Preparation method of Iars1 gene knockout zebrafish model and application of Iars1 gene knockout zebrafish model in early development abnormality research

Abstract

The invention discloses a preparation method of an Iars1 gene knockout zebrafish model, which comprises the following steps: mixing sgRNA fragments and Cas9 protein, injecting a mixed solution into zebrafish fertilized eggs in 1-2 cell stages through micro-injection, and obtaining Iars1 gene edited individuals after the fertilized eggs are hatched and cultured; after genotype identification, family screening and continuous breeding, the stably inherited Iars1 gene knockout zebrafish mutant strain is obtained. According to the invention, a zebrafish Iars1 gene is subjected to targeted editing by adopting a CRISPR / Cas9 technology, a zebrafish model carrying deletion mutation is obtained, and a stably inherited mutant is obtained through molecular identification. The model constructed by the invention can be used for researching early development abnormality related to Iars1 function deficiency, and an experimental model can be provided for evaluating early nutrition utilization abnormality, protein translation related abnormality and candidate interveners. The construction method is reliable, the model phenotype is clear, and the method has good research and application prospects.

Description

Technical Field

[0001] This invention belongs to the field of gene-edited animal model construction technology, specifically involving a method for preparing an Iars1 gene knockout zebrafish model and its application in early developmental abnormality research. Background Technology

[0002] With the rapid development of molecular biology and genetic engineering technologies, gene editing technology, especially the CRISPR / Cas9 system, has become an important technical tool in current life science research and model development. This technology has advantages such as ease of operation, high editing efficiency, and strong targeting, and has been widely applied in gene function identification, animal model construction, evaluation of abnormal phenotypes, and candidate screening. Zebrafish (Danio rerio) are characterized by embryonic transparency, rapid development, strong reproductive capacity, clear genetic background, and suitability for real-time in vivo observation. Furthermore, their developmental regulation and metabolic regulation processes are highly conserved compared to higher vertebrates. Therefore, they have significant advantages in evaluating early developmental abnormalities, analyzing nutritional and metabolic abnormalities, and screening small molecule interventions, making them an important model animal with both basic research and applied development value.

[0003] The Iars1 gene encodes isoleucyl-tRNA synthetase 1, a member of the aminoacyl-tRNA synthetase family. During protein translation, it is responsible for linking isoleucine residues to their corresponding tRNAs, and is a crucial factor in maintaining cellular protein synthesis, amino acid utilization, and metabolic homeostasis. Early embryonic and larval development is highly dependent on protein synthesis, nutrient utilization, and energy metabolism; therefore, Iars1 dysfunction can easily lead to developmental arrest, abnormal tissue differentiation, decreased survival rates, and even death. Current research on Iars1 mainly focuses on gene function. Regarding its role in the early development of fish, especially zebrafish, there is a lack of gene knockout models with well-defined genotypes and stable phenotypes, particularly in vivo models that can be directly used for evaluating early developmental abnormalities, identifying early nutrient utilization abnormalities, and screening candidate interventions. This limits the expansion of this gene's application development.

[0004] The early developmental stages of fish are critical periods for organ formation and body axis establishment, as well as a crucial transition from yolk sac nutrition to active feeding and nutrient utilization. If key gene deletions impair amino acid utilization and protein translation, they often lead to developmental abnormalities, nutrient utilization disorders, and overall survival failure. Therefore, establishing an Iars1 gene knockout zebrafish model can provide stable material for rapid identification of early developmental abnormalities, offer an experimental model for in vivo evaluation of early nutrient utilization abnormalities, and further screen and evaluate candidate interventions to improve developmental delays, increase survival rates, or alleviate nutrient utilization disorders. Simultaneously, this model can also serve as an in vivo evaluation tool for amino acid utilization abnormalities and protein translation disorders, enabling the development of phenotypic determination methods and preliminary screening systems for related abnormal states. Based on this, it is necessary to construct an Iars1 gene knockout zebrafish model based on CRISPR / Cas9 technology to obtain experimental material with a clear genetic background and stable abnormal phenotypes, providing technical support for specific applications such as abnormal development evaluation, nutrient utilization abnormality determination, and candidate intervention screening. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a simple, stable and phenotypically well-defined method for preparing Iars1 gene knockout zebrafish mutant strains. The animal models prepared by this method can provide technical support for evaluating early developmental abnormalities caused by Iars1 mutations, determining early nutrient utilization abnormalities, evaluating amino acid utilization and protein translation abnormalities in vivo, as well as screening and evaluating the effects of candidate interventions.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for preparing an Iars1 gene knockout zebrafish model, comprising: mixing sgRNA fragments and Cas9 protein, injecting the mixture into 1-2 cell stage zebrafish fertilized eggs via microinjection, obtaining Iars1 gene-edited individuals after the fertilized eggs hatch and are cultured; and obtaining a stably inherited Iars1 gene knockout zebrafish mutant strain after genotyping, family screening and continuous breeding.

[0007] Preferably, sgRNAs are designed targeting the exon regions of the zebrafish Iars1 gene using CRISPR / Cas9 technology.

[0008] Preferably, the sgRNA target sequence is designed on exon 1 of the zebrafish Iars1 gene, and the sgRNA target sequence is: 5'-GTCCATCCACTTCCCCACTG-3'.

[0009] Preferably, the PCR identification primer pair targeting the sgRNA target region is: Upstream forward primer: 5'-CAGTGCCAGAGTCCATCCAC-3'; Downstream reverse primer: 5'-ACACTCCTGGAAACAGTCGT-3'.

[0010] Preferably, the vector used to express the sgRNA is the pDR274-sgRNA vector, or other commercially available vectors that can be used for in vitro transcription of sgRNA.

[0011] Preferably, the specific steps are described as follows: S1. Target Design: The sgRNA target was designed on exon 1 of the zebrafish Iars1 gene. The sgRNA targeting Iars1 sequence is GTCCATCCACTTCCCCACTG, and its corresponding sgRNA sequence is 5'-GGCCATCCACTTCCCCACTG-3'.

[0012] S2, Primer Synthesis: Based on the sgRNA target sequence, sgRNA construction primers were designed and synthesized, with the upstream and downstream primers each containing the sticky end sequences required for ligation with the vector.

[0013] S3. Preparation of the target double strand: Using the upstream and downstream primers synthesized in step S2, a double-stranded DNA fragment with sticky ends is formed after denaturation and annealing.

[0014] Construction of S4 and sgRNA expression vectors: The pDR274-sgRNA vector was digested with restriction endonucleases, and the double-stranded DNA fragment obtained in step S3 was ligated with the linearized vector to obtain an sgRNA expression vector containing the target sequence. The ligation was verified by PCR or sequencing.

[0015] Preparation of S5 and sgRNA in vitro transcription templates: Using the positive vector obtained in step S4 as a template, PCR amplification was performed and the corresponding product was purified and recovered as a template for in vitro transcription of sgRNA.

[0016] S6 and sgRNA in vitro transcription: The sgRNA template obtained in step S5 was transcribed in vitro using the T7 transcription system, and then purified and recovered to obtain sgRNA.

[0017] S7, Microinjection: The sgRNA recovered in step S6 was mixed with commercial Cas9 protein and then microinjected into 1- to 2-cell stage zebrafish fertilized eggs to obtain F0 generation injected embryos.

[0018] S8. Target effectiveness detection: Several zebrafish embryos were collected 24 hours after injection, and genomic DNA was extracted. The target fragment was amplified using PCR primers targeting the target region and sequenced. If the sequencing results showed obvious overlapping peaks or deletion / insertion signals near the target site, the injection was considered effective. The effective batch of embryos was continued to be raised until sexual maturity to obtain gene knockout positive chimeras F0.

[0019] S9. Strain Establishment: Positive F0 individuals were testcrossed with wild-type zebrafish, and their offspring were genotyped to obtain F1 heterozygotes carrying effective mutations (+ / -). ); Select F1 generation female and male individuals with the same mutation type for self-fertilization to obtain F2 generation homozygous mutants ( / ), namely the Iars1 gene knockout zebrafish mutant strain.

[0020] Preferably, in the Iars1 gene knockout zebrafish, the Iars1 gene undergoes base deletion, insertion, or frameshift mutation, resulting in premature termination or loss of function of the encoded protein.

[0021] Preferably, the Iars1 gene knockout zebrafish gradually die from the 6th day after fertilization and all die by the 8th day, accompanied by obvious early developmental abnormalities.

[0022] Secondly, this invention provides the application of the Iars1 gene knockout zebrafish model prepared by the method in the study of early developmental abnormalities in zebrafish.

[0023] Furthermore, the Iars1 gene knockout zebrafish early developmental abnormality model obtained by the method can be used for early developmental abnormality assessment. By observing the mortality process, survival rate changes and abnormal phenotypes of larvae at specific developmental stages, the degree of early developmental impairment can be determined in vivo.

[0024] Furthermore, the Iars1 gene knockout zebrafish early nutrient utilization abnormality model obtained by the method can be used to determine early nutrient utilization abnormalities. By combining the larval growth status, mortality time window, and abnormal transcriptomic and metabolomic characteristics, the nutrient utilization impairment and its severity can be evaluated.

[0025] Furthermore, the Iars1 gene knockout zebrafish model obtained by the method can be used for in vivo evaluation of abnormal amino acid utilization and protein translation disorders. By detecting changes in survival rate, degree of developmental abnormality, and molecular indicators related to aminoacyl-tRNA synthesis, protein processing and stress response, cell cycle and apoptosis, energy metabolism, and eye development, abnormal states affecting amino acid utilization and protein synthesis can be determined.

[0026] Furthermore, the Iars1 gene knockout zebrafish model obtained by the method can be used for candidate intervention screening and effect evaluation. By applying the test substance to the mutant embryo or larva, the test substance can be preliminarily screened and its effect evaluated based on its improvement on mortality rate, time to death, abnormal phenotype and molecular indicators.

[0027] On the other hand, the present invention also provides an sgRNA, the nucleotide sequence of which is: 5'-GGCCATCCACTTCCCCACTG - 3'.

[0028] This invention reveals that Iars1 gene deletion leads to significant mortality in zebrafish larvae during late development, with mortality beginning on day 6 and culminating in complete mortality by day 8, accompanied by marked early developmental abnormalities. Transcriptomic analysis shows significant abnormalities in pathways related to aminoacyl-tRNA synthesis, protein processing and stress response, cell cycle and apoptosis, energy metabolism, and eye and lens development. Metabolomic analysis further indicates a significant metabolic homeostasis imbalance. Therefore, the Iars1 gene-deleted zebrafish model of this invention can serve as an animal model for evaluating early developmental abnormalities, determining early nutrient utilization abnormalities, assessing amino acid utilization and protein translation abnormalities in vivo, and screening and evaluating the effectiveness of candidate interventions.

[0029] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention uses CRISPR / Cas9 technology to construct the Iars1 gene knockout zebrafish model. The method is simple, efficient and reproducible, and can obtain mutant strains with clear genetic background and stable abnormal phenotypes.

[0030] (2) The Iars1 gene knockout zebrafish model constructed in this invention gradually died from the 6th day after fertilization and all died on the 8th day. The time window of death was clear and accompanied by obvious early developmental abnormalities. It can be used as an in vivo evaluation model for early developmental abnormalities and early nutrient utilization abnormalities.

[0031] (3) The model constructed in this invention has systemic abnormality characteristics at both the transcriptomic and metabolomic levels. It can be used for in vivo evaluation of abnormal amino acid utilization and protein translation-related abnormalities, and can be further used for preliminary screening and effect evaluation of candidate interventions. It has good application development value. Attached Figure Description

[0032] Figure 1This diagram illustrates the structure of the Iars1 gene and the sequence of gene editing sites in wild-type (WT) and homozygous mutant Iars1 zebrafish (Iars1- / -). Black boxes represent exons, black lines represent introns, black underlines represent the target sequence designed by sgRNA, short horizontal lines represent deleted or inserted bases in the homozygous mutant, and red letters indicate predicted frameshifts and premature termination of amino acid sequences in the homozygous mutant.

[0033] Figure 2 Wild-type (WT, i.e., + / +), heterozygous mutant (Iars1+ / ) PCR typing and sequencing identification of the target editing site in zebrafish with heterozygous and homozygous mutants (Iars1- / -). The left image shows the results of non-denaturing PAGE gel HMA; heterozygous samples show obvious heteroduplex bands, while homozygous samples show only a single main band. The right image shows the sequence alignment results of the target site. Sequencing results show that sample 1 is Iars1+ / +, and sample 2 is Iars1- / -, with a mutation type of 4 bp deletion (-4).

[0034] Figure 3 A schematic diagram showing the survival rate changes of wild-type (WT, i.e., + / +) and Iars1 homozygous mutant zebrafish (Iars1- / -) during the early developmental stages. The horizontal axis represents developmental days (dpf), and the vertical axis represents survival rate. The results show that the Iars1 homozygous mutants began to die gradually from day 6 post-fertilization, and all died by day 8, while the wild-type control group maintained a higher survival rate at the same stage.

[0035] Figure 4 This figure shows the results of differential expression analysis of the transcriptomes of wild-type (WT, i.e., + / +) and homozygous mutant zebrafish (Iars1- / -) larvae. Figure A is a volcano plot of differentially expressed genes, with the horizontal axis representing log2 (fold change) of gene expression and the vertical axis representing -log10 (p-value) of the significance of the difference; red dots indicate significantly upregulated genes, blue dots indicate significantly downregulated genes, and gray dots indicate genes with no significant difference. Figure B shows the results of GO functional enrichment analysis of differentially expressed genes, showing that the differentially expressed genes are mainly involved in redox processes, protein processing and stress responses, membrane components, and immune-related functions. Figure C shows the results of KEGG pathway enrichment analysis of differentially expressed genes, showing that the differentially expressed genes are mainly enriched in aminoacyl-tRNA synthesis, protein processing and stress responses, cell cycle and apoptosis, energy metabolism, and pathways related to eye and lens development. This figure illustrates that Iars1 gene deletion can cause widespread changes in transcriptional levels, leading to disruption of protein translation-related processes, activation of stress responses, and early developmental abnormalities. Detailed Implementation

[0036] To facilitate understanding of the present invention, a more complete description will be given below with reference to specific embodiments. Preferred embodiments of the invention are shown in the accompanying drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0038] Unless otherwise specified, the experimental methods used in the following examples and comparative examples are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0039] Example 1: Analysis of the Iars1 gene in zebrafish Isoleucyl-tRNA synthetase 1 (Iars1) is an important member of the aminoacyl-tRNA synthetase family. It is primarily responsible for the accurate ligation of isoleucine residues to their corresponding tRNAs and is a key enzyme in protein translation. Protein translation is a fundamental process for early embryonic cell proliferation, tissue differentiation, organ formation, and individual survival. Therefore, abnormal Iars1 function may significantly impact early development, growth and survival, nutrient utilization, and the maintenance of metabolic homeostasis. Previous studies have shown that functional deficiencies in members of the aminoacyl-tRNA synthetase family are often closely associated with developmental abnormalities, tissue damage, metabolic disorders, and multi-system defects, suggesting their crucial role in normal biological development.

[0040] Zebrafish, as a classic model organism, possesses advantages such as embryonic transparency, rapid development, strong reproductive capacity, and ease of in vivo observation, making it suitable for evaluating developmental abnormalities and constructing application models after the loss of function of target genes. Previous research by the inventors revealed that after the Iars1 gene was deleted, zebrafish larvae exhibited significant abnormalities in the early developmental stages, gradually dying from day 6 post-fertilization and all dying by day 8, suggesting that Iars1 plays a crucial role in the early survival of larvae. Further transcriptomic analysis showed that after Iars1 deletion, multiple molecular pathways related to aminoacyl-tRNA synthesis, protein processing and stress response, cell cycle and apoptosis, energy metabolism, and eye and lens development were significantly abnormal. Specifically, the expression of aminoacyl-tRNA synthesis-related genes such as kars and tars was significantly altered, as were stress-related genes such as xbp1, atf3, and atf5b, and the expression of some lens / eye development-related genes, such as cryba4, was downregulated. Metabolomic analysis further indicated that Iars1 deletion can lead to significant metabolic homeostasis imbalance. This demonstrates that the Iars1 gene knockout zebrafish model constructed in this invention can be used as an early developmental abnormality evaluation model, an early nutrient utilization abnormality determination model, an in vivo evaluation model for amino acid utilization and protein translation abnormalities, and a candidate intervention screening and effect evaluation model for application development.

[0041] Example 2: Design of sgRNA for the zebrafish Iars1 gene Information on the zebrafish Iars1 gene (NCBI Gene ID: 334393) was obtained by querying the NCBI (National Center for Biotechnology Information) and Ensembl databases to obtain its chromosomal location, transcript, and coding sequence information. To achieve effective knockout of the Iars1 gene, its open reading frame was targeted and disrupted using CRISPR / Cas9 technology. The target site was preferably designed near the front of the coding region in the exon, so that frameshift mutations caused by base deletion or insertion would lead to premature protein termination or loss of function.

[0042] Specifically, the genomic sequence of the zebrafish Iars1 gene corresponding chromosomal region and the reference transcript CDS sequence were downloaded. The CDS and genomic sequence were compared in SnapGene software to determine the exon structure and conserved coding regions. Coding regions common to multiple transcripts were selected as candidate target regions. Online design tools such as CRISPRscan were then used to analyze the candidate sites, taking into account factors such as target activity, off-target risk, and ease of subsequent PCR identification, to finally obtain the sgRNA target of the Iars1 gene. Figure 1 ).

[0043] The selected target site is located in exon 1 of the zebrafish Iars1 gene, and the target sequence is GTCCATCCACTTCCCCACTG (SEQ ID NO. 1), and its corresponding sgRNA sequence is: 5'-GGCCATCCACTTCCCCACTG-3' (SEQ ID NO. 2).

[0044] Example 3: Preparation of sgRNA in vitro transcription template pDR274- iars1 Construction of recombinant plasmids targeting sgRNA.

[0045] Table 1

[0046] Oligo nucleotide chains Oligo 1-2 (10 μM) were synthesized according to Table 1. 10 μL each of Oligo 1 and Oligo 2 were pipetted into 1.5 mL centrifuge tubes, gently vortexed to mix, and briefly centrifuged to ensure all liquid was at the bottom of the tube. The tubes were then placed in a 95°C water bath for 10 min and allowed to cool naturally. The resulting double strands formed by annealing both Oligo nucleotides exhibited sticky "TAGG—" and "AAAC—" ends.

[0047] The pDR274 plasmid was subjected to restriction cleavage using the BsaI enzyme. The enzyme digestion reaction system is shown in Table 2 below.

[0048] Table 2

[0049] The double-stranded plasmid obtained by annealing and the pDR274 plasmid cleaved by BsaI enzyme were ligated using T4 ligase, and PCR amplification was performed using the ligation product as a template to verify whether the ligation reaction was successful.

[0050] The PCR amplification system is shown in Table 3.

[0051] Table 3

[0052] The sequence of primer 1861_m13 is: GTAAAACGACGGCCAGT (SEQ ID NO. 5).

[0053] The PCR reaction conditions are shown in Table 4.

[0054] Table 4

[0055] The recombinant plasmid pDR274- iars1The plasmid was transferred into E. coli DH5α cells and single clones containing the recombinant plasmid were screened by colony PCR.

[0056] Plasmid extraction was performed using the EZNAEndo-free Plasmid Mini Kit II (Omega).

[0057] ETR Solution, N3 Buffer, and Solution I should be placed on ice beforehand.

[0058] The specific steps for plasmid extraction are as follows: 1. Inoculate the bacteria at a ratio of 1:100 into 20 ml of resistant medium, shake at 37°C and 220 rpm for 12-16 h, centrifuge at RT and 5000 g for 10 min, and discard the supernatant.

[0059] 2. Add 500 μL Solution I (4°C, pre-added with RNase A), shake to resuspend, and transfer to a 2 mL EP tube.

[0060] 3. Add 500 μL Solution II, invert 10 times, let the solution clarify, and let it stand at room temperature for 2-5 minutes.

[0061] 4. (Remove genomic DNA) Add 250 μL (half volume) of N3 Buffer, invert several times until a white precipitate appears.

[0062] 5. Centrifuge at 13000 g for 5 min at RT, transfer the supernatant to a 1.5 ml EP tube, and centrifuge at 13000 g for 10 min at RT.

[0063] 6. Carefully transfer the supernatant into a 2 ml EP tube.

[0064] 7. Add 600 μL (0.5 times the volume) of ethanol, invert 6-7 times to mix well, and let stand at room temperature for 1-2 minutes.

[0065] 8. Load 700 μL onto the column each time, centrifuge at high speed for 1 min, and discard the filtrate.

[0066] 9. (To remove protein) Add 500 μL of HBC Buffer, centrifuge at high speed for 1 min, and discard the filtrate.

[0067] 10. Add 700 μL DNA wash buffer, centrifuge at high speed for 1 min, discard the filtrate, and repeat once.

[0068] 11. Quickly spin the column for 2 minutes, then transfer it into a 1.5 ml EP tube.

[0069] 12. Add 80-100 μL of dd water and let stand at room temperature for 1 minute.

[0070] 13. Centrifuge at high speed for 1 min, then elute by reabsorption.

[0071] The high-fidelity DNA polymerase KOD FX (Toyobo, catalog number KFX-101) was used to amplify the in vitro transcription template.

[0072] The PCR reaction system is shown in Table 5.

[0073] Table 5

[0074] upstream gRNA of primer: TTTAAAAGCACCGACTCGGTGCCAC (SEQ ID NO. 6); The PCR reaction conditions are shown in Table 6.

[0075] Table 6

[0076] After the target band was cut under UV light, it was extracted using the EZNA Gel Extraction Kit (Omega). The procedure is as follows: 1. Place the cut gel pieces into a 1.5 mL centrifuge tube and calculate its volume based on a density of approximately 1 g / mL; 2. Add Binding Buffer (XP2) to the centrifuge tube in an amount equal to the volume of the gel block; 3. Incubate at 50-60℃ for about 7 minutes to allow the gel to dissolve completely. During incubation, gently invert or briefly vortex every 2-3 minutes to mix. Once the gel has completely dissolved, return the sample to room temperature. 4. Install the HiBind DNA Mini Column into a 2 mL collection tube. Add no more than 700 μL of gel solution to the column each time. Centrifuge at 10000 ×g for 1 min at room temperature and discard the filtrate in the collection tube. 5. If the remaining sample volume is large, continue to add it to the centrifuge column in batches, with each batch not exceeding 700 μL. Repeat centrifugation until all samples have been processed. 6. Add 300 μL Binding Buffer (XP2) to the centrifuge column, centrifuge at 13000 ×g for 1 min at room temperature, and discard the filtrate; 7. Add 700 μL of SPW Wash Buffer to the centrifuge column, centrifuge at 13000 ×g for 1 min at room temperature, and discard the filtrate; 8. Repeat step 7) once to further remove impurities; 9. After washing, centrifuge the column at 13000 ×g for 2 min at room temperature, and then dry it properly in a metal bath at 56℃ to remove residual ethanol. 10. Transfer the centrifuge column to a new 1.5 mL centrifuge tube, add 30–50 μL of Elution Buffer or deionized water to the center of the column membrane, and let stand at room temperature for 2 min. 11. Centrifuge at 13000 ×g for 1 min to collect the eluent. The eluent can be added back to the center of the column membrane for repeated elution to improve DNA recovery.

[0077] The DNA recovered from the gel was used as a template for PCR amplification using KOD FX enzyme.

[0078] After amplification, the PCR products were purified and recovered using the EZNA Cycle Pure Kit (Omega). The specific steps are as follows: 1. Measure the total volume of the PCR amplification system and transfer the amplification products to a 1.5 mL centrifuge tube; 2. Add 4 to 5 volumes of CP Buffer to the sample; when the PCR product fragment length is less than 200 bp, add 5 volumes of CP Buffer and simultaneously add 0.4 volumes of anhydrous isopropanol. 3. After thoroughly vortexing and mixing, perform a brief centrifugation to concentrate the liquid on the tube wall at the bottom of the tube; 4. Place the HiBind DNA Mini Column in a 2 mL collection tube, then add all the above-treated sample into the centrifuge column, centrifuge at 13000 ×g for 1 min at room temperature, and discard the filtrate. 5. Add 700 μL of DNA Wash Buffer to the centrifuge column, centrifuge at 13000 ×g for 1 min, and discard the filtrate; 6. Repeat step 5) once to further remove impurities; 7. After washing, centrifuge the column at 13000 ×g for 2 min, then place it in a 56℃ metal bath for 2 min to fully evaporate any residual ethanol. 8. Transfer the centrifuge column to a new 1.5 mL centrifuge tube, and add 30–50 μL of Elution Buffer, TE Buffer, or sterile deionized water to the center of the column membrane; 9. Let it stand at room temperature for 2 minutes to wash out the elution; or place it in a 56℃ metal bath for 2 minutes to speed up the washing process. Make sure to tighten the tube cap during operation. 10. Centrifuge at 13000 ×g for 1 min and collect the eluent; if necessary, the eluent can be added back to the center of the column membrane for repeated elution to improve recovery efficiency.

[0079] The recovered DNA was used as a template for subsequent in vitro transcription experiments.

[0080] Example 4: Preparation and purification of sgRNA In vitro transcription In vitro transcription was performed using the MEGAscript T7 Transcription Kit (Invitrogen).

[0081] The reaction system is shown in Table 7 below.

[0082] Table 7

[0083] In vitro transcription was performed using RNA Polymerase Enzyme Mix (Invitrogen), and the specific steps are as follows: 1. Place the RNA Polymerase Enzyme Mix on ice for later use. Vortex the 10× Reaction Buffer and the solutions of ATP, CTP, GTP, and UTP ribonucleotides thoroughly until they are completely dissolved. After the reagents have thawed, place the ribonucleotide solutions on ice and allow the 10× Reaction Buffer to return to room temperature for later use. Before use, briefly centrifuge each reagent to collect the liquid at the bottom of the tube. 2. Prepare an in vitro transcription reaction system with a total volume of 20 μL. Add 8 μL of ribonucleotide mixture (2 μL each of ATP, CTP, GTP, and UTP; when performing multiple reactions, mix well before aliquoting), 2 μL of 10× Reaction Buffer, 0.1–0.2 μg of purified PCR product, and 2 μL of EnzymeMix to a 1.5 mL EP tube free of RNase in sequence. The PCR product can be added directly to 8 μL. Gently tap the bottom of the EP tube or use a pipette to gently mix the reaction solution. Then, briefly centrifuge to collect the liquid at the bottom of the tube and incubate at 37°C for 4–6 h. 3. After the reaction is complete, add 50 μL of LiCl Precipitation Solution to the above system to terminate the in vitro transcription reaction and precipitate RNA. Vortex to mix and then briefly centrifuge to collect the liquid at the bottom of the tube. Then place the tube at -20℃ and let it stand overnight. 4. The next day, centrifuge at 12000 rcf for 15 min at 4℃ to allow the RNA to fully precipitate into clumps; 5. Carefully discard the supernatant, add 1 mL of 70% or 75% ethanol to the precipitate for washing, and centrifuge at 4°C and 12000 rcf for 10–15 min to remove as many unbound nucleotides as possible; 6. After discarding the ethanol, allow the RNA precipitate to air dry at room temperature, avoiding excessive drying; then add 20-30 μL of nuclease-free water for resuspending, quickly vortex to mix, and briefly centrifuge to concentrate the liquid at the bottom of the tube. After measuring the RNA concentration, store at -20℃ or -80℃.

[0084] Example 6: Microinjection and target effectiveness testing 45 ng / μL of sgRNA and 200 ng / μL of commercial Cas9 protein (New England Biolabs, USA) were mixed with nuclease-free water. After incubating the mixture on ice for 10–15 min, the mixture was microinjected into wild-type zebrafish 1–2 cell stage embryos, with an injection volume of approximately 0.46 nL per embryo.

[0085] After injection, embryonic genomic DNA was extracted using an alkaline lysis method. Specifically, several injected embryos were randomly selected, and 30–50 μL of 50 mM NaOH solution was added. The mixture was then treated at 95°C for 10 min until the embryonic tissue was fully lysed. After the reaction solution cooled to room temperature, 3–5 μL of Tris-HCl buffer (pH 8.0) was added to neutralize the reaction system. Subsequently, the mixture was centrifuged at 12,000 rpm for 1 min, and the supernatant was used as the PCR amplification template for subsequent genotyping.

[0086] Identification primers were designed based on the target site. The upstream primer sequence was CAGTGCCAGAGTCCATCCAC (SEQ ID NO. 5), and the downstream primer sequence was ACACTCCTGGAAACAGTCGT (SEQ ID NO. 6).

[0087] This was used to perform PCR amplification and detection on F0 generation chimeric zebrafish. The PCR reaction system is shown in Table 8 below.

[0088] Table 8

[0089] Using Bio The amplification reaction was performed using a Rad PCR instrument, and the amplification conditions are shown in Table 9 below.

[0090] Table 9

[0091] Embryos from the same batch that showed heterogeneous peaks near the target peak in the melting curve analysis were continued to be raised to sexual maturity and used as candidate parents for subsequent breeding. After obtaining offspring, the embryos were screened using the aforementioned PCR amplification and sequencing identification methods to determine whether they carried effective mutations, thereby obtaining the Iars1 gene mutant zebrafish strain. Positive individuals were further screened and lateralized with wild-type zebrafish to obtain Iars1 heterozygous mutants (+ / -), and their specific mutation types were confirmed by sequencing. Based on this, heterozygous individuals (+ / -) with the same promoter fragment deletion type were selected for self-pollination to finally obtain the corresponding homozygous mutant offspring (- / -).

[0092] Example 6; Genotyping of mutants and wild types Genomic DNA was extracted from the tail fin of the fish using the alkaline lysis method described above.

[0093] PCR amplification and detection were performed on zebrafish tail fin samples using primers.

[0094] The primer sequences are as follows: Upstream primer: CAGTGCCAGAGTCCATCCAC (SEQ ID NO. 7); Downstream primer: ACACTCCTGGAAACAGTCGT (SEQ ID NO. 8).

[0095] Genotyping of genomic DNA was performed using high-resolution melting analysis (HRMA).

[0096] Design primers targeting mutation sites: Upstream forward primer: CAACAGCGTCAGAATCGGTG (SEQ ID NO. 9); Downstream reverse primer: GTTGAGGAATTCCCTTGCTCTG (SEQ ID NO. 10).

[0097] The PCR reaction system is shown in Table 10 below.

[0098] Table 10

[0099] Using Bio The amplification reaction was performed using a Rad PCR instrument, and the amplification conditions are shown in Table 11 below.

[0100] Table 11

[0101] Based on the differences in melting curves of wild-type, heterozygous, and homozygous mutants in quantitative real-time PCR, different genotypes can be initially distinguished. For samples that are difficult to determine definitively using HRMA, the PCR products can be subjected to non-denaturing PAGE electrophoresis, followed by heteroduplex mobility analysis (HMA) for further identification. Figure 2 ). Figure 2 The results showed that samples 2, 4, and 5 were (+ / -), and heterozygous samples showed obvious heteroduplex bands, making them relatively easy to identify. However, samples showing only a single main band could not be further distinguished as wild-type homozygous (+ / +) or mutant homozygous (- / -) based solely on HMA results; confirmation using PCR product sequencing results was still required. Sequencing verification confirmed that sample 1 was wild-type homozygous (+ / +) and sample 3 was mutant homozygous (- / -).

[0102] Example 7: Observation of early mortality and abnormal development phenotypes in Iars1 gene knockout zebrafish Wild-type and Iars1 gene homozygous mutant larvae obtained from the same batch of breeding were selected and their development and survival were continuously observed under the same culture conditions.

[0103] The results showed that wild-type larvae developed normally and had a high survival rate during the observation period; while larvae with homozygous Iars1 gene mutations gradually showed abnormalities in the early developmental stages and began to die gradually from the 6th day after fertilization, with all of them dying by the 8th day. Figure 3 These results indicate that Iars1 gene deletion can lead to significant early survival defects and developmental abnormalities, with a relatively concentrated mortality time window and stable phenotype, making it suitable as an in vivo evaluation model for early developmental abnormalities and nutrient utilization disorders.

[0104] Example 8: Transcriptome analysis of Iars1 gene knockout zebrafish Wild-type and Iars1 gene homozygous mutant larvae samples were collected separately, with multiple biological replicates set up for each group. Total RNA was extracted and then subjected to transcriptome sequencing analysis.

[0105] Differential expression analysis showed that the expression of a large number of genes changed significantly after Iars1 deletion. Figure 4Functional annotation and pathway enrichment analysis revealed that the differentially expressed genes were mainly involved in processes related to aminoacyl-tRNA synthesis, protein processing and stress response, cell cycle and apoptosis, energy metabolism, and eye and lens development. Specifically, the expression of aminoacyl-tRNA synthesis-related genes kars and tars was significantly altered, as were stress-related genes xbp1, atf3, and atf5b. Some lens / eye development-related genes, such as cryba4, were downregulated.

[0106] The results indicate that Iars1 deficiency can lead to disordered protein translation-related processes, activation of stress responses, and abnormal developmental programs, providing a molecular basis for the use of this model to evaluate abnormal amino acid utilization, protein translation-related abnormalities, and early developmental abnormalities.

[0107] The Iars1 gene knockout zebrafish model constructed in this invention has a clear genetic background and stable abnormal phenotype, and can be used in the following applications: (1) Used for early developmental abnormality assessment: The degree of early developmental impairment is determined by observing the mortality process, survival rate changes and abnormal phenotypes of larvae at specific developmental stages; (2) Used for early nutrient utilization abnormality assessment: Combining the larval mortality time window, developmental status and molecular and metabolic abnormality characteristics, the nutrient utilization disorder and its severity are evaluated. (3) In vivo evaluation of abnormal amino acid utilization and protein translation disorders: by detecting changes in developmental phenotype and molecular indicators, abnormal states affecting amino acid utilization and protein synthesis can be determined; (4) For screening and evaluation of candidate interventions: The test substance is applied to the mutant embryo or larvae, and the test substance is preliminarily screened and evaluated based on its improvement effect on survival rate, time to death, abnormal phenotype and molecular indicators.

[0108] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Therefore, any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A method for preparing an Iars1 gene knockout zebrafish model, characterized in that... include: After mixing sgRNA fragments and Cas9 protein, the mixture was injected into 1- to 2-cell stage zebrafish fertilized eggs via microinjection. After the fertilized eggs hatched and were cultured, Iars1 gene-edited individuals were obtained. After genotyping, family screening, and continuous breeding, a stably inherited Iars1 gene knockout zebrafish mutant strain was obtained.

2. The method according to claim 1, characterized in that, The sgRNA target sequence is located on exon 1 of the zebrafish Iars1 gene, and the sgRNA target sequence is: 5'-GTCCATCCACTTCCCCACTG-3'.

3. The method according to claim 2, characterized in that, The PCR identification primer pair targeting the sgRNA target region is as follows: Upstream forward primer: 5'-CAGTGCCAGAGTCCATCCAC-3'; Downstream reverse primer: 5'-ACACTCCTGGAAACAGTCGT-3'.

4. The method according to claim 1, characterized in that, The vector used to express the sgRNA is the pDR274-sgRNA vector.

5. The method according to claim 1, characterized in that, The specific operation steps of the method are as follows: S1. Target Design: The sgRNA target was designed on exon 1 of the zebrafish Iars1 gene. The sgRNA targeting Iars1 sequence is GTCCATCCACTTCCCCACTG, and the corresponding sgRNA sequence is: 5'-GGCCATCCACTTCCCCACTG-3'. S2, Primer Synthesis: Based on the sgRNA target sequence, sgRNA construction primers were designed and synthesized. The upstream and downstream primers each contained the sticky end sequences required for ligation with the vector. S3. Preparation of the target double strand: Using the upstream and downstream primers synthesized in step S2, a double-stranded DNA fragment with sticky ends is formed after denaturation and annealing. Construction of S4 and sgRNA expression vectors: The pDR274-sgRNA vector was digested with restriction endonucleases, and the double-stranded DNA fragment obtained in step S3 was ligated with the linearized vector to obtain an sgRNA expression vector containing the target sequence; the ligation success was verified by PCR or sequencing. Preparation of S5 and sgRNA in vitro transcription templates: Using the positive vector obtained in step S4 as a template, PCR amplification was performed and the corresponding product was purified and recovered as a template for in vitro transcription of sgRNA. S6 and sgRNA in vitro transcription: The sgRNA template obtained in step S5 was transcribed in vitro using the T7 transcription system, and then purified and recovered to obtain sgRNA. S7, Microinjection: The sgRNA recovered in step S6 was mixed with commercial Cas9 protein and then microinjected into 1-2 cell stage zebrafish fertilized eggs to obtain F0 generation injected embryos. S8. Target effectiveness detection: Several zebrafish embryos were collected 24 hours after injection, genomic DNA was extracted, and the target fragment was amplified and sequenced using PCR primers targeting the target region. If the sequencing results show obvious peak overlap or deletion / insertion signals near the target site, the batch of injections is considered effective; the effective batch of embryos are continued to be raised until sexual maturity to obtain gene knockout positive chimeras F0; S9. Strain Establishment: Positive F0 individuals were testcrossed with wild-type zebrafish, and their offspring were genotyped to obtain F1 generation heterozygotes carrying effective mutations. F1 generation female and male individuals with the same mutation type were selected for self-crossing to obtain F2 generation homozygous mutants, namely the Iars1 gene knockout zebrafish mutant strain.

6. The method according to claim 1, characterized in that, In the Iars1 gene knockout zebrafish, the Iars1 gene undergoes base deletion, insertion, or frameshift mutation, resulting in premature termination or loss of function of the encoded protein.

7. The method according to claim 1, characterized in that, The Iars1 gene knockout zebrafish began to die gradually from day 6 after fertilization and all died by day 8, accompanied by obvious early developmental abnormalities.

8. The application of the Iars1 gene knockout zebrafish model prepared by any one of claims 1 to 7 in the study of early developmental abnormalities in animals.

9. The application according to claim 8, characterized in that, The Iars1 gene knockout zebrafish model is applied to any of the following: a) Assessment of early developmental abnormalities; b) Early assessment of abnormal nutrient utilization; c) In vivo evaluation of abnormal amino acid utilization and protein translation disorders; d) Screening of candidate interventions and evaluation of their effects.

10. An sgRNA, characterized in that, The nucleotide sequence is: 5'-GGCCATCCACTTCCCCACTG - 3'.

Images