A novel lactoferricin inducible soluble expression system and a method for constructing the same

The lactoferrin inducible expression system constructed through codon optimization and adaptable vectors solved the problem of efficient and soluble expression of lactoferrin in Escherichia coli Nissle 1917, achieving efficient and safe preparation and purification of lactoferrin with good anti-inflammatory activity.

CN122104720APending Publication Date: 2026-05-29DALIAN POLYTECHNIC UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DALIAN POLYTECHNIC UNIVERSITY
Filing Date
2026-01-27
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve efficient, soluble, heterologous expression of lactoferrin in Escherichia coli Nissle 1917, posing risks of endotoxin formation and protein aggregation into inclusion bodies. Furthermore, traditional induction systems are inefficient in their host environment.

Method used

A lactoferrin inducible soluble expression system was constructed using a codon-optimized lactoferrin gene, the adaptable vector pGFPmut3.1 plasmid, low-temperature induction, and a two-step purification process. The process included recombinant vector construction, cell disruption, ultrafiltration, cation exchange column purification, and desalting freeze-drying.

Benefits of technology

The system achieved efficient and soluble expression of lactoferrin in the probiotic EcN. The recombinant lactoferrin obtained had good anti-inflammatory activity. The system was safe, easy to operate, and highly reproducible.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104720A_ABST
    Figure CN122104720A_ABST
Patent Text Reader

Abstract

The application discloses a novel lactoferrin inducible soluble expression system and a construction method thereof, and belongs to the technical field of biotechnology and genetic engineering, and the specific scheme is that human lactoferrin (LF) is expressed by probiotic Escherichia coli Nissle1917, the protein is purified after the expression position is determined, and anti-inflammatory activity is determined. The LF expression system constructed by the application provides a construction method of a prokaryotic expression stable human lactoferrin expression vector, the vector is introduced into probiotic Escherichia coli Nissle1917, soluble target recombinant human lactoferrin is obtained after induction fermentation expression, two-step purification and identification, and the application has the characteristics of high safety, low cost, easy operation and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a novel lactoferrin-inducible soluble expression system and its construction method, belonging to the field of genetic engineering and recombinant protein expression technology. Background Technology

[0002] Lactoferrin (LF) is a multifunctional glycoprotein with important functional properties. Its unique iron-binding capacity and broad-spectrum biological activity make it widely applicable in food, medicine, and other fields. Currently, it is mainly obtained through two methods: natural extraction and recombinant expression. Natural extraction is limited by the availability of raw materials and extraction efficiency, making it difficult to meet the needs of industrial production. As for recombinant expression systems, traditional E. coli expression systems (such as BL21) are simple to operate, but they pose an endotoxin risk, and their strong expression characteristics often lead to protein aggregation and inclusion body formation.

[0003] Escherichia coli Nissle 1917 (EcN), a unique strain combining the characteristics of probiotics and the potential of engineered bacteria, offers new possibilities for solving this technical challenge. This strain not only boasts a century-long clinically proven safety profile but also exhibits excellent intestinal colonization ability and microecological regulation functions, while retaining the advantages of typical E. coli such as ease of handling and a clear genetic background. Notably, EcN has received formal approval from the EU and the US FDA for use as a probiotic additive.

[0004] However, developing EcN into a high-efficiency protein expression platform faces unique technical challenges. This strain exhibits significant adaptation barriers to the widely used T7 expression system, and the efficiency of conventional induction systems is significantly reduced in its host environment. These characteristics make it difficult to directly apply traditional E. coli expression strategies to EcN, necessitating the development of a specially adapted expression regulation system to fully realize its potential as an engineered bacterium. Summary of the Invention

[0005] Overcoming the shortcomings of existing technologies, this study achieves soluble heterologous expression of lactoferrin in Escherichia coli (EcN), resolving issues such as the contradiction between host safety and expression efficiency, the easy formation of inclusion bodies by the protein, and the complexity of purification processes.

[0006] To address the aforementioned technical problems, this invention provides a lactoferrin-inducible soluble expression system based on Escherichia coli Nissle 1917 and its construction method, as detailed below: The first technical solution provided by the present invention is a gene encoding lactoferrin, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0007] The second technical solution provided by the present invention is a recombinant vector carrying the gene described in the first technical solution.

[0008] In some embodiments, the recombinant vector is expressed as a pGFPmut3.1 plasmid expression vector.

[0009] The third technical solution provided by the present invention is a recombinant Escherichia coli containing the gene described in the first technical solution or transformed with the recombinant vector described in the second technical solution.

[0010] In some embodiments, the recombinant Escherichia coli uses Escherichia coli Nissle 1917 (EcN) as the host.

[0011] The fourth technical solution provided by the present invention is a method for constructing recombinant Escherichia coli, wherein the method involves transforming the pGFPmut3.1 plasmid carrying the gene described in the first technical solution into Escherichia coli Nissle 1917.

[0012] The fifth technical solution provided by the present invention is a method for preparing lactoferrin, wherein the method involves culturing and inducing expression of recombinant Escherichia coli as described in the third technical solution, followed by purification, to obtain lactoferrin.

[0013] In some implementations, the following steps are included: (1) Target protein induction expression: The recombinant Escherichia coli described in the third technical solution was inoculated into LB medium containing 100 μg / mL ampicillin sodium and cultured overnight at 37 ℃ and 250 rpm; it was then transferred to fresh LB medium (containing 100 μg / mL ampicillin sodium) at a ratio of 1:300 and cultured at 37 ℃ until the bacterial culture OD reached the target protein expression level. 600 When the expression level reaches 0.5-0.6, IPTG is added to induce expression. The induction conditions are: IPTG concentration 0.2-0.5 mM, induction temperature 16 ℃, and induction time 14-18 h. After induction, the bacterial cells are collected by centrifugation at 8000 rpm for 20 min. (2) Protein purification and processing: Cell disruption: Resuspend the cells in lysis buffer (50 mM MES, pH 6.5), add lysozyme and 1 mM PMSF to a final concentration of 30 μg / mL, incubate on ice for 30 min, then sonicate (300 W, 3 s interval, 3 s interval, total 20 min), and collect the supernatant by centrifugation at 4 ℃ and 12000 rpm for 20 min. Preliminary separation by ultrafiltration: The supernatant was filtered through a 0.22 μm filter membrane and then concentrated through a 30 kDa ultrafiltration centrifuge tube (4℃, 5000 rpm) to remove small molecule impurities and proteins; Cation exchange column purification: After equilibrating the strong cation exchange column (SP 6FF Chromatography Column, 5 mL) with equilibration buffer (50 mM MES, pH 6.5) for 4-6 column volumes, the supernatant after ultrafiltration was loaded at a flow rate of 1 mL / min. After loading, the column was washed with equilibration buffer until the baseline stabilized, and then linear gradient elution was performed with elution buffer (50 mM MES, pH 6.5, 1 M NaCl). The elution peak of the target protein was collected by UV detection at 280 nm. Desalting and freeze-drying: The target protein eluent was concentrated using a 30 kDa ultrafiltration tube and then passed through a desalting column (equilibration solution was PBS, pH 7.4) to remove salt ions. The protein concentration was determined by the BCA method. The desalted protein solution was filtered through a 0.22 μm filter membrane and then freeze-dried under vacuum to obtain recombinant hLF protein powder.

[0014] The sixth technical solution provided by this invention is the application of the gene described in the first technical solution, the recombinant vector described in the second technical solution, the recombinant cell described in the third technical solution, or the method described in the fourth technical solution in the preparation of lactoferrin or products containing lactoferrin.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This technical solution achieves efficient and soluble expression of hLF in probiotic EcN through codon optimization, adaptive vector construction, low-temperature induction, and a two-step purification process. The obtained rhLF has good anti-inflammatory activity, and the entire system is characterized by high safety, simple operation, and strong reproducibility. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of the structure of the expression vector pmut3.1-opt-hLF in this application.

[0017] Figure 2 This is a schematic diagram of the structure of the expression vector pmut3.1-wt-hLF in this application.

[0018] Figure 3 The plasmid retention rate of the expression vector pmut3.1-opt-hLF in EcN is given.

[0019] Figure 4 The images show the Western blot (WB) results of lactoferrin expression levels before and after codon optimization for human lactoferrin in this application.

[0020] Figure 5 This paper presents a grayscale analysis of the WB detection results of lactoferrin expression levels before and after codon optimization for human lactoferrin, based on the present application.

[0021] Figure 6This is the WB detection result of the hLF expression location in this application.

[0022] Figure 7 This is a chromatogram of the hLF protein purification instrument used in this application.

[0023] Figure 8 This is the SDS-PAGE image of the sample corresponding to the recombinant hLF obtained in this application.

[0024] Figure 9 The cytotoxicity and anti-inflammatory activity of the recombinant hLF obtained in this application were tested. Detailed Implementation

[0025] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0026] Raw materials used in the examples: 1. Escherichia coli Nissle 1917 (EcN) was purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0027] 2. The pGFPmut3.1 plasmid was obtained from Wuhan Miaoling Biotechnology Co., Ltd.

[0028] 3. The LB medium formula is as follows: LB liquid medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, add deionized water to a final volume of 1 L, autoclave at 121℃ for 20 min.

[0029] LB solid medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 15 g agar powder, add deionized water to a final volume of 1 L, autoclave at 121℃ for 20 min.

[0030] 4. Natural hLF was purchased from Merck Life Sciences, product number L4894.

[0031] Example 1: Construction of the recombinant expression vector pmut3.1-opt-hLF (codon-optimized) (1) hLF gene codon optimization Human lactoferrin gene optimization: The original hLF gene sequence was retrieved, and the signal peptide coding sequence was deleted to obtain the wild-type hLF gene sequence without the signal peptide (as shown in SEQ ID NO:1); Based on the codon bias of Escherichia coli Nissle 1917 (EcN), the wild-type sequence without the signal peptide shown in SEQ ID NO:1 was specifically optimized to obtain the optimized hLF gene sequence (as shown in SEQ ID NO:2).

[0032] (2) PCR amplification of the target gene and vector backbone Using the synthesized and optimized hLF gene as a template, PCR amplification was performed using upstream and downstream primers containing homologous arms: Upstream primer LF-opt-hLF-F (SEQ ID NO:3): AATTAAGCATGGGCCGCCGTCG; Downstream primer LF-opt-hLF-R (SEQ ID NO:4): TAATTAAGCTTATTTGCGCAGAAATTCGCACG.

[0033] PCR reaction system (50 μL): 2×Phanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, forward and reverse primers (10 μM each) 2 μL, template DNA 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, ddH2O 17 μL.

[0034] Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min (extension time adjusted according to fragment length), for a total of 35 cycles; final extension at 72℃ for 5 min. The amplified products were verified by 1% agarose gel electrophoresis, and the target gene fragment was recovered using a gel extraction kit.

[0035] Using pGFPmut3.1 plasmid as a template, the linearized vector backbone was amplified using vector inverse PCR primers: Upstream primer pmut3.1-vec-F (SEQ ID NO:5): GCGCAAATAAGCTTAATTAGCTGACCTACTAGTCGG; Downstream primer pmut3.1-vec-R (SEQ ID NO:6): CGGCCCATGCTTAATTTCTCCTTCTTTAATTCTAGGTACCC.

[0036] The PCR reaction system and conditions were the same as above, and the linearized vector fragment was recovered.

[0037] (3) Homologous recombination to construct recombination carriers The target gene fragment recovered from the gel was mixed with the linearized vector at a molar ratio of 2:1. 10 μL of 2×ClonExpress Mix and the remaining ddH2O were added to a final volume of 20 μL. The mixture was incubated at 50 °C for 5 min, followed by an ice bath for 5 min to terminate the reaction. 5–10 μL of the recombinant product was transformed into DH5α competent cells. After an ice bath for 30 min, the cells were heat-shocked at 42 °C for 90 s, immediately followed by an ice bath for 2 min. 1 mL of LB liquid medium was added, and the cells were incubated at 37 °C and 250 rpm for 1 h. 200 μL of the resuscitated bacterial culture was plated on LB solid medium containing 100 μg / mL ampicillin sodium and incubated overnight at 37 °C. Single colonies were picked for colony PCR verification (primers as in step 2). Positive clones were sequenced. The correctly sequenced recombinant plasmid was named pmut3.1-opt-hLF (see schematic diagram of the vector structure). Figure 1 ).

[0038] Example 2: Construction of the recombinant expression vector pmut3.1-wt-hLF (wild type) (1) Processing of lactoferrin gene sequence Lactoferrin gene sequence processing: The original hLF gene sequence was retrieved, and the signal peptide coding sequence was deleted to obtain the wild-type hLF gene sequence without the signal peptide (the wild-type sequence is shown in SEQ ID NO:1).

[0039] (2) PCR amplification of the target gene and vector backbone Using the wild-type hLF gene as a template, PCR amplification was performed using upstream and downstream primers containing homologous arms: Upstream primer LF-wt-LF-F (SEQ ID NO:7): AATTAAGCATGGGCCGTAGGAGGAGT; Downstream primer LF-wt-LF-R (SEQ ID NO:8): GCTAATTAAGCTTACTTCCTGAGGAATTCACAGGCT.

[0040] PCR reaction system (50 μL): 2×Phanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, forward and reverse primers (10 μM each) 2 μL, template DNA 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, ddH2O 17 μL.

[0041] Reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min (extension time adjusted according to fragment length), for a total of 35 cycles; final extension at 72℃ for 5 min. The amplified products were verified by 1% agarose gel electrophoresis, and the target gene fragment was recovered using a gel extraction kit.

[0042] Using pGFPmut3.1 plasmid as a template, the linearized vector backbone was amplified using vector inverse PCR primers: Upstream primer pmut3.1-wt-vec-F (SEQ ID NO:9): TCAGGAAGTAAGCTTAATTAGCTGACCTACTAGGCC; Downstream primer pmut3.1-wt-vec-R (SEQ ID NO:10): CGGCCCATGCTTAATTTCTCCTTCTTTAATTCTAGGTACCC.

[0043] The PCR reaction system and conditions were the same as above, and the linearized vector fragment was recovered.

[0044] (3) Homologous recombination to construct recombination carriers The target gene fragment recovered from the gel was mixed with the linearized vector at a molar ratio of 2:1. 10 μL of 2×ClonExpress Mix and the remaining ddH2O were added to a final volume of 20 μL. The mixture was incubated at 50 °C for 5 min, followed by an ice bath for 5 min to terminate the reaction. 5–10 μL of the recombinant product was transformed into DH5α competent cells. After an ice bath for 30 min, the cells were heat-shocked at 42 °C for 90 s, immediately followed by an ice bath for 2 min. 1 mL of LB broth was added, and the cells were incubated at 37 °C and 250 rpm for 1 h. 200 μL of the resuscitated bacterial culture was plated on LB solid medium containing 100 μg / mL ampicillin sodium and incubated overnight at 37 °C. Single colonies were picked for colony PCR verification (primers as in step 2). Positive clones were sequenced. The correctly sequenced recombinant plasmid was named pmut3.1-wt-hLF (wild type) (see schematic diagram of the vector structure). Figure 2 ).

[0045] Example 3: Construction of recombinant engineered bacteria EcN-opt-hLF and EcN-wt-hLF (1) Preparation of EcN competent cells Single colonies of strain EcN were picked and inoculated into 5 mL of LB liquid medium and incubated overnight at 37 ℃ and 250 rpm; then transferred 1:100 to 100 mL of LB medium and incubated at 37 ℃ until OD. 600=0.4-0.6, ice bath for 30 min; centrifuge at 4℃ and 4000 rpm for 10 min to collect bacterial cells, wash the bacterial cells twice with pre-cooled 0.1M CaCl2 solution, resuspend in 10 mL of 0.1M CaCl2 solution containing 15% glycerol, aliquot and store at -80℃ for later use.

[0046] (2) Transformation and validation of recombinant vectors Take 100 μL of EcN competent cells, add 5-10 μL of the pmut3.1-opt-hLF plasmid constructed in Example 1, incubate on ice for 30 min, then heat shock at 42 ℃ for 90 s, incubate on ice for 2 min, add 1 mL of LB liquid medium, and revive at 37 ℃ and 250 rpm for 1 h. Spread 200 μL of the revived bacterial culture on LB solid medium containing 100 μg / mL ampicillin sodium, and incubate overnight at 37 ℃. Pick single colonies for colony PCR verification (primers are the same as in step 2 of Example 1). Positive clones are the recombinant engineered bacteria, named EcN-opt-hLF.

[0047] Take 100 μL of EcN competent cells, add 5-10 μL of the pmut3.1-wt-hLF plasmid constructed in Example 1, incubate on ice for 30 min, then heat shock at 42 ℃ for 90 s, incubate on ice for 2 min, add 1 mL of LB liquid medium, and revive at 37 ℃ and 250 rpm for 1 h. Spread 200 μL of the revived bacterial culture on LB solid medium containing 100 μg / mL ampicillin sodium, and incubate overnight at 37 ℃. Pick single colonies for colony PCR verification (primers are the same as in step 2 of Example 2). Positive clones are the recombinant engineered bacteria, named EcN-wt-hLF.

[0048] Example 4: Plasmid stability of pmut3.1-opt-hLF The pET-32a plasmid was transformed into strain EcN using the method described in Example 3.

[0049] Continuous subculturing: Single colonies of recombinant engineered strain EcN / pmut3.1-opt-hLF and control engineered strain EcN / pET-32a (+) were picked and inoculated into 5 mL of ampicillin-free LB liquid medium and cultured at 37°C and 200 rpm for 96 h with continuous shaking.

[0050] Sample collection and processing: Samples were taken at 0 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, and 96 h of culture. 1 mL of bacterial culture was collected each time and serially diluted 10-fold with sterile physiological saline. -1 Up to 10 -9 ).

[0051] Plate plating and counting: Take 100 μL of bacterial suspension at different dilutions and spread it evenly on two types of LB solid medium (resistant medium containing 100 μg / mL ampicillin and non-resistant medium without antibiotics), with three replicates for each dilution. After incubation at 37℃ for 12-16 h, count the number of colonies (CFU) on the plates.

[0052] Plasmid retention rate calculation: Based on the counting results, the plasmid retention rate at each time point is calculated using the following formula: Plasmid retention rate = number of colonies on resistant medium ÷ number of colonies on non-resistant medium.

[0053] Results analysis: such as Figure 3 As shown, the recombinant vector pmut3.1-Plac-ehLF maintained a plasmid retention rate of over 98%, close to 1.0, throughout the entire 96-hour continuous passage process; while the retention rate of the control vector pET-32a(+) decreased rapidly over time, falling below 1% at 96 hours. The ratio of the retention rates of the two vectors continuously increased with the extension of culture time, indicating that the recombinant vector constructed in this invention has significantly better genetic stability in Escherichia coli Nissle 1917, effectively avoiding the problem of decreased target protein expression due to plasmid loss in industrial production.

[0054] Example 4: Induced expression and solubility identification of human lactoferrin (hLF) (EcN-opt-hLF vs EcN-wt-hLF) (1) Optimization of induction expression conditions Single colonies of EcN-opt-hLF (codon-optimized type, abbreviated as ELF) and EcN-wt-hLF (wild type, abbreviated as WLF) were picked and inoculated into 5 mL of LB medium containing ampicillin sodium, and cultured overnight at 37 ℃ and 250 rpm; then transferred at a ratio of 1:300 to 100 mL of fresh LB medium (containing 100 μg / mL ampicillin sodium), and cultured at 37 ℃ until OD. 600 =0.5-0.6, add IPTG to a final concentration of 0.2 mM, and induce at 16 ℃ and 200 rpm for 16 h. After induction, centrifuge at 8000 rpm for 20 min to collect the bacterial cells, discard the supernatant for later use.

[0055] (2) Verification of expression (bacterial cell WB detection) Take 0.1 g of each ELF and WLF bacterial pellet, resuspend them in 1 mL of lysis buffer (50 mM MES, pH 6.5), add lysozyme and 1 mM PMSF to a final concentration, and incubate on ice for 30 min. Sonicate (300 W, 3 s working time, 3 s interval, total 10 min), centrifuge at 12000 rpm, 4 ℃ for 10 min, and collect the supernatant as the total protein sample. Take 20 μL of each total protein sample, add 5 μL of 5×SDS loading buffer, denature in boiling water for 5 min, separate by 10% SDS-PAGE, transfer to a PVDF membrane, block with 5% bovine serum albumin (BSA) solution for 1 h, add anti-hLF monoclonal antibody (1:5000 dilution) and incubate overnight at 4 ℃, incubate with HRP-labeled secondary antibody (1:10000 dilution) at room temperature for 1 h, and detect by ECL colorimetric assay (see results below). Figure 4 ). Figure 4 The results showed that the band gray level of the ELF group at approximately 80 kDa (the theoretical molecular weight of hLF) was significantly higher than that of the WLF group, demonstrating that the codon-optimized hLF had a higher expression level in EcN, which was 2.85 ± 0.85 times higher than that before optimization. Figure 5 ).

[0056] (3) Identification of soluble expression The bacterial cells were resuspended in 5 mL of lysis buffer (50 mM MES, pH 6.5), and lysozyme and 1 mM PMSF were added to a final concentration. The mixture was incubated on ice for 30 min. The cells were then sonicated (300 W, 3 s on, 3 s off, total 20 min), and centrifuged at 12000 rpm for 20 min at 4 ℃. The supernatant and precipitate were collected separately. Western blotting was used to detect the distribution of the target protein: the precipitate was resuspended in an equal volume of lysis buffer, and 20 μL of both the supernatant and precipitate were added to 5×SDS loading buffer and boiled for 5 min. After separation by 10% SDS-PAGE, the samples were transferred to a PVDF membrane, incubated with anti-hLF monoclonal antibody, and detected by ECL (see results below). Figure 6 Lanes 1 and 2 represent the supernatant and precipitate of the blank group, respectively; lanes 3 and 4 represent the supernatant and precipitate before codon optimization, respectively; and lanes 5 and 6 represent the supernatant and precipitate after codon optimization, respectively. Results showed that the target protein was mainly present in the supernatant. Gray-scale analysis showed that the soluble expression after optimization was 4.04 times that before optimization; the soluble expression after optimization was 1.19 times that of inclusion bodies.

[0057] Example 5: Purification and Identification of Recombinant hLF (1) Preliminary separation by ultrafiltration The cell lysate supernatant from EcN-opt-hLF in Example 3 was collected, filtered through a 0.22 μm filter membrane, and concentrated using an ultrafiltration centrifuge tube with a molecular weight cutoff of 30 kDa (centrifuged at 4 °C and 5000 rpm) to remove small molecule proteins, and the concentrate was collected.

[0058] (2) Purification by strong cation exchange column Purification was performed using a strong cation exchange column (SP 6FF, 5 mL): the column was equilibrated to 4-6 column volumes with equilibration buffer (50 mM MES, pH 6.5), and the concentrated ultrafiltration solution was loaded (flow rate 1 mL / min). After loading, the column was washed with equilibration buffer until the baseline stabilized, and then linear gradient elution was performed with elution buffer (50 mM MES, pH 6.5, 1 M NaCl). The elution peak was monitored with a UV detector (280 nm), and the target protein peak was collected (elution curve shown in [reference]). Figure 7 ).

[0059] (3) Desalination and freeze drying The collected target protein eluent was concentrated using a 30 kDa ultrafiltration centrifuge tube, and salt ions were removed by passing it through a desalting column (equilibration buffer: PBS, pH 7.4). Protein concentration was determined by the BCA method, yielding a lactoferrin yield of 70.53 ± 2.16 μg / L. The desalted protein solution was filtered through a 0.22 μm filter membrane and then freeze-dried under vacuum to obtain recombinant lactoferrin powder. SDS-PAGE results are shown below. Figure 8 Lane 1 represents the area before purification, and lane 2 represents the area after purification.

[0060] Example 6: Detection of cytotoxicity and anti-inflammatory activity of recombinant hLF Cytotoxicity assay: NCM460 cells were inoculated at a concentration of 1×10⁻⁶ cells / mL. 4 Cells / wells were seeded in 96-well plates, and recombinant hLF or natural hLF was added at final concentrations of 0, 5, 25, 50, 75, and 100 μg / mL, respectively. After 24 h of culture, cell viability was detected by CCK-8 assay. Figure 9 A). Overall, the cell viability of both lactoferrins was higher than 50% in the concentration range of 5-100 μg / mL, and ≥80% at concentrations of 5-75 μg / mL; statistical analysis between groups showed no significant difference (P>0.05), indicating that recombinant hLF had no obvious cytotoxicity and its safety was comparable to that of natural hLF.

[0061] Anti-inflammatory activity assay: NCM460 cells were cultured at 5 × 10⁻⁶ cells / year. 4Cells / wells were seeded in 24-well plates, with four treatment groups: ① blank control group (no LPS + no LF); ② LPS model group (1 μg / mL LPS + no LF); ③ natural hLF intervention group (1 μg / mL LPS + 50 μg / mL natural hLF); ④ recombinant hLF intervention group (1 μg / mL LPS + 50 μg / mL recombinant hLF). After 12 hours of culture, the levels of inflammatory factors were detected by ELISA. Figure 9 B-9E): The LPS level in the model group decreased to 13.98±0.21 pg / mL; the level in the natural hLF group increased to 20.68±0.53 pg / mL; and the level in the recombinant hLF group increased to 21.21±0.62 pg / mL. The latter two groups were significantly higher than the model group (P<0.05).

[0062] The pro-inflammatory factor TNF-α: The secretion level in the blank control group was 44.58 ± 3.31 pg / mL; in the LPS model group, it increased to 248.39 ± 6.10 pg / mL; in the natural hLF group, it decreased to 131.05 ± 5.75 pg / mL, and in the recombinant hLF group, it decreased to 122.11 ± 1.72 pg / mL. The latter two groups were significantly lower than the model group (P<0.05).

[0063] The pro-inflammatory factor IL-1β: The secretion level in the blank control group was 50.62 ± 3.00 pg / mL; in the LPS model group, it increased to 223.71 ± 5.87 pg / mL; in the natural hLF group, it decreased to 127.03 ± 7.89 pg / mL, and in the recombinant hLF group, it decreased to 119.30 ± 1.59 pg / mL. The latter two groups were significantly lower than the model group (P<0.05).

[0064] Pro-inflammatory factor IL-6: The secretion level in the blank control group was 5.74±0.72 pg / mL; in the LPS model group, it increased to 18.61±0.27 pg / mL; in the natural hLF group, it decreased to 10.24±0.44 pg / mL, and in the recombinant hLF group, it decreased to 12.48±0.17 pg / mL. The latter two groups were significantly lower than the model group (P<0.05).

[0065] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A gene encoding lactoferrin, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO:

2.

2. A recombinant vector carrying the gene of claim 1.

3. The recombinant vector according to claim 2, characterized in that, The recombinant vector was expressed using the pGFPmut3.1 plasmid.

4. Recombinant *E. coli* containing the gene of claim 1 or transformed with the recombinant vector of claim 2 or 3, characterized in that, The recombinant Escherichia coli used Escherichia coli Nissle 1917 as the host.

5. A method for constructing recombinant Escherichia coli, characterized in that, The method involves transforming the pGFPmut3.1 plasmid carrying the gene described in claim 1 into Escherichia coli Nissle 1917.

6. A method for preparing lactoferrin, characterized in that, The method involves culturing and inducing expression of the recombinant Escherichia coli as described in claim 4, followed by purification to obtain lactoferrin.

7. The method according to claim 6, characterized in that, The specific method for inducing expression is as follows: The recombinant *E. coli* as described in claim 4 is inoculated into LB medium containing 100 μg / mL ampicillin sodium and cultured overnight at 37 ℃ and 250 rpm; then transferred at a ratio of 1:300 to fresh LB medium containing 100 μg / mL ampicillin sodium and cultured at 37 ℃ until the bacterial culture reaches OD0.

05. 600 When the expression reaches 0.5-0.6, IPTG is added for induction. The induction conditions are: IPTG concentration 0.2-0.5 mM, induction temperature 16 ℃, and induction time 14-18 h. After induction, the cells are collected by centrifugation at 8000 rpm for 20 min.

8. The method according to claim 6, characterized in that, The purification process specifically involves: breaking the bacterial cells, performing preliminary separation by ultrafiltration, purification by cation exchange column, desalting, and lyophilization.

9. The method according to claim 8, characterized in that, The initial separation via ultrafiltration is as follows: the supernatant is filtered through a 0.22 μm filter membrane and then concentrated in a 30 kDa ultrafiltration centrifuge tube at 4°C and 5000 rpm to remove small molecule impurities. The purification via cation exchange column is as follows: after equilibrating a strong cation exchange column to 4-6 column volumes with equilibration buffer, the supernatant after ultrafiltration is loaded at a flow rate of 1 mL / min. After loading, the column is washed with equilibration buffer until the baseline is stable, and then linear gradient elution is performed with elution buffer. The elution peak of the target protein is collected by 280 nm UV detection.

10. The use of the gene of claim 1, the recombinant vector of any one of claims 2-3, the recombinant cell of any one of claims 4-5, or the method of claim 6 in the preparation of lactoferrin or products containing lactoferrin.