A recombinant bacillus calmette-guerin strain and application thereof in preparation of tumor vaccine

Abstract

The application discloses a recombinant bacillus Calmette-Guerin (BCG) strain and application of the recombinant BCG strain in preparation of a tumor vaccine, wherein the recombinant BCG strain comprises an HPV16 E7 antigen gene with a nucleotide sequence as shown in SEQ ID NO:1; a cytolysin ClyA gene is further fused with the HPV16 E7 to be expressed, and a rBCG-ClyA+E7 recombinant strain is constructed; the recombinant BCG strain rBCG-E7 or rBCG-ClyA+E7 is applied in preparation of a vaccine for treating cervical cancer solid tumors; the anti-tumor effect is verified in a solid tumor model through a subcutaneous injection mode; the ClyA significantly improves the expression efficiency of an exogenous antigen in the BCG, and simultaneously enhances the presentation efficiency of an antigen presenting cell; the recombinant vaccine effectively activates an anti-tumor immune response, and does not cause obvious toxic side effects, thereby providing a safe and effective candidate strategy for immunotherapy of cervical cancer and other HPV related solid tumors.

Description

Technical Field

[0001] This invention belongs to the field of tumor vaccine technology, specifically relating to a recombinant BCG strain and its application in the preparation of tumor vaccines. Background Technology

[0002] Tumor immunotherapy is one of the most important breakthroughs in cancer treatment in recent years. Its core principle is to activate the body's own immune system to recognize and eliminate tumor cells. Compared with traditional surgery, radiotherapy, and chemotherapy, immunotherapy has unique advantages such as high specificity, relatively low toxicity and side effects, and the ability to form immune memory for long-term protection. Among the many immunotherapy strategies, therapeutic tumor vaccines have become a research hotspot due to their ability to induce specific anti-tumor immune responses and form long-term immune memory.

[0003] Bacillus Calmette-Guérin (BCG) is a live attenuated Mycobacterium bovis vaccine. The history of BCG's use as an immunomodulator in cancer treatment dates back to the mid-20th century. In 1976, the clinical efficacy of bladder instillation of BCG for bladder cancer was first reported. Since then, numerous clinical studies have confirmed that bladder instillation of BCG can significantly reduce the recurrence rate and progression risk of non-muscle-invasive bladder cancer. Currently, BCG has become the standard treatment for high-risk non-muscle-invasive bladder cancer and is the only bacterial agent currently approved for cancer treatment.

[0004] To further enhance the immunotherapeutic effect of BCG, researchers have attempted to genetically engineer BCG to construct recombinant BCG (rBCG) strains expressing exogenous immunomodulatory molecules. However, existing BCG and rBCG vaccines still have the following shortcomings: First, their indications are limited; currently, they are only approved for intracavitary instillation therapy for bladder cancer. Due to the anatomical specialties of the bladder as an instillation organ, there is a lack of effective applications for solid tumors. Second, they lack tumor antigen specificity; the anti-tumor effect of BCG mainly relies on non-specific activation of the immune response and cannot form specific immune memory against specific tumor antigens. Third, the training immune effect is not fully utilized; there is a lack of systematic research and effective strategies on how to organically combine training immunity with tumor antigen-specific responses. Fourth, their effect on reversing the immunosuppressive microenvironment is limited; tumors establish an immunosuppressive microenvironment by recruiting suppressor cells such as myeloid-derived suppressor cells (MDSCs), which is difficult for existing therapies to effectively reverse.

[0005] Extending BCG's anti-tumor strategy to solid tumors, selecting tumor types with a clear viral etiology is a reasonable entry point. Cervical cancer is a serious public health problem threatening women's health worldwide, with approximately 604,000 new cases and 342,000 deaths annually, ranking fourth among female malignant tumors. Approximately 99% of cervical cancer cases are closely related to human papillomavirus (HPV) infection, and its carcinogenic mechanism is mainly attributed to the HPV16 E6 and E7 oncogenic proteins. Based on the clear viral etiology of HPV, HPV16 E7, as a tumor-specific antigen, is persistently expressed in tumors but not in normal tissues, making it an ideal target for HPV-related tumor therapeutic vaccines. However, existing treatment strategies based on the HPV16 E7 antigen still have significant limitations: First, the delivery vector efficiency is insufficient. Current research mainly focuses on peptide vaccines, DNA vaccines, or dendritic cell (DC) vaccines, and the in vivo delivery efficiency of exogenous antigens, the uptake efficiency of antigen-presenting cells, and the specific T cell activation ability are still unclear. Second, clinical translation is difficult. Many HPV16 E7 therapeutic vaccines have failed to achieve ideal efficacy in clinical trials. For example, the ProCervix vaccine failed in a phase II clinical trial, and to date, no HPV therapeutic vaccine has been approved for marketing worldwide.

[0006] The aforementioned limitations indicate that relying solely on the delivery of HPV16 E7 antigen is insufficient to achieve ideal anti-tumor effects, necessitating the use of carrier systems with strong immune-activating capabilities. Traditional immunological theory holds that only adaptive immunity possesses immune memory function, while innate immune responses are transient and non-specific. However, recent studies have discovered that innate immune cells, after initial stimulation, can acquire enhanced responsiveness through epigenetic and metabolic reprogramming—a phenomenon known as "training immunity." BCG, as a classic innate immune activator, has been proven to induce training immunity, enabling monocytes and macrophages (Mφ) to acquire long-term enhanced immune responses through histone modification and metabolic reprogramming.

[0007] Cytolysin A (ClyA) is an α-perforating toxin found in bacteria such as Escherichia coli, capable of forming transmembrane pores. Due to obstacles such as heterologous expression, there are currently no reports on expressing ClyA in Mycobacterium tuberculosis (including BCG) to improve antigen delivery efficiency. Summary of the Invention

[0008] This invention provides a recombinant BCG strain containing the HPV16 E7 antigen gene with the nucleotide sequence shown in SEQ ID NO:1. The HPV16 E7 antigen gene is transformed into the BCG strain using the vector pMV261. The BCG strain is... Mycobacterium bovis BCG.

[0009] Another objective of this invention is to apply recombinant BCG strains in the preparation of vaccines for treating cervical cancer solid tumors.

[0010] Another objective of this invention is to apply the cytolysin ClyA gene in the preparation of a vaccine that enhances the ability of the above-mentioned recombinant BCG strain to treat solid tumors. The nucleotide sequence of the cytolysin ClyA gene is shown in SEQ ID NO:2.

[0011] The objective of this invention is achieved through the following technical solution: 1. The HPV16 E7 gene was obtained by chemical synthesis or polymerase chain reaction amplification, and BamHI and HindIII restriction sites were introduced at both ends of the gene. 2. The HPV16 E7 gene was ligated into the pMV261 vector, transformed into E. coli DH5α competent cells, positive clones were screened, recombinant plasmids were extracted and sequenced for verification. 3. Transform the recombinant expression vector into the BCG strain to prepare BCG competent cells. The recombinant plasmid is introduced by electroporation. After transformation, the bacterial culture is plated on M7H10 solid medium containing 25 μg / mL kanamycin and cultured at 37°C. Single colonies are picked for immunoblotting verification. 4. Culture rBCG positive clones and prepare vaccine formulation: Inoculate the correctly identified rBCG into M7H9 liquid medium and culture at 37°C until the logarithmic growth phase; collect the bacterial cells by centrifugation, adjust the bacterial concentration, and dispense to obtain live bacterial tumor vaccine; 5. The above-mentioned rBCG live bacterial tumor vaccine expressing tumor antigen was applied to the treatment of cervical cancer solid tumors by subcutaneous injection. The experimental results showed that the vaccine could effectively activate the anti-tumor immune response without causing obvious toxic side effects, achieving the best balance between efficacy and safety. 6. ClyA was fused with the HPV16 E7 antigen to construct a recombinant BCG (rBCG-ClyA+E7) expressing the ClyA+E7 fusion protein. While leveraging the immune-inducing advantages of BCG, the delivery efficiency of the HPV16 E7 antigen was enhanced by utilizing the characteristics of ClyA, thereby inducing a stronger E7-specific T cell response. This provides a new strategy for the treatment of HPV-related solid tumors such as cervical cancer. Experimental results showed that this fusion expression strategy can significantly increase the expression level of E7 protein in BCG, thereby enhancing the immunogenicity and anti-tumor effect of the vaccine.

[0012] Advantages and technical effects of the present invention: 1. This invention successfully constructed an rBCG vaccine expressing the HPV16 E7 antigen and verified its anti-tumor effect in a cervical cancer solid tumor model via subcutaneous injection. This vaccine fully utilizes the unique advantage of BCG as a natural immune activator, combining the training immune-inducing effect with the E7-specific adaptive immune response, achieving a synergistic effect of broad-spectrum innate immunity and precise antigen-specific immunity. Experimental results show that this recombinant vaccine effectively activates the anti-tumor immune response without causing significant toxic side effects, providing a safe and effective candidate strategy for the immunotherapy of HPV-related solid tumors such as cervical cancer.

[0013] 2. This invention further fuses ClyA with HPV16 E7 to construct a recombinant rBCG-ClyA+E7 strain. This fusion strategy utilizes ClyA to significantly enhance the expression efficiency of exogenous antigens in BCG, while simultaneously improving the presentation efficiency of antigen-presenting cells. This technical approach effectively solves the key technical challenge of low expression levels of exogenous antigens in mycobacteria, significantly enhancing the immunogenicity of the vaccine and providing a new technical solution for improving the anti-tumor efficacy of rBCG vaccines. Attached Figure Description

[0014] Figure 1 The morphological characteristics of wild-type BCG, rBCG-E7, and rBCG-ClyA+E7 strains on solid M710 and liquid M7H9 media are shown. The upper part is solid medium and the lower part is liquid medium. Figure 2 The results of acid-fast staining identification of wild-type BCG, rBCG-E7, and rBCG-ClyA+E7 strains; Figure 3 Growth curves for wild-type BCG, rBCG-E7, and rBCG-ClyA+E7 strains; Figure 4 The results are from the immunoblotting detection of wild-type BCG, rBCG-E7, and rBCG-ClyA+E7 strains. Figure 5 To optimize the experimental results for dosage; Figure 6 To optimize experimental results; Figure 7 The results of tumor morphology in the tumor growth monitoring experiment; Figure 8 The results of tumor volume statistics in the tumor growth monitoring experiment; Figure 9 The result shows the proportion of Th1 cells in tumor lymphocytes; Figure 10 Results showing the proportion of CTL cells in tumor lymphocytes; Figure 11 Results showing the proportion of CD8+T GZMB+ cells in tumor lymphocytes; Figure 12 The result shows the proportion of MDSC cells in tumor lymphocytes; Figure 13 This refers to the statistical results of ELISpot testing; Figure 14 This is the result of the ELISpot test; Figure 15 The concentration of IL6 in the supernatant of PBMC cells after LPS stimulation; Figure 16 The concentration of TNF-α in the supernatant of PBMC cells after LPS stimulation; Figure 17 Results showing the proportion of NK cells in tumor lymphocytes; Figure 18 Results showing the proportion of NK IFN-γ+ cells in tumor lymphocytes; Figure 19 Results showing the proportion of NK GZMB+ cells in tumor lymphocytes; Figure 20 The result shows the proportion of Tcm cells among tumor lymphocytes; Figure 21 The result shows the proportion of Tem cells in tumor lymphocytes; Figure 22 Results showing the proportion of DC cells in tumor lymphocytes; Figure 23 Results showing the proportion of DC CD86+ cells in tumor lymphocytes; Figure 24 The result shows the proportion of Mφ cells in tumor lymphocytes; Figure 25 The result shows the proportion of M1 cells in tumor lymphocytes; Figure 26 The result shows the proportion of M2 cells in tumor lymphocytes; Figure 27 The result shows the proportion of G-MDSC cells in tumor lymphocytes; Figure 28 The result shows the proportion of M-MDSC cells in tumor lymphocytes. Detailed Implementation

[0015] The present invention will be further described below with reference to the accompanying drawings and examples. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in this embodiment shall be operated in accordance with conventional methods, and the reagents used shall be conventional reagents or reagents prepared in accordance with conventional methods unless otherwise specified.

[0016] Example 1: Construction and identification of rBCG live bacterial tumor vaccine expressing HPV16 E7 antigen 1. Construction of recombinant plasmid pMV261-E7 Based on the HPV16 E7 gene sequence published in GenBank (accession number KJ152697.1), the HPV16 E7 gene expression fragment was optimized to form a recombinant HPV16 E7 gene, and BamHI and HindIII restriction sites were introduced at both ends of the gene; the nucleotide sequence of the recombinant HPV16 E7 gene is shown in SEQ ID NO:1, and its size is 297bp.

[0017] The synthesized HPV16 E7 gene and pMV261 vector were double-digested with BamHI and HindIII, respectively, and incubated at 37°C for 2 hours. After the digestion products were recovered by gel, they were ligated overnight at 16°C using T4 DNA ligase. The ligation products were transformed into E. coli DH5α competent cells, plated on LB agar plates containing 100 μg / mL kanamycin, and incubated at 37°C for 12-16 hours.

[0018] 2. Construction of rBCG-ClyA+E7 fusion expression vector Based on the ClyA gene sequence published in GenBank (accession number AF240780.1), the ClyA gene expression fragment was optimized to construct a recombinant ClyA gene (as shown in SEQ ID NO:2). The HPV16 E7 and ClyA genes were fused together using a flexible linker peptide (GGTTCGGGTGGCTCGGGTGGTGGCTCG) to construct a ClyA+E7 fusion gene. BamHI and HindIII restriction sites were introduced at both ends of the gene, with a size of 1233bp.

[0019] The ClyA+E7 fusion gene and the pMV261 vector were double-digested with BamHI and HindIII, respectively, to construct the pMV261-ClyA+E7 recombinant plasmid, using the same method as above.

[0020] 3. Preparation of rBCG Preparation of BCG competent cells: BCG cells were inoculated into M7H9 liquid medium (containing 10% OADC enrichment broth, 0.5% glycerol, and 0.05% Tween-80) and cultured at 37°C until the logarithmic growth phase (OD600 = 0.6-0.8). The cells were collected by centrifugation at 6000g for 15 minutes at 4°C, washed three times with pre-cooled 10% glycerol, and finally resuspended in 10% glycerol, adjusting the concentration to approximately 1×10⁻⁶. 8 CFU / mL.

[0021] Take 200 μL of BCG competent cells, add 1 μg of recombinant plasmid (pMV261-E7 or pMV261-ClyA+E7), mix well, and transfer to a 0.2 cm electroporation cuvette. Use the optimized electroporation parameters of this invention: voltage 2.5 kV, capacitance 25 μF, resistance 1000 Ω. Immediately after electroporation, add 1 mL of M7H9 medium and incubate at 37°C for 24 hours.

[0022] Spread the revived bacterial culture onto M7H10 solid medium containing 25 μg / mL kanamycin (containing 10% OADC enrichment broth and 0.5% glycerol), and incubate at 37°C and 5% CO2 for 3-4 weeks until visible single colonies appear.

[0023] 4. Observation of rBCG colony and bacterial culture morphology Observe the morphological characteristics of rBCG colonies and bacterial suspensions on solid M7H10 medium and liquid M7H9 medium, including size, color, and texture, and take photos for recording. The results are shown in [Table missing]. Figure 1 Colony morphology observation showed that after 4 weeks of culture, rBCG-E7 and rBCG-ClyA+E7 showed small, light yellow to milky white, dry and rough colonies, consistent with wild-type BCG. Bacterial suspension morphology observation showed that after 2 weeks of culture, rBCG-E7 and rBCG-ClyA+E7 showed slight turbidity, and the bacterial suspension existed in the form of dispersed or small clumps without obvious precipitation, consistent with wild-type BCG.

[0024] 5. Identification by acid-fast staining Select rBCG bacterial suspension cultured to the logarithmic growth phase and spread it onto a glass slide. Use Escherichia coli suspension as a negative control. After natural drying, fix with flame. Add carbolic acid fuchsin staining solution, heat until steam is generated, and maintain for 5 minutes; wash with water, then decolorize with 3% hydrochloric acid alcohol for 30 seconds; wash with water, then counterstain with methylene blue staining solution for 1 minute; wash with water, dry, and observe under a microscope. Figure 2 Acid-fast staining results showed that rBCG-E7 and rBCG-ClyA+E7 were positive, with the bacterial cells stained red and appearing as slender rods under the microscope, consistent with wild-type BCG.

[0025] 6. Growth curve determination Wild-type BCG, rBCG-E7, and rBCG-ClyA+E7 were inoculated into M7H9 liquid medium, and the initial OD600 value was adjusted to 0.05. OD600 values ​​were measured on days 0, 2, 4, 6, 8, 10, and 12 after culture, and growth curves were plotted. Figure 3Growth curve measurements showed that rBCG-E7 and rBCG-ClyA+E7 exhibited the same growth trends as wild-type BCG, all experiencing a lag phase, a logarithmic growth phase, and a stationary phase. The OD600 values ​​showed no significant differences at each time point, indicating that exogenous gene expression did not affect the growth and metabolism of BCG.

[0026] 7. Immunoblotting detection of E7 protein expression Collect rBCG bacterial culture in the logarithmic growth phase, adjust the initial OD600 value to 0.6, centrifuge at 4℃ and 6000g for 15 minutes to collect the bacterial cells, wash twice with PBS, add an appropriate amount of PBS to resuspend the bacterial cells, and sonicate (power 200W, 5 seconds working / 5 seconds intermittent, 30 minutes in total); centrifuge at 4℃ and 12000g for 15 minutes to collect the supernatant.

[0027] 15 μL of bacterial culture was subjected to SDS-PAGE electrophoresis (12.5% ​​separating gel), transferred to a PVDF membrane, and blocked with 5% skim milk powder at room temperature for 1 hour. Anti-HPV16 E7 monoclonal antibody (1:1000 dilution) was added and incubated overnight at 4°C. After washing three times with TBST, horseradish peroxidase-labeled secondary antibody (1:1000 dilution) was added and incubated at room temperature for 1 hour. After washing three times with TBST, the substrate was detected by chemiluminescence immunoassay.

[0028] Figure 4 Immunoblotting results showed that the rBCG-E7 strain exhibited a specific band at approximately 15 kDa, consistent with the expected molecular weight of HPV16E7 protein, while the wild-type BCG control group showed no corresponding band, indicating that the rBCG-E7 strain was successfully constructed. The rBCG-ClyA+E7 strain exhibited a stronger specific band at approximately 45 kDa, and its expression level was higher than that of the 15-fold concentrated rBCG-E7 strain, indicating a significant increase in E7 protein expression.

[0029] Example 2: Optimization of immunization dosage and route of rBCG live bacterial tumor vaccine 1. Establishment of an animal model of cervical cancer tumors Female C57BL / 6 mice aged 6-8 weeks were subcutaneously inoculated with 5×10⁶ cells on the right back. 5 One TC-1 cell line (a cell line established by co-transformation of primary lung epithelial cells from C57BL / 6 mice with HPV16 E6, E7 oncogenes and activated H-ras gene) was suspended in 100 μL PBS. When the tumor grew to approximately 5 mm in diameter, the tumor-bearing mice were randomly assigned to different groups for the experiment.

[0030] 2. Dosage optimization experiment Tumor-bearing mice were randomly divided into four groups (n=8 / group): PBS control group: 100 μL of PBS was injected subcutaneously; low-dose rBCG-E7 group: subcutaneous injection of 1×10 6 CFU rBCG-E7; medium-dose rBCG-E7 group: subcutaneous injection of 1×10 7 CFU rBCG-E7; High-dose rBCG-E7 group: subcutaneous injection of 1×10 8 CFU rBCG-E7; Each group received subcutaneous immunization on days 12, 19, and 26 after tumor inoculation, for a total of 3 times. The long and short diameters of the tumors were measured with calipers every 3 days, and the survival status of the mice was recorded. Mice with tumors exceeding 2 cm in length were euthanized.

[0031] Dosage optimization results show that 1×10 6 CFU dosage group significantly prolonged the survival time of mice ( Figure 5 ).

[0032] 3. Pathway optimization experiment Tumor-bearing mice were randomly divided into three groups (n=8 / group): PBS control group: PBS was injected subcutaneously; rBCG-E7 subcutaneous group: subcutaneous injection of 1×10 6 CFU rBCG-E7; rBCG-E7 intradermal group: intradermal injection of 1×10 6 CFU rBCG-E7; Each group was immunized on days 12, 19, and 26 post-tumor inoculation, for a total of three times. Tumor monitoring methods were the same as above.

[0033] Optimization of the treatment pathway showed that the subcutaneous injection group had a significantly longer survival time than the intradermal injection group. Figure 6 ).

[0034] Example 3: Evaluation of the effect of rBCG live bacterial tumor vaccine on remodeling the tumor immune microenvironment 1. Establishment and grouping of animal tumor models The tumor model was established as in Example 2. Tumor-bearing mice were randomly divided into four groups (n=8 / group): PBS control group: 100 μL of PBS was injected subcutaneously; BCG control group: subcutaneous injection of 1×10 6 CFU BCG; rBCG-E7 group: subcutaneous injection of 1×10 6 CFU rBCG-E7; rBCG-ClyA+E7 group: subcutaneous injection of 1×10 6 CFU rBCG-ClyA+E7; 2. Immunization regimen Each group received subcutaneous immunization on days 12, 19, and 26 post-tumor inoculation, for a total of three immunizations; the immunization dose for each group was 1×10⁻⁶. 6 CFU / each.

[0035] 3. Tumor growth monitoring The growth monitoring method is the same as in Example 2. The tumor volume is calculated using the formula: Tumor volume (mm²) 3 ) = (major axis × minor axis) 2 ) / 2. Monitor continuously until day 33 and plot the tumor growth curve.

[0036] Figure 7 , Figure 8 Tumor growth curves showed that, compared with the PBS control group, both the rBCG-E7 group and the rBCG-ClyA+E7 group significantly inhibited tumor growth, and the rBCG-ClyA+E7 group was more effective than the rBCG-E7 group.

[0037] 4. Sample Collection and Processing Mice were sacrificed on day 33, and tumor tissue was aseptically isolated. The tumor tissue was cut into pieces and placed in RPMI 1640 medium containing collagenase (1 mg / mL). It was shaken and digested at 37°C for 1 hour. The mixture was then filtered through a 70 μm cell sieve to prepare a single-cell suspension.

[0038] 5. Flow cytometry detection Take a single-cell suspension of tumor cells and adjust the concentration to 1×10⁻⁶. 7 Cells / mL, added to flow cytometry tubes. Add fluorescently labeled antibody combination, incubate at 4°C in the dark for 30 minutes. After washing with PBS, analyze the following cell subset proportions using flow cytometry: Effector T cells: T helper 1 cell (Th1) (CD3+CD4+IFN-γ+), cytotoxic T lymphocyte (CTL) (CD3+CD8+IFN-γ+), CD8+ T granzyme B (GZMB)+ (CD3+CD8+GZMB+). Immunosuppressive cells: MDSCs (CD11b+Gr-1+) Flow cytometry results showed that, compared with the PBS control group, Th1 (…) levels in tumor tissues of the rBCG-E7 group and the rBCG-ClyA+E7 group were significantly higher. Figure 9 ), CTL ( Figure 10 ) and CD8+T GZMB+ ( Figure 11 The proportion of MDSC ( ) increased significantly. Figure 12 The proportion of ) decreased significantly, and the effect was more significant in the rBCG-ClyA+E7 group.

[0039] 6. Enzyme-linked immunospot assay (ELISpot) for detecting E7-specific T cell responses. Lymphocytes isolated from tumor tissue were adjusted to a concentration of 2.5 × 10⁻⁶. 6 Cells / mL were added to 100 μL per well of an ELISpot plate pre-coated with anti-IFN-γ antibody. E7 peptide (final concentration 5 μg / mL) was added, and the plate was incubated at 37°C and 5% CO2 for 36 hours. Cells were discarded, and the plate was washed with PBS. Biotin-labeled detection antibody, horseradish peroxidase-labeled streptavidin, and finally substrate chromogenic buffer were added sequentially. After air drying, the number of cells forming spots was counted using an ELISpot reader.

[0040] ELISAPT assays showed that, after stimulation with E7 peptide, tumor lymphocytes in the rBCG-E7 and rBCG-ClyA+E7 groups exhibited significantly higher levels of IFN-γ secretion compared to the PBS control group, with the rBCG-ClyA+E7 group showing a more pronounced effect. Figure 13-14 ).

[0041] The above results indicate that the rBCG live bacterial tumor vaccine expressing HPV16 E7 antigen constructed in this invention can effectively reshape the tumor immune microenvironment, increase effector T cell infiltration, reduce immunosuppressive cells, and induce E7-specific T cell responses, among which the rBCG-ClyA+E7 vaccine has the best effect.

[0042] Example 4: rBCG live bacteria tumor vaccine significantly enhances training immune response 1. Establishment of animal tumor models and immunization Same as steps 1-2 in Example 3; 2. Sample Collection and Processing Mice were sacrificed on day 33, and peripheral blood was collected through the orbital venous plexus and placed in heparin sodium anticoagulant tubes. At the same time, after the mice were sacrificed, tumor tissue was aseptically isolated and single-cell suspensions were prepared according to the method in Example 3.

[0043] 3. Isolation of peripheral blood mononuclear cells (PBMCs) and stimulation with lipopolysaccharide (LPS) PBMCs were separated by density gradient centrifugation: Anticoagulated blood was mixed with an equal volume of PBS and carefully added to the upper layer of lymphocyte separation medium. The mixture was centrifuged at 800g for 30 minutes, and the white membrane layer cells were aspirated. The cells were washed twice with PBS to obtain PBMCs. Adjust the concentration of PBMC to 1×10⁻⁶ using RPMI 1640 medium containing 10% FBS. 6 Cells / mL, 200 μL per well in a 96-well cell culture plate. Experimental groups received LPS (final concentration 100 ng / mL), while the control group received an equal volume of PBS; cultured at 37°C and 5% CO2 for 24 hours.

[0044] 4. Cytokine detection After culture, the cell culture supernatant was collected, and the levels of IL6 and TNF-α were detected using an enzyme-linked immunosorbent assay (ELISA) kit. The kit instructions were strictly followed, and absorbance values ​​were read at 450 nm using a microplate reader. Cytokine concentrations were calculated based on a standard curve.

[0045] 5. Flow cytometry detection of immune cell subsets in tumor tissue Single-cell suspensions of tumor tissue were collected, and the proportions of the following cell subsets were detected using multicolor flow cytometry: Memory T cells: Central memory T cells (Tcm) (CD3+CD8+CD44+CD62L+) and effector memory T cells (Tem) (CD3+CD8+CD44+CD62L-). Natural killer cells: NK (CD3-NK1.1+), NK IFN-γ⁺ (CD3-NK1.1+IFN-γ+), NK GZMB+ (CD3-NK1.1+ GZMB+) Dendritic cells: DC (CD11b+CD11c+), DC CD86+ (CD11b+CD11c+CD86+) Macrophages: Mφ (CD11b+F4 / 80+), M1 (CD11b+F4 / 80+CD86+), M2 (CD11b+F4 / 80+CD206+) Myeloid-derived suppressor cells: G-MDSCs (CD11b+Ly6G+Ly6C+), M-MDSCs (CD11b+Ly6G-Ly6C+) The specific staining method and flow cytometry analysis are the same as in Example 3.

[0046] 6. Results Evaluation of training immune response: After LPS stimulation, IL-6 (IL-6) levels in the supernatant of PBMCs in the rBCG-E7 group and the rBCG-ClyA+E7 group were significantly higher than those in the rBCG-E7 group. Figure 15 ) and TNF-α ( Figure 16 The levels of the two vaccines were significantly higher than those in the PBS control group, indicating that both vaccines successfully induced a trained immune state, enabling innate immune cells to produce an enhanced response to foreign stimuli.

[0047] Immune cell infiltration in tumor tissues: Compared with the PBS control group, the following changes were observed in the tumor tissues of the rBCG-E7 group and the rBCG-ClyA+E7 group: Natural killer cells: Total number of NK cells ( Figure 17 ) and IFN-γ+ ( Figure 18 ), GZMB+ Figure 19 The significantly increased proportion of NK cells indicates that NK cells were effectively recruited and activated; Memory T cells: Tcm ( Figure 20 ), Tem ( Figure 21 The significantly increased proportion of these cells indicates that the vaccine promoted the formation and infiltration of memory T cells. Antigen-presenting cells: Total number of DCs ( Figure 22 ) and DC CD86+ ( Figure 23 ) proportion, total number of Mφ ( Figure 24 ) and M1 ( Figure 25 The significantly increased proportion indicates that the tumor's local antigen presentation ability is enhanced; Immunosuppressive cells: M2 ( Figure 26 ), G-MDSC ( Figure 27 M-MDSC Figure 28 The significant decrease in the proportion of tumor immunosuppressive network indicates that the tumor immunosuppressive network has been effectively dismantled.

[0048] Furthermore, all of the above indicators showed significantly better results in the rBCG-ClyA+E7 group than in the rBCG-E7 group.

[0049] The results of this embodiment demonstrate that the rBCG live bacterial tumor vaccine expressing HPV16 E7 antigen constructed in this invention can: (1) Successful induction of training immunity; after secondary stimulation with LPS, the levels of IL6 and TNF-α in the supernatant of PBMC cells were significantly increased. (2) Systematically remodel the tumor immune microenvironment and increase the infiltration of memory T cells, activated NK cells and mature antigen-presenting cells; (3) Effectively reduces the proportion of immunosuppressive cells and relieves the tumor immunosuppressive network; (4) Enhanced E7 expression through ClyA fusion can further amplify the above effects.

[0050] The above results corroborate the findings of Example 3, jointly demonstrating that the vaccine of the present invention achieves a systematic reshaping of the tumor immune microenvironment through a synergistic activation mechanism of trained immunity and acquired immunity.

Claims

1. A recombinant BCG vaccine strain, characterized in that: It contains the HPV16 E7 antigen gene with a nucleotide sequence as shown in SEQ ID NO:

1.

2. The recombinant BCG strain according to claim 1, characterized in that: The HPV16 E7 antigen gene was transformed into the BCG strain via the pMV261 vector.

3. The use of the recombinant BCG strain according to claim 1 in the preparation of a vaccine for treating cervical cancer solid tumors.

4. The application of the cytolysin ClyA gene in the preparation of a vaccine that enhances the therapeutic efficacy of the recombinant BCG strain of claim 1 for treating cervical cancer solid tumors, characterized in that: The nucleotide sequence of the cytolysin ClyA gene is shown in SEQ ID NO:2.

Images