SiRNA of pyroptosis regulation related gene and application thereof

Abstract

The invention discloses siRNA of a pyroptosis regulation related gene and application of the siRNA. The invention designs and screens out a series of efficient and specific small interfering RNA (siRNA) molecules aiming at key genes Apip, Elavl1, Pelp1, Plcg1 and Bax for pyroptosis regulation and control, and provides a specific sequence of the siRNA molecules. Cell experiments verify that the siRNA molecules can significantly inhibit the mRNA expression level of a target gene. The invention also provides a pharmaceutical composition containing the siRNA and application of the pharmaceutical composition in preparation of drugs for treating pyroptosis related diseases (such as inflammatory diseases, tumors, neurodegenerative diseases and the like). The siRNA molecule provided by the invention provides a brand-new targeted drug for treating pyroptosis related diseases, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to siRNAs targeting genes involved in pyroptosis regulation and their applications. Specifically, it relates to small interfering RNA (siRNA) molecules and compositions thereof that target genes involved in pyroptosis regulation, and their application in the preparation of drugs for treating pyroptosis-related diseases. More specifically, this invention relates to siRNA sequences that specifically target the Apip, Elavl1, Pelp1, Plcg1, and Bax genes and their applications in regulating pyroptosis, treating inflammatory diseases, tumors, neurodegenerative diseases, etc. Background Technology

[0002] Pyroptosis is a programmed cell death mechanism that has been extensively studied in recent years. It depends on the activation of caspase family proteins and the cleavage of gasdermin (GSDM) family proteins, ultimately leading to cell membrane perforation, cell lysis, and the release of large amounts of inflammatory factors such as IL-1β and IL-18. Unlike apoptosis, pyroptosis is a highly inflammatory cell death mechanism that plays a crucial role in the body's defense against pathogen infection, clearance of abnormal cells, and maintenance of immune homeostasis.

[0003] The balanced regulation of pyroptosis is crucial. Excessive activation of pyroptosis can lead to tissue damage, autoimmune diseases, and sepsis; while inhibition of pyroptosis can result in impaired pathogen clearance and tumorigenesis. Therefore, key regulators of the pyroptosis pathway have become highly promising drug targets. Existing research indicates that multiple genes are involved in the fine regulation of pyroptosis: Apip can directly interact with Caspase family proteases, inhibiting their activity and thus suppressing excessive pyroptosis and maintaining the balance of the pyroptosis process. Studies have shown that the expression level of Apip is closely related to the progression of various inflammatory diseases.

[0004] Elavl1: As an RNA-binding protein, it can regulate the pyroptosis process at the posttranscriptional level by binding to the mRNA of pyroptosis-related genes and affecting their stability.

[0005] Pelp1: As a transcriptional cofactor, it can participate in regulating the expression of various inflammatory factors and indirectly affect the occurrence of pyroptosis.

[0006] Plcg1: As a phospholipase, it participates in signal transduction in multiple signaling pathways, especially those related to Caspase activation, thereby regulating the pyroptosis process.

[0007] Bax: As a classic pro-apoptotic protein, in addition to mediating the mitochondrial apoptosis pathway, recent studies have shown that it can mediate the conversion from apoptosis to pyroptosis under certain conditions, making it one of the key molecules connecting apoptosis and pyroptosis.

[0008] RNA interference (RNAi) technology, especially small interfering RNA (siRNA), is a highly efficient gene silencing tool. siRNA is a double-stranded RNA molecule of 20-25 nucleotides in length that can specifically bind to and degrade target gene mRNA homologous to its sequence, thereby achieving specific inhibition of gene expression. Drug development based on siRNA has become a hot topic in the treatment of various diseases, such as cancer, viral infections, and genetic diseases.

[0009] However, no siRNA drugs or therapeutic strategies targeting the key pyroptosis regulatory genes such as Apip, Elavl1, Pelp1, Plcg1, and Bax have been reported to date. Developing siRNA molecules that can efficiently and specifically silence these target genes will provide novel drug candidates for the treatment of pyroptosis-related diseases and has significant clinical application value. Summary of the Invention

[0010] To address the shortcomings of existing technologies, the purpose of this invention is to provide siRNAs for pyroptosis-regulating genes and their applications. This invention aims to overcome the technical deficiency in existing technologies regarding the lack of specific targeted therapeutic drugs for key pyroptosis-regulating genes (Apip, Elavl1, Pelp1, Plcg1, Bax), and to provide a series of double-stranded siRNA molecules and their compositions that can efficiently and specifically inhibit the expression of these genes. Furthermore, this invention provides the application of these siRNA molecules in the preparation of drugs for treating diseases associated with abnormal pyroptosis regulation (e.g., inflammatory diseases, tumors, neurodegenerative diseases, etc.).

[0011] The above-mentioned objective of this invention is achieved through the following technical solutions: This invention provides a double-stranded RNA molecule for inhibiting the expression of genes related to pyroptosis regulation. The pyroptosis-regulating genes are selected from Apip, Elavl1, Pelp1, Plcg1, and Bax. This invention also provides one or more of these genes. The double-stranded RNA molecule comprises a sense strand and an antisense strand, the sequences of which are selected from any one of the following groups: a) The justice chain is shown in SEQ ID NO: 1, and the antisense chain is shown in SEQ ID NO: 2; b) The justice chain is shown in SEQ ID NO: 3, and the antisense chain is shown in SEQ ID NO: 4; c) The justice chain is shown in SEQ ID NO: 5, and the antisense chain is shown in SEQ ID NO: 6; d) The justice chain is shown in SEQ ID NO: 7, and the antisense chain is shown in SEQ ID NO: 8; e) The justice chain is shown in SEQ ID NO: 9, and the antisense chain is shown in SEQ ID NO: 10; f) The justice chain is shown in SEQ ID NO: 11, and the antisense chain is shown in SEQ ID NO: 12; g) The justice chain is shown in SEQ ID NO: 13, and the antisense chain is shown in SEQ ID NO: 14; h) The justice chain is shown in SEQ ID NO: 15, and the antisense chain is shown in SEQ ID NO: 16; i) The justice chain is shown in SEQ ID NO: 17, and the antisense chain is shown in SEQ ID NO: 18; j) The justice chain is shown in SEQ ID NO: 19, and the antisense chain is shown in SEQ ID NO: 20; k) The justice chain is shown in SEQ ID NO: 21, and the antisense chain is shown in SEQ ID NO: 22; l) The justice chain is shown in SEQ ID NO: 23, and the antisense chain is shown in SEQ ID NO: 24; m) The justice chain is shown in SEQ ID NO: 25, and the antisense chain is shown in SEQ ID NO: 26; n) The justice chain is shown in SEQ ID NO: 27, and the antisense chain is shown in SEQ ID NO: 28; o) The justice chain is shown in SEQ ID NO: 29, and the antisense chain is shown in SEQ ID NO: 30; p) The justice chain is shown in SEQ ID NO: 31, and the antisense chain is shown in SEQ ID NO: 32; q) The justice chain is shown in SEQ ID NO: 33, and the antisense chain is shown in SEQ ID NO: 34; r) The justice chain is shown in SEQ ID NO: 35, and the antisense chain is shown in SEQ ID NO: 36; s) The justice chain is shown in SEQ ID NO: 37, and the antisense chain is shown in SEQ ID NO: 38; t) The justice chain is shown in SEQ ID NO: 39, and the antisense chain is shown in SEQ ID NO: 40; u) The justice chain is shown in SEQ ID NO: 41, and the antisense chain is shown in SEQ ID NO: 42.

[0012] According to one embodiment of the present invention, the 3' ends of both the sense and antisense strands of the double-stranded RNA molecule protrude two nucleotides.

[0013] According to one embodiment of the present invention, the two protruding nucleotides are TT or UU.

[0014] According to one embodiment of the present invention, the double-stranded RNA molecule is chemically modified, and the chemical modification is selected from 2'-O-methyl modification, 2'-fluoro modification, thiophosphate bond modification, cholesterol coupling, and one or more of the present invention are also provided.

[0015] The present invention also provides a pharmaceutical composition comprising a double-stranded RNA molecule for inhibiting the expression of pyroptosis-regulated genes as described above and a pharmaceutically acceptable vector.

[0016] According to one embodiment of the present invention, the pharmaceutically acceptable carrier is a liposome, nanoparticle, viral vector, or cationic polymer.

[0017] The present invention also provides the use of a double-stranded RNA molecule for inhibiting the expression of genes related to pyroptosis regulation or a pharmaceutical composition of the above embodiments in the preparation of a medicament for treating pyroptosis-related diseases.

[0018] According to one embodiment of the present invention, the pyroptosis-related diseases include inflammatory diseases, tumors, and neurodegenerative diseases.

[0019] According to one embodiment of the present invention, the inflammatory disease is sepsis, acute pancreatitis, inflammatory bowel disease, or an autoimmune disease; the tumor is liver cancer, lung cancer, or colorectal cancer; and the neurodegenerative disease is Alzheimer's disease or Parkinson's disease.

[0020] The present invention also provides a method for inhibiting the expression of pyroptosis-regulating genes in cells for non-therapeutic purposes, wherein a double-stranded RNA molecule for inhibiting the expression of pyroptosis-regulating genes described in the above embodiments is introduced into the cells.

[0021] In summary, compared with the prior art, the present invention has at least one of the following beneficial technical effects: This invention fills a technological gap by disclosing for the first time specific siRNA molecules targeting five key pyroptosis regulatory genes: Apip, Elavl1, Pelp1, Plcg1, and Bax. Currently, no siRNA drugs or therapeutic strategies targeting these genes have been reported. This invention provides novel targets and drug candidates for the treatment of pyroptosis-related diseases.

[0022] High efficiency and specificity: Through extensive experimental screening, this invention has obtained multiple siRNA sequences that can significantly inhibit the expression levels of target gene mRNAs (see examples and figures for specific effects). These siRNA molecules exhibit highly efficient and specific gene silencing effects at the cellular level, significantly reducing the expression levels of Apip, Elavl1, Pelp1, Plcg1, and Bax genes, thereby effectively regulating the pyroptosis process. The siRNA oligonucleotide combination can effectively inhibit the expression of pyroptosis-regulating genes, including Apip, Elavl1, Pelp1, Plcg1, and Bax, suppressing their biological functions.

[0023] Broad applicability: The siRNA molecules provided by this invention can be used alone or in combination to achieve precise regulation of the pyroptosis process by targeting different pyroptosis regulatory nodes. This provides new strategies and tools for treating a variety of diseases caused by pyroptosis imbalance (including inflammation, tumors, neurodegenerative diseases, etc.).

[0024] Promising Development Prospects: siRNA drugs, as an important branch of biopharmaceutical technology, possess advantages such as strong targeting, clear mechanism of action, and short design cycle. The siRNA sequence provided in this invention can serve as a core active ingredient, combined with various delivery systems (such as lipid nanoparticles) to develop novel nucleic acid drugs, demonstrating enormous potential for clinical translation. Attached Figure Description

[0025] Figure 1 The effect of different siRNAs on the expression level of Apip gene mRNA in A549 cells was detected by qPCR. The results showed that, compared with the control group, multiple siRNAs targeting Apip (such as APIP-Homo / Mus-1) could significantly inhibit the expression of Apip mRNA.

[0026] Figure 2 The effect of different siRNAs on the expression level of Bax gene mRNA in A549 cells was detected by qPCR. The results showed that, compared with the control group, Bax-targeting siRNAs (such as BAX-Homo-441) could significantly inhibit the expression of Bax mRNA.

[0027] Figure 3 The effect of different siRNAs on the expression level of Elavl1 gene mRNA in A549 cells was detected by qPCR. The results showed that, compared with the control group, multiple siRNAs targeting Elavl1 (such as ELAVL1-Homo / Mus-1) could significantly inhibit the expression of Elavl1 mRNA.

[0028] Figure 4The effect of different siRNAs on the expression level of Pelp1 gene mRNA in A549 cells was detected by qPCR. The results showed that, compared with the control group, multiple siRNAs targeting Pelp1 (such as PELP1-Homo / Mus-2) could significantly inhibit the expression of Pelp1 mRNA.

[0029] Figure 5 The effect of different siRNAs on the expression level of Plcg1 gene mRNA in HEPG2 cells was detected by qPCR. The results showed that, compared with the control group, multiple siRNAs targeting Plcg1 (such as Plcg1-Homo / Mus-1) could significantly inhibit the expression of Plcg1 mRNA. Detailed Implementation

[0030] The technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0031] This invention, through in-depth research and extensive experiments, designs and screens multiple siRNA molecules that can efficiently inhibit the expression of five key pyroptosis regulatory genes: Apip, Elavl1, Pelp1, Plcg1, and Bax. These siRNA molecules can specifically bind to the mRNA of the target genes, induce their degradation, and thereby block the translation of the target proteins, thus achieving the goal of regulating the pyroptosis process.

[0032] This invention provides the following technical solutions: In a first aspect, the present invention provides a double-stranded RNA molecule (siRNA) for inhibiting the expression of pyroptosis-regulating genes, characterized in that the pyroptosis-regulating genes are selected from one or more of Apip, Elavl1, Pelp1, Plcg1, and Bax; the double-stranded RNA molecule comprises a sense strand and an antisense strand, wherein the sequences of the sense strand and the antisense strand are selected from any one or more of the following groups: The siRNA targeting the Apip gene has its sense and antisense strand sequences selected from: SEQ ID NO: 1 (Justice Chain) and SEQ ID NO: 2 (Antisense Chain); SEQ ID NO: 3 (Justice Chain) and SEQ ID NO: 4 (Antisense Chain); SEQ ID NO: 5 (Justice Chain) and SEQ ID NO: 6 (Antisense Chain); SEQ ID NO: 7 (Justice Chain) and SEQ ID NO: 8 (Anti-Justice Chain); SEQ ID NO: 9 (Justice Chain) and SEQ ID NO: 10 (Anti-Justice Chain); SEQ ID NO: 11 (Justice Chain) and SEQ ID NO: 12 (Antisense Chain).

[0033] The siRNA targeting the Bax gene has its sense and antisense sequences selected from: SEQ ID NO: 13 (Justice Chain) and SEQ ID NO: 14 (Antisense Chain); SEQ ID NO: 15 (Justice Chain) and SEQ ID NO: 16 (Antisense Chain).

[0034] The siRNA targeting the Elavl1 gene has its sense and antisense sequences selected from: SEQ ID NO: 17 (Justice Chain) and SEQ ID NO: 18 (Anti-Justice Chain); SEQ ID NO: 19 (Justice Chain) and SEQ ID NO: 20 (Antisense Chain); SEQ ID NO: 21 (Justice Chain) and SEQ ID NO: 22 (Antisense Chain); SEQ ID NO: 23 (Justice Chain) and SEQ ID NO: 24 (Antisense Chain); SEQ ID NO: 25 (Justice Chain) and SEQ ID NO: 26 (Antisense Chain).

[0035] The siRNA targeting the Pelp1 gene has its sense and antisense strand sequences selected from: SEQ ID NO: 27 (Justice Chain) and SEQ ID NO: 28 (Antisense Chain); SEQ ID NO: 29 (Justice Chain) and SEQ ID NO: 30 (Antisense Chain); SEQ ID NO: 31 (Justice Chain) and SEQ ID NO: 32 (Antisense Chain); SEQ ID NO: 33 (Justice Chain) and SEQ ID NO: 34 (Antisense Chain); SEQ ID NO: 35 (Justice Chain) and SEQ ID NO: 36 (Antisense Chain).

[0036] The siRNA targeting the Plcg1 gene has its sense and antisense strand sequences selected from: SEQ ID NO: 37 (Justice Chain) and SEQ ID NO: 38 (Antisense Chain); SEQ ID NO: 39 (Justice Chain) and SEQ ID NO: 40 (Antisense Chain); SEQ ID NO: 41 (Justice Chain) and SEQ ID NO: 42 (Antisense Chain).

[0037] In a preferred embodiment, the double-stranded RNA molecule has blunt ends or protruding ends. More preferably, the 3' ends of both the sense and antisense strands of the double-stranded RNA molecule protrude two nucleotides, such as TT or UU.

[0038] In a preferred embodiment, the double-stranded RNA molecule is chemically modified to improve its stability and / or reduce its immunogenicity. The chemical modifications include, but are not limited to: 2'-O-methyl modification, 2'-fluorine modification, thiophosphate bond modification, cholesterol coupling, etc.

[0039] In a second aspect, the present invention provides a pharmaceutical composition comprising one or more double-stranded RNA molecules as described in the first aspect above, and a pharmaceutically acceptable carrier and / or excipient.

[0040] In a preferred embodiment, the pharmaceutically acceptable carrier includes, but is not limited to, liposomes, nanoparticles, viral vectors, cationic polymers, etc., to facilitate the in vivo delivery of double-stranded RNA molecules.

[0041] Thirdly, the present invention provides the use of the double-stranded RNA molecule described in the first aspect or the pharmaceutical composition described in the second aspect in the preparation of a medicament for treating pyroptosis-related diseases.

[0042] In a preferred embodiment, the pyroptosis-related diseases include, but are not limited to: inflammatory diseases (such as sepsis, acute pancreatitis, inflammatory bowel disease, autoimmune diseases), tumors (such as liver cancer, lung cancer, colorectal cancer), neurodegenerative diseases (such as Alzheimer's disease, Parkinson's disease), etc.

[0043] Fourthly, the present invention provides a method for inhibiting the expression of pyroptosis-regulating genes in cells for non-therapeutic purposes, characterized in that the double-stranded RNA molecule described in the first aspect is introduced into the cell.

[0044] Fifthly, the present invention provides a method for treating pyroptosis-related diseases, comprising administering to a subject in need a therapeutically effective amount of the double-stranded RNA molecule described in the first aspect or the pharmaceutical composition described in the second aspect.

[0045] Example 1: Design and Synthesis of siRNA Multiple potential siRNA sequences were designed using bioinformatics software based on the mRNA sequences of the human and mouse Apip, Elavl1, Pelp1, Plcg1, and Bax genes (referencing the GenBank database). Candidate sequences were screened through homology alignment, off-target effect prediction, and secondary structure analysis. All siRNAs were chemically synthesized by a specialized company and purified by HPLC to ensure a purity >95%. All synthesized siRNAs were double-stranded RNAs, with two deoxythymidine nucleotides (dTdT) protruding from the 3' end of both the sense and antisense strands to enhance their stability and transfection efficiency. The specific siRNA sequences and their corresponding numbering are shown in the table below. Table 1. List of siRNA sequences siRNA name target genes Justice Chain Sequence (5'-3') Antisense chain sequence (5'-3') Serial Number APIP-Homo / Mus-1 Apip UCAUACCCACUCUAAAGCUTT AGCUUUAGAGUGGGUAUGATT SEQ ID NO:1 / 2 APIP-homo-290 Apip GGAACGAAUUCAGCCUGAATT UUCAGGCUGAAUUCGUUCCTT SEQ ID NO:3 / 4 APIP-homo-575 Apip GGUACCCAUUAUUGAGAAUTT AUUCUCAAUAAUGGGUACCTT SEQ ID NO:5 / 6 APIP-homo-626 Apip GGCUCAUGCAAUGAAUGAATT UUCAUUCAUUGCAUGAGCCTT SEQ ID NO:7 / 8 APIP-Homo-154 Apip ACAAGGAGCAUCCAAGAUATT UAUCUUGGAUGCUCCUUGUTT SEQ ID NO:9 / 10 APIP-Homo-378 Apip AGCCAGUGUACUCCUCUUUTT AAAGAGGAGUACACUGGCUTT SEQ ID NO:11 / 12 BAX-Homo-441 Bax CGGAACUGAUCAGAACCAUTT AUGGUUCUGAUCAGUUCCGTT SEQ ID NO:13 / 14 BAX-Homo-257 Bax ACGAACUGGACAGUAACAUTT AUGUUACUGUCCAGUUCGUTT SEQ ID NO:15 / 16 ELAVL1-Homo / Mus-1 Elavl1 UAUUCGGGAUAAAGUAGCATT UGCUACUUUAUCCCGAAUATT SEQ ID NO:17 / 18 ELAVL1-Homo / Mus-2 Elavl1 CAGAAGAGGCAAUUACCAGTT CUGGUAAUUGCCUCUUCUGTT SEQ ID NO:19 / 20 ELAVL1-Homo / Mus-3 Elavl1 CUCGCAGCUGUACCACUCGTT CGAGUGGUACAGCUGCGAGTT SEQ ID NO:21 / 22 ELAVL1-Homo / Mus-5 Elavl1 CUACCGCCUGGGGGACAAATT UUUGUCCCCCAGGCGGUAGTT SEQ ID NO:23 / 24 ELAVL1-homo-655 Elavl1 CCAGUUUCAAUGGUCAUAATT UUAUGACCAUUGAACUGGTT SEQ ID NO:25 / 26 PELP1-Homo / Mus-2 Pelp1 UUAUUAAUAUCAACAGCAGTT CUGCUGUUGAUAUUAAUAATT SEQ ID NO:27 / 28 PELP1-Homo-726 Pelp1 GUUGGCCUGUGUGUUAUTT AUAACACUCACAGGCCAACTT SEQ ID NO:29 / 30 PELP1-Homo-2312 Pelp1 CAGCCUUUGUCCACUAUGATT UCAUAGUGGACAAAGGCUGTT SEQ ID NO:31 / 32 PELP1-Homo-1311 Pelp1 CAAGGUGUAUGCGAUAUUATT UAAUAUCGCAUACACCUUGTT SEQ ID NO:33 / 34 PELP1-Homo-918 Pelp1 GUCCUCAGAAGAUGGUGAUTT AUCACCAUCUUCUGAGGACTT SEQ ID NO:35 / 36 Plcg1-Homo / Mus-1 Plcg1 GAGGAUGAAGGAACAUGU ACAUGUUCACUUCAUCCUCAG SEQ ID NO:37 / 38 Plcg1-Homo / Mus-2 Plcg1 GAGAGGUGGCUCCGGAAGC GCUUCCGGAGCCACCUCUCAA SEQ ID NO:39 / 40 Plcg1-Homo / Mus-3 Plcg1 GGAUCGUAUAUCAGCCAAG CUUGGCUGAUAUACGAUCCUC SEQ ID NO:41 / 42 Effects of siRNA on RNA expression levels of Apip, Elavl1, Pelp1, Plcg1, and Bax genes: 1. Design at least 3 siRNAs for each gene and transfect A549 and HEPG2 cells. Collect cell samples 48 hours after transfection for qPCR detection. Set up 3 replicates for each siRNA.

[0046] 2. Culture 293T cells in DMEM medium containing 10% fetal bovine serum in a 10cm diameter cell culture dish until 80-90% confluence, discard the culture supernatant, and wash the cells with PBS buffer.

[0047] 3. Add 1 ml of Trypsin-EDTA solution to the cell culture dish, mix well, carefully aspirate the supernatant, and incubate at 37°C for 1 minute to digest the cells.

[0048] 4. Add 2 ml of complete culture medium to the cell culture dish and gently pipette the cells to obtain a single-cell suspension.

[0049] 5. Take the cell suspension obtained in step 3 and seed it into a 12-well plate (1×10⁵ cells per well) and incubate at 37°C for 12 hours.

[0050] 6. Dissolve the siRNA to be tested in DEPC-H2O to obtain a siRNA stock solution with a concentration of 20 μM.

[0051] 7. Add the siRNA solution and DMEM culture medium obtained in step 5 to a 1.5 ml EP tube, mix well, and obtain 200 μl of mixture A; add 196 μl of DMEM culture medium and 4 μl of transfection reagent lipo2000 to another EP tube, mix well and let stand for 5 min, and obtain 200 μl of mixture B; mix the two mixtures to obtain 400 μl of mixture, let stand at room temperature for 20 min, and this is the transfection mixture.

[0052] 8. Take the 12-well plate after completing step 4, aspirate the supernatant, add 600 μl of DMEM culture medium to each well, let it stand for 20 min, then add 400 μl of the transfection mixture prepared in step 6 to each well. The concentration of siRNA in 1 ml of each well is 10 nM. After incubating at 37℃ for 6 hours, change the medium, add complete culture medium and continue incubating for 48 hours.

[0053] 9. Take the 12-well plate after completing step 7, aspirate the supernatant, wash with PBS buffer, then add DMEM culture medium and incubate at 37°C for 24 hours.

[0054] 10. Total RNA extraction: (1) Take the 12-well plate after completing step 8, collect the cells, add 1 ml of Ezol lysis buffer to the collected cell sample, and vortex to mix. Let stand at room temperature for 5 minutes.

[0055] (2) Add 0.2 ml of chloroform, shake vigorously for 10 seconds, and let stand at room temperature for 5 minutes.

[0056] (3) Centrifuge at 4℃, 12,000 x g for 15 min.

[0057] (4) Transfer the supernatant to another new RNase-free centrifuge tube and add an equal volume of 100% ethanol.

[0058] (5) Add the sample containing ethanol to a mini-spin centrifuge column with a 2ml collection tube in two portions. Centrifuge at 8,000xg at room temperature for 15s and discard the flow-through liquid.

[0059] (6) Add 700 μl WB to the centrifuge column, lightly cover the cap, centrifuge at 8,000 x g at room temperature for 15 s, and discard the flow-through liquid.

[0060] (7) Repeat step 6 and wash the centrifuge column twice with 500 μl WB.

[0061] (8) Transfer the centrifuge column to a new RNase-free 1.5ml centrifuge tube, add 40μl of DEPC water to the center of the silica membrane, and centrifuge at 10,000xg for 3 min at 4℃ to elute RNA.

[0062] 11. Random reverse transcription: (1) Take a centrifuge tube containing N6 primer powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 10 times the number of nmol of primer powder, and the primer concentration obtained after dilution is 100 μM.

[0063] (2) Premix N6, 5×RT Buffer, dNTP, and MMLV Reverse Transcriptase in each well of the EP tube according to the reaction system. Then, calculate the required RNA volume based on the RNA concentration and add it to the premixed reaction system. Finally, use RNase-Free H2O to bring the volume to 20 μl. Set the reaction program on the instrument. The reaction system and reaction program are shown in the table below: Component Final Con. Vol / 1 rxns N6 (100 μM) 5 μl RNA Sample as required 2 μg 5×RT Buffer 1× 4 μl dNTP(10 mM) 0.4 mM 0.8 μl MMLV Reverse Transcriptase(200 U / µl) 2 U / µl 0.2 μl RNase Free H2O At 20 μl (3) After mixing, place it in a PCR instrument at 25℃ for 30 min, 42℃ for 45 min, 85℃ for 5 min, and 25℃ for 30 s.

[0064] 12. Real-time quantitative PCR was used to detect the relative expression levels of each gene: (1) Take a centrifuge tube containing F / R primer dry powder, centrifuge at 13000 rpm for 5 minutes on a benchtop high-speed centrifuge, add RNase Free H2O to dilute, the amount of RNase Free H2O added is 50 times the number of nmol of primer dry powder, and the primer concentration obtained after dilution is 20 μM.

[0065] (2) Premix 2× Real-time PCR Master Mix, F / R primer, Taq DNA polymerase, ROX reference dye, and RNase-free H2O in each well of an EP tube according to the reaction system. Add 18 μl of the premix to each well of an eight-tube strip, and then add 2 μl of cDNA to each well. Set the reaction program on the instrument. The reaction system and reaction program are shown in the table below: Component Final Con. Vol / 1 rxns 2× Real-Time PCR Master Mix 1× 10 μl F primer (20 uM) 0.1µM 0.1 μl R primer (20 uM) 0.1µM 0.1 μl cDNA — 2 μl Taq DNA polymerase(5U / μl) 0.05 U / µl 0.2 μl ROX reference dye (50×) 1× 0.4 μl RNase-free H2O To 20 μl (3) Cyclic settings: 95℃, 3min pre-denaturation; 95℃, 12s, 62℃, 30s, 40 cycles, fluorescence signal acquisition.

[0066] (4) Melting curve: 95 ℃, 1 min, 62 ℃ 30 s, 95 ℃ 30 s.

[0067] 13. Data Processing: (1) Perform real-time PCR to obtain the Ct values ​​of the target gene and internal reference gene for each reaction.

[0068] (2) Calculate the average value of the three replicates of the sample and the calibration sample.

[0069] (3) Subtract the average Ct value of the internal reference gene from the average Ct value of the target gene to calculate the ΔCt value of each sample.

[0070] (4) The ΔCT value of each sample is calculated by subtracting the ΔCT value of the calibration sample from the ΔCt value of the test sample.

[0071] (5)Use 2 –ΔΔCt Calculate the relative gene expression ratio.

[0072] 14. Results are shown below. Figure 1-5 : (1) siRNA APIP-Homo / Mus-1, APIP-homo-290, APIP-homo-575, APIP-homo-626, APIP-Homo-154, and APIP-Homo-378 significantly inhibited the expression of endogenous Apip gene in A549 cells.

[0073] (2) siRNAs ELAVL1-Homo / Mus-1, ELAVL1-Homo / Mus-2, ELAVL1-Homo / Mus-3, ELAVL1-Homo / Mus-5, and ELAVL1-homo-655 significantly inhibit the expression of endogenous Elavl1 gene in A549 cells.

[0074] (3) siRNAs PELP1-Homo / Mus-2, PELP1-Homo-726, PELP1-Homo-2312, PELP1-Homo-1311, and PELP1-Homo-918 significantly inhibited the expression of the endogenous Pelp1 gene in A549 cells.

[0075] (4) siRNAs Plcg1-Homo / Mus-1, Plcg1-Homo / Mus-2, and Plcg1-Homo / Mus-3 significantly inhibited the expression of endogenous Plcg1 gene in HEPG2 cells.

[0076] siRNAs BAX-Homo-441 and BAX-Homo-257 significantly inhibited the expression of endogenous Bax gene in A549 cells.

[0077] Example 2: Cell Culture and Transfection This example is used to verify the silencing effect of siRNA on target genes.

[0078] Cell culture: Human non-small cell lung cancer cells A549 and human hepatocellular carcinoma cells HEPG2 were purchased from the American Type Culture Collection (ATCC). Cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin at 37°C in a 5% CO2 incubator. Passaging or transfection experiments were performed when cell confluence reached 80-90%.

[0079] Cell seeding: 24 hours before transfection, A549 or HEPG2 cells in logarithmic growth phase were harvested, digested with 0.25% trypsin-EDTA, resuspended in complete culture medium, counted, and seeded into 12-well plates at 1×10⁶ cells per well. 5 Cells were cultured overnight at 37°C in a 5% CO2 incubator to achieve a cell confluence of approximately 70% on the day of transfection.

[0080] siRNA transfection: Transfection was performed using Lipofectamine 2000 (Invitrogen) reagent. The specific procedures are as follows: The siRNA to be transfected was dissolved in DEPC-treated water to prepare a 20 μM stock solution.

[0081] Take a 1.5 mL EP tube, add an appropriate amount of siRNA stock solution and Opti-MEM serum-reduced culture medium, mix well, and the total volume is 50 μL.

[0082] Take another 1.5 mL EP tube, add an appropriate amount of Lipofectamine 2000 and Opti-MEM, mix well, and let stand at room temperature for 5 minutes. The total volume is 50 μL.

[0083] Gently mix the two liquids and let stand at room temperature for 20 minutes to form an siRNA-liposome complex.

[0084] Discard the old culture medium in the 12-well plate, add 900 μL of Opti-MEM medium to each well, and then add 100 μL of siRNA-liposome complex dropwise to make the final volume of each well 1 mL and the final concentration of siRNA 10 nM.

[0085] After culturing the cells in a 37°C, 5% CO2 incubator for 6 hours, the transfection mixture was discarded, replaced with complete culture medium, and cultured for another 48 hours in preparation for subsequent detection. A negative control (transfected with non-targeting siRNA, NC-siRNA) and a blank control group (transfection reagent only) were also included.

[0086] Example 3: Real-time quantitative PCR (qPCR) detection of gene mRNA expression levels This embodiment is used to detect changes in the expression levels of mRNA of each target gene after siRNA transfection.

[0087] Total RNA extraction: 48 hours after transfection, the culture medium in the 12-well plate was aspirated, and the cells were washed once with PBS buffer. 1 mL of EZol lysis buffer (Shanghai Yuanye Biotechnology) was added to each well, and the cells were repeatedly pipetted to collect the lysis buffer into a 1.5 mL RNase-free centrifuge tube. Then, total RNA was extracted according to the following steps: Add 200 μL of chloroform to the lysis buffer, shake vigorously for 10 seconds, and let stand at room temperature for 5 minutes.

[0088] Centrifuge at 4°C and 12,000×g for 15 minutes, and carefully transfer the upper aqueous phase to a new RNase-free centrifuge tube.

[0089] Add an equal volume of 100% ethanol and mix well.

[0090] Transfer the mixture to an RNA mini spin column with a collection tube, centrifuge at 8,000×g for 15 seconds at room temperature, and discard the flow-through.

[0091] Add 700 μL Wash Buffer (WB) to the centrifuge column, centrifuge at 8,000×g for 15 seconds, and discard the flow-through liquid.

[0092] Repeat the washing once, add 500 μL of WB, centrifuge and discard the flow-through solution.

[0093] Transfer the centrifuge column to a new RNase-free 1.5 mL centrifuge tube, add 40 μL of DEPC water to the center of the silica membrane, incubate at room temperature for 1 minute, then centrifuge at 10,000 × g for 3 minutes to elute RNA. The resulting RNA sample was analyzed for concentration and purity using Nanodrop and stored at -80°C for later use.

[0094] Reverse transcription: Total RNA was reverse transcribed into cDNA using a reverse transcription kit (Toyobo). The reaction mixture was as follows (total volume 20 μL): N6 random primers (100 μM): 5 μL; RNA template: 2 μg; 5×RT Buffer: 4 μL; dNTP Mix (10 mM): 0.8 μL; MMLV reverse transcriptase (200 U / μL): 0.2 μL; RNase-free H2O: Add to a final volume of 20 μL; Reaction program: 25℃ for 30 minutes, 42℃ for 45 minutes, 85℃ for 5 minutes, 25℃ for 30 seconds.

[0095] qPCR detection: Quantitative PCR was performed using SYBR Green Real-time PCR Master Mix (Toyobo). The reaction mixture was as follows (total volume 20 μL): 2×Real-time PCR Master Mix: 10 μL; Upstream primer (20 μM): 0.1 μL; Downstream primer (20 μM): 0.1 μL; cDNA template: 2 μL; Taq DNA polymerase (5 U / μL): 0.2 μL; ROX reference dye (50×): 0.4 μL; RNase-free H2O: Add to a final volume of 20 μL; The reaction was performed on an ABI 7500 Fast Real-Time PCR instrument with the following program: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 12 seconds; 62℃ annealing / extension for 30 seconds, for a total of 40 cycles; followed by melting curve analysis: 95℃ for 1 minute, 62℃ for 30 seconds, and 95℃ for 30 seconds.

[0096] The primer sequences used to detect the target gene and the internal reference gene GAPDH are as follows: Apip-F: 5'-...-3', Apip-R: 5'-...-3'; Bax-F: 5'-...-3', Bax-R: 5'-...-3'; Elavl1-F: 5'-...-3', Elavl1-R: 5'-...-3'; Pelp1-F: 5'-...-3', Pelp1-R: 5'-...-3'; Plcg1-F: 5'-...-3', Plcg1-R: 5'-...-3'; GAPDH-F: 5'-...-3', GAPDH-R: 5'-...-3'.

[0097] (Note: The primer sequences here are examples; in actual applications, they should be designed and validated based on the gene sequence.) Data processing: using 2 ⁻ΔΔCtThe relative expression levels of each target gene were calculated. Using GAPDH as an internal reference gene, the target gene expression levels in the blank control group or negative control group were normalized to 1, and the relative expression levels of each siRNA treatment group were calculated.

[0098] Example 4: Experimental Results The experimental results are attached. Figures 1 to 5 As shown.

[0099] Figure 1 The silencing effects of different siRNAs targeting the Apip gene in A549 cells were demonstrated. Results showed that, compared with the negative control group (NC), all six siRNAs (APIP-Homo / Mus-1, APIP-homo-290, APIP-homo-575, APIP-homo-626, APIP-Homo-154, and APIP-Homo-378) significantly reduced Apip mRNA expression levels (p < 0.05), with APIP-Homo / Mus-1 and APIP-homo-290 showing the most significant inhibitory effects, exceeding 80%. These results demonstrate that the siRNAs designed in this invention can efficiently target and inhibit Apip gene expression.

[0100] Figure 2 The silencing effect of siRNA targeting the Bax gene in A549 cells was demonstrated. Results showed that both BAX-Homo-441 and BAX-Homo-257 siRNAs significantly inhibited Bax mRNA expression (p < 0.05), with inhibition efficiencies of approximately 70% and 60%, respectively. These results indicate that the siRNAs provided in this invention can effectively silence the Bax gene.

[0101] Figure 3 The silencing effect of siRNAs targeting the Elavl1 gene in A549 cells was demonstrated. Results showed that all five siRNAs—ELAVL1-Homo / Mus-1, ELAVL1-Homo / Mus-2, ELAVL1-Homo / Mus-3, ELAVL1-Homo / Mus-5, and ELAVL1-homo-655—significantly reduced Elavl1 mRNA expression levels (p < 0.05). The inhibitory effects of ELAVL1-Homo / Mus-2 and ELAVL1-Homo / Mus-5 were particularly pronounced. These results demonstrate that the siRNAs designed in this invention can effectively silence the Elavl1 gene.

[0102] Figure 4The silencing effect of siRNAs targeting the Pelp1 gene in A549 cells was demonstrated. Results showed that five siRNAs—PELP1-Homo / Mus-2, PELP1-Homo-726, PELP1-Homo-2312, PELP1-Homo-1311, and PELP1-Homo-918—significantly inhibited Pelp1 mRNA expression (p < 0.05). These results indicate that the siRNAs provided in this invention have a significant silencing effect on the Pelp1 gene.

[0103] Figure 5 The silencing effect of siRNAs targeting the Plcg1 gene in HEPG2 cells was demonstrated. Results showed that all three siRNAs—Plcg1-Homo / Mus-1, Plcg1-Homo / Mus-2, and Plcg1-Homo / Mus-3—significantly reduced the expression level of Plcg1 mRNA (p < 0.05), with Plcg1-Homo / Mus-1 showing the best inhibitory effect. These results indicate that the siRNAs designed in this invention can efficiently inhibit the expression of the Plcg1 gene in HEPG2 cells.

[0104] In summary, the results of Examples 2-4 confirm that the siRNA molecules targeting Apip, Bax, Elavl1, Pelp1, and Plcg1 genes provided by this invention can efficiently and specifically inhibit the mRNA expression of their target genes at the cellular level, laying a solid foundation for subsequent in vivo functional studies and drug development.

[0105] Example 5: Chemical modification of siRNA (example) To enhance the stability of siRNA in vivo and reduce its potential immunogenicity, synthetic siRNA can be chemically modified. For example, 2'-O-methyl (2'-OMe) or 2'-fluoro (2'-F) modifications can be made to the nucleotides of the sense and / or antisense strands, particularly at the 5' end of the sense strand and / or the seed region of the antisense strand. Furthermore, phosphodiester bonds can be modified with thiophosphate to enhance its resistance to nuclease degradation. These modifications can be used alone or in combination and do not significantly affect the gene silencing activity of the siRNA. For example, all pyrimidine nucleotides in the sense strand shown in SEQ ID NO: 1 can be modified with 2'-OMe, or 3-5 nucleotides at the 5' and 3' ends of the antisense strand shown in SEQ ID NO: 2 can be modified with thiophosphate. Modified siRNA can be transfected and functionally validated using the same methods as unmodified siRNA to confirm its activity retention.

[0106] Example 6: Pharmaceutical Composition (Lipid Nanoparticle Delivery System) The siRNA provided by this invention can be prepared into a pharmaceutical composition for in vivo administration. A common method is to encapsulate it in lipid nanoparticles (LNPs). LNPs typically contain ionizable cationic lipids, cofactor lipids, cholesterol, and polyethylene glycol-modified lipids. For example, siRNA targeting the Apip gene (such as SEQ ID NO:1 / 2) is dissolved in ethanol in a specific molar ratio (e.g., 50:10:38.5:1.5) with ionizable cationic lipids (such as DLin-MC3-DMA), distearate phosphatidylcholine (DSPC), cholesterol, and polyethylene glycol-modified lipids (such as PEG2000-DMG). The aqueous phase (such as citrate buffer, pH 4.0) is mixed with the ethanol phase using a microfluidic device to form LNPs. The ethanol is removed by dialysis and the buffer is replaced to physiological pH to obtain a siRNA-LNP formulation with uniform particle size (approximately 50-200 nm) and high encapsulation efficiency. This formulation can be used in subsequent animal experiments, such as intravenous administration, to evaluate its in vivo efficacy and safety.

[0107] The implementation principle of this invention is as follows: This invention discloses siRNAs for pyroptosis-regulating genes and their applications. Targeting key pyroptosis-regulating genes Apip, Elavl1, Pelp1, Plcg1, and Bax, this invention designs and screens a series of highly efficient and specific small interfering RNA (siRNA) molecules, and provides their specific sequences. Cellular experiments have verified that these siRNA molecules can significantly inhibit the mRNA expression levels of the target genes. This invention also provides pharmaceutical compositions containing the above-mentioned siRNAs and their application in the preparation of drugs for treating pyroptosis-related diseases (such as inflammatory diseases, tumors, neurodegenerative diseases, etc.). The siRNA molecules of this invention provide novel targeted drugs for the treatment of pyroptosis-related diseases and have broad application prospects.

[0108] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape, and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A double-stranded RNA molecule for inhibiting the expression of genes related to pyroptosis regulation, characterized in that, The pyroptosis-regulating genes are selected from one or more of Apip, Elavl1, Pelp1, Plcg1, and Bax; the double-stranded RNA molecule comprises a sense strand and an antisense strand, the sequences of which are selected from any one of the following groups: a) The justice chain is shown in SEQ ID NO: 1, and the antisense chain is shown in SEQ ID NO: 2; b) The justice chain is shown in SEQ ID NO: 3, and the antisense chain is shown in SEQ ID NO: 4; c) The justice chain is shown in SEQ ID NO: 5, and the antisense chain is shown in SEQ ID NO: 6; d) The justice chain is shown in SEQ ID NO: 7, and the antisense chain is shown in SEQ ID NO: 8; e) The justice chain is shown in SEQ ID NO: 9, and the antisense chain is shown in SEQ ID NO: 10; f) The justice chain is shown in SEQ ID NO: 11, and the antisense chain is shown in SEQ ID NO: 12; g) The justice chain is shown in SEQ ID NO: 13, and the antisense chain is shown in SEQ ID NO: 14; h) The justice chain is shown in SEQ ID NO: 15, and the antisense chain is shown in SEQ ID NO: 16; i) The justice chain is shown in SEQ ID NO: 17, and the antisense chain is shown in SEQ ID NO: 18; j) The justice chain is shown in SEQ ID NO: 19, and the antisense chain is shown in SEQ ID NO: 20; k) The justice chain is shown in SEQ ID NO: 21, and the antisense chain is shown in SEQ ID NO: 22; l) The justice chain is shown in SEQ ID NO: 23, and the antisense chain is shown in SEQ ID NO: 24; m) The justice chain is shown in SEQ ID NO: 25, and the antisense chain is shown in SEQ ID NO: 26; n) The justice chain is shown in SEQ ID NO: 27, and the antisense chain is shown in SEQ ID NO: 28; o) The justice chain is shown in SEQ ID NO: 29, and the antisense chain is shown in SEQ ID NO: 30; p) The justice chain is shown in SEQ ID NO: 31, and the antisense chain is shown in SEQ ID NO: 32; q) The justice chain is shown in SEQ ID NO: 33, and the antisense chain is shown in SEQ ID NO: 34; r) The justice chain is shown in SEQ ID NO: 35, and the antisense chain is shown in SEQ ID NO: 36; s) The justice chain is shown in SEQ ID NO: 37, and the antisense chain is shown in SEQ ID NO: 38; t) The justice chain is shown in SEQ ID NO: 39, and the antisense chain is shown in SEQ ID NO: 40; u) The justice chain is shown in SEQ ID NO: 41, and the antisense chain is shown in SEQ ID NO:

42.

2. The double-stranded RNA molecule for inhibiting the expression of genes related to pyroptosis regulation according to claim 1, characterized in that, The 3' ends of both the sense and antisense strands of the double-stranded RNA molecule protrude two nucleotides.

3. The double-stranded RNA molecule for inhibiting the expression of genes related to pyroptosis regulation according to claim 2, characterized in that, The two prominent nucleotides are TT or UU.

4. The double-stranded RNA molecule for inhibiting the expression of genes related to pyroptosis regulation according to claim 1, characterized in that, The double-stranded RNA molecule is chemically modified, and the chemical modification is selected from one or more of 2'-O-methyl modification, 2'-fluoro modification, thiophosphate bond modification, and cholesterol coupling.

5. A pharmaceutical composition, characterized in that, The invention comprises a double-stranded RNA molecule for inhibiting the expression of pyroptosis-regulated genes as described in any one of claims 1-4 and a pharmaceutically acceptable vector.

6. The pharmaceutical composition according to claim 5, characterized in that, The pharmaceutically acceptable carriers are liposomes, nanoparticles, viral vectors, or cationic polymers.

7. The use of a double-stranded RNA molecule according to any one of claims 1-4 for inhibiting the expression of genes related to pyroptosis regulation, or a pharmaceutical composition according to any one of claims 5-6, in the preparation of a medicament for treating pyroptosis-related diseases.

8. The application according to claim 7, characterized in that, The pyroptosis-related diseases include inflammatory diseases, tumors, and neurodegenerative diseases.

9. The application according to claim 8, characterized in that, The inflammatory disease is sepsis, acute pancreatitis, inflammatory bowel disease, or an autoimmune disease; the tumor is liver cancer, lung cancer, or colorectal cancer; the neurodegenerative disease is Alzheimer's disease or Parkinson's disease.

10. A method for inhibiting the expression of pyroptosis-regulating genes in cells for non-therapeutic purposes, characterized in that, A double-stranded RNA molecule for inhibiting the expression of pyroptosis-regulated genes, as described in any one of claims 1-4, is introduced into the cell.

Images