A method for preparing FOXL2 gene overexpressing goats
By preparing an overexpression vector for the FOXL2 gene and performing nuclear transfer cloning, the breeding challenges of hornless intersex syndrome in goats were solved, achieving sex determination and horn type regulation, and ensuring the progress of germplasm research on normal hornless dairy goats.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-22
- Publication Date
- 2026-05-26
AI Technical Summary
Existing technologies for addressing intersex goat hornless syndrome (PIS) in goats involve painful dehorning procedures that negatively impact growth, the selection of hornless dairy goats that leads to intersex reproductive defects, and the lack of effective gene regulation methods, all of which affect breeding and production.
By preparing a FOXL2 gene overexpression vector, transfecting intersex goat embryonic fibroblasts, obtaining a stable monoclonal cell line overexpressing the FOXL2 gene, performing nuclear transfer cloning, and obtaining cloned goats overexpressing the FOXL2 gene, thus achieving sex determination and horn type regulation.
This study provides a method to reduce or eliminate intersex hornless goats, ensuring the progress of hornless normal dairy goat germplasm research, exploring the function of the FOXL2 gene in horn trait regulation, and providing a theoretical basis for breeding.
Smart Images

Figure CN122081399A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and transgenic animal technology, specifically relating to a method for preparing FOXL2 gene overexpressing goats. Background Technology
[0002] In goat farming, the aggressive nature of horned goats poses a significant challenge to production and management. Currently, two main methods address this issue: dehorning and pollination. However, dehorning causes considerable pain and stress to lambs, and incomplete dehorning results in stubble, requiring secondary removal. This practice negatively impacts growth and development, contradicting modern animal welfare principles. Another method is to raise hornless dairy goats. However, hornless individuals often carry intersex reproductive defect genes; homozygous hornless ewes exhibit intersex traits. In other words, intersex traits in goats are closely linked to the hornless trait, a condition known as intersex hornless syndrome (PIS). Because intersex individuals lack reproductive capacity and have relatively low viability and disease resistance, they cause severe losses to breeding and production. Reducing or even eliminating the occurrence of intersex individuals in hornless goat populations remains a major challenge in goat breeding.
[0003] Research has found that intersex goat hornless syndrome (PIS) is caused by two structural variations: a 10.1kb deletion and a 480kb inverted insertion in the PIS region of chromosome 1. Current technology indicates that the FOXL2 gene is a major gene for determining female sex in goats, but whether it is a major gene for the horned trait remains unclear. Therefore, exploring the function and application potential of the FOXL2 gene in PIS goat traits, and developing related products for screening and regulating the horned trait in intersex goats and for assisting in the breeding of horned normal goats, is of great significance for ensuring and accelerating the research progress of horned normal dairy goat germplasm. Summary of the Invention
[0004] The purpose of this invention is to provide a method for preparing FOXL2 gene overexpressing goats, and to develop related products for preparing experimental models of genes that regulate the horn-like trait of goats or assist in the breeding of hornless normal goats, thereby ensuring and accelerating the research process of hornless normal dairy goat germplasm.
[0005] To achieve the above objectives, the present invention provides a method for preparing FOXL2 gene overexpressing goats, comprising the following steps: transfecting interstitial goat embryonic fibroblasts with a vector plasmid overexpressing the FOXL2 gene to obtain a stable monoclonal cell line overexpressing the FOXL2 gene; using the monoclonal cell line as a nuclear donor to perform nuclear transfer cloning on a recipient goat to obtain a cloned goat embryo overexpressing the FOXL2 gene; transferring the cloned goat embryo into a surrogate goat; and obtaining a goat overexpressing the FOXL2 gene after birth. The nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.1.
[0006] Preferably, the method for preparing the vector plasmid includes introducing the FOXL2 gene into an overexpression vector via enzyme digestion and ligation; the overexpression vector includes pcDNA3.1(+).
[0007] Preferably, the recipient sheep breed includes Boer goats; the embryo transfer involves transferring the cloned goat embryo into a surrogate sheep, and the surrogate sheep breed includes Laoshan dairy goats.
[0008] Preferably, the method for preparing the intersex goat embryonic fibroblasts includes: (1) Take interstitial embryonic skin tissue and place it in DMEM / F12 medium containing 1% PS, and wash it 3 times with the DMEM / F12 medium containing 1% PS; (2) Take the tissue block, transfer it to a sterile centrifuge tube, and add collagenase I for digestion. (3) Centrifuge, discard collagenase I supernatant and add trypsin for further digestion; (4) After digestion, add DMEM / F12 medium containing 1% PS and 10% FBS to stop digestion, filter to obtain cell suspension, centrifuge, discard supernatant, resuspend cells to obtain cell suspension, and culture to obtain the interstitial goat embryonic fibroblasts.
[0009] Preferably, in step (1), the concentration of collagenase I added is 1~2 mg / mL; in step (2), after adding the supernatant of discarded collagenase I, 1~1.5 mL of 0.25%~0.5% pancreatic enzyme is added; the digestion time in both step (2) and step (3) is 30~40 min.
[0010] Preferably, the digestion temperature is 36°C to 38°C.
[0011] The present invention also provides the application of the method in preparing experimental models for sex determination and / or horn type regulation in intersex goats.
[0012] This invention also provides an application of a reagent for overexpressing the FOXL2 gene in screening genes that regulate intersex goat horn traits or in research-assisted breeding of hornless normal goats.
[0013] Preferably, the nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.1.
[0014] Preferably, the reagent comprises an overexpression recombinant vector containing the FOXL2 gene or a monoclonal cell line containing the overexpression recombinant vector.
[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a method for preparing FOXL2 gene overexpressing goats. By overexpressing the FOXL2 gene in intersex goats, the regulatory function of the FOXL2 gene on horn traits is explored. Related products are developed for preparing gene experimental models for research on genes regulating horn traits in intersex goats or for research-aided breeding of hornless normal goats. This ensures and accelerates the research process of hornless normal dairy goat germplasm, provides ideas for reducing or even overcoming the harm of hornless intersex syndrome and obtaining hornless normal dairy goat germplasm, and also provides a theoretical basis for breeding hornless normal dairy goat germplasm. Attached Figure Description
[0016] Figure 1 This is a graph showing the agarose gel electrophoresis results of the linearized plasmid vector in Example 2.
[0017] Figure 2 The image shows the results of the G418 antibiotic concentration gradient screening in Example 4. The left image shows the culture with 800 μg / mL G418 resistance, the middle image shows the culture with 1000 μg / mL G418 resistance, and the right image shows the culture with 1200 μg / mL G418 resistance.
[0018] Figure 3 The results of agarose gel electrophoresis for screening positive monoclonal cells in Example 5 are shown. P is the positive control, N is the negative control, B is the blank control, and 1-2-3 and 1-4-1 represent the integrated monoclonal cell line numbers, respectively.
[0019] Figure 4 The images show the growth status of the donor cells after 48 hours of culture in Example 6, with the left image being a 40× scale image and the right image being a 100× scale image.
[0020] Figure 5 The image shows the morphology of the donor in Example 6, where 1-2-3 and 1-4-1 represent the numbers of the integrated positive monoclonal cell lines, respectively.
[0021] Figure 6 This is an image of the embryo before embryo transfer in Example 6.
[0022] Figure 7 The results of PCR detection of the FOXL2 gene in 12 cloned sheep in Example 6 are shown. N is the negative control (PCR detection result of ordinary interbreeding goats), P is the positive control PCR detection result, B is the blank control PCR detection result, and the lanes following B are the PCR detection results of 12 cloned sheep.
[0023] Figure 8The image shows the phenotypic characteristics of the cloned lambs in Example 6, where 0890, 0889, 0888, 0887, 0886, 0885, 0884, 0883, 0798, 0882, 0881 and 0799 represent the numbers (ear numbers) of different cloned lambs. Detailed Implementation
[0024] This invention provides a method for preparing FOXL2 gene-overexpressing goats, comprising the following steps: transfecting interstitial goat embryonic fibroblasts with a vector plasmid overexpressing the FOXL2 gene to obtain a stable monoclonal cell line overexpressing the FOXL2 gene; using the monoclonal cell line as a nuclear donor to perform nuclear transfer cloning on a recipient goat to obtain a cloned goat embryo overexpressing the FOXL2 gene; transferring the cloned goat embryo into a surrogate goat; and obtaining a goat overexpressing the FOXL2 gene after birth; the nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.1.
[0025] In the method described in this invention, the preparation method of the vector plasmid includes inserting the FOXL2 gene into an overexpression vector via enzyme digestion and ligation. The overexpression vector is preferably pcDNA3.1(+). The enzyme digestion and ligation sites selected are HindIII and XhoI. As an optional embodiment, the pcDNA3.1(+) vector is double-digested with HindIII and XhoI; the FOXL2 gene sequence shown in SEQ ID NO.1 has HindIII and XhoI restriction sites at both ends, and is also double-digested with HindIII and XhoI, followed by ligation with T4 ligase to obtain the overexpression plasmid vector pcDNA3.1(+)-FOXL2.
[0026] In this invention, the overexpression plasmid vector pcDNA3.1(+)-FOXL2 needs to be purified before transfection to remove endotoxins. The purification is performed using a purification kit. As an optional implementation, the purification kit for the overexpression plasmid vector pcDNA3.1(+)-FOXL2 uses the Omega EZNA Endo-free Plasmid Mini Kit II. The purified endotoxin-free pcDNA3.1(+)-FOXL2 vector plasmid is linearized by ScaI restriction enzyme digestion. The linearized overexpression plasmid vector pcDNA3.1(+)-FOXL2 is then transfected into interstitial goat embryonic fibroblasts. The transfection is performed using a conventional cell transfection kit, and the specific source of the transfection kit is not limited.
[0027] The method for preparing interstitial goat embryonic fibroblasts according to the present invention includes: (1) taking interstitial embryonic skin tissue and placing it in DMEM / F12 medium containing 1% PS, and washing it three times with the DMEM / F12 medium containing 1% PS; (2) taking tissue blocks, transferring them to sterile centrifuge tubes, and adding collagenase I for digestion; (3) centrifuging, discarding the collagenase I supernatant, and adding trypsin for digestion again; (4) after digestion, adding DMEM / F12 medium containing 1% PS and 10% FBS to stop digestion, filtering to obtain cell suspension, centrifuging, discarding the supernatant, resuspending the cells, obtaining cell suspension, and culturing to obtain the interstitial goat embryonic fibroblasts. In step (1), the concentration of collagenase I added is preferably 1-2 mg / mL, more preferably 1 mg / mL; in step (2), after adding the supernatant of discarded collagenase I, 1-1.5 mL of 0.25%-0.5% trypsin is added, more preferably 1 mL of 0.25% trypsin; the digestion time in both steps (2) and (3) is preferably 30-40 min, more preferably 30-35 min, and more preferably 30 min. The digestion temperature is preferably 36℃-38℃, more preferably 37℃.
[0028] In obtaining a stable monoclonal cell line overexpressing the FOXL2 gene, the present invention screens the concentration of G418 antibiotic in the culture medium, preferably a complete culture medium containing 900~1100 μg / mL G418 antibiotic, and more preferably a DMEM / F12 culture medium containing 1% PS and 10% FBS containing 1000 μg / mL G418.
[0029] In this invention, the monoclonal cell line is used as a nuclear donor for nuclear transfer cloning of a recipient sheep to obtain cloned goat embryos overexpressing the FOXL2 gene. These cloned goat embryos are then transferred to obtain intersex goats overexpressing the FOXL2 gene. The recipient sheep breed is the Boer goat. The embryo transfer involves transferring the cloned goat embryo into a surrogate sheep, the surrogate sheep breed being the Laoshan dairy goat. Both the nuclear transfer cloning and embryo transfer were performed by Henan Qingniu Siyuan Biotechnology Co., Ltd.
[0030] The present invention also provides the application of the method in preparing experimental models for sex determination and / or horn type regulation in intersex goats.
[0031] This invention provides a reagent for overexpressing the FOXL2 gene for screening genes regulating the horn-bearing trait in intersex goats or for studying genes related to the breeding of hornless normal goats. The reagent comprises an overexpression recombinant vector containing the FOXL2 gene and a monoclonal cell line containing the overexpression recombinant vector; the monoclonal cell line is obtained by transfecting intersex goat embryonic fibroblasts containing the overexpression recombinant vector. The nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.1.
[0032] In the following embodiments of the present invention, the experimental material, interstitial embryonic fibroblasts, was isolated from interstitial embryonic skin tissue, which was derived from interstitial goat embryos detected as interstitial at the Jimo Sijichun Dairy Goat Farm.
[0033] In the following examples, the restriction enzymes HindIII, XhoI, and ScaI were all purchased from NEB. The pcDNA3.1(+) vector was directly provided by Shanghai Sangon Biotech Co., Ltd. during synthesis; it is a conventional pcDNA3.1(+) vector, and its specific source is not limited; it can be obtained commercially. The pcDNA3.1(+) vector is a eukaryotic expression vector specifically designed for overexpression of exogenous genes in mammalian cells. Unless otherwise specified, the test methods used in the following examples are conventional test methods; the materials and reagents used are commercially available unless otherwise specified.
[0034] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.
[0035] Example 1 Construction of the overexpression plasmid vector pcDNA3.1(+)-FOXL2 The overexpression plasmid vector pcDNA3.1(+)-FOXL2 was synthesized and constructed by Shanghai Sangon Biotech Co., Ltd. The nucleotide sequence of the synthesized DNA fragment FOXL2 gene is shown in SEQ ID NO.1. It was inserted into the overexpression pcDNA3.1(+) vector by double digestion with HindIII and XhoI to obtain the overexpression plasmid vector pcDNA3.1(+)-FOXL2.
[0036] The nucleotide sequence (1146 bp) of the synthesized FOXL2 gene is as follows:
[0037] The bolded portions of the above SEQ ID NO.1 sequence are the restriction sites of HindIII and XhoI, respectively. The base sequence of HindIII is AAGCTT, and the base sequence of XhoI is CTCGAG.
[0038] The sequence was verified by Shanghai Sangon Biotech using universal primers for the pcDNA3.1(+) vector. The universal primers for the pcDNA3.1(+) vector include the forward sequencing primer T7: TAATACGACTCACTATAGG (SEQ ID NO. 2); and the reverse sequencing primer bgh: CAGGGTCAAGGAAGGCAC (SEQ ID NO. 3). The confirmed sequence is shown in SEQ ID NO. 4.
[0039] The nucleotide sequence (6494 bp) of the overexpression plasmid vector pcDNA3.1(+)-FOXL2 was verified by sequencing as follows:
[0040] Example 2 Linearization of pcDNA3.1(+)-FOXL2 plasmid vector The overexpression plasmid vector pcDNA3.1(+)-FOXL2 was purified using the Omega EZNA Endo-free Plasmid Mini Kit II (Omega, catalog number: D6950-01). The specific experimental steps were performed according to the kit instructions.
[0041] The purified endotoxin-free pcDNA3.1(+)-FOXL2 vector plasmid was linearized by ScaI restriction enzyme digestion, as follows: (1) Establish the ScaI enzyme digestion reaction system as shown in Table 1 on ice to obtain the reaction solution; (2) Vortex the reaction mixture and centrifuge briefly; (3) Incubate at 37℃ for 1 hour using a PCR instrument; (4) The endotoxin-free pcDNA3.1(+)-FOXL2 linearized plasmid vector was obtained by incubating at 80℃ for 20 min using a PCR instrument for heat inactivation.
[0042] Table 1 ScaI enzyme digestion reaction system
[0043] Agarose gel electrophoresis was used to detect linearized plasmid vectors, and the results are as follows: Figure 1 As shown, the pcDNA3.1(+)-FOXL2 plasmid vector was successfully linearized. The linearized plasmid vector was purified from the reaction system using the Tiangen Common DNA Product Purification Kit (Tiangen, catalog number: DP204-02). Specific experimental procedures were performed according to the Tiangen Common DNA Product Purification Kit instructions. Endotoxin-free pcDNA3.1(+)-FOXL2 linearized plasmid vector for cell transfection was obtained.
[0044] Example 3 Interstitial embryonic fibroblast isolation and culture The steps for isolating interstitial embryonic fibroblasts are as follows: (1) Take intercalary embryonic skin tissue (the size of a little fingernail), place it in DMEM / F12 medium containing 1% PS, and then place it on ice. Wash it three times with the above medium in a clean bench, and remove blood stains and impurities with curved forceps. The intercalary embryonic skin tissue was obtained from goat embryos that were detected as intercalary at the Jimo Sijichun Dairy Goat Farm.
[0045] (2) Cut the tissue into pieces of about 5 mm, transfer them to a 1.5 mL sterile centrifuge tube, add 1 mg / mL collagenase I, digest in a 37 °C water bath for 30 min, and perform mechanical dissociation once every 10 min.
[0046] (3) Centrifuge briefly with a handheld centrifuge to centrifuge the tissue digested by proteinase I to the bottom of the tube, discard the collagenase I supernatant, then add 1 mL of 0.25% trypsin (GIBCO, catalog number: 25200072), digest in a 37°C water bath for 30 min, and mechanically dissociate every 10 min (Note: the entire tissue processing process should not exceed 4 h).
[0047] (4) After digestion for 30 min, add complete culture medium (DMEM / F12 medium with 1% PS and 10% FBS) to stop digestion. Filter the cell suspension using a 40 μm nylon cell filter (BioSharp, catalog number: BS-40-CS). Centrifuge at 1000×g for 5 min, discard the supernatant of the complete culture medium (DMEM / F12 medium with 1% PS and 10% FBS), and gently pipette 1 mL of complete culture medium (DMEM / F12 medium with 1% PS and 10% FBS) to resuspend the cells. Transfer the cell suspension to a cell culture flask, add complete culture medium (DMEM / F12 medium with 1% PS and 10% FBS) to a final volume of 5 mL, and incubate at 37°C in a cell culture incubator. T25 cell culture flasks can be cryopreserved when the cell concentration reaches approximately 90%. Newly isolated cells have a higher risk of contamination; therefore, the culture medium should be changed promptly after cell adhesion.
[0048] Example 4 G418 antibiotic concentration gradient screening Interstitial embryonic fibroblasts obtained in Example 3 were used for gradient screening. These cells were cultured in 24-well plates at different concentration gradients until cell attachment was achieved. Cell densities of 20%, 40%, 60%, and 80% were reached. Medium containing different concentrations of G418 antibiotic (DMEM / F12 medium with 1% PS and 10% FBS) was then added for concentration screening. Optimal G418 antibiotic concentrations were selected by adding medium containing 100 μg / mL, 200 μg / mL, 400 μg / mL, 600 μg / mL, 800 μg / mL, and 1000 μg / mL at different cell densities.
[0049] pass Figure 2 Based on the screening results, the optimal medium (DMEM / F12 medium containing 1% PS and 10% FBS) containing 1000 μg / mL G418 was determined to be the best for screening cell lines that stably integrate and overexpress the FOXL2 gene.
[0050] Example 5 Cell transfection and selection of positive cell monoclonal antibodies (1) Cell transfection The endotoxin-free pcDNA3.1(+)-FOXL2 linearized plasmid vector for cell transfection obtained in Example 2 was introduced into the interstitial goat embryonic fibroblasts isolated in Example 3 via electroporation. Electroporation was performed using the Lonza Primary Fibroblast Basic Nuclear Transfection Kit (catalog number: VPI-1002), and the specific operation was performed in accordance with the kit's instructions.
[0051] The transfection system was: (0.5-1)×10 6 1 cell; 1-5 μg plasmid DNA; 100 μL electroporation buffer.
[0052] (2) Screening of positive cell monoclonal antibodies The cell suspension obtained after electroporation was diluted to 1000 cells / mL with DMEM / F12 medium containing 1% PS and 10% FBS. Then, 10 μL of this diluted solution was added to 990 μL of DMEM / F12 medium containing 1% PS and 10% FBS to obtain a 10 cell / mL cell suspension. Subsequently, 100 μL of the 10 cell / mL cell suspension was added to each well of a 96-well plate (during seeding, the cell suspension was mixed after each addition to prevent uneven cell distribution due to sedimentation). After cell attachment, the medium was replaced with DMEM / F12 complete medium containing 1000 μg / mL G418, 1% PS, 1% GABA, and 20% FBS for selection (to avoid cell senescence, the concentration of FBS in the complete medium was increased at this point, and 1% GABA was added separately, changing it to DMEM / F12 complete medium containing 1% PS, 1% GABA, and 20% FBS). Once the cell density in the 96-well plate exceeded 80%, cells were transferred to a 48-well plate for clonal expansion to obtain positive monoclonal cells. 80% of the expanded monoclonal cells were cryopreserved, and the remaining 20% were used for positive detection.
[0053] (3) Screening of FOXL2 gene-stable integration positive cells The screening steps for FOXL2 gene-stable integrated positive cells are as follows: Cell DNA was extracted from the monoclonal cells obtained above for positive detection. Primers designed upstream and downstream for the FOXL2 gene in the endotoxin-free pcDNA3.1(+)-FOXL2 linearized plasmid vector obtained in Example 2 included the forward primer FOXL2-5F (SEQ ID NO. 5) and the reverse primer FOXL2-5R (SEQ ID NO. 6), and PCR detection was performed using the extracted monoclonal cell DNA as a template.
[0054] The sequence of the forward primer FOXL2-5F is: GCGTGTACGGTGGGAGGTCTATA (SEQ ID NO.5). The sequence of the reverse primer FOXL2-5R is: ATTAGGAAAGGACAGTGGGAGTG (SEQ ID NO.6).
[0055] The agarose gel electrophoresis results of the PCR products are as follows: Figure 3 As shown, the primer target fragment length is 1402 bp. Two FOXL2 gene-stable integrated positive cell lines were obtained: 1-4-1 and 1-2-3, respectively. Sequencing of the PCR products confirmed that the sequence information of the FOXL2 gene-stable integrated positive monoclonal cell lines 1-4-1 and 1-2-3 is shown in SEQ ID NO. 7.
[0056] The nucleotide sequences (1402 bp) of the FOXL2 gene-stable integration-positive monoclonal cell lines 1-4-1 and 1-2-3 are as follows:
[0057] The final selected stable FOXL2 gene integration positive monoclonal cell lines were 1-4-1 and 1-2-3.
[0058] Example 6 The selected cell lines 1-4-1 and 1-2-3 were given to Henan Qingniu Siyuan Biotechnology Co., Ltd. as nuclear transfer donors for nuclear transfer cloning and embryo transfer.
[0059] nuclear transfer cloning (1) Nuclear transfer donor cells Cells were thawed, revived, and inoculated for culture. After 48 hours of culture, the cell growth status was as follows: Figure 4 After being cultured to a state of contact inhibition, the cells are digested into single cells (resuspended state). These resuspended cells are used as nuclear donors for somatic cell nuclear transfer. The donor morphology is as follows: Figure 5 As shown.
[0060] The recipient sheep are Boer goats, sourced from Henan Qingniu Siyuan Biotechnology Co., Ltd.
[0061] Table 2 Embryo Transfer Information Table
[0062] Cell line 1-4-1: 16 sheep were transplanted in the first batch, and 6 sheep were transplanted in the second batch, for a total of 22 recipient sheep. Cell line 1-4-1: 8 sheep were transplanted. Pre-transfer embryo images are shown below. Figure 6 As shown.
[0063] Pregnancy test results of 30 recipient sheep: Cell line 1-4-1: 16 recipient sheep were transplanted in the first batch, and 6 in the second batch, for a total of 22 recipient sheep transplanted with cell line 1-4-1. Ultrasound examination showed that 8 recipient sheep were pregnant, and 14 were not pregnant. Cell line 1-2-3: 8 recipient sheep were transplanted; ultrasound examination showed that 4 recipient sheep were pregnant, and 4 were not pregnant.
[0064] Table 3. Pregnancy test results of recipient sheep
[0065] Results of births in 12 pregnant ewes: 14 lambs were conceived in total, including two stillborn lambs from surrogate ewe 0381. The remaining 11 surrogate ewes gave birth to a total of 12 lambs, including 3 lambs delivered by cesarean section from surrogate ewe 0388, and the rest were born naturally.
[0066] Table 4. Birth Records of Cloned Sheep
[0067] Results analysis: Ultimately, 12 cloned dairy goats with FOXL2 gene overexpression were obtained. Testing showed that the FOXL2 gene expression level in all 12 cloned goats was significantly higher than that in ordinary interbreeding goats. The integration rate of the exogenous gene was 100%.
[0068] like Figure 7 As shown, using DNA from 12 cloned sheep as templates, PCR detection was performed using the forward and reverse primers described in Example 5 (3). After sequencing and comparing the PCR products, it was confirmed that the FOXL2 gene overexpression was successful.
[0069] Phenotypic characteristics analysis of cloned lambs: like Figure 8 As shown, all cloned lambs exhibited a smaller vulva and an enlarged clitoris that protruded beyond the vulva, displaying an intercalary trait. Furthermore, testicular-like gonadal tissue could be palpated in the abdomen of most lambs, located outside the abdominal cavity but not fully submerged under the skin at the testicular site, and without a scrotum; however, no similar tissue was palpable in lambs 0885 and 0889. Simultaneously, all lambs remained hornless, with no horn buds observed. Phenotypic analysis showed that all cloned lambs still exhibited intercalary traits and remained hornless.
[0070] This invention successfully produced cloned dairy goats with FOXL2 gene overexpression, and preliminarily verified that FOXL2 overexpression failed to restore intersex goats to normal females. This provides an important experimental model for elucidating the role of FOXL2 in sex determination and horn type regulation, and provides ideas and technical basis for solving the breeding problem of hornlessness and intersex linkage through gene editing strategies.
[0071] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A method for preparing FOXL2 gene overexpressing goats, characterized in that, The process includes the following steps: transfecting interstitial goat embryonic fibroblasts with a vector plasmid that overexpresses the FOXL2 gene to obtain a monoclonal cell line that stably overexpresses the FOXL2 gene; using the monoclonal cell line as a nuclear donor to perform nuclear transfer cloning on a recipient goat to obtain a cloned goat embryo that overexpresses the FOXL2 gene; transferring the cloned goat embryo into a surrogate goat; and obtaining a goat that overexpresses the FOXL2 gene after birth. The nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.
1.
2. The method according to claim 1, characterized in that, The method for preparing the vector plasmid includes introducing the FOXL2 gene into an overexpression vector via enzyme digestion and ligation; the overexpression vector includes pcDNA3.1(+).
3. The method according to claim 1, characterized in that, The recipient sheep breed includes Boer goats; the embryo transfer involves transferring the cloned goat embryo into a surrogate sheep, and the surrogate sheep breed includes Laoshan dairy goats.
4. The method according to claim 1, characterized in that, The method for preparing the interstitial goat embryonic fibroblasts includes: (1) Take interstitial embryonic skin tissue and place it in DMEM / F12 medium containing 1% PS, and wash it 3 times with the DMEM / F12 medium containing 1% PS; (2) Take the tissue block, transfer it to a sterile centrifuge tube, and add collagenase I for digestion. (3) Centrifuge, discard collagenase I supernatant and add trypsin for further digestion; (4) After digestion, add DMEM / F12 medium containing 1% PS and 10% FBS to stop digestion, filter to obtain cell suspension, centrifuge, discard supernatant, resuspend cells to obtain cell suspension, and culture to obtain the interstitial goat embryonic fibroblasts.
5. The method according to claim 4, characterized in that, In step (1), the concentration of collagenase I added is 1~2 mg / mL; in step (2), after adding the supernatant of discarded collagenase I, 1~1.5 mL of 0.25%~0.5% trypsin is added; the digestion time in both step (2) and step (3) is 30~40 min.
6. The method according to claim 4, characterized in that, The digestion temperature is 36℃~38℃.
7. The application of the method according to any one of claims 1 to 6 in the preparation of experimental models for sex determination and / or horn type regulation in intersex goats.
8. The application of a reagent for overexpressing the FOXL2 gene in screening genes that regulate the horn-like trait in intersex goats or in research-assisted breeding of hornless normal goats.
9. The application according to claim 8, characterized in that, The nucleotide sequence of the FOXL2 gene is shown in SEQ ID NO.
1.
10. The application according to claim 8 or 9, characterized in that, The reagents include an overexpression recombinant vector containing the FOXL2 gene or a monoclonal cell line containing the overexpression recombinant vector.