Application of miR-32 in improving the development ability of porcine immature oocytes after freezing

By using miR-32 mimic transfection solution to enhance the developmental capacity of frozen porcine immature oocytes after in vitro maturation culture, the problem of unsatisfactory developmental capacity of frozen oocytes was solved, and the blastocyst formation rate was significantly improved.

CN122104564APending Publication Date: 2026-05-29YUNNAN ANIMAL SCI & VETERINARY INST
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YUNNAN ANIMAL SCI & VETERINARY INST
Filing Date
2026-03-04
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing technologies, the developmental capacity of frozen porcine oocytes differs significantly from that of fresh oocytes. Therefore, improving the developmental capacity of frozen oocytes is an urgent problem to be solved.

Method used

The miR-32 mimic was transfected by incubating frozen immature porcine oocytes in a transfection solution containing the miR-32 nucleotide sequence after in vitro maturation culture. The specific steps included incubation for 2-6 hours at a concentration of 25 nM-200 nM in a carbon dioxide incubator at 39°C, 5% CO2, and 100% humidity.

Benefits of technology

It improved the early embryonic development ability of frozen porcine immature oocytes, increasing the blastocyst formation rate by more than 10 percentage points. miR-32 can serve as a key marker molecule for frozen oocyte damage, and its expression level can be upregulated through gene transfection technology to improve the maturation quality of frozen oocytes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104564A_ABST
    Figure CN122104564A_ABST
Patent Text Reader

Abstract

The application relates to the field of super-low-temperature cryopreservation of mammalian oocytes, and particularly relates to application of miR-32 in improving the development capacity of pig immature oocytes after freezing. Pig immature oocytes are frozen and cultured in vitro, and mature oocytes which are cultured to expel the first polar body are incubated in transfection liquid containing a miR-32 nucleotide sequence for 2-6 hours; the pig immature oocytes are GV stage oocytes; and the miR-32 nucleotide sequence is shown in SEQ ID NO:1. It is found that miR-32 can be used as a key marker molecule of damage of vitrification oocytes, and by transfecting miR-32 mimics into the frozen oocytes, the early embryo development capacity of the oocytes can be improved, a new solution is provided for improving the maturation quality of the frozen oocytes, and various embryo biological technology researches are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cryopreservation technology for mammalian oocytes, specifically to the application of miR-32 in improving the developmental capacity of frozen porcine immature oocytes. Background Technology

[0002] Cryopreservation technology for mammalian oocytes has contributed to the development of research fields such as animal husbandry, bioengineering, and human medicine, and is of great significance in the reserve of female genetic resources in livestock. In recent years, research on vitrification cryopreservation technology for porcine oocytes has achieved many breakthroughs, successfully obtaining healthy piglets derived from frozen immature oocytes. However, frozen oocytes still lag significantly behind fresh oocytes in terms of early developmental capacity. Therefore, improving the developmental capacity of frozen oocytes is an urgent problem to be solved.

[0003] The mechanisms of oocyte cryopreservation damage are receiving increasing attention, which can help in taking corresponding improvement measures to mitigate or overcome certain cryopreservation injuries, thereby improving the developmental capacity of frozen oocytes. Currently, research on oocyte cryopreservation damage has progressed from the cellular level to the molecular level, for example, by analyzing the mRNA transcriptome information of frozen oocytes. Transcriptomics studies include mRNA and non-coding RNA. Identifying and analyzing non-coding RNAs in frozen oocytes can provide a deeper understanding of the reasons for their decreased developmental capacity. MicroRNAs (miRNAs) are a class of endogenous short-sequence, single-stranded, non-coding RNAs in eukaryotes, possessing high conservation and playing an important role in regulating gene expression at the posttranscriptional level. In recent years, some studies have been conducted on the role of miRNAs in animal reproduction, such as their function in regulating oocyte meiosis, early embryonic cleavage, and maternal RNA degradation. Currently, there are only reports of vitrification affecting miRNA expression changes in mouse or porcine embryos. Therefore, studying the miRNA expression profiles of frozen oocytes and further analyzing the functional roles of differentially expressed miRNAs can provide new insights into improving their developmental capacity.

[0004] Our team previously filed Chinese patent 202411897275.X, which discloses a regulator, N-(2-(2-(4-chlorophenyl)thiazo-4-yl)ethyl)butyryl (Azoramide), that can improve the maturation quality of frozen porcine oocytes by enhancing mitochondrial function after in vitro maturation. However, the relationship between miRNAs and cryogenic damage to oocytes has not been thoroughly investigated previously.

[0005] miR-32 is a non-coding RNA of 18-25 nucleotides in length, belonging to the miRNA family. It regulates gene expression by binding to the 3'UTR region of target gene mRNA, inhibiting its translation or promoting its degradation. Existing technologies have revealed that miR-32 participates in the pathogenesis of various diseases (such as tumors, schizophrenia, and myocardial infarction) through gene expression regulation. Chinese Patent 202210082767.8 discloses the application of miR-32-5p in the preparation of drugs that enhance the sensitivity of tumor cells to dihydroartemisinin, proposing that miR-32-5p can increase the sensitivity of neuroblastoma cells to dihydroartemisinin, thereby enhancing the therapeutic effect. However, there are currently no reports on the application of miR-32 in improving the developmental capacity of frozen oocytes. Summary of the Invention

[0006] To address the above problems, this invention proposes the application of miR-32, a miRNA that can regulate the developmental capacity of frozen oocytes, in improving the developmental capacity of frozen immature porcine oocytes. The aim is to solve the problem of unsatisfactory developmental capacity of frozen porcine oocytes.

[0007] This invention provides a method for improving the developmental capacity of frozen porcine immature oocytes. The frozen porcine immature oocytes are subjected to in vitro maturation culture, and the mature oocytes that have extruded the first polar body are placed in a transfection solution containing the miR-32 nucleotide sequence and incubated for 2-6 hours. The porcine immature oocytes are GV stage oocytes. The miR-32 nucleotide sequence is shown in SEQ ID NO:1.

[0008] Furthermore, the mature oocytes were incubated in a transfection solution containing the miR-32 nucleotide sequence for 4 hours.

[0009] Furthermore, the transfection solution containing the miR-32 nucleotide sequence was prepared using a miR-32 mimic.

[0010] Furthermore, the concentration of the transfection solution containing the miR-32 nucleotide sequence is 25 nM to 200 nM.

[0011] Furthermore, the concentration of the transfection solution containing the miR-32 nucleotide sequence is 50 nM.

[0012] Furthermore, the incubation conditions are as follows: incubation in a carbon dioxide incubator at 39°C, 5% CO2, and 100% humidity.

[0013] Furthermore, the freezing process is vitrification freezing.

[0014] Furthermore, the in vitro maturation culture includes the following steps:

[0015] S1. Add 500 μL of in vitro maturation solution to each well of a 24-well plate, cover with 300 μL of paraffin oil, and equilibrate for more than 3 hours in a carbon dioxide incubator at 39°C, 5% CO2 and 100% humidity.

[0016] S2. After washing the frozen immature porcine oocytes three times in the in vitro maturation solution, place them into culture wells, 40-60 oocytes per well, and culture them in a carbon dioxide incubator at 39°C, 5% CO2 and 100% humidity for 42 hours.

[0017] The beneficial effects of this invention are as follows:

[0018] 1. This invention utilizes miRNA sequencing technology to analyze the miRNA expression profile of vitrified porcine oocytes after in vitro maturation and screen for differentially expressed miRNAs. Compared with fresh oocytes and oocytes treated with toxicity, miR-32 was a significantly downregulated miRNA in the frozen group. Further investigation of miR-32 target gene information and bioinformatics analysis revealed that the target genes are mainly involved in a series of pathways related to oocyte maturation quality, including cAMP signaling, actin cytoskeleton regulation, oocyte meiosis, cell cycle, and mTOR signaling. These results indicate that miR-32 can serve as a key marker molecule for damage in vitrified oocytes.

[0019] 2. This invention provides the application of miR-32 in improving the developmental capacity of frozen porcine immature oocytes. By transfecting frozen oocytes with miR-32 mimics, early embryonic development can be enhanced. In vitro embryo culture experiments showed that parthenogenetic activated embryos obtained from frozen immature porcine oocytes using the technique described in this invention had a blastocyst formation rate approximately 10 percentage points higher than conventional methods. This invention provides a novel use for miR-32 as a molecular marker of oocyte cryopreservation damage. Upregulating its expression level through gene transfection technology can improve the developmental capacity of frozen oocytes, providing a new solution for improving the maturation quality of frozen oocytes and benefiting various embryo biotechnology research. Attached Figure Description

[0020] Figure 1 Statistics on the length of miRNAs in the samples from Example 1;

[0021] Figure 2 This is a heatmap of differentially expressed miRNAs between frozen oocytes and fresh oocytes in Example 1.

[0022] Figure 3 This is a heatmap of differentially expressed miRNAs between frozen oocytes and toxically treated oocytes in Example 1.

[0023] Figure 4 This is a bubble diagram showing the KEGG pathway enrichment of miR-32 target genes in Example 1;

[0024] Figure 5 This is for the detection of transfection efficiency of miR-32 simulant in Example 2. Detailed Implementation

[0025] The present invention will be further described below with reference to the embodiments.

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Example 1: miRNA transcriptome sequencing analysis of frozen immature porcine oocytes after in vitro maturation:

[0028] 1.1 Collection of porcine oocytes:

[0029] Pig ovaries were collected from local slaughterhouses and placed in physiological saline containing penicillin and streptomycin at 37°C. They were then transported back to the laboratory within 4 hours. The ovaries were washed 2-3 times with the same saline solution. Follicular fluid was extracted from follicles with a diameter of 3-8 mm on the surface of the ovary using a 20 mL disposable syringe with an 18-gauge needle. This fluid was then transferred to a 50 mL centrifuge tube to allow the GV-stage oocytes to settle naturally. The precipitate was washed twice in TL-Hepes-PVA solution and then transferred to a culture dish. Under a stereomicroscope, GV (germinal vesicle) stage oocytes with uniform cytoplasm and at least three layers of granulosa cells (i.e., immature oocytes) were selected using a pipette.

[0030] The TL-Hepes-PVA solution consists of 6.662 g / L sodium chloride, 0.2386 g / L potassium chloride, 0.168 g / L sodium bicarbonate, 0.046 g / L potassium dihydrogen phosphate, 2.383 g / L HEPES, 0.022 g / L sodium pyruvate, 0.856 mL sodium lactate, 2.186 g / L sorbitol, 0.102 g / L magnesium chloride hexahydrate, 0.294 g / L calcium chloride dihydrate, 0.065 g / L penicillin, 0.05 g / L streptomycin, and 3 g / L bovine serum albumin, fully dissolved in ultrapure water, brought to a final volume of 1 L, adjusted to pH 7.2–7.4, filtered through a 0.22 μm filter, dispensed, and stored at 4°C for later use.

[0031] 1.2 Freezing and thawing of porcine oocytes:

[0032] Oocyte vitrification was performed at 25°C using Cryotop as the cryoprotectant. First, the immature porcine oocytes obtained in step 1.1 were washed in basal solution for 3 minutes, then equilibrated in equilibration solution for 10 minutes, and then transferred to vitrification solution for 30–40 seconds. Finally, they were neatly arranged on Cryotop tips and placed in liquid nitrogen for preservation. The time the oocytes spent in the vitrification solution did not exceed 1 minute. For thawing, the Cryotop carrier was removed from the liquid nitrogen, and the portion containing the oocytes was quickly immersed directly in 1 mol / L sucrose thawing solution at 42°C for 1 minute. Then, the oocytes were sequentially transferred to 0.5 mol / L and 0.25 mol / L sucrose thawing solutions for 2.5 minutes each, and finally equilibrated in basal solution for 5 minutes, thus completing the thawing process.

[0033] In addition, oocytes for toxic treatment were prepared by washing the porcine immature oocytes obtained in 1.1 in the basal solution for 3 minutes, then transferring them to the equilibration solution for 10 minutes, then transferring them to the vitrification freezing solution for 30-40 seconds, and finally processing them according to the thawing procedure.

[0034] The base solution is DuPont phosphate buffer with 20% fetal bovine serum added; the equilibration solution is the base solution with 5% ethylene glycol added; the freezing solution is the base solution with 5% polyvinylpyrrolidone, 0.6 mol / L sucrose and 5% ethylene glycol added; and the thawing solution is a sucrose thawing solution with concentrations of 1 mol / L, 0.5 mol / L and 0.25 mol / L prepared using the base solution.

[0035] 1.3. In vitro maturation culture of porcine oocytes:

[0036] First, 500 μL of in vitro maturation medium was added to each well of a 24-well plate, covered with 300 μL of paraffin oil, and equilibrated for at least 3 hours in a carbon dioxide incubator at 39°C, 5% CO2, and 100% humidity. The fresh immature oocytes obtained in 1.1, the frozen immature oocytes obtained in 1.2, and the toxic treatment immature oocytes were washed three times in the in vitro maturation medium and then placed into culture wells, approximately 50 oocytes per well, and cultured for 42 hours in a carbon dioxide incubator under the above conditions. After in vitro maturation culture was completed, the oocytes were placed in 0.5 mL centrifuge tubes containing 0.1% (w / v) hyaluronidase solution. The cumulus granulosa cells were gently removed by pipetting with a 200 μL pipette, and the oocytes were washed three times with the in vitro manipulation solution. Finally, mature oocytes with homogeneous cytoplasm and extrusion of the first polar body were selected under a stereomicroscope for later use.

[0037] The in vitro maturation solution comprises 90% TCM199 (v / v), 10% porcine follicular fluid (v / v), 0.1 g / L sodium pyruvate, 0.07 g / L cysteine, 0.55 g / L glucose, 10 ng / mL epidermal growth factor, 0.065 g / L penicillin, 0.05 g / L streptomycin, 0.5 μg / mL follicle-stimulating hormone, and 0.5 μg / mL luteinizing hormone.

[0038] The in vitro operating solution includes TCM199 supplemented with 2.383 g / L HEPES, 2.603 g / L HEPES-Na, 0.065 g / L penicillin, 0.05 g / L streptomycin, and 0.5% (v / v) fetal bovine serum.

[0039] 1.4 miRNA transcriptome sequencing:

[0040] Samples were collected from fresh, virulence-treated, and frozen oocytes cultured in vitro as obtained in section 1.3. Total RNA was extracted, and the samples were quality checked using an ND-1000 Nanodrop and an Agilent 2200 TapeStation. For qualified samples, the total RNA was ligated with 5' and 3' adapters to synthesize first-strand cDNA, which was then amplified by PCR. A cDNA library with insert fragments of approximately 18–40 nt was obtained by gel electrophoresis and sequenced. The 50 nt raw reads obtained from Illumina HiSeq™ 2500 sequencing were initially filtered by removing adapters, low-quality reads, and other contaminants to obtain clean reads. Sequence length distribution and common sequences among samples were statistically analyzed. Clean reads were then categorized and annotated to obtain information on the composition and expression levels of various sRNAs in the samples. After annotating all sRNA fragments, the remaining unannotated fragments were used to predict new miRNAs. After analyzing the base composition and quality values ​​of the data, the data is filtered based on the original analysis results to remove adapter sequences, contaminants, and sequences containing excessive low-quality bases. For paired-end sequencing data, the filtered data requires further screening to retain paired sequences, resulting in clean data. After filtering, the clean data undergoes quality analysis to determine the base content and base quality distribution, confirming that the filtered data meets the analytical requirements.

[0041] After length filtering, the data were used to identify miRNAs using ACGT101-miR, and the expression level of miRNAs in each sample was calculated. The expression levels were statistically analyzed to assess the correlation of miRNA expression characteristics within and between groups, as well as differentially expressed miRNAs. The lengths of identified miRNAs were statistically analyzed, with the x-axis representing miRNA length and the y-axis representing the number of duplicated miRNAs. The miRNA lengths were mainly concentrated in the range of 19–24 nt. Figure 1 ).

[0042] Differentially significant miRNAs refer to the sum of upregulated and downregulated miRNAs among samples or within the same sample after different treatments. The threshold for screening differentially expressed miRNAs was P < 0.05. In the comparison group of frozen oocytes and fresh oocytes, a total of 10 differentially expressed miRNAs were identified. The 5 upregulated miRNAs were ssc-miR-27b-5p_R-1, ssc-miR-28-3p, ssc-miR-186-5p_R-1, ssc-miR-574-3p, and ssc-miR-28-5p_R+1; the 5 downregulated miRNAs were PC-3p-72139_58, PC-5p-51859_88, ssc-miR-32_R+1, ssc-miR-424-3p, and PC-3p-109161_30. Figure 2 In the comparison group of frozen oocytes and toxically treated oocytes, ssc-miR-6516 was upregulated, while ssc-miR-32_R+1 and PC-5P-173402_14 were downregulated. Figure 3 Among them, ssc-miR-32_R+1 is a miRNA shared by both comparison groups, and both showed downregulation.

[0043] Furthermore, TargetScan and miRanda were used to predict the target genes of ssc-miR-32. TargetScan removed target genes with a context score percentile less than 50, while miRanda removed target genes with a maximum free energy greater than -10. The intersection of these two algorithms was used as the final target genes for differentially expressed miRNAs. To further understand the biological processes involved by the target genes of differentially expressed miRNAs, Kyoto Encyclopedia of Genes and Genomes (KEGG) functional annotation was performed to establish a link between miRNAs and their functions mediated by genes. KEGG functional analysis showed that the target genes are mainly involved in a series of pathways related to oocyte maturation quality, including cAMP signaling, actin cytoskeleton regulation, progesterone-mediated oocyte maturation, oocyte meiosis, GnRH signaling, cell cycle, FoxO signaling, cell senescence, PI3K-Akt signaling, autophagy, and mTOR signaling. Figure 4 ).

[0044] Based on the above analysis, it can be determined that miR-32 can serve as an important marker molecule for frozen oocyte damage, and its nucleotide sequence is UAUUGCACAUUACUAAGUUGC (as in SEQ ID NO.1, where the uracil “u” is represented by “t”).

[0045] Example 2: miR-32 mimics enhance the developmental capacity of frozen porcine immature oocytes:

[0046] 2.1 miR-32 mimic transfection:

[0047] Gene transfection methods include electroporation, microinjection, nanoparticle transfection, liposome transfection, and viral particle transfection, all of which are well-known technologies in the field and will not be described in detail here.

[0048] This embodiment uses commercially available Lipofectamine. TM 3000 represents the miR-32 mimic used for transfection. The negative control mimic, miR-32 mimic, and 5-FAM-labeled miR-32 mimic were all purchased from Guangzhou Ribo Biotechnology Co., Ltd.

[0049] Referring to Example 1, frozen immature porcine oocytes were subjected to in vitro maturation culture, and cumulus granulosa cells were removed after 42 hours of culture; according to Lipofectamine... TMThe 3000 procedure instructions outline the preparation of transfection buffer, negative control miR-32 mimic, and 5-FAM-labeled miR-32 mimic. The miR-32 mimic transfection buffer was divided into four groups with concentrations of 25 nM, 50 nM, 100 nM, and 200 nM. The negative control group consisted of frozen oocytes transfected with a negative random sequence; the 5-FAM-labeled group consisted of frozen oocytes transfected with 5-FAM-labeled miR-32 mimic; and the experimental groups consisted of frozen oocytes transfected with miR-32 mimic at concentrations of 25 nM, 50 nM, 100 nM, and 200 nM. Mature oocytes cultured until they extruded the first polar body were incubated in the transfection buffer for 4 hours to transfect miR-32 into the oocytes. The incubation conditions were 39°C, 5% CO2, and 100% humidity.

[0050] Simultaneously, a fresh control group (i.e., fresh oocytes) and a frozen control group (i.e., frozen oocytes) were set up. During the transfection and incubation of the negative control group, 5-FAM labeled group, and experimental group, the fresh control group and the frozen control group were cultured in in vitro maturation medium for 4 hours.

[0051] Transfection efficiency was verified using 5-FAM-labeled miR-32 mimics. After transfection, oocytes from the 5-FAM-labeled group were observed and photographed under an inverted fluorescence microscope. The cytoplasm appeared green, indicating that the miR-32 mimics had been transfected into the cytoplasm. Figure 5 As shown, the left image shows bright field oocytes, and the right image shows oocytes transfected with 5-FAM-labeled miR-32 mimics, which exhibit green fluorescence. This suggests that the miR-32 mimics in each experimental group have also been transfected into the cytoplasm.

[0052] 2.2 In vitro embryo culture

[0053] After incubation in step 2.1, oocytes from each treatment group (except the 5-FAM labeled group) were washed in electroactivation solution for approximately 30 seconds, and then rapidly transferred between the two electrodes in a 1 mm fusion tank covered with electroactivation solution for electroactivation. The conditions were: electric field strength 1.3 kV / cm, DC pulse duration 80 μs, and one pulse. After electroactivation, the oocytes were cultured in auxiliary activation solution for 4 hours at 39°C, 5% CO2, and 100% humidity.

[0054] The electroactivating solution consists of 0.3 mol / L mannitol, 0.1 mmol / L calcium chloride dihydrate, 0.1 mmol / L magnesium sulfate heptahydrate, and 0.1 g / L polyvinyl alcohol. It is filtered and dispensed through a 0.22 μm filter and stored at -20°C for later use.

[0055] The auxiliary activation solution is PZM-3 solution with 5 μg / mL cytochalasin B and 10 μg / mL actinomycin added.

[0056] The PZM-3 solution consists of 6.312 g / L sodium chloride, 2.106 g / L sodium bicarbonate, 0.746 g / L potassium chloride, 0.048 g / L potassium dihydrogen phosphate, 0.022 g / L sodium pyruvate, 0.048 g / L magnesium sulfate, 0.616 g / L L-calcium lactate, 0.292 g / L L-glutamine, 0.05 g / L gentamicin, 0.546 g / L sodium taurate, 4 g / L BSA, 20 mL of non-essential amino acid solution, and 40 mL of essential amino acid solution, diluted to 1 L, adjusted to pH 7.2-7.4, and osmotic pressure 272-288 mOsm, filtered through a 0.22 μm filter, dispensed, and stored at 4°C for later use.

[0057] After parthenogenetic activation, oocytes were washed three times in PZM-3 solution and then transferred in groups of 15 into 50 μL droplets of PZM-3 solution for in vitro embryo culture at 39°C, 5% CO2, and 100% humidity. The PZM-3 solution needed to be equilibrated in a CO2 incubator under these conditions for at least 3 hours. Cleavage rate and blastocyst formation rate were observed at 48 h and 168 h, respectively.

[0058] 2.3 Data Statistics and Experimental Results:

[0059] Unless otherwise specified, data were statistically analyzed using SPSS 20 software. Duncan's multiple comparisons were used to determine significance, with P < 0.05 considered significant. Results are expressed as mean ± standard error.

[0060] As shown in Table 1, there was no significant difference in blastocyst formation rate between the negative control group and the frozen control group. However, the cleavage rate and blastocyst formation rate were higher in the experimental groups with concentrations of 50 nM and 100 nM. Among them, the 50 nM concentration of miR-32 mimic had the best efficiency in promoting parthenogenetic embryos to blastocysts, with an improvement of more than 10 percentage points.

[0061] Table 1. Development of parthenogenetic embryos after oocyte transfection with miR-32.

[0062]

[0063] Note: Different letters in the superscript of data in the same column indicate significant differences (P<0.05), and no letter indicates no significant differences (P>0.05).

[0064] In summary, this invention provides the application of miR-32 in improving the developmental capacity of frozen porcine immature oocytes. Specifically, transfecting frozen oocytes with miR-32 mimics enhances their early embryonic development. In particular, a 50 nM concentration of miR-32 mimics showed the best efficiency in promoting parthenogenetic embryonic development to the blastocyst stage, increasing the efficiency by more than 10 percentage points. Therefore, miR-32 can serve as a molecular marker for oocyte cryopreservation damage. By simply upregulating its expression level using existing gene transfection techniques, the developmental capacity of frozen porcine immature oocytes can be improved, providing a new solution for improving the maturation quality of frozen oocytes and benefiting various embryo biotechnology research.

[0065] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

[0066] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A method for improving the developmental capacity of frozen porcine immature oocytes, characterized in that, Frozen porcine immature oocytes were subjected to in vitro maturation culture. Mature oocytes that had expelled the first polar body were placed in a transfection solution containing the miR-32 nucleotide sequence and incubated for 2-6 hours. The porcine immature oocytes were GV stage oocytes. The miR-32 nucleotide sequence is shown in SEQ ID NO:

1.

2. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 1, characterized in that, The mature oocytes were incubated in a transfection solution containing the miR-32 nucleotide sequence for 4 hours.

3. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 1, characterized in that, The transfection solution containing the miR-32 nucleotide sequence was prepared using a miR-32 mimic.

4. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 3, characterized in that, The concentration of the transfection solution containing the miR-32 nucleotide sequence is 25 nM to 200 nM.

5. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 4, characterized in that, The concentration of the transfection solution containing the miR-32 nucleotide sequence was 50 nM.

6. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 1 or 2, characterized in that, The incubation conditions are as follows: incubation in a carbon dioxide incubator at 39°C, 5% CO2, and 100% humidity.

7. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 1, characterized in that, The freezing process is vitrification freezing.

8. The method for improving the developmental capacity of frozen porcine immature oocytes according to claim 1, characterized in that, The in vitro maturation culture includes the following steps: S1. Add 500 μL of in vitro maturation solution to each well of a 24-well plate, cover with 300 μL of paraffin oil, and equilibrate for more than 3 hours in a carbon dioxide incubator at 39°C, 5% CO2 and 100% humidity. S2. After washing the frozen immature porcine oocytes three times in the in vitro maturation solution, place them into culture wells, 40-60 oocytes per well, and culture them in a carbon dioxide incubator at 39°C, 5% CO2 and 100% humidity for 42 hours.

Citation Information

Patent Citations

  • Application of miR-32-5p in the preparation of drugs that enhance the sensitivity of tumor cells to dihydroartemisinin

    CN114099684B

  • Application of regulator in improvement of maturation quality of frozen porcine oocytes

    CN119351320A