Norfloxacin's nucleic acid aptamer OUC-NOR7-2T and its application
By screening out the nucleic acid aptamer OUC-NOR7-2T with high affinity and specificity, the problem of difficulty in detecting norfloxacin in the existing technology has been solved, achieving efficient and specific identification of norfloxacin and reducing its residual risk in the environment and food.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2026-04-24
- Publication Date
- 2026-06-30
AI Technical Summary
The lack of existing technologies for nucleic acid aptamers that can specifically recognize norfloxacin makes it difficult to detect norfloxacin residues in the environment and food, increasing the risk of bacterial resistance.
A screening library was designed using a dynamic functional base pre-embedded synergistic end-locking strategy. Combined with graphene oxide-indexed enriched ligand system evolution technology (GO-SELEX) and biomembrane interference technology (BLI), a nucleic acid aptamer OUC-NOR7-2T with high affinity and specificity for norfloxacin was screened out, and its affinity was verified by isothermal titration calorimetry (ITC).
The nucleic acid aptamer OUC-NOR7-2T, which has high affinity and good specificity for norfloxacin, was successfully screened. It can efficiently identify norfloxacin and reduce its residual risk in the environment and food.
Smart Images

Figure CN122081335B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a nucleic acid aptamer for norfloxacin, OUC-NOR7-2T, and its application, belonging to the field of nucleic acid aptamer technology. Background Technology
[0002] Norfloxacin (NOR), a third-generation fluoroquinolone antibiotic, is widely used to treat various infectious diseases caused by susceptible bacteria. However, its residues in the environment and food may lead to increased bacterial resistance and pose a potential risk to human health. Therefore, it is necessary to test for norfloxacin.
[0003] The use of nucleic acid aptamers for specific target detection is currently a hot research topic. However, there are no reports yet of nucleic acid aptamers that specifically recognize norfloxacin. Summary of the Invention
[0004] In view of the above-mentioned prior art, the present invention provides a nucleic acid aptamer of norfloxacin, OUC-NOR7-2T, and its application, belonging to the field of nucleic acid aptamer technology.
[0005] This invention is achieved through the following technical solution:
[0006] A norfloxacin aptamer, OUC-NOR7-2T, has the nucleotide sequence shown in SEQ ID NO.10.
[0007] The application of the nucleic acid aptamer OUC-NOR7-2T of norfloxacin in the identification or detection of norfloxacin.
[0008] The norfloxacin nucleic acid aptamer OUC-NOR7-2T of this invention was obtained through screening. The technical principle is as follows: a screening library was designed based on a strategy of dynamic functional base pre-embedding and synergistic end locking; nucleic acid aptamers with affinity for norfloxacin were enriched using graphene oxide-index enriched ligand system evolution technology (GO-SELEX) and analyzed by high-throughput sequencing; the nucleic acid aptamers were initially screened using biomembrane interferometry (BLI); the affinity of the nucleic acid aptamers was further determined using isothermal titration calorimetry (ITC); and the specificity of the nucleic acid aptamers was determined using biomembrane interferometry (BLI).
[0009] The nucleic acid aptamer OUC-NOR7-2T of the present invention has an affinity dissociation constant of 70.9 nM for norfloxacin as determined by isothermal titration calorimetry. It shows no significant affinity for structural analogs of norfloxacin such as enrofloxacin, ciprofloxacin, ofloxacin, lomefloxacin, and pefloxacin, indicating that the nucleic acid aptamer has high affinity and good specificity for norfloxacin and can be used for the specific identification or detection of norfloxacin.
[0010] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description
[0011] Figure 1 : Schematic diagram of secondary structure prediction for primer-binding regions in a library.
[0012] Figure 2 Fitted curves of relative fluorescence enrichment rates for different screening rounds.
[0013] Figure 3 Bar chart showing the relative fluorescence enrichment rates for different screening rounds.
[0014] Figure 4 : Schematic diagram of the affinity determination results between aptamer OUC-NOR6-1T and norfloxacin. The upper part represents the heat change when the aptamer binds to norfloxacin, and the lower part represents the enthalpy change when the aptamer binds to norfloxacin.
[0015] Figure 5 : Schematic diagram of the affinity determination results between aptamer OUC-NOR7-1T and norfloxacin. The upper part represents the heat change when the aptamer binds to norfloxacin, and the lower part represents the enthalpy change when the aptamer binds to norfloxacin.
[0016] Figure 6 : Schematic diagram of the affinity determination results between aptamer OUC-NOR7-2T and norfloxacin. The upper part represents the heat change when the aptamer binds to norfloxacin, and the lower part represents the enthalpy change when the aptamer binds to norfloxacin.
[0017] Figure 7 : Schematic diagram of the affinity determination results between aptamer OUC-NOR7-8T and norfloxacin. The upper part represents the heat change when the aptamer binds to norfloxacin, and the lower part represents the enthalpy change when the aptamer binds to norfloxacin.
[0018] Figure 8: Schematic diagram of the affinity determination results between aptamer OUC-NOR9-2T and norfloxacin. The upper part represents the heat change when the aptamer binds to norfloxacin, and the lower part represents the enthalpy change when the aptamer binds to norfloxacin.
[0019] Figure 9 : Schematic diagram of the affinity determination results between aptamer OUC-NOR9-9T and norfloxacin. The upper part represents the heat change when the aptamer binds to norfloxacin, and the lower part represents the enthalpy change when the aptamer binds to norfloxacin.
[0020] Figure 10 Schematic diagram of the predicted secondary structure of aptamer OUC-NOR7-2T.
[0021] Figure 11 Schematic diagram of the predicted secondary structure of aptamer OUC-NOR7-8T.
[0022] Figure 12 Schematic diagram of the affinity determination results between aptamer OUC-NOR7-2T and enrofloxacin.
[0023] Figure 13 Schematic diagram of the affinity determination results between aptamer OUC-NOR7-2T and ciprofloxacin.
[0024] Figure 14 Schematic diagram of the affinity determination results between aptamer OUC-NOR7-2T and ofloxacin. Detailed Implementation
[0025] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.
[0026] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.
[0027] This invention employs a biomembrane interferometer to determine the high-throughput affinity of nucleic acid aptamers for norfloxacin, as well as the specificity of the aptamers. The detection method involves modifying one end of the nucleic acid aptamer with biotin, which binds to streptavidin to immobilize the aptamer on the sensor surface. The instrument parameters are set as follows: sensor equilibration 180 s, aptamer immobilization 300 s, equilibration 180 s, target binding and dissociation both 300 s, temperature 25℃, and frequency 2 Hz. Fitting the obtained curve yields the affinity dissociation constant, i.e. K d value.
[0028] Simultaneously, this invention employs an isothermal titration microcalorimeter to further verify the affinity between the nucleic acid aptamer and norfloxacin. The detection method is as follows: the sample to be tested is thoroughly degassed, the nucleic acid aptamer solution is placed in the sample cell, and the target solution is placed in the titration needle; the instrument program is set as follows: 25 drops of sample solution, 2 μL per drop, titration interval 180 s, temperature 25℃, stirring speed 350 r / min. The target solution is then added to the nucleic acid aptamer solution, and the obtained curve is fitted to obtain... K d value.
[0029] Example 1: Screening of nucleic acid aptamers that specifically bind to norfloxacin
[0030] This invention employs a screening method based on a dynamic functional base pre-embedding and synergistic end-locking strategy. During the construction of the screening library, specific key bases are embedded in random regions of the library, while simultaneously locking the ends of these random regions. The principle of this screening method is described in another invention patent of the applicant, CN 120866332 A.
[0031] (1) Constructing a screening library of random oligonucleotides
[0032] Select a nucleic acid aptamer that can identify norfloxacin and simulate its binding with norfloxacin using the molecular docking simulation software Autodock.
[0033] The nucleotide sequence of the nucleic acid aptamer selected in this invention to recognize norfloxacin is shown in SEQ ID NO.1, as shown below (direction 5'-3'):
[0034] CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTAT.
[0035] Based on clustering results and the principle of minimum energy, the key sites for the interaction between nucleic acid aptamers and norfloxacin are predicted to be: G11, G12, C13, C36, T37, and G38.
[0036] Based on the base spacing positions, key bases are embedded into the selected random regions, and six pairs of complementary GC sequences are used to lock the ends of the random regions. The design of the random oligonucleotide library for screening is as follows: Figure 1 As shown, four arbitrary bases (represented by "N" in the figure) were inserted before key sites G11, G12, and C13; 22 arbitrary bases were inserted after key sites G11, G12, and C13; and eight arbitrary bases were inserted after key sites C36, T37, and G38. Simultaneously, specific primers for PCR amplification were designed based on the screening library. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and it is labeled with the fluorescent group FAM at the 5' end; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3, and it is modified with biotin at the 5' end.
[0037] The nucleotide sequence of the forward primer is shown below (direction 5'-3'): AGCGTCGAATACCACTACAG.
[0038] The nucleotide sequence of the reverse primer is shown below (direction 5'-3'): CTGACCACGAGCTCCATTAG.
[0039] The online tool "the mfold web server" was used to predict the secondary structure of the primer-free binding regions in the screened library. A schematic diagram of the secondary structure prediction for the primer-free binding regions of the screened library is shown below. Figure 1 As shown, the random regions of the filtered library form an end-locked structure.
[0040] (2) Forward screening of graphene oxide (GO)
[0041] Library binding to target: The screening library was denatured by heating at 95 °C for 10 min and immediately cooled on ice for 10 min before use. The screening library (2 nmol for the first round; 200 pmol for subsequent rounds) was incubated with norfloxacin (2 nmol) at 25 °C for 2 h in 600 μL binding buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 2 mM MgCl2·6H2O). During incubation, sequences with affinity for norfloxacin bound to the drug, while unbound sequences remained free in the solution.
[0042] GO was added to the above mixture and incubated at 25°C for 40 min, where unbound sequences were adsorbed onto the GO surface. The supernatant containing the norfloxacin-bound sequences was collected by centrifugation and used as a template for subsequent PCR amplification. The precipitate containing the unbound sequences adsorbed on the GO was discarded.
[0043] (3) Preparation of secondary libraries
[0044] Using the supernatant containing the norfloxacin-binding sequence obtained in (2) above as a template, PCR amplification was performed; the correctness of the band position and the success of the amplification were verified by 3% agarose gel electrophoresis. The PCR amplification reaction system was as follows: 5 μL template, 1 μL each of forward and reverse primers, 0.25 μL Taq DNA polymerase (5 U / μL), 5 μL 10×PCR buffer (20 mM), 4 μL dNTPs, and ultrapure water to a final volume of 50 μL. The amplification conditions were as follows: 95℃ pre-denaturation for 1.5 min; 95℃ denaturation for 0.5 min, 55℃ annealing for 0.5 min, 72℃ extension for 1.5 min, denaturation, annealing, and extension constitute one cycle, and 12 cycles were performed (the number of cycles for each round of screening depends on the electrophoresis results); 75℃ extension for 5 min; and cooling at 4℃.
[0045] Preparation and purification of single-stranded DNA: The PCR products obtained from the previous screening were mixed with streptavidin microspheres and reacted at room temperature for 20 min. Since streptavidin reacts with biotin, the biotin-modified double-stranded DNA will detach from the streptavidin microspheres. The supernatant was discarded after centrifugation. 500 μL of 200 mM NaOH solution was added and reacted for 15 min. NaOH disrupts the double-stranded structure of the DNA, causing the unlabeled DNA strand to detach from the streptavidin microspheres and remain in the supernatant. The supernatant was collected by centrifugation and desalted using a desalting column to obtain the desired single-stranded DNA.
[0046] The concentration of desalted single-stranded DNA at 260 nm is measured. Based on the concentration, the corresponding volume of DNA solution is taken out and diluted to form a secondary library, which is the screening library for the next round.
[0047] (4) Multiple rounds of screening
[0048] The above steps (2) and (3) were repeated using the secondary library as the next round of screening, for a total of 10 rounds of screening. To ensure the specificity of the candidate aptamers, structural analogs of norfloxacin (enrofloxacin, ciprofloxacin, ofloxacin, lomefloxacin, and pefloxacin) were added for reverse screening in the 5th and 8th rounds of screening.
[0049] Determination of the optimal number of sequencing rounds: In this study, FAM-labeled forward primers were used for PCR amplification to obtain FAM-labeled secondary libraries. After GO screening, the relative fluorescence enrichment rate (F2 / F1×100%) was calculated to determine the optimal number of sequencing rounds. Here, F1 is the fluorescence intensity of the library before the target was added in each round, and F2 is the fluorescence intensity of the supernatant after GO adsorption with the target.
[0050] The fitted curves of relative fluorescence enrichment rates for different screening rounds are shown below. Figure 2 As shown in the bar chart, the relative fluorescence enrichment rates for different screening rounds are as follows: Figure 3 As shown, the fitting curves tended to stabilize after the 5th round of screening, suggesting that the sequences binding to norfloxacin reached relatively sufficient enrichment after the 5th round. Meanwhile, the 6th, 7th, and 9th rounds of screening showed the highest relative fluorescence enrichment rates; therefore, the PCR products obtained from the 6th, 7th, and 9th rounds of screening were subjected to high-throughput sequencing.
[0051] (5) Analysis of high-throughput sequencing results
[0052] Based on homology, base number, frequency of occurrence, and free energy, six candidate nucleic acid aptamers were screened from the library pool. One aptamer was selected in round 6, three in round 7, and two in round 9. The names and nucleotide sequences of these six candidate aptamers are shown below.
[0053] The aptamer OUC-NOR6-1 has the nucleotide sequence shown in SEQ ID NO.4, as shown below (direction 5'-3') (the underlined region indicates the primer binding region, the same below):
[0054] AGCGTCGAATACCACTACAG GGCGGGGACTGGCGCACGGCGATTTGGTTCTACTACTGAGGTAAATCCCGCC CTAATGGAGCTCGTGGTCAG .
[0055] The aptamer OUC-NOR7-1 has the nucleotide sequence shown in SEQ ID NO.5, as shown below (direction 5'-3'):
[0056] AGCGTCGAATACCACTACAG GGCGGGTCGTGGCGTCGATCACAAGTCTCAATCTACTGGGGTATCTCCCGCC CTAATGGAGCTCGTGGTCAG .
[0057] The aptamer OUC-NOR7-2 has the nucleotide sequence shown in SEQ ID NO.6, as shown below (direction 5'-3'):
[0058] AGCGTCGAATACCACTACAG GGCGGGGTGTGGCATCTCTGGCGTGCTAGTATCCTCTGAATTGGATCCCGCC CTAATGGAGCTCGTGGTCAG .
[0059] The aptamer OUC-NOR7-8 has the nucleotide sequence shown in SEQ ID NO.7, as shown below (direction 5'-3'):
[0060] AGCGTCGAATACCACTACAGGGCGGGAATAGGCAGCGCTAACTACTGTTCACTCGCTGATTGGCGGCCCGCC CTAATGGAGCTCGTGGTCAG .
[0061] The aptamer OUC-NOR9-2 has the nucleotide sequence shown in SEQ ID NO.8, as shown below (direction 5'-3'):
[0062] AGCGTCGAATACCACTACAG GGCGGGCGTGGGCATAGAAGGACCCACGTACGGGCCTGGTCTTTACCCCGCC CTAATGGAGCTCGTGGTCAG .
[0063] The aptamer OUC-NOR9-9 has the nucleotide sequence shown in SEQ ID NO.9, as shown below (direction 5'-3'):
[0064] AGCGTCGAATACCACTACAG GGCGGGTAGGGGCTACGACTTCAGGATCGTCACATCTGTGGTTAGTCCCGCC CTAATGGAGCTCGTGGTCAG .
[0065] Example 2: Determination of the affinity between nucleic acid aptamers and norfloxacin
[0066] The primer-binding regions of the first and last primers of the six candidate nucleic acid aptamers selected in Example 1 were removed. The aptamers after primer-binding region removal were named as follows: OUC-NOR6-1T, OUC-NOR7-1T, OUC-NOR7-2T, OUC-NOR7-8T, OUC-NOR9-2T, and OUC-NOR9-9T. The affinity of the primer-removed aptamers for norfloxacin was determined using a biomembrane interferometer molecular interaction spectrometer, and the results are shown in Table 1.
[0067] Table 1. Results of affinity determination between nucleic acid aptamers and norfloxacin
[0068]
[0069] The affinity of the above six nucleic acid aptamers for norfloxacin was further determined using isothermal titration microcalorimetry. A schematic diagram of the affinity determination results between aptamer OUC-NOR6-1T and norfloxacin is shown below. Figure 4 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR7-1T and norfloxacin are illustrated below. Figure 5 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR7-2T and norfloxacin are illustrated below. Figure 6 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR7-8T and norfloxacin are illustrated below. Figure 7 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR9-2T and norfloxacin are illustrated below. Figure 8 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR9-9T and norfloxacin are illustrated below. Figure 9 As shown in the table, the affinity dissociation constants of aptamers OUC-NOR6-1T, OUC-NOR7-1T, OUC-NOR7-2T, OUC-NOR7-8T, OUC-NOR9-2T, and OUC-NOR9-9T are 84.8 nM, 142 nM, 70.9 nM, 75.5 nM, 278 nM, and 279 nM, respectively. These values differ from the affinity dissociation constants measured in Table 1 (the measurement methods are different). The results indicate that aptamers OUC-NOR7-2T and OUC-NOR7-8T exhibit excellent binding affinity to norfloxacin, with aptamer OUC-NOR7-2T showing the best affinity.
[0070] The nucleotide sequence of the aptamer OUC-NOR7-2T is shown in SEQ ID NO.10, as follows (direction 5'-3'):
[0071] GGCGGGGTGTGGCATCTCTGGCGTGCTAGTATCCTCTGAATTGGATCCCGCC.
[0072] The nucleotide sequence of the aptamer OUC-NOR7-8T is shown in SEQ ID NO.11, as follows (direction 5'-3'):
[0073] GGCGGGAATAGGCAGCGCTAACTACTGTTCACTCGCTGATTGGCGGCCCGCC.
[0074] A schematic diagram of the secondary structure prediction for aptamer OUC-NOR7-2T is shown below. Figure 10 As shown in the diagram, the secondary structure prediction schematic of aptamer OUC-NOR7-8T is as follows: Figure 11 As shown.
[0075] Example 3: Determination of the specificity of nucleic acid aptamers
[0076] The affinity of the two nucleic acid aptamers (OUC-NOR7-2T and OUC-NOR7-8T) obtained in Example 2 to the structural analogues of norfloxacin (enrofloxacin, ciprofloxacin, ofloxacin, lomefloxacin and pefloxacin) was determined using a biomembrane interference molecular interaction analyzer.
[0077] A schematic diagram showing the affinity determination results between aptamer OUC-NOR7-2T and enrofloxacin is shown below. Figure 12 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR7-2T and ciprofloxacin are illustrated below. Figure 13 As shown in the diagram, the results of the affinity determination between the aptamer OUC-NOR7-2T and ofloxacin are illustrated below. Figure 14 As shown in the figure. The results showed that no obvious binding signal was observed between aptamer OUC-NOR7-2T and ciprofloxacin, lomefloxacin, and pefloxacin; the binding signal with enrofloxacin and ofloxacin showed no linear gradient and the binding response value at the highest concentration was still below 0.01 nm, indicating invalidity, indicating that aptamer OUC-NOR7-2T has good specificity for norfloxacin. No obvious binding signal was observed between aptamer OUC-NOR7-8T and enrofloxacin, ciprofloxacin, ofloxacin, lomefloxacin, and pefloxacin, indicating that aptamer OUC-NOR7-8T has good specificity for norfloxacin. It should be noted that the affinity tests of aptamer OUC-NOR7-2T with lomefloxacin and pefloxacin, and aptamer OUC-NOR7-8T with enrofloxacin, ciprofloxacin, ofloxacin, lomefloxacin, and pefloxacin, all showed no obvious binding signal. Figure 13 As shown in the diagram, the present invention does not provide a schematic diagram of the results of their affinity determination.
[0078] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.
Claims
1. A nucleic acid aptamer for norfloxacin, OUC-NOR7-2T, characterized in that: The nucleotide sequence is shown in SEQ ID NO.
10.
2. The use of the norfloxacin nucleic acid aptamer OUC-NOR7-2T as described in claim 1 in the identification or detection of norfloxacin.