Nucleic acid constructs and uses thereof
By designing lentiviral vectors containing specific retroviral elements and pretreatment protocols, the problems of donor limitations and low vector efficiency in the treatment of thalassemia in existing technologies have been solved, achieving a highly efficient and low-cost gene therapy cure.
Patent Information
- Application Number
- CN202480068309.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-10-25
- Filing Date
- 2024-10-25
- Publication Date
- 2026-05-19
AI Technical Summary
In existing technologies, allogeneic hematopoietic cell transplantation therapy for the treatment of thalassemia is limited by the lack of donors and the risks of transplantation. Furthermore, existing vectors have low productivity and unoptimized gene expression efficiency, resulting in high treatment costs and poor efficacy.
A lentiviral vector containing a left (5') retroviral LTR, a human β-globin gene, an upstream locus control region, a cis-acting posttranscriptional regulatory element, and an SV40 polyadenylation signal was designed for transducing hematopoietic stem cells. Combined with busulfan and cyclophosphamide pretreatment, gene therapy was achieved.
It significantly improved viral packaging efficiency and vector integration strength, reduced immunogenicity, achieved clinical efficacy at lower doses, reduced production costs, and achieved a complete cure for thalassemia.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] Cross-references to related applications
[0002] This application claims the benefit of U.S. Application No. 18 / 383,596, filed October 25, 2023. The contents of the foregoing application, in their entirety, are incorporated herein by reference.
[0003] sequence list
[0004] This application contains a sequence list, which has been electronically submitted in XML file format and is incorporated herein by reference in its entirety. The XML copy was created on October 22, 2024, is named K2046-7006WO_SL.xml, and has a size of 177,688 bytes. Technical Field
[0005] This disclosure relates to the field of medical technology, and in particular to gene therapy and nucleic acid constructs. Background Technology
[0006] Hereditary anemias such as thalassemia and sickle cell anemia are rare inherited blood disorders, most commonly found in patients of Mediterranean, Middle Eastern, Indian, and South Asian descent. Thalassemia typically arises from an imbalance between the single chains of globin-hemoglobin tetramers. Imbalances in alpha-globin and beta-globin in red blood cells (RBCs) often produce a variety of clinical symptoms, such as 1) insufficient red blood cells and hemoglobin, leading to inadequate oxygen delivery throughout the body; 2) increased red blood cell hemolysis, resulting in increased mortality from chronic vascular damage; and 3) spleen and liver damage due to extreme iron overload.
[0007] Current treatments for hereditary anemia include, for example, blood transfusion therapy, iron chelation therapy, and splenectomy or splenic artery embolization. Allogeneic hematopoietic stem cell transplantation (e.g., allogeneic bone marrow transplantation, peripheral blood hematopoietic stem cell transplantation, or umbilical cord blood transplantation) is a potential therapy for thalassemia. However, the lack of transplant donors and the risks associated with transplantation limit the widespread use of allogeneic hematopoietic cell transplantation in patients with thalassemia.
[0008] Therefore, new treatments for thalassemia still need to be developed. Invention Overview
[0010] In one aspect, this disclosure provides a vector comprising: a) a left (5') retroviral LTR; b) a human β-globin gene; c) an upstream locus control region (LCR) of the human β-globin gene; d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) an SV40 polyadenylation signal and / or an SV40 replication initiation site.
[0011] In some embodiments, the sequence of the human β-globin gene comprises exon 1, intron 1, exon 2, intron 2, and exon 3. In some embodiments, the sequence of the human β-globin gene is based on the Ensembl database gene: HBB (ENSG00000244734) transcript: HBB-201 (ENST00000335295.4). In some embodiments, the human β-globin gene contains a human β-globin promoter. In some embodiments, the human β-globin promoter is located approximately 250 to approximately 275 bp (e.g., 268 bp) upstream of exon 1 of the human β-globin promoter. In some embodiments, the human β-globin gene contains a human β-globin 3'-enhancer. In some embodiments, the human β-globin 3'-enhancer is located approximately 850 bp to approximately 900 bp (e.g., 878 bp) downstream of exon 3 of the human β-globin gene. In some embodiments, the human β-globin gene comprises one or more (e.g., 2 or 3) wild-type exons. In some embodiments, the human β-globin gene comprises one or more (e.g., 2 or 3) codon-optimized exons. In some embodiments, the human β-globin gene comprises one or more wild-type introns. In some embodiments, the human β-globin gene comprises wild-type intron 2. In some embodiments, the human β-globin gene comprises one or more truncated introns. In some embodiments, the human β-globin gene comprises truncated intron 2. In some embodiments, the human β-globin gene comprises wild-type exon 2. In some embodiments, the human β-globin gene comprises exon 2 encoding a threonine-to-glutamine mutation (T87Q) at codon 87. In some embodiments, the human β-globin gene comprises the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or nucleotide sequences having at least 85%, 90%, 95%, 98%, or 99% sequence identity therewith, or any combination thereof.
[0012] In some embodiments, the upstream locus control region (LCR) contains one or more (e.g., two or three) truncated DNase I hypersensitive sites, HS2, HS3, and HS4, of the LCR. In some embodiments, the posttranscriptional regulatory element is a marmot hepatitis virus posttranscriptional regulatory element (WPRE). In some embodiments, the SV40 polyadenylation signal and / or the SV40 replication initiation site is located at the 3' of the right (3') retroviral LTR.
[0013] In some embodiments, the WPRE is a wild-type WPRE or a mutant WPRE, such as the mutant WPRE described herein. In some embodiments, the wild-type WPRE comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity therewith. In some embodiments, the mutant WPRE comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity therewith.
[0014] In some embodiments, the vector is a lentiviral vector. In some embodiments, the left (5') retroviral LTR is a lentiviral LTR. In some embodiments, the right (3') LTR is a lentiviral LTR. In some embodiments, both the left (5') and right (3') retroviral LTRs are lentiviral LTRs. In some embodiments, the promoter of the left (5') retroviral LTR is replaced with a heterologous promoter. In some embodiments, the right (3') LTR is a self-inactivating (SIN) LTR.
[0015] In some implementations, the vector further comprises one or more (e.g., two or three) of a Psi packaging sequence (Ψ+), a central polypurine bundle / DNA flap (cPPT / FLAP), or a retroviral export element-rev response element (RRE).
[0016] In some embodiments, the vector comprises the nucleotide sequences of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, or nucleotide sequences having at least 85%, 90%, 95%, 98% or 99% sequence identity with them.
[0017] On the other hand, this disclosure is characterized by compositions comprising the carrier described herein and a pharmaceutically acceptable loading agent.
[0018] In another aspect, this disclosure provides cells comprising the vector described herein.
[0019] In some embodiments, the cells are human cells. In some embodiments, the cells are selected from the group consisting of embryonic stem cells, adult stem cells, adult progenitor cells, and differentiated adult cells. In some embodiments, the cells are hematopoietic stem cells or hematopoietic progenitor cells. In some embodiments, the stem cells or progenitor cells are derived from bone marrow, umbilical cord blood, placental blood, or peripheral blood. In some embodiments, the cells are transduced using a vector.
[0020] In another aspect, this disclosure provides compositions comprising the cellular and pharmaceutically acceptable carriers described herein.
[0021] On the other hand, this disclosure provides a method for treating β-thalassemia, comprising administering an effective amount of the cells described herein, or cells transduced with the vector described herein, to a subject in need of such treatment, thereby treating β-thalassemia.
[0022] In some embodiments, the method further includes obtaining cells from a subject. In some embodiments, the method further includes transducing cells using a vector. In some embodiments, the cells are hematopoietic stem cells or hematopoietic progenitor cells.
[0023] In some embodiments, the method further includes administering an effective amount of busulfan and cyclophosphamide to the subject prior to administration of the vector-transduced cells. In some embodiments, busulfan is administered intravenously at a dose of 2 to 5 mg / kg / day, for example, 2.4 to 4.8 mg / kg / day. In some embodiments, busulfan is administered every 6 hours. In some embodiments, cyclophosphamide is administered intravenously at a dose of 30-80 mg / kg / day, for example, 45-65 mg / kg / day. In some embodiments, cyclophosphamide is administered 18 to 30 hours, for example, 24 hours after busulfan administration. In some embodiments, busulfan is administered for 2-4 days, and cyclophosphamide is administered for 1-5 days. In some embodiments, administration of the vector-transduced cells begins 24-72 hours after the completion of cyclophosphamide administration.
[0024] In another aspect, this disclosure provides a method for pre-treating a subject, comprising administering an effective amount of busulfan and cyclophosphamide to the subject prior to administration of a therapy for β-thalassemia. In some embodiments, the therapy for β-thalassemia comprises delivering cells transduced with a vector containing the human β-globin gene, such as the cells described herein, or cells transduced with the vector described herein, to the subject. In some embodiments, busulfan is administered intravenously at a dose of 2 to 5 mg / kg / day, for example, 2.4 to 4.8 mg / kg / day. In some embodiments, busulfan is administered every 6 hours. In some embodiments, cyclophosphamide is administered intravenously at a dose of 30-80 mg / kg / day, for example, 45-65 mg / kg / day. In some embodiments, cyclophosphamide is administered 18 to 30 hours, for example, 24 hours, after busulfan administration. In some embodiments, busulfan is administered for 2-4 days, and cyclophosphamide is administered for 1-5 days. In some embodiments, administration of vector-transduced cells begins 24-72 hours after cyclophosphamide administration. In some embodiments, subjects are pretreated according to the methods described in Examples 9-12.
[0025] In another aspect, this disclosure provides formulations comprising the carrier, buffer, stabilizer and sodium chloride described herein.
[0026] In some implementations, the carrier is in the form of 1x10 8 TU / mL to 1x10 10 It is present at a concentration of TU / mL. In some embodiments, the carrier is in a concentration of 5 x 10⁻⁶. 8 TU / mL to 5x10 9 It is present at a concentration of TU / mL. In some embodiments, the carrier is in a concentration of 5 x 10⁻⁶. 8 TU / mL to 1x10 9 TU / mL, for example 6 x 10 8 TU / mL or 6.2 10 8 It is present at a concentration of TU / mL. In some embodiments, the carrier is at a concentration of 1 x 10⁻⁶. 9 TU / mL to 5x10 9 A concentration of TU / mL is present. In some embodiments, the carrier is at a concentration of 2... 10 9 TU / mL to 3 10 9 TU / mL, for example 2.5 10 9 TU / mL or 2.8 x 10 9 A concentration of TU / mL is present.
[0027] In some embodiments, the buffer is a phosphate buffer, sodium citrate, or PIPES. In some embodiments, the buffer is present at a concentration of 10 mM to 50 mM, for example, 10 mM to 30 mM, 20 mM to 40 mM, 30 mM to 50 mM, or 10 mM to 40 mM. In some embodiments, the buffer is present at a concentration of 10 mM, 20 mM, or 40 mM.
[0028] In some embodiments, the stabilizer comprises a sugar or polyol, such as sucrose, trehalose, sorbitol, inositol, glucose, or dextran. In some embodiments, the stabilizer is present at a concentration of 1% to 5%, for example, 1% to 3%, 2% to 3%, or 1% to 2.5%. In some embodiments, the stabilizer is present at a concentration of 1%, 2%, or 2.5%.
[0029] In some embodiments, sodium chloride is present at concentrations from 50 mM to 200 mM, such as 50 mM to 70 mM, 70 mM to 90 mM, 80 mM to 100 mM, 100 mM to 120 mM, 140 mM to 160 mM, 100 mM to 150 mM, or 50 mM to 150 mM. In some embodiments, sodium chloride is present at concentrations of 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 110 mM, 140 mM, or 150 mM.
[0030] In some embodiments, the formulation comprises the carrier described herein, sodium citrate, sucrose, and sodium chloride. In some embodiments, the carrier is in a 5x10- ratio. 8 TU / mL to 5x10 9 It is present at a concentration of TU / mL, sodium citrate at a concentration of 20 mM to 40 mM, sucrose at a concentration of 1% to 2%, and sodium chloride at a concentration of 100 mM to 150 mM.
[0031] In some implementations, the formulation is any one of the formulations described in Examples 13-14. Attached Figure Description
[0032] Figure 1 A schematic design of an exemplary viral vector construct is depicted.
[0033] Figure 2 A diagram depicting an exemplary lentiviral vector packaging backbone plasmid without the insertion of the gene of interest.
[0034] Figure 3 Depicting Figure 1 The viral vector packaging efficiency of the exemplary viral vector construct shown.
[0035] Figure 4 An illustrative design of another exemplary viral vector construct is depicted.
[0036] Figure 5 This is a graph depicting the VCN values in PBMCs of recipient mice in the mock (untransduced), LV-TH04 (transduced), and positive (wild-type C57BL / 6 cells) groups. Blood samples were collected from recipient mice at 4, 6, and 8 weeks post-bone marrow transplantation.
[0037] Figure 6 This is a graph depicting the chimerism (%) of PBMCs in recipient mice in the mock (untransduced), LV-TH04 (transduced), and positive (wild-type C57BL / 6 cells) groups. Blood samples were collected from recipient mice at 4, 6, and 8 weeks post-bone marrow transplantation.
[0038] Figure 7 This is a series of graphs depicting hemoglobin levels (HGB (g / L); top left), reticulocyte percentage (RET%); top right), hematocrit level (HCT (%); bottom left), and mean corpuscular volume (MCV (fL); bottom right) in recipient mice in the mock (untransduced), LV-TH04 (transduced), and positive (wild-type C57BL / 6 cells) groups. Blood samples were collected at 4, 6, and 8 weeks after bone marrow transplantation in the recipient animals.
[0039] Figure 8 These are a series of chromatograms obtained by HPLC analysis using supernatants collected from cells transduced with LV-TH04 (top chromatogram) or cells without LV-TH04 (bottom chromatogram). The peaks indicate β-globin and α-globin.
[0040] Figure 9 This describes the absolute neutrophil count (10⁻⁶) following the infusion of LV-TH04-transduced hematopoietic stem cells. 9 Figure / L). Subjects PJYU and ZRHA were treated with BU / CY-based myeloablative pretreatment; subject FAZH was treated with BU-based myeloablative pretreatment.
[0041] Figure 10 This describes the platelet count (10) after infusion of LV-TH04-transduced hematopoietic stem cells. 9 Figure / L). Subjects PJYU and ZRHA were treated with BU / CY-based myeloablative pretreatment; subject FAZH was treated with BU-based myeloablative pretreatment.
[0042] Figure 11 This is a graph depicting the loss (%) of lentiviral particles after the formulations described in Table 15 were placed at room temperature for 1 day, at 4°C for 3 days, or subjected to freeze-thaw cycles 3 times.
[0043] Figure 12 It is a graph depicting the lentivirus titer (TU / mL) of the formulations described in Table 16 after being subjected to freeze-thaw conditions 3 times or 9 times.
[0044] Figure 13 This is a graph depicting the lentivirus titer (TU / mL) of the formulations described in Table 17 after being subjected to freeze-thaw conditions three times.
[0045] Figure 14 This is a graph depicting the loss (%) of lentiviral particles after the formulations described in Table 18 were placed at room temperature for 1 day, at 4°C for 3 days, or subjected to freeze-thaw cycles 3 times.
[0046] Figure 15 It is a graph depicting the lentiviral titer (TU / mL) of formulations containing sodium citrate (20 mM), sodium chloride (110 mM), and sucrose (1%) or PBS under control conditions, or after being placed at 4°C for 1 day, at 4°C for 3 days, or at room temperature for 1 day. Invention Details
[0048] Lentiviral vectors, with their host genome integration capabilities, are widely considered promising gene delivery vectors for various genetic diseases caused by the deletion of single gene expression, such as hereditary anemia. Autologous hematopoietic stem cell therapy can be a promising curative treatment for severe hereditary anemia. Essentially, a functional gene encoding a human β-globin peptide chain is introduced ex vivo into a patient's hematopoietic stem cells via lentiviral vector transduction, and the transduced cells are then infused back into the patient. Unaffected by donor availability and the associated risks of transplant cell rejection and / or graft-versus-host disease, the methods described herein can achieve a complete cure for thalassemia with a single treatment.
[0049] The human β-globin gene contains a promoter region, three exons and two introns, a downstream enhancer region, and an endogenous upstream gene expression control region sequence with a DNase I hypersensitive site (HS). The gene's total length exceeds 60,000 base pairs (bp), making it difficult to contain in any gene therapy vector. For decades, scientists have been working to develop relatively small β-globin gene expression cassettes for use in gene therapy.
[0050] However, the commercial production of existing vectors for treating conditions associated with defective human β-globin genes faces numerous challenges. For example, vector productivity is often low, which significantly increases production costs and ultimately drug costs. Furthermore, gene expression efficiency is often not optimized, and viral copy number (VCN) in hematopoietic stem cells (one of the most critical quality attributes) still needs to be significantly improved.
[0051] The nucleic acid constructs, vectors, compositions, cells, and methods described herein can have a variety of beneficial effects, such as: 1) significantly enhanced viral packaging efficiency; 2) more robust and efficient integration of vectors into the target cell genome; 3) achieving better clinical efficacy at lower doses and reducing immunogenicity; 4) higher vector production efficiency and lower production costs; and 5) broad applications, including generating various forms of vectors for gene therapy of hereditary anemia.
[0052] definition
[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0054] As used in this article, the terms “one” and “a” refer to one or more (i.e., at least one) grammatical objects of an article.
[0055] As used herein, the terms “about” or “approximately” when referring to a measurable value (e.g., quantity, duration, etc.) mean that they cover a variation of ±20% or, in some cases, ±10%, or, in some cases, ±5%, or, in some cases, ±1%, or, in some cases, ±0.1% from the specified value, as such variation is appropriate in the context of this disclosure.
[0056] As used in this article, the term "alien" refers to a cell of the same species that is genetically different from the cell being compared.
[0057] As used herein, when referring to two or more parts, the terms "bonded with" or "connected" mean that the part is physically or chemically bonded or connected to another part, directly or via one or more other parts acting as a linker, to form a sufficiently stable structure such that the part remains physically bonded under the conditions of using the structure (e.g., physiological conditions). In some embodiments, the two or more parts are covalently or non-covalently attached, coupled, connected, or tethered. In some embodiments, the bonding is through direct covalent chemical bonding. In other embodiments, the bonding is through sufficiently stable ionic or hydrogen bonds or hybridization-based connectivity such that the bonded or connected entities remain physically bonded.
[0058] As used in this article, the term "autologous" refers to cells derived from the same subject.
[0059] As used herein, the term "carrier" includes any and all solvents, dispersion media, media, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delay agents, buffers, carrier solutions, suspensions, colloids, etc.
[0060] As used herein, the term "complementary" when used to describe a first nucleotide sequence associated with a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing the second nucleotide sequence and form base pairs (e.g., a duplex). In some embodiments, the base pairs are formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains. In some embodiments, complementary polynucleotide or oligonucleotide chains may form base pairs in a Watson-Crick manner or in any other manner that allows for the formation of a duplex. As used herein, the term "complementary" may cover complete complementarity, partial complementarity, or substantially complementarity. "Complete complementarity" means that each nucleotide unit of one polynucleotide or oligonucleotide chain can pair with a base of a nucleotide unit of a second polynucleotide or oligonucleotide chain. "Substantially complementarity" means that the two polynucleotide or oligonucleotide chains are completely complementary, or they can form one or more, but typically no more than 1, 2, 3, 4, or 5 mismatched or non-complementary base pairs when hybridizing to form a duplex, while still retaining the ability to hybridize under the conditions most relevant to their final application.
[0061] As used herein, the terms “control element,” “regulatory control element,” or “regulatory sequence” refer to an element used to express a gene or gene product. Exemplary “control elements,” “regulatory control elements,” or “regulatory sequences” include, but are not limited to, promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, replication initiation sites, internal ribosome entry sites (“IRES”), enhancers, etc., which enable the replication, transcription, and translation of coding sequences in recipient cells.
[0062] As used herein, the term "effective amount" refers to the amount of a compound, formulation, material, or composition that achieves a particular biological outcome. In some embodiments, the effective amount is a therapeutically effective amount. In some embodiments, the effective amount of a pharmaceutical agent is an amount sufficient to achieve a beneficial or desired outcome (e.g., clinical outcome). For example, in the context of administering a pharmaceutical agent to treat a condition, the effective amount of the agent is, for example, an amount sufficient to treat the condition compared to a response obtained without administering the agent.
[0063] As used herein, the term "enhancer" refers to a DNA segment containing a sequence capable of providing enhanced transcription and, in some cases, functioning independently of its orientation relative to another control sequence. Enhancers can function synergistically or cumulatively with promoters and / or other enhancer elements.
[0064] As used herein, the term "output element" refers to a cis-acting posttranscriptional regulatory element that regulates the transport of RNA transcripts from the cell nucleus to the cytoplasm. Examples of RNA output elements include, but are not limited to, human immunodeficiency virus (HIV) rev response elements (RREs) and hepatitis B virus posttranscriptional regulatory elements (HPREs). In some embodiments, the RNA output element is located within the 3' UTR of a gene and is inserted as one or more copies.
[0065] As used herein, the term “expression” refers to the transcription and / or translation of a specific nucleotide sequence. Expression can typically include one or more of the following: (1) the generation of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of RNA transcripts (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) the translation of RNA into a polypeptide or protein; and (4) post-translational modifications of a polypeptide or protein.
[0066] As used herein, the term “expression control sequence” refers to a polynucleotide sequence containing one or more promoters, enhancers or other transcriptional control elements or combinations thereof that can direct, increase, regulate or control the transcription or expression of operablely linked polynucleotides.
[0067] As used herein, the term "FLAP element" refers to a nucleic acid whose sequence includes a central polypurine bundle and a central termination sequence (cPPT and CTS) of a retrovirus (e.g., HIV-1 or HIV-2). Without wishing to be theoretically bound, it is believed that during retroviral reverse transcription, the central initiation at the central polypurine bundle (cPPT) and the central termination at the central termination sequence (CTS) of the positive-strand DNA result in the formation of a triple-stranded DNA structure: a central DNA flap. The central DNA flap can act as a cis-activity determinant of retroviral genome nuclear input and / or can increase viral titer. Exemplary FLAP elements are described, for example, in Zennou, et al., 2000, Cell, 101:173 and U.S. Patent No. 6,682,907, the contents of which are incorporated herein by reference in their entirety. In embodiments, the retroviral or lentiviral vector backbone described herein includes one or more FLAP elements upstream or downstream of a heterologous gene of interest in the vector. For example, transfer plasmids may include FLAP elements. In the implementation scheme, the viral vector described herein comprises a FLAP element isolated from HIV-1.
[0068] As used herein, the term "hematopoietic stem cell" or "HSC" refers to pluripotent stem cells that produce all types of blood cells in an organism, including myeloid (e.g., monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes / platelets, dendritic cells) and lymphoid (e.g., T cells, B cells, NK cells) as well as other blood cell types known in the art.
[0069] As used herein, the term "host cell" refers to a cell that is transfected, infected, or transduced in vivo, in vitro, or with a vector or polynucleotide. Host cells may include packaging cells, production cells, and cells infected with viral vectors. In some embodiments, the term "target cell" is used interchangeably with host cell and refers to a transfected, infected, or transduced cell of the desired cell type.
[0070] As used herein, the term "identity" refers to the subunit sequence identity between two polymer molecules, such as two nucleic acid molecules (e.g., two DNA molecules and / or two RNA molecules) and / or two polypeptide molecules. Two molecules are considered identical at that position when the subunit positions of both are occupied by the same monomeric subunit. The percentage of identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number and length of vacancies, which can be incorporated for optimal alignment of the two sequences. For example, for optimal comparison purposes, the percentage of identity between two sequences can be calculated by aligning the two sequences (e.g., vacancies can be introduced in one or both of the first and second sequences for optimal alignment, and dissimilar sequences can be ignored for comparison purposes). In some embodiments, for comparison purposes, the length of the aligned sequence is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of the length of the reference sequence. The sequences are identical at that position when a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence. The comparison of sequences and the determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms known in the art.
[0071] As used herein, the term "isolated" means material that is substantially or substantially free of components typically associated with it in its natural state (e.g., polynucleotides, polypeptides, cells). In some embodiments, the terms "obtained" or "derived" are used interchangeably with the term "isolated." For example, as used herein, "isolated polynucleotide" refers to a polynucleotide that has been purified from a sequence flanking it in its natural state, such as a DNA fragment that has been removed from a sequence typically adjacent to that fragment.
[0072] As used in this article, the term "lentiviral vector" refers to a viral vector containing structural or functional elements or portions thereof that are primarily derived from lentiviruses.
[0073] As used herein, the term "lentivirus" refers to a genus of retroviruses. Exemplary lentiviruses include, but are not limited to, HIV (human immunodeficiency virus, such as HIV type 1 and HIV type 2), bovine immunodeficiency virus (BIV), caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), simian immunodeficiency virus (SIV), and visna-maedi virus (VMV). In this embodiment, the lentivirus is HIV.
[0074] As used herein, the term "long terminal repeat" or "LTR" refers to a base-pair domain located at the end of retroviral DNA that is a direct repeat sequence containing U3, R, and U5 regions in its natural sequence context. Without being bound by theory, it is considered that in some implementations, the LTR provides essential functions for retroviral gene expression (e.g., initiation, activation, and polyadenylation of gene transcripts) and viral replication. The LTR contains numerous regulatory signals, such as transcriptional control elements, polyadenylation signals, and sequences required for viral genome replication and integration. The LTR typically comprises U3, R, and U5 regions and is located at both the 5' and 3' ends of the viral genome. The U3 region contains enhancer and promoter elements. The U5 region is the sequence between the primer binding site and the R region and contains polyadenylation sequences. The R (repeat) region is flanked by the U3 and U5 regions. Adjacent to the 5' LTR are sequences necessary for genome reverse transcription (tRNA primer binding site) and sequences necessary for the efficient packaging of viral RNA into particles (Psi site).
[0075] As used herein, the term "nucleic acid cassette" refers to a sequence within a vector that can express RNA and subsequently a polypeptide. For example, a nucleic acid cassette may contain a gene of interest and / or one or more expression control sequences. A vector may contain one, two, three, four, five, or more nucleic acid cassettes. The nucleic acid cassettes may be oriented in position and sequence within the vector such that the nucleic acids within the cassette can be transcribed into RNA and, when necessary, translated into a protein or polypeptide, undergo appropriate post-translational modifications required for activity in transformed cells, and translocate to the appropriate compartment for biological activity by targeting the appropriate intracellular compartment or secreting into the extracellular compartment. In some embodiments, the 5' and 3' ends of the nucleic acid cassette are adjusted for insertion into the vector, for example, having restriction endonuclease sites at each end. In some embodiments, the nucleic acid cassette contains a polynucleotide sequence that can be used to treat or prevent a condition. Typically, the cassette can be removed and inserted as a single unit into a plasmid or viral vector.
[0076] As used herein, the term "operably linked" refers to a functional link between two or more molecules, constructs, transcripts, entities, parts, etc. In some implementations, "operably linked" refers to a functional link between a regulatory sequence and a heterologous nucleic acid sequence, resulting in the expression of the latter. For example, the first nucleic acid sequence is operably linked to the second nucleic acid sequence when they are in a functional relationship. For example, the promoter is operably linked to the coding sequence if it affects the transcription or expression of the coding sequence. Operatically linked DNA sequences can be adjacent to each other and, for example, in cases where it is necessary to link two protein-coding regions, can be within the same reading frame.
[0077] As used herein, the term “or” means one, two, or any combination of the alternatives and is used interchangeably with the term “and / or” unless the context clearly indicates otherwise.
[0078] As used herein, the term "packaging cell line" refers to a cell line that does not contain packaging signals but stably or transiently expresses viral structural proteins and replicases (e.g., gag, pol, and env) necessary for the proper packaging of viral particles.
[0079] As used herein, the term "packaging signal" or "packaging sequence" refers to the sequence located within the retroviral genome required for the insertion of viral RNA into the viral capsid or particle. Several retroviral vectors use a minimal packaging signal (also known as a psi[Ψ] sequence) required for viral genome capsidation. Therefore, in some embodiments, the terms "packaging sequence," "packaging signal," "psi," and the symbol "Ψ" are used interchangeably to describe the non-coding sequence required for capsidation of the retroviral RNA strand during viral particle formation.
[0080] As used herein, the term “pharmaceutical acceptable” refers to molecular entities and compositions that do not produce allergic reactions or similar adverse reactions when administered to humans.
[0081] As used herein, the term “pharmaceuticalally acceptable carrier” includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption delay agents, including pharmaceutically acceptable cell culture media.
[0082] As used in this article, the term "prevention" means that if a subject receives antibody molecules, the subject (e.g., a person) is less likely to develop a condition such as myeloma.
[0083] As used in this article, the term "promoter" refers to the recognition site of a polynucleotide (DNA or RNA) that RNA polymerase binds to.
[0084] As used herein, the term "promoter / enhancer" refers to a DNA fragment containing a sequence that provides both promoter and enhancer functions.
[0085] As used in this article, the term "preventive effective quantity" refers to the quantity that effectively achieves the desired preventive effect or outcome.
[0086] As used herein, the term "retroviral vector" refers to a viral vector containing structural or functional elements or portions thereof that are primarily derived from retroviruses.
[0087] As used herein, the term "R region" refers to the region within the LTR that begins at the origin of the capping group (i.e., the origin of transcription) and ends before the origin of the poly A sequence. The R region is also defined as flanked by the U3 and U5 regions. Without wishing to be bound by theory, it is thought that in some implementations, the R region plays a role in allowing nascent DNA to be transferred from one end of the genome to the other during reverse transcription.
[0088] As used herein, the term "retrovirus" refers to an RNA virus that reverse-transcribes its genomic RNA into DNA and subsequently integrates the DNA into the host genome. Exemplary retroviruses include, but are not limited to, lentiviruses, oncoretroviruses, and foam viruses. Exemplary oncoretroviruses include, but are not limited to, feline leukemia virus (FLV), Friend mouse leukemia virus, gibberish leukemia virus (GaLV), Harvey mouse sarcoma virus (HaMuSV), Moloney mouse leukemia virus (M-MuLV), Moloney mouse sarcoma virus (MoMSV), mouse mammary tumor virus (MuMTV), mouse stem cell virus (MSCV), and Rous sarcoma virus (RSV). In this embodiment, the retrovirus is a lentivirus.
[0089] As used herein, the term "thalassemia" refers to a hereditary condition characterized by a defect in hemoglobin production. The term "thalassemia" encompasses hereditary anemia caused by mutations affecting hemoglobin synthesis. Therefore, the term includes any symptomatic anemia caused by thalassemia conditions such as severe or β-thalassemia, major thalassemia, intermediate thalassemia, and α-thalassemia such as hemoglobin H disease. Examples of thalassemia include α-thalassemia and β-thalassemia. α-thalassemia is caused by the deletion of one or more genes in the globin chain. β-thalassemia is caused by mutations in the β-globin chain and can occur in a major or minor form. In the major form of β-thalassemia, children are usually normal at birth but develop anemia in the first year of life. Mild β-thalassemia produces microcytes.
[0090] As used in this article, the term "therapeutic effective amount" refers to the amount that effectively achieves the desired therapeutic effect or outcome.
[0091] As used herein, the terms "self-inactivating vector" or "SIN vector" refer to replication-defective vectors (e.g., retroviral or lentiviral vectors) in which the right 3'LTR enhancer-promoter region, referred to as the U3 region, has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. It is not intended to be theoretically correct to assume that during viral replication, the right 3'LTR U3 region serves as a template for the left 5'LTR U3 region; therefore, viral transcripts cannot be produced without a functional U3 enhancer-promoter. In some embodiments, the 3'LTR is modified such that the U5 region is replaced, for example, with a poly(A) sequence.
[0092] As used herein, the term “stem cell” refers to an undifferentiated cell that is capable of (1) long-term self-renewal or of generating at least one identical copy of the original cell, (2) differentiates at the single-cell level into multiple (and in some cases only one) specialized cell types, and (3) functionally regenerates tissues in vivo.
[0093] As used herein, the term "subject" is intended to include both humans and non-human animals. In some embodiments, the subject is a human subject, such as a human patient who has the condition described herein or is at risk of having the condition described herein. The term "non-human animal" includes mammals and non-mammals, such as non-human primates. The vectors, cells, and compositions described herein are suitable for treating human patients with the condition described herein. Patients with the condition described herein include, for example, patients who have developed the condition described herein but are (at least temporarily) asymptomatic, patients who have exhibited symptoms of the condition described herein, and patients who have a condition related to or associated with the condition described herein.
[0094] As used herein, the term "transactivation response" or "TAR" refers to a genetic element located in the R region of a retroviral or lentiviral LTR. Without wishing to be bound by theory, it is understood that in some embodiments, this element interacts with a retroviral or lentiviral transactivator (tat) genetic element to enhance viral replication. In some embodiments, this element is not essential, where the U3 region of the 5' LTR is replaced with a heterologous promoter. In embodiments described herein, the viral vector contains a TAR element.
[0095] As used herein, in some embodiments, the term "treatment" means that a subject (e.g., a person) suffering from and / or experiencing symptoms of a condition, when treated, suffers from less severe symptoms and / or recovers more quickly than when never treated. Treatment may partially or completely reduce, improve, alleviate, suppress, or decrease one or more effects or symptoms, features, and / or causes of the condition and / or reduce its incidence, and optionally delay its onset. In some embodiments, the treatment recipient is a subject who does not exhibit certain signs of the condition, and / or a subject who exhibits only early signs of the condition. In some embodiments, the treatment recipient is a subject exhibiting one or more definitive signs of the condition. In some embodiments, the treatment recipient is a subject diagnosed with the condition.
[0096] As used herein, the term "variant" refers to a polypeptide that is distinguished from a reference polypeptide by the addition, deletion, truncation, and / or substitution of at least one amino acid residue while retaining its biological activity. In some embodiments, polypeptide variants are distinguished from a reference polypeptide by one or more substitutions, which may be conserved or non-conserved, as known in the art.
[0097] As used herein, the term "vector" refers to a nucleic acid molecule used as a medium to transfer another nucleic acid molecule into a host cell. In embodiments, the transferred nucleic acid molecule is inserted into a vector nucleic acid molecule. The vector may include a sequence that directs autonomous replication within the cell, or may include a sequence sufficient to allow integration into the host cell genome. Exemplary vectors include, but are not limited to, viral vectors, plasmids (e.g., DNA plasmids or RNA plasmids), transposons, granules, and bacterial artificial chromosomes. Exemplary viral vectors include, but are not limited to, retroviral vectors (e.g., replication-defective retroviral vectors) and lentiviral vectors.
[0098] As used herein, the term "viral vector" refers to a nucleic acid molecule (e.g., a plasmid) that includes one or more virus-derived nucleic acid elements that facilitate the transfer of the nucleic acid molecule into a cell, the integration of the nucleic acid molecule into the cellular genome, or the delivery of the nucleic acid molecule into a viral particle.
[0099] Nucleic acid constructs and vectors
[0100] This disclosure provides nucleic acid constructs or vectors (e.g., viral vectors) containing the human β-globin gene or a functional fragment thereof.
[0101] In some embodiments, the sequence of the human β-globin gene includes exon 1, intron 1, exon 2, intron 2, and exon 3. In some embodiments, the sequence of the human β-globin gene is based on the Ensemble database gene: HBB (ENSG00000244734) transcript: HBB-201 (ENST00000335295.4).
[0102] In some embodiments, the nucleic acid construct or vector contains regulatory control elements. In some embodiments, the nucleic acid construct or vector contains expression control sequences. In some embodiments, the nucleic acid construct or vector contains a promoter or promoter / enhancer.
[0103] In some embodiments, the human β-globin gene includes a human β-globin promoter. In some embodiments, the human β-globin gene does not include a human β-globin promoter. In some embodiments, the human β-globin promoter is located approximately 250 to approximately 275 bp (e.g., 268 bp) upstream of exon 1 of the human β-globin promoter. In some embodiments, the human β-globin gene includes a human β-globin 3'-enhancer. In some embodiments, the human β-globin 3'-enhancer is located approximately 850 bp to approximately 900 bp (e.g., 878 bp) downstream of exon 3 of the human β-globin gene. In some embodiments, the human β-globin gene includes one or more (e.g., 2 or 3) wild-type exons. In some embodiments, the human β-globin gene includes one or more (e.g., 2 or 3) codon-optimized exons. In some embodiments, the human β-globin gene includes one or more wild-type introns. In some embodiments, the human β-globin gene includes a wild-type intron 2. In some embodiments, the human β-globin gene includes one or more truncated introns. In some embodiments, the human β-globin gene includes a truncated intron 2. In some embodiments, the human β-globin gene includes wild-type exon 2. In some embodiments, the human β-globin gene includes exon 2 encoding a threonine-to-glutamine mutation (T87Q) at codon 87. In some embodiments, the human β-globin gene includes the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or nucleotide sequences having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with them, or any combination thereof. In some implementations, the nucleic acid construct or vector comprises a nucleotide sequence complementary to the following nucleotide sequences: SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with them, or any combination thereof.
[0104] In some embodiments, the human β-globin gene encodes a human β-globin variant. For example, the variant may include an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with the wild-type human β-globin amino acid sequence.
[0105] In some embodiments, the nucleic acid construct or vector comprises a retroviral (e.g., lentiviral) LTR. In some embodiments, the nucleic acid construct or vector comprises a left (5') retroviral LTR and a right (3') retroviral LTR. In some embodiments, the right (3') LTR is a self-inactivating (SIN) LTR. In some embodiments, the retroviral LTR is unmodified, e.g., a wild-type retroviral LTR. In some embodiments, the retroviral LTR is modified, e.g., comprising one or more substitutions, insertions, and / or deletions. In some embodiments, the left (5') retroviral LTR is replaced with a heterologous promoter (e.g., a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a thymidine kinase promoter, or a simian virus 40 (SV40) promoter). In some embodiments, the right (3') retroviral LTR is deleted. In some embodiments, the retroviral LTR is a lentiviral LTR.
[0106] In some embodiments, the nucleic acid construct or vector contains the upstream locus control region (LCR) of the human β-globin gene. In some embodiments, the upstream locus control region (LCR) contains one or more (e.g., two or three) truncated DNase I hypersensitive sites, HS2, HS3, and HS4, of the LCR.
[0107] In some implementations, the nucleic acid construct or vector contains a cis-acting post-transcriptional regulatory element. In some implementations, the post-transcriptional regulatory element is a marmot hepatitis virus post-transcriptional regulatory element (WPRE).
[0108] In some embodiments, the nucleic acid construct or vector contains a polyadenylation signal and / or a replication origin site. In some embodiments, the polyadenylation signal is the SV40 polyadenylation signal. In some embodiments, the replication origin site is the SV40 replication origin site. The polyadenylation signal and / or replication origin site may be located at the 3' of the right (3') retroviral LTR.
[0109] In some implementations, the nucleic acid construct or vector contains one or more of the following (e.g., two, three, four, or all): a) a left (5') retroviral LTR; b) a human β-globin gene; c) a locus control region (LCR) upstream of the human β-globin gene; d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) an SV40 polyadenylation signal and / or an SV40 replication initiation site.
[0110] In some implementations, the nucleic acid construct or vector contains a nucleic acid cassette containing one or more (e.g., two, three, four, or all) of the following: a) a left (5') retroviral LTR; b) a human β-globin gene; c) a locus control region (LCR) upstream of the human β-globin gene; d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) an SV40 polyadenylation signal and / or an SV40 replication initiation site.
[0111] In some implementations, the nucleic acid construct or vector further comprises one or more (e.g., two or three) of a Psi packaging sequence (Ψ+), a central polypurine bundle / DNA flap (cPPT / FLAP), or a retroviral export element-rev response element (RRE).
[0112] In some implementations, the nucleic acid construct or vector comprises nucleotide sequences SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or nucleotide sequences having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with them. In some implementations, the nucleic acid construct or vector comprises a nucleotide sequence complementary to the following nucleotide sequences: SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with them.
[0113] In some implementations, the nucleic acid construct or vector further includes a truncated erythrocyte expression control sequence.
[0114] In some implementations, the lentiviral nucleic acid construct or vector is an HIV nucleic acid construct or vector. For example, the lentiviral nucleic acid construct or vector may be derived from human immunodeficiency virus-1 (HIV-1), human immunodeficiency virus-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana virus (JDV), equine infectious anemia virus (EIAV), caprine arthritis encephalitis virus (CAEV), etc.
[0115] The nucleic acid constructs or vector components described herein can be operatively linked to allow for the expression of human β-globin. The vectors described herein can be self-inactivating vectors.
[0116] Large-scale viral particle production is often necessary to achieve reasonable viral titers. Viral particles can be produced by transfecting transfer nucleic acid constructs or vectors into packaging cell lines containing viral structures and / or accessory genes, such as gag, pol, env, tat, rev, vif, vpr, vpu, vpx, or nef genes or other retroviral genes.
[0117] Pharmaceutical compositions and formulations
[0118] This disclosure provides pharmaceutical compositions comprising the nucleic acid constructs or vectors described herein or the cells described herein, and pharmaceutically acceptable carriers.
[0119] In some embodiments, pharmaceutically acceptable carriers are suitable for parenteral administration, such as intravascular (intravenous or intra-arterial), intraperitoneal, or intramuscular administration. Exemplary pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for preparing sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is well known in the art.
[0120] The compositions disclosed herein may comprise, for example, one or more polypeptides, polynucleotides, carriers containing them, or transduced cells, formulated in a pharmaceutically acceptable or physiologically acceptable solution for administration alone or in combination with one or more other therapeutic agents or forms of treatment to cells or animals. The compositions disclosed herein may also be administered in combination with other pharmaceutical agents, including but not limited to cytokines, growth factors, hormones, small molecules, or other pharmaceutically active agents.
[0121] In the pharmaceutical compositions disclosed herein, the formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, as is the development of suitable dosing and treatment regimens for the use of the particular compositions described herein in a variety of treatment regimens, including but not limited to parenteral, intravenous, and intramuscular administration and formulation.
[0122] In all cases, the form should be sterile and should be in a fluid form readily injectable. It should be stable under production and storage conditions and should be preserved against contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants. Prevention of microbial action can be facilitated by various antibacterial and antifungal agents.
[0123] For example, for parenteral administration in aqueous solutions, the solution should be appropriately buffered if necessary, and the liquid diluent should first be isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Some dosage variation will inevitably occur depending on the condition of the subject being treated. In any case, the person responsible for administration can determine the appropriate dosage for the individual subject.
[0124] Sterile injectable solutions can be prepared by incorporating the desired amount of the active compound with various other ingredients listed above (as needed) into a suitable solvent, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating various sterile active ingredients into a sterile medium containing an alkaline dispersion medium and the desired other ingredients from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preferred methods of preparation include vacuum drying and freeze-drying techniques, which produce powders from previously sterile filtered solutions containing the active ingredient plus any other desired ingredients.
[0125] The compositions disclosed herein can be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed from the free amino groups of proteins) and are formed from inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed from free carboxyl groups can also be derived from inorganic bases, such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc. After formulation, the solution can be administered in a manner compatible with dosage forms and at a therapeutically effective amount. The formulation is readily available for administration in various dosage forms, such as injectable solutions, drug-release capsules, etc.
[0126] The compositions or formulations described herein may comprise cells in contact with any number of peptides, polynucleotides, and small molecules as described herein.
[0127] In another aspect, this disclosure provides compositions comprising a therapeutically effective amount of one or more polynucleotides or polypeptides as described herein, formulated with one or more pharmaceutically acceptable carriers (additives) and / or diluents (e.g., pharmaceutically acceptable cell culture media).
[0128] In another aspect, this disclosure provides formulations or compositions suitable for delivering viral vector systems (including, but not limited to, retroviral (e.g., lentiviral) vectors) (e.g., virus-mediated transduction).
[0129] Exemplary formulations for ex vivo delivery include, but are not limited to, the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (e.g., lipid-mediated transfection).
[0130] Therapeutic uses
[0131] The nucleic acid constructs, vectors, compositions, and cells described herein can be used in methods for treating or preventing thalassemia (e.g., β-thalassemia).
[0132] In some embodiments, the vector is administered, for example, by direct in vivo injection into the cells, tissues, or organs of a subject requiring gene therapy. In some embodiments, cells are transduced in vitro or ex vivo using the nucleic acid constructs or vectors described herein, and optionally expanded ex vivo. The transduced cells are then administered to the subject requiring gene therapy. Cells suitable for transduction or administration in the methods described herein include, but are not limited to, stem cells, progenitor cells, and differentiated cells. In some embodiments, the transduced cells are hematopoietic stem cells.
[0133] In some embodiments, the transduced cells are, for example, hematopoietic stem cells and / or progenitor cells isolated from bone marrow, umbilical cord blood, or peripheral circulation.
[0134] Hematopoietic stem cells or pluripotent cells can be identified based on certain phenotypic or genotypic markers known in the art.
[0135] On the other hand, this disclosure provides a method for treating a condition. The method comprises administering an effective amount of the nucleic acid construct or vector described herein, or cells (e.g., hematopoietic stem cells or progenitor cells) transduced with the nucleic acid construct or vector described herein, to a subject in need (e.g., a human subject), thereby treating the condition. In some embodiments, the effective amount is a therapeutically effective amount. In some embodiments, the effective amount is a preventatively effective amount.
[0136] In some embodiments, the condition is associated with a defective β-globin gene. In some embodiments, the condition is thalassemia (e.g., β-thalassemia). In some embodiments, the method further includes obtaining cells (e.g., hematopoietic stem cells or pluripotent cells) from the subject. In some embodiments, the method further includes transducing the cells (e.g., hematopoietic stem cells or pluripotent cells) from the subject using the nucleic acid constructs or vectors described herein. In some embodiments, the method further includes isolating the transduced cells. In some embodiments, the method further includes administering a second therapeutic agent or form of treatment to the subject.
[0137] On the other hand, this disclosure provides a method for providing transduced cells. The method includes administering cells (e.g., hematopoietic stem cells or progenitor cells) transduced using the nucleic acid constructs or vectors described herein to a subject in need (e.g., a human subject).
[0138] On the other hand, this disclosure provides a method for treating hemoglobinopathies. The method includes administering, to a subject in need (e.g., a human subject), the nucleic acid construct or vector described herein, or cells (e.g., hematopoietic stem cells or progenitor cells) transduced using the vector described herein.
[0139] On the other hand, this disclosure provides a method for selectively amplifying red blood cell counts. This method includes administering, to a subject in need (e.g., a human subject), the nucleic acid construct or vector described herein, or cells (e.g., hematopoietic stem cells or progenitor cells) transduced with the nucleic acid construct or vector described herein.
[0140] On the other hand, this disclosure provides a method for increasing the ratio of red blood cells or erythrocytes to white blood cells or leukocytes in a subject. This method includes administering the nucleic acid construct or vector described herein, or cells (e.g., hematopoietic stem cells or progenitor cells) transduced with the nucleic acid construct or vector described herein.
[0141] In some embodiments, the transduced cells are administered intravenously to the subject. In some embodiments, the transduced cells are administered at a concentration of approximately 1 x 102 5 To approximately 1x10 8 One cell, for example, about 1 x 10 6 To approximately 1x10 7 One cell, approximately 1x10 6 To approximately 1x10 8 One cell, approximately 1x10 7 To approximately 1x10 8 One cell, approximately 1x10 5 To approximately 1x10 7 One cell, or approximately 1 x 10 5 To approximately 1x106 A dose of individual cells is administered to the subject. In some implementations, the transduced cells are administered as a single dose.
[0142] List of implementation plans
[0143] 1. A carrier, comprising:
[0144] a) Left (5') retroviral LTR;
[0145] b) Human β-globin gene;
[0146] c) Control region (LCR) of the upstream locus of the human β-globin gene;
[0147] d) Cis-acting posttranscriptional regulatory elements;
[0148] e) Right (3') retroviral LTR; and
[0149] f) Cis-acting elements: SV40 polyadenylation signal and / or SV40 replication initiation site.
[0150] 2. The vector of implementation scheme 1, wherein the human β-globin gene includes exon 1, intron 1, exon 2, intron 2 and exon 3.
[0151] 3. The vector of implementation scheme 1 or 2, wherein the human β-globin gene contains the human β-globin promoter.
[0152] 4. The vector of implementation scheme 3, wherein the human β-globin gene contains exon 1, and the human β-globin promoter is located 268 bp upstream of exon 1.
[0153] 5. The vector of any one of the implementation schemes 1-3, wherein the β-globin gene contains the human β-globin 3'-enhancer.
[0154] 6. The vector of implementation scheme 5, wherein the human β-globin gene contains exon 3, and the human β-globin 3'-enhancer is located 878 bp downstream of exon 3.
[0155] 7. A vector of any one of implementation schemes 1-6, wherein the human β-globin gene contains wild-type exons or codon-optimized exons.
[0156] 8. A vector of any one of the implementation schemes 1-7, wherein the human β-globin gene contains wild-type intron 2 or truncated intron 2.
[0157] 9. A vector of any one of embodiments 1-8, wherein the human β-globin gene contains wild-type exon 2, or exon 2 encoding a threonine-to-glutamine mutation (T87Q) at codon 87.
[0158] 10. A vector of any one of implementation schemes 1-9, wherein the upstream locus control region (LCR) contains a truncated DNaseI hypersensitive site, HS2, HS3 and HS4.
[0159] 11. A vector according to any one of the implementation schemes 1-10, wherein the post-transcriptional regulatory element is a marmot hepatitis virus post-transcriptional regulatory element (WPRE).
[0160] 12. The vector of embodiment 11, wherein the WPRE is a wild-type WPRE or a mutated WPRE, such as a WPRE containing one or more of the mutations described herein.
[0161] 13. The vector of embodiment 12, wherein the wild-type WPRE contains the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least 80%, 85%, 90%, 95% or 99% identity with it.
[0162] 14. The vector of embodiment 12, wherein the mutated WPRE comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 80%, 85%, 90%, 95% or 99% identity with it.
[0163] 15. A vector of any one of embodiments 1-14, wherein the SV40 polyadenylation signal and / or the SV40 replication origin site is located 3' downstream of the right (3') retroviral LTR.
[0164] 16. The vector of any one of embodiments 1-15, wherein the human β-globin gene comprises one, two, or all of the following nucleotide sequences: nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or nucleotide sequences having at least 80%, 85%, 90%, 95%, or 99% identity with them.
[0165] 17. The vector of any one of the implementation schemes 1-16 is a lentiviral vector.
[0166] 18. The vector of any one of the implementation schemes 1-17, wherein the left (5') retroviral LTR, the right (3') retroviral LTR, or both are lentiviral LTRs.
[0167] 19. A vector of any of embodiments 1-18, wherein the right (5')LTR contains a promoter replaced by a heterogeneous promoter.
[0168] 20. The carrier of any one of the implementation schemes 1-19, wherein the right (3')LTR is a self-inactivated (SIN)LTR.
[0169] 21. A vector according to any one of embodiments 1-20, further comprising one or more of a Psi packaging sequence (Ψ+), a central polypurine bundle / DNA flap (cPPT / FLAP), or a retroviral output element-rev response element (RRE).
[0170] 22. The vector of any one of embodiments 1-21, comprising the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, or a nucleotide sequence having at least 80%, 85%, 90%, 95% or 99% identity with it.
[0171] 23. A composition comprising the carrier of embodiment 1 and a pharmaceutically acceptable loading agent.
[0172] 24. Human cells transduced using a vector according to any one of embodiments 1-22.
[0173] 25. The cells of implementation scheme 24 are embryonic stem cells, adult stem cells, adult progenitor cells, or differentiated adult cells.
[0174] 26. The cells in implementation scheme 24 are hematopoietic stem cells or hematopoietic progenitor cells.
[0175] 27. The cells of implementation scheme 26, wherein hematopoietic stem cells or hematopoietic progenitor cells are obtained from bone marrow, umbilical cord blood, placental blood or peripheral blood.
[0176] 28. A composition comprising cells transduced with a vector of any one of embodiments 1-22 and a pharmaceutically acceptable carrier.
[0177] 29. A method for treating β-thalassemia, comprising administering to a subject in need an effective amount of cells transduced by a vector of any one of embodiments 1-22, thereby treating β-thalassemia.
[0178] 30. The method of implementation scheme 29, which further includes obtaining cells from a subject.
[0179] 31. The method in implementation plan 29 or 30, which further includes transducing cells with a vector.
[0180] 32. The method of any one of implementation schemes 29-31, wherein the cells are hematopoietic stem cells or hematopoietic progenitor cells.
[0181] 33. The method of any one of embodiments 29-32, further comprising administering an effective amount of busulfan and cyclophosphamide to the subject prior to administering the vector-transduced cells to the subject.
[0182] 34. The method of implementation scheme 33, wherein busulfan is administered intravenously at a dose of 2 to 5 mg / kg / day, for example, 2.4 to 4.8 mg / kg / day.
[0183] 35. The method of implementation scheme 33 or 34, wherein cyclophosphamide is administered intravenously at a dose of 30-80 mg / kg / day, for example, 45-65 mg / kg / day.
[0184] 36. The method of any one of embodiments 33-35, wherein cyclophosphamide is applied 18 to 30 hours, for example 24 hours, after the application of busulfan.
[0185] 37. The method of any one of implementation schemes 33-36, wherein busulfan is applied for 2-4 days and cyclophosphamide is applied for 1-5 days.
[0186] 38. The method of any one of 33-37, wherein the administration of vector-transduced cells begins 24-72 hours after the completion of cyclophosphamide administration.
[0187] 39. A formulation comprising a carrier, a buffer, a stabilizer and sodium chloride as described in any one of embodiments 1-22.
[0188] 40. The formulation of embodiment 39, wherein the carrier is in the form of 1x10 8 TU / mL to 1x10 10 A concentration of TU / mL is present.
[0189] 41. The formulation of embodiment 40, wherein the carrier is in a concentration of 5 x 10⁻⁶. 8 TU / mL to 5x10 9 A concentration of TU / mL is present.
[0190] 42. The formulation according to any one of embodiments 39-41, wherein the carrier is 5 x 10 8 TU / mL to 1x10 9 TU / mL, for example 6 x 10 8 A concentration of TU / mL is present.
[0191] 43. The formulation of any one of embodiments 39-42, wherein the buffer is a phosphate buffer, sodium citrate or PIPES.
[0192] 44. The formulation of any one of embodiments 39-43, wherein the buffer is present at a concentration of 10 mM to 50 mM, for example 10 mM to 30 mM, 20 mM to 40 mM, 30 mM to 50 mM or 10 mM to 40 mM.
[0193] 45. The formulation of any one of embodiments 39-44, wherein the buffer is present at a concentration of 10 mM, 20 mM or 40 mM.
[0194] 46. A formulation according to any one of embodiments 39-45, wherein the stabilizer comprises a sugar or polyol, such as sucrose, trehalose, sorbitol, inositol, glucose or dextran.
[0195] 47. The formulation of any one of embodiments 39-46, wherein the stabilizer is present at a concentration of 1% to 5%, for example 1% to 3%, 2% to 3% or 1% to 2.5%.
[0196] 48. The formulation of any one of embodiments 39-47, wherein the stabilizer is present at a concentration of 1%, 2% or 2.5%.
[0197] 49. The formulation of any one of embodiments 39-48, wherein sodium chloride is present at a concentration of 50 mM to 200 mM, for example 50 mM to 70 mM, 70 mM to 90 mM, 80 mM to 100 mM, 100 mM to 120 mM, 140 mM to 160 mM or 50 mM to 150 mM.
[0198] 50. The formulation of any one of embodiments 39-49, wherein sodium chloride is present at a concentration of 50 mM, 60 mM, 80 mM, 90 mM, 110 mM or 150 mM.
[0199] 51. A formulation according to any one of embodiments 39-50, comprising the carrier of embodiment 1, sodium citrate, sucrose and sodium chloride.
[0200] 52. The formulation of embodiment 51, wherein the carrier comprises 5 x 10 8 TU / mL to 5x10 9 The product is present at a concentration of TU / mL, sodium citrate at a concentration of 20 mM to 40 mM, sucrose at a concentration of 1% to 2%, and sodium chloride at a concentration of 100 mM to 150 mM. Example
[0201] Example 1. Design of a lentiviral vector for the human β-globin gene
[0202] like Figure 1As shown, three vectors, P002, P005, and P006, were designed, incorporating the post-transcriptional regulatory element (WPRE) of marmot hepatitis virus, the SV40 viral polyadenylation signal (SV40 pA signal), and / or the SV40 viral replication origin site (SV40 ori). Figure 1 and Figure 4 In the middle, the upstream artificial gene expression control region represents the truncated locus control region. A human β-globin gene expression cassette similar to the gene therapy drug betibeglogene autotemcel was designed and used as a control, named P001 (May C. et al. Nature. 2000; 406(6791):82-6).
[0203] Example 2. Construction of a lentiviral vector containing the human β-globin gene
[0204] The gene expression cassette designed in Example 1 was cloned into a lentiviral vector backbone, which was a third-generation lentiviral vector backbone prepared internally by Kanglin Biotechnology (Hangzhou) Co., Ltd., pKL-Kan (SEQ ID NO: 1)( Figure 2 ).
[0205] The β-globin gene expression cassette P001 (SEQ ID NO: 2) designed in Example 1 was synthesized by Nanjing Genscript Biotech Co., Ltd., and cloned into the multiple cloning site XhoI / KpnI of the lentiviral vector backbone pKL-Kan using homologous recombination methods well known in the art. The sequence of the obtained construct was confirmed by sequencing and named pKL-Kan-TH-P001 (SEQ ID NO: 3). WPRE (SEQ ID NO: 4) incorporating the β-globin gene expression cassette P002 was synthesized by Nanjing Genscript Biotech Co., Ltd., and cloned into the lentiviral vector pKL-Kan-TH-P001 between the LCR and 3' LTR using homologous recombination methods. The sequence of the obtained construct was confirmed by sequencing and named pKL-Kan-TH-P002 (SEQ ID NO: 5).
[0206] The SV40 pA signal plus SV40 ori (SEQ ID NO: 6) incorporated into the β-globin gene expression cassette P005 was synthesized by Nanjing Genscript Biotech Co., Ltd., and cloned into the 3' LTR and kan ori space of the lentiviral vector pKL-Kan-TH-P001 using homologous recombination. The sequence of the obtained construct was confirmed by sequencing and named pKL-Kan-TH-P005 (SEQ ID NO: 7).
[0207] The WPRE fragment was amplified by PCR using pKL-Kan-TH-P002 as a template, and then cloned into the LCR and SV40 pA signal of the lentiviral vector pKL-Kan-TH-P005 via homologous recombination. The sequence of the obtained construct was confirmed by sequencing and named pKL-Kan-TH-P006 (SEQ ID NO: 8).
[0208] Example 3. Packaging of lentiviruses containing the human β-globin gene
[0209] To package lentiviruses for β-globin gene therapy, lentiviral vectors of the β-globin gene constructed in Example 2 (pKL-Kan-TH-P001, pKL-Kan-TH-P002, pKL-Kan-TH-P005, or pKL-Kan-TH-P006), envelope plasmids (pKL-Kan-Vsvg; SEQ ID NO: 9), and packaging plasmids (pKL-Kan-Rev (SEQ ID NO: 10) and pKL-Kan-GagPol (SEQ ID NO: 11)) were used in a 10-cm³ medium. 2 293T cells (purchased from ATCC; accession number: CRL-3216) were co-transfected onto cell culture dishes. Transient transfection of eukaryotic cells was performed via PEI (cationic polymer) mediated according to the manufacturer's instructions. PEI-Max transfection reagent was obtained from Polysciences (catalog number: 24765-1).
[0210] Forty-eight hours post-transfection, lentivirus (supernatant from transfected cells) was harvested, and aliquots were stored at -80°C. Different volumes of lentivirus were inoculated into the human CD4+ T cell line MT4 (purchased from Shanghai Suer Biotechnology Co., Ltd.) pre-coated in 96-well cell culture plates. Culture supernatant from cells transfected with a lentiviral vector containing the EGFP reporter gene (lentivirus packaged with pCCL-sin-EF1α-WPRE-EGFP using the method described above) was used as a positive control. The initial transfection titer of lentivirus in the harvested supernatant was calculated using quantitative PCR (qPCR) and flow cytometry data based on the GFP signal, methods well-known in the art. The sequences of primers and probes used in qPCR are as follows.
[0211] LV forward primer: 5'-AGTAAGACCACCGCACAGCA-3' (SEQ ID NO: 26)
[0212] LV reverse primer: 5'-CCTTGGTGGGTGCTACTCCT-3' (SEQ ID NO: 27)
[0213] LV probe: 5'-CCTCCAGGTCTGAAGATCAGCGGCCGC-3' (SEQ ID NO: 28)
[0214] HK forward primer: 5'-GCTGTCATCTCTTGTGGGCTGT-3' (SEQ ID NO: 29)
[0215] HK probe: 5'-CCTGTCATGCCCACACAAATCTCTCC-3' (SEQ ID NO: 30)
[0216] HK reverse primer: 5'-ACTCATGGGAGCTGCTGGTTC-3' (SEQ ID NO: 31)
[0217] The LV probe carries 6-FAM fluorescent dye at its 5' end and TAMRA fluorescent dye at its 3' end. The HK probe carries CY5 fluorescent dye at its 5' end and BHQ2 fluorescent dye at its 3' end.
[0218] qPCR program: 94℃ for 5 minutes; 95℃ for 10 seconds, 60℃ for 30 seconds, 40 cycles.
[0219] The initial transfection titers of lentivirus in the harvest supernatants of four different β-globin gene lentiviral vectors (pKL-Kan-TH-P001, pKL-Kan-TH-P002, pKL-Kan-TH-P005, pKL-Kan-TH-P006) are shown in the figure. Figure 3 Data showed that cis-acting WPRE and SV40 pA signaling combined with SV40 ori sequences significantly increased the initial transfection titer of lentivirus in the harvested supernatant, and these two enhancing effects could be additive.
[0220] Example 4. Evaluation of human β-globin gene expression efficiency in lentiviruses
[0221] β-globin gene lentiviral vectors (pKL-Kan-TH-P005, pKL-Kan-TH-P006) were used to transfect two 15-cm cells using the same protocol as in Example 3. 2 293T cells were cultured in cell culture dishes to package lentivirus. Forty-eight hours post-transfection, the lentivirus (supernatant from transfected cells) was harvested and centrifuged for 5 minutes at 4000 rpm and room temperature in a benchtop pendant centrifuge to remove cell debris, followed by centrifugation at 10000 g and 4°C for 4 hours. After removing the clear supernatant, 1 mL of RPMI complete medium was added to the viral pellet, and the viral particles were resuspended using a microsyringe. The viral resuspension was aliquoted and stored at -80°C for later use.
[0222] Different volumes of lentivirus resuspension were seeded into the MT4 cell line, and the transfection titer of the lentivirus resuspension was calculated using qPCR and GFP signal-based flow cytometry data, following the protocol described in Example 3.
[0223] The expression of the β-globin gene mediated by lentivirus was tested in cultured cells. K562 cells are erythroleukemic cells derived from patients with chronic myeloid leukemia (blast crisis). These cells produce a small amount of hemoglobin during fetal development and possess some potential to differentiate into erythrocytes. K562 cells were purchased from ATCC (accession number CCL-243). Based on the calculated transfection titer of lentivirus containing the β-globin gene in the resuspension, lentivirus was seeded into K562 cells pre-coated in 96-well plates at different multiples of infection (MOIs). Cells were harvested on days 5, 10, and 13 post-transfection and used in the following experiments.
[0224] 1. Harvest K562 cells transduced with lentivirus and wash with PBS. Then, collect the cells after centrifugation at 4200 rpm for 5 minutes and resuspend them in 50 μL QuickExtract. TM DNA extraction solution (purchased from Lucigen; catalog number QE09050). Cells were lysed and resuspended in a PCR machine operating under the following conditions (Table 1) to separate total DNA.
[0225] Table 1. PCR conditions
[0226]
[0227] Using methods well-known in the art, the vector copy number (VCN) of lentiviruses in transduced K562 cells was calculated using qPCR and GFP signal-based flow cytometry data. The data showed that the two lentiviral vectors, P005 and P006, produced very similar VCNs in K562 cells when transduced at the same MOI (Table 2).
[0228] Table 2. VCN in transduced K562 cells
[0229]
[0230] 2. Transduced K562 cells were fixed with 4% paraformaldehyde (dissolved in PBS), permeabilized with 0.1% Triton-X100 dissolved in PBS, and stained with FITC-labeled mouse anti-human β-globin mAb. Flow cytometry based on FITC signaling was used to determine the percentage of K562 cells expressing human β-globin and the relative signal intensity of expressed human β-globin.
[0231] The data in Table 3 show that when K562 cells were transduced with the same MOI and very similar VCNs were obtained, the lentiviral vector P005 resulted in significantly higher β-globin expression than the lentiviral vector P006.
[0232] Table 3. Expression levels of β-globin in transduced K562 cells
[0233]
[0234] Example 5. Further design of lentiviral vectors for the human β-globin gene
[0235] In addition to optimizing the cis-acting elements in the lentiviral vector of the β-globin gene, this invention also optimizes the expression cassette of the β-globin gene, including intron sequences and coding sequences.
[0236] Based on P006, we designed six other vectors ( Figure 4 The sequence includes: wild-type human β-globin gene sequence (P009); codon-optimized exons with T87Q mutation using method 3 (P011); codon-optimized exons with T87Q mutation using method 4 (P012); human β-globin gene with full-length intron 2 and T87Q mutation optimized using method 4 (P015); human β-globin gene with full-length intron 2 but without T87Q mutation optimized using method 2 (P019); or human β-globin gene with full-length intron 2 and T87Q mutation but with WPRE removed optimized using method 4 (P021).
[0237] Example 6. Construction of a lentiviral vector containing the human β-globin gene
[0238] The wild-type human β-globin gene sequence (SEQ ID NO: 12) was amplified using genomic DNA isolated from human 293T cells (purchased from ATCC; accession number CRL-3216) as a template via PCR methods well-known in the art. The amplified PCR fragment was cloned between the cPPT / CTS and LCR of pKL-Kan-TH-P006 using homologous recombination methods well-known in the art. The sequence of the resulting vector was confirmed by sequencing and named pKL-Kan-TH-P009 (SEQ ID NO: 13).
[0239] As designed in Example 5, the sequence of the human β-globin gene with codon-optimized exons and the T87Q mutation (SEQ ID NO: 14) obtained by Method 3 was synthesized by Nanjing Genscript Biotech Co., Ltd., and cloned between the β-globin enhancer and β-globin promoter of pKL-Kan-TH-P006 via homologous recombination. The sequence of the obtained vector was confirmed by sequencing and named pKL-Kan-TH-P011 (SEQ ID NO: 15).
[0240] As designed in Example 5, the sequence of the human β-globin gene (SEQ ID NO: 16) with codon-optimized exons and the T87Q mutation, obtained by method 4, was synthesized by Nanjing Genscript Biotech Co., Ltd., and cloned into the β-globin enhancer and β-globin promoter of pKL-Kan-TH-P006 via homologous recombination. The sequence of the obtained vector was confirmed by sequencing and named pKL-Kan-TH-P012 (SEQ ID NO: 17).
[0241] Using pKL-Kan-TH-P009 plasmid DNA as a template, the full-length intron 2 sequence of the human β-globin gene was amplified by PCR and cloned into the space between exon 2 and exon 3 of pKL-Kan-TH-P012 via homologous recombination. The sequence of the resulting vector was confirmed by sequencing and named pKL-Kan-TH-P015 (SEQ ID NO: 18).
[0242] The T87Q mutation in pKL-Kan-TH-P015 was reversed back to T87 using a site-directed mutagenesis kit (purchased from Novizan Biotechnology Co., Ltd.; catalog number C214), and confirmed by sequencing. The new vector was named pKL-Kan-TH-P019 (SEQ ID NO: 19).
[0243] Using pKL-Kan-TH-P015 plasmid DNA as a template, two fragments excluding the WPRE sequence were amplified and recombinated via homologous recombination. The sequence of the resulting new vector was confirmed by sequencing and named pKL-Kan-TH-P021 (SEQ ID NO: 20).
[0244] Example 7. Evaluation of β-globin gene expression efficiency in lentiviruses
[0245] The expression efficiency of the human β-globin gene in the lentiviral vector constructed in Example 6 was evaluated using the method described in Example 4.
[0246] First, for the lentiviral vectors pKL-Kan-TH-P006, pKL-Kan-TH-P011, and pKL-Kan-TH-P012 constructed in Example 6, the lentiviruses were packaged in 293T cells, and the lentiviral resuspension was aliquoted and stored at -80°C for later use.
[0247] Lentiviral-mediated expression of the β-globin gene was tested in cultured cells. Based on the calculated transfection titer of lentivirus containing the β-globin gene in the resuspension, lentivirus was seeded into K562 cells pre-coated in 96-well plates at the multiples of infection (MOI) shown in Table 4. Cells were harvested on days 5, 10, and 15 post-transduction and used in the following experiments.
[0248] 1. Harvest and lyse K562 cells transduced with lentivirus and isolate total DNA. The vector copy number (VCN) of the lentivirus in the transduced K562 cells was calculated using qPCR and GFP signal-based flow cytometry data (Table 4).
[0249] Table 4. VCN in transduced K562 cells
[0250]
[0251] 2. Harvest K562 cells transduced with lentivirus. Flow cytometry based on PE signal was used to determine the percentage of K562 cells expressing human β-globin and the relative signal intensity of expressed human β-globin.
[0252] Table 5. Expression levels of β-globin in transduced K562 cells
[0253]
[0254] Data showed that when K562 cells were transduced with the same MOI and very similar VCNs were obtained, lentiviral vectors P011 and P012 resulted in significantly higher β-globin expression than lentiviral vector P006 (Table 5). Among them, P012 was more advantageous.
[0255] Example 8. Evaluation of β-globin gene expression efficiency in lentiviruses
[0256] The expression efficiency of the human β-globin gene in the lentiviral vector constructed in Example 6 was evaluated using the method described in Example 4.
[0257] First, for the lentiviral vectors pKL-Kan-TH-P006, pKL-Kan-TH-P009, pKL-Kan-TH-P012, pKL-Kan-TH-P015 and pKL-Kan-TH-P019 constructed in Example 6, the lentiviruses were packaged in 293T cells, and the lentiviral resuspension was aliquoted and stored at -80°C for later use.
[0258] The expression of the β-globin gene mediated by lentivirus was then tested in cultured cells. Based on the calculated transfection titer of lentivirus containing the β-globin gene in the resuspension, lentivirus was seeded into K562 cells pre-coated in 96-well plates at the multiples of infection (MOI) shown in Table 6. Cells were harvested on days 5 and 10 post-transduction and used in the following experiments.
[0259] 1. Harvest and lyse K562 cells transfected with lentivirus and isolate total DNA. The vector copy number (VCN) of the lentivirus in transfected K562 cells was calculated using qPCR and flow cytometry data based on GFP signaling (Table 6).
[0260] Table 6. VCN in transduced K562 cells
[0261]
[0262] 2. Harvest K562 cells transfected with lentivirus. Flow cytometry based on PE signal was used to determine the percentage of K562 cells expressing human β-globin and the relative signal intensity of expressed human β-globin.
[0263] The data in Table 7 show that when K562 cells were transfected with the same MOI and very similar VCNs were obtained, lentiviral vectors P012 and P015 resulted in significantly higher β-globin expression than other lentiviral vectors.
[0264] Table 7. Expression levels of β-globin in transduced K562 cells
[0265]
[0266]
[0267] Example 9. Construction of the TH04 vector
[0268] Considering the safety of clinical trials, the wild-type WPRE (SEQ ID NO: 32) in the lentiviral vector P0012 for gene therapy of β-thalassemia was replaced with a mutant WPRE (SEQ ID NO: 33). WPRE (marmot hepatitis virus post-transcriptional regulatory element) is a commonly used regulatory element in lentiviral vectors. When WPRE is placed in the 3'UTR of the target gene, it can enhance the expression of the transgene in the early stages of RNA transcription by increasing the mRNA levels in the nucleus and cytoplasm. When placed upstream of the 3'LTR, transcription termination is improved, thus significantly reducing transcript readthrough. In the P0012 plasmid, to prevent introns in the β-globin gene from being cut off before reverse transcription of the lentiviral genome, its reverse complementary sequence was cloned into the lentiviral vector (according to the transcriptional direction of the lentivirus). WPRE, as an element placed only in the 3'LTR, theoretically cannot improve the expression efficiency of the β-globin gene. In the P0012 plasmid, the inclusion of WPRE surprisingly significantly improved the lentiviral packaging yield, by at least approximately 50%. However, the use of WPRE was found to be risky because its sequence overlaps with that of the marmot hepatitis virus protein X (WHX). Therefore, a six-base mutation (mut6) was performed on the WPRE sequence, including five bases in the predicted WHX promoter region and one base in the start codon, preventing WHX from initiating WPRE expression and thus enhancing safety. The mutated form of WPRE was named mWPRE (SEQ ID NO: 33), and the modified P0012 was named TH04.
[0269] The mWPRE gene was synthesized and inserted between MluI and KpnI of P0012 by restriction endonuclease digestion and ligation. The new construct was confirmed by sequencing and named TH04.
[0270] SEQ ID NO: 32
[0271] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC
[0272] SEQ ID NO: 33
[0273] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTAT AAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCC CTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATT CTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC
[0274] Example 10. Efficacy test in a mouse model of thalassemia
[0275] This example describes the evaluation of the efficacy of the TH04 vector in a mouse model of thalassemia.
[0276] Hbbth-4 / Hbb+ mice (purchased from Southern Model Biotechnology) were used to test the efficacy of the TH04 vector in a thalassemia model. The mice were 11 weeks old, with females as donors and males as recipients. Bone marrow hematopoietic stem cells / progenitor cells were collected and purified from donor mice, transduced in vitro with TH04 lentivirus, and infused into recipient mice via tail vein injection. The therapeutic effect of TH04 lentivirus was evaluated by measuring changes in vector copy number, chimerism rate, and thalassemia-related blood parameters.
[0277] Experimental Protocol: Three groups were tested: a treatment group, a negative control group, and a positive control group. For the negative control group (G1), purified bone marrow stem cells from female Hbbth4 mice without LV-TH04 transduction were transplanted into male Hbbth4 mice. For the treatment group (G2), purified bone marrow stem cells from female Hbbth4 mice transduced with LV-TH04 were transplanted into male Hbbth4 mice. For the positive control group (G3), purified bone marrow stem cells from female C57BL / 6 mice were transplanted into male Hbbth4 mice. Table 8 includes details of the experimental groups.
[0278] Table 8. Overview of the Experimental Group
[0279]
[0280] Isolation of mouse bone marrow stem cells: After euthanizing donor animals with carbon dioxide, femurs, tibias, and iliac bones were rapidly isolated in a biosafety cabinet and immediately transferred to sterile culture dishes containing DPBS to prevent bone desiccation. Bone marrow was washed with 5 mL DPBS (2% fetal bovine serum) / mouse into a new 50 mL tube equipped with a 70 μm cell filter, and the bone marrow cell suspension was centrifuged at 500 xg for 5 minutes at room temperature. The bone marrow cells were resuspended in 5 mL DPBS and slowly added to 4 mL of preheated Ficoll-Paque (ρ=1.084 g / mL) at room temperature. Mature red blood cells were removed after centrifugation at 0 / 0 at room temperature for 15 minutes. After density gradient centrifugation, the liquid except for the bottom red blood cell layer was slowly aspirated, and the sample was centrifuged at 500 xg for 5 minutes at 4°C. The pellet was then resuspended in 5 mL DPBS.
[0281] Purification of mouse bone marrow stem cells: Stem cells were purified using the Lineage Cell Depletion Kit and c-Kit Positive Sorting Kit from MACS, according to the manufacturer’s instructions.
[0282] Transduction and culture of bone marrow stem cells: Cells sorted using the Lineage Cell Depletion kit and the c-Kit positive sorting kit were cultured overnight in a cell culture incubator at 37°C and 5% CO2, and then transduced with LV-TH04 lentivirus at MOI=200 for use in the treatment group. Transduced cells from the treatment group, as well as cells from the negative and positive control groups, were cultured for two more days in a cell culture incubator at 5% CO2.
[0283] Irradiation and cell reinfusion in recipient animals: On the day the bone marrow cell culture was completed, the recipient animals underwent myeloablative pretreatment with X-ray irradiation (4.5 Gy) in two separate irradiations, 3 hours apart. Within 2 hours of completing the myeloablative pretreatment, the cultured and collected cell suspensions were infused into each group of animals via tail vein injection, with a cell infusion rate of 1E+06 cells / animal.
[0284] Determination of VCN and chimerism rate in mouse PBMCs: 100 μL of whole blood samples were collected from the retroorbital region at 4, 6 and 8 weeks after bone marrow transplantation in recipient animals. Approximately 5E+05 PBMCs were separated after density gradient centrifugation and used for chimerism rate and VCN analysis.
[0285] Genomic DNA was extracted from PBMCs using a magnetic bead genomic extraction kit, and the concentration of each extracted template DNA was determined using a micro-spectrophotometer. The genomic DNA samples were uniformly diluted with ultrapure water to approximately 50 ng / μL. Chimerism and VCN were determined using real-time PCR.
[0286] VCN assay: The mouse MKL3 gene was used as a reference gene, and LTR was used as the primer and probe for gene detection of lentiviral vector integration into cells. The sequences of primers and probes are shown in Table 9, the reaction system is shown in Table 10, and the reaction procedure is shown in Table 11.
[0287] Table 9. Primer and probe sequences used for VCN qPCR
[0288]
[0289] Table 10. Preparation of qPCR reaction system for VCN determination (20 μL)
[0290]
[0291] Table 11. qPCR Procedure
[0292]
[0293] The VCN value in the sample is calculated as follows:
[0294] 2^MKL3 / 2^LTR = relative VCN
[0295] Relative VCN / Average Relative VCN per Single Copy = Absolute VCN
[0296] Each assay included a RAW264.7 cell DNA template containing a single copy of the vector for each genome (with only one lentiviral vector integrated).
[0297] The results of the VCN measurement are as follows: Figure 5As shown in the figure. VCN measurements in PBMCs showed that the VCN in PBMCs of the LV-TH04 transducer group was between 1 and 4, which was in line with expectations.
[0298] Chimerism determination: The sample preparation and methods for chimerism determination were the same as those for VCN determination, except that the LTR primers and probes were replaced with primers and probes for the SRY gene, which is a gene specific to the mouse Y chromosome. The SRY sequence is shown in Table 12. The reaction system was the same as in Table 10, except that the LTR primers and probes were replaced with primers and probes for SRY. The reaction procedure was the same as in Table 11.
[0299] Table 12. Sequences of primers and probes used in qPCR for chimerism determination
[0300]
[0301] The chimerism analysis is as follows:
[0302] (1) Calculation of VCN value in sample: 2^MKL3 / 2^SRY = relative VCN
[0303] (2) The mean relative VCN of bone marrow cells in male mice in the thalassemia model of the sample = absolute VCN
[0304] (3) Calculation of chimerism rate after female mouse cells are re-infused into male mice: 1-VCN, then converted to percentage.
[0305] The results of the chimerism analysis are as follows Figure 6 As shown in the figure. The chimerism rate assay of PBMCs showed that the engraftment effect of bone marrow stem cells was consistent in the three groups, indicating that LV-TH04 transduction does not affect the engraftment of stem cells.
[0306] Complete blood count (CBC): At 4, 6, and 8 weeks post-bone marrow transplantation, 50 μL whole blood samples were collected from the recipient animals via retroorbital aspiration for complete blood cell count (CBC). Results of key markers associated with thalassemia are as follows: Figure 7 As shown in the figure. Following transduction and infusion, the LV-TH04 transduction group showed significantly improved hemoglobin levels, hematocrit, and mean corpuscular volume compared to the Mock group, while the TH04 transduction group showed a significantly decreased reticulocyte count compared to the Mock group. Figure 7 The levels of hemoglobin, reticulocytes, hematocrit, and mean corpuscular volume were similar between the LV-TH04 transduction group and the positive control group. Figure 7 These data demonstrate the high therapeutic efficacy of TH04 in animal models of thalassemia, achieving a curative effect.
[0307] Example 11. Clinical Data 1 - Expression determination of CD34+ stem cells isolated from patients with severe thalassemia in erythrocytes differentiated after in vitro transduction with LV-TH04.
[0308] This example describes the effect of TH04 on erythrocytes directed to differentiate from CD34+ stem cells isolated from patients with severe thalassemia.
[0309] CD34+ stem cells were isolated from patients with severe thalassemia via apheresis and transduced with TH04 at an MOI of 100. After transduction, the stem cells were induced to differentiate into erythrocytes using a medium containing erythropoietin. Cells were collected after 15 days of culture. 200 μL of ultrapure water was added to 1E7 cells and mixed thoroughly to lyse the cells. The supernatant was collected after centrifugation at 12,000 rpm for 5 minutes and used for HPLC analysis.
[0310] The conditions used for HPLC determination are shown in Table 13. The HPLC determination conditions included: column C4 4.6 x 250 nm; UV 220 nm detection; sample loading volume, 20 μL.
[0311] Table 13. HPLC determination conditions
[0312]
[0313] like Figure 8 As shown in the chromatogram and peak area calculations in Table 14, the β / α ratio increased from 0 to 43%. Clinical trial results indicate that patients with this β / α ratio no longer require blood transfusions and achieve complete cure.
[0314] Table 14. Peak areas determined by HPLC
[0315]
[0316] Example 12. Clinical Data 2 - Myeloablative pretreatment regimens generally shorten neutrophil engraftment time and platelet recovery time.
[0317] This example describes the effects of different myeloablative pretreatment regimens on neutrophil engraftment time and platelet recovery time in patients receiving lentivirus-transduced hematopoietic stem cell infusions.
[0318] To ensure better and faster engraftment of LV-TH04-transduced CD34+ hematopoietic stem cells (composition) after infusion into patients, myeloablative pretreatment is required before reinfusion. In previous clinical trials of gene therapy for thalassemia, including those using lentiviral vectors to transduce CD34+ hematopoietic stem cells or modifying them with gene editing technologies, busulfan (BU)-based myeloablative pretreatment was performed. In this embodiment, busulfan-based myeloablative pretreatment in combination with cyclophosphamide (BU / CY) was performed, and the regimen was optimized for individual patients. As described below, clinical trial results showed that BU / CY-based myeloablative pretreatment generally shortened neutrophil engraftment time and platelet recovery time compared to BU-based myeloablative pretreatment alone.
[0319] The specific steps of myeloablation pretreatment are as follows:
[0320] Myeloablative pretreatment based on BU / CY:
[0321] Busulfan is administered intravenously over 2 hours, every 6 hours, at a dose of 2.4–4.8 mg / kg / day. Cyclophosphamide is administered 24 hours after busulfan administration. The dose of cyclophosphamide is 45–65 mg / kg / day, administered intravenously. The duration of busulfan administration is 2–4 days, and the duration of cyclophosphamide administration is 1–5 days. Infusion of the combination is initiated 24–72 hours after cyclophosphamide administration.
[0322] BU-based ablation pretreatment:
[0323] Busulfan is administered intravenously over 2 hours, every 6 hours, at a dose of 3.2 mg / kg / day. The duration of busulfan administration is 4 days. Reinfusion of the composition begins 72 hours after busulfan administration.
[0324] Clinical trial results showed that in subjects treated with BU / CY-based myeloablative conditioning (PJYU, ZRHA), neutrophils were engrafted on day 10 after infusion (ANC ≥ 0.5 x 10⁻⁶ for 3 consecutive days). 9 / L), while in subjects treated with BU-based myeloablative conditioning (FAZH), neutrophils achieved engraftment on day 14 post-infusion ( Figure 9 Similarly, subjects treated with BU / CY-based myeloablative conditioning (PJYU, ZRHA) had faster platelet recovery than subjects treated with BU-based myeloablative conditioning (FAZH). Figure 10 The platelet levels of PJYU and ZRHA showed a continuous upward trend from day 17 and day 11, respectively, and returned to normal levels (≥100 x 10⁻⁶) on day 48 and day 29, respectively. 9 / L). On the other hand, FAZH platelet levels are between 20-40 x 10 9 The levels fluctuated between / L for up to 28 days, only starting to rise on day 43, and did not return to normal levels until day 56. Figure 10 ).
[0325] Example 13. Determination of stabilizers in pharmaceutical compositions containing lentiviral vectors
[0326] This embodiment describes the screening and evaluation of stabilizers for a pharmaceutical composition comprising, for example, a lentiviral vector for gene therapy of thalassemia.
[0327] Preliminary screening of stabilizers:
[0328] Preliminary screening of stabilizers was conducted by dispersing purified lentiviral vectors for gene therapy of thalassemia into the systems shown in Table 15 to form formulations. Each formulation was tested as follows:
[0329] Leave at room temperature for 1 day.
[0330] Place at 4℃ for 3 days, or
[0331] Place it under freeze-thaw conditions three times (freeze at -80℃ for no less than 6 hours, thaw at 23℃ for no less than 30 minutes).
[0332] Then, the loss rate of virus particles in a certain amount of sample was analyzed to characterize the stability of the formulation.
[0333] Table 15. Formulation components tested during the initial screening of stabilizers.
[0334]
[0335] like Figure 11 As shown, the addition of sugar or polyol to the formulation inhibited the inactivation of lentiviral particles caused by low temperature and repeated freeze-thaw processes. In particular, the formulation containing sucrose exhibited the best performance and showed a significant protective effect compared with the formulation without sugar or polyol.
[0336] The effect of stabilizers:
[0337] To evaluate the effectiveness of the stabilizers, purified lentiviral vectors for thalassemia gene therapy were dispersed into the systems shown in Table 16 to form formulations. Each formulation was tested as follows:
[0338] Place under freeze-thaw conditions three times (freeze at -80°C for at least 6 hours, thaw at 23°C for at least 30 minutes), or
[0339] Placed under freeze-thaw conditions 9 times (freezing at -80℃ for no less than 6 hours and thawing at 23℃ for no less than 30 minutes).
[0340] Then, a certain amount of sample was analyzed using biometric titer assay (PCR).
[0341] Table 16. Components of formulations tested to compare the effects of stabilizers.
[0342]
[0343] like Figure 12 As shown, regardless of the ratio of sodium citrate to sucrose, the combination of sodium citrate and sucrose in the formulation produces lentiviral particles with good bioactivity after repeated freeze-thaw cycles.
[0344] Stabilizer concentration:
[0345] To determine how the concentration of stabilizer affects the stability of lentiviral particles, purified lentiviral vectors for thalassemia gene therapy were dispersed into the systems shown in Table 17 to form formulations. Each formulation was tested as follows:
[0346] Place it under freeze-thaw conditions 3 times (freeze at -80°C for no less than 6 hours, thaw at 23°C for no less than 30 minutes).
[0347] Then, a certain amount of sample was analyzed using biometric titer assay (PCR).
[0348] Table 17. Components of formulations tested to compare the concentration of stabilizers.
[0349]
[0350] like Figure 13 As shown, under isotonic conditions, formulations containing different proportions of sodium citrate and sucrose effectively inhibited the loss of titer and bioactivity of lentiviral vector particles.
[0351] Example 14. Determination of buffers in pharmaceutical compositions containing lentiviral vectors
[0352] This embodiment describes the screening and evaluation of buffers for pharmaceutical compositions containing, for example, lentiviral vectors for gene therapy of thalassemia.
[0353] Preliminary screening of buffers:
[0354] Preliminary screening of buffers was conducted by dispersing purified lentiviral vectors for gene therapy of thalassemia into the systems shown in Table 18 to form formulations. Each formulation was tested as follows:
[0355] Leave at room temperature for 1 day.
[0356] Place at 4℃ for 3 days, or
[0357] Place it under freeze-thaw conditions three times (freeze at -80℃ for no less than 6 hours, thaw at 23℃ for no less than 30 minutes).
[0358] Then, the loss rate of virus particles in a certain amount of sample was analyzed to characterize the stability of the formulation.
[0359] Table 18. Components of formulations tested during the initial screening of buffers.
[0360]
[0361] like Figure 14 As shown, sodium citrate buffer exhibits superior performance in stabilizing the bioactivity of lentiviral particles compared to other buffers. No significant inactivation of viral particles was observed when sodium citrate buffer was used, indicating that viral particles are more stable in formulations containing this buffer than in conventional formulations.
[0362] The effect of buffer:
[0363] To evaluate the effectiveness of the buffer, purified lentiviral vectors for thalassemia gene therapy were dispersed into the systems shown in Table 19 to form formulations. Each formulation was tested as follows:
[0364] Place at 4℃ for 1 day.
[0365] Leave at room temperature for 1 day, or
[0366] Place at 4℃ for 3 days.
[0367] Then, a certain amount of sample was analyzed using biometric titer assay (PCR).
[0368] Table 19. Components of formulations tested to compare the effects of buffers.
[0369]
[0370] like Figure 15 As shown, the combination of sodium citrate and sucrose under isotonic conditions was more effective in stabilizing lentiviral bioactivity than conventional PBS, and the biotiter of lentiviral particles did not change significantly under different test conditions.
[0371] Summarize
[0372] The tested formulations (e.g., those containing the stabilizers and / or buffers described in Examples 13 and 14) offer numerous benefits, including good freeze-thaw stability and storage stability of lentiviral particles. The formulations effectively prevent loss of viral activity caused by repeated freeze-thaw cycles and low-temperature storage, and the viral particles retain good biological activity after repeated freeze-thaw cycles and long-term storage. Furthermore, the tested formulations can disperse more active lentiviral particles in solution, even with 2-3 [unclear text - likely referring to a specific concentration or concentration]. 10 9 No obvious precipitation or turbidity was observed in the TU / mL viral particles.
[0373] The specific embodiments described above are for illustrative purposes only and should not be construed as limiting the scope of this disclosure. Furthermore, any modifications and / or variations described herein will be apparent to those skilled in the art, provided they do not depart from the concept of this disclosure or exceed the scope defined by the claims. While various preferred embodiments have been used to describe the details of this disclosure, it should be noted that this disclosure is not limited to these specific embodiments. In fact, any modifications to the described specific embodiments that are obvious to those skilled in the art should fall within the scope of this patent protection.
[0374] By incorporating via reference
[0375] All publications, patents and registration numbers mentioned herein are incorporated herein by reference in their entirety, as if each individual publication or patent were specifically and individually indicated to be incorporated by reference.
[0376] Equivalent solution
[0377] While specific embodiments of the invention have been discussed, the above description is illustrative rather than restrictive. Many variations of the invention will become apparent to those skilled in the art upon review of this description and the following claims. The full scope of the invention should be determined by referring to the full scope of the claims and their equivalents, the description, and these variations.
[0378] sequence list
[0379]
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394]
[0395]
[0396]
[0397]
[0398]
[0399]
[0400]
[0401]
[0402]
[0403]
[0404]
[0405]
[0406]
[0407]
[0408]
[0409]
[0410]
[0411]
[0412]
[0413]
[0414]
[0415]
[0416]
[0417]
[0418]
[0419]
[0420]
[0421]
[0422]
[0423]
[0424]
[0425]
[0426]
[0427]
[0428]
[0429]
[0430]
[0431]
[0432]
[0433]
[0434]
[0435]
[0436]
[0437]
[0438]
[0439]
[0440]
[0441]
Claims
1. A carrier, comprising: a) Left (5') retroviral LTR; b) Human β-globin gene; c) Control region (LCR) of the upstream locus of the human β-globin gene; d) Cis-acting posttranscriptional regulatory elements; e) Right (3') retroviral LTR; and f) Cis-acting elements: SV40 polyadenylation signal and / or SV40 replication initiation site.
2. The vector of claim 1, wherein the human β-globin gene comprises a human β-globin promoter, exon 1, intron 1, exon 2, intron 2, exon 3, and human β-globin 3'-enhancer.
3. The vector of claim 1 or 2, wherein the human β-globin gene comprises wild-type exon 2, or exon 2 encoding a threonine-to-glutamine mutation (T87Q) at codon 87.
4. The vector according to any one of claims 1-3, wherein the upstream locus control region (LCR) comprises truncated DNase I hypersensitive sites, HS2, HS3 and HS4.
5. The vector according to any one of claims 1-4, wherein the post-transcriptional regulatory element is a marmot hepatitis virus post-transcriptional regulatory element (WPRE).
6. The vector of claim 5, wherein the WPRE is a mutated WPRE containing the nucleotide sequence of SEQ ID NO:
33.
7. The vector of any one of claims 1-6, wherein the SV40 polyadenylation signal and / or the SV40 replication initiation site is located 3' downstream of the right (3') retroviral LTR.
8. The vector according to any one of claims 1-7, wherein the human β-globin gene comprises one, two, or all of the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a nucleotide sequence having at least 85%, 90%, 95%, or 99% identity with it.
9. The vector of any one of claims 1-8, wherein the left (5') retroviral LTR, the right (3') retroviral LTR, or both are lentiviral LTRs, the left (5') LTR contains a promoter replaced by a heterologous promoter, and the right (3') LTR is a self-inactivating (SIN) LTR.
10. The vector of any one of claims 1-9, further comprising one or more of a Psi packaging sequence (Ψ+), a central polypurine bundle / DNA flap (cPPT / FLAP), or a retroviral output element-rev response element (RRE).
11. The vector according to any one of claims 1-10, comprising the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, or a nucleotide sequence having at least 85%, 90%, 95% or 99% identity with it.
12. A composition comprising the carrier and a pharmaceutically acceptable loading agent as described in any one of claims 1-11.
13. Human cells, said human cells transduced using any one of claims 1-11.
14. The cell of claim 13 is an embryonic stem cell, an adult stem cell, an adult progenitor cell, a differentiated adult cell, a hematopoietic stem cell, or a hematopoietic progenitor cell.
15. The cell of claim 14, wherein the hematopoietic stem cells or hematopoietic progenitor cells are derived from bone marrow, umbilical cord blood, placental blood or peripheral blood.
16. A composition comprising cells transduced with the vector of any one of claims 1-11, and a pharmaceutically acceptable carrier.
17. The vector-transduced cells of any one of claims 1-11, used in a method for treating β-thalassemia in a subject.
18. The cells used according to claim 17, wherein the method further comprises obtaining cells from the subject and transducing the cells using the vector.
19. The cell used as described in claim 17 or 18, wherein the cell is a hematopoietic stem cell or a hematopoietic progenitor cell.
20. The cells used according to any one of claims 17-19, wherein the method further comprises administering an effective amount of busulfan and cyclophosphamide to the subject prior to administering the cells transduced by the carrier to the subject.
21. The cell used according to claim 20, wherein: (a) Busulfan was administered intravenously at a dose of 2.4 to 4.8 mg / kg / day; (b) Cyclophosphamide was administered intravenously at a dose of 45 to 65 mg / kg / day; (c) Cyclophosphamide was applied 24 hours after busulfan; (d) Apply busulfan for 2-4 days and cyclophosphamide for 1-5 days; and (e) Administration of the cells transduced via the carrier begins 24–72 hours after the administration of cyclophosphamide.
22. A formulation comprising the carrier, buffer, stabilizer, and sodium chloride as described in any one of claims 1-11.
23. The formulation of claim 22, wherein the carrier is at a density of 5 x 10⁻⁶. 8 TU / mL to 5x10 9 A concentration of TU / mL is present.
24. The formulation of claim 22 or 23, wherein the buffer is a phosphate buffer, sodium citrate, or PIPES.
25. The formulation of any one of claims 22-24, wherein the buffer is present at a concentration of 10 mM to 50 mM.
26. The formulation of any one of claims 22-25, wherein the stabilizer comprises sucrose, trehalose, sorbitol, inositol, or glucose.
27. The formulation of any one of claims 22-26, wherein the stabilizer is present at a concentration of 1% to 5%.
28. The formulation of any one of claims 22-27, wherein sodium chloride is present at a concentration of 50 mM to 200 mM.
29. The formulation of any one of claims 22-28, wherein the buffer comprises sodium citrate and the stabilizer comprises sucrose.
30. The formulation of any one of claims 22-29, wherein the carrier is in a 5x10 8 TU / mL to 5x10 9 The product is present at a concentration of TU / mL, sodium citrate at a concentration of 20 mM to 40 mM, sucrose at a concentration of 1% to 2%, and sodium chloride at a concentration of 100 mM to 150 mM.