A polypeptide targeting graft versus host disease and expression system and local in situ regulatory system

By using engineered probiotics to deliver the peptide BigLEN, NLRP3 pyroptosis in intestinal macrophages of GVHD patients is precisely inhibited, solving the problem of systemic immunosuppression in GVHD treatment and achieving local control of GVHD while preserving the GVL effect.

CN122124203APending Publication Date: 2026-06-02FOURTH MILITARY MEDICAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FOURTH MILITARY MEDICAL UNIVERSITY
Filing Date
2026-03-13
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing treatments for GVHD rely on immunosuppressive drugs, which lead to systemic immunosuppression, weaken the graft-versus-leukemia effect, and have significant side effects.

Method used

By using engineered probiotics and an arabinose-induced system, a targeted peptide, BigLEN, was prepared. The peptide is delivered in the intestine by outer membrane vesicles produced by probiotics, which precisely inhibits NLRP3 pyroptosis in macrophages, alleviates GVHD symptoms, and preserves the GVL effect.

Benefits of technology

Without compromising GVL activity, it significantly alleviates GVHD symptoms, achieving separation of GVHD from GVL effects and providing a localized and potent targeted treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122124203A_ABST
    Figure CN122124203A_ABST
Patent Text Reader

Abstract

This invention provides a peptide targeting graft-versus-host disease, its expression system, and a local in-situ regulatory system, belonging to the field of biomedical technology. This invention also provides the application of the peptide BigLEN in the preparation of macrophage pyroptosis inhibitors. BigLEN has a high affinity for the NLRP3 NACHT domain, and in vitro experiments have confirmed its effective inhibition of NLRP3-mediated pyroptosis in macrophages. This invention constructs a fusion protein and expression vector based on arabinose-induced expression, and an arabinose-inducible engineered EcN strain. Oral administration significantly improves survival rate, reduces intestinal pathological damage, decreases the infiltration of pro-inflammatory T cells, and promotes macrophage polarization towards an anti-inflammatory phenotype. This invention develops an orally administered engineered probiotic to precisely inhibit NLRP3-driven pyroptosis in intestinal macrophages.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a peptide targeting graft-versus-host disease, its expression system, and a local in-situ regulatory system. Background Technology

[0002] Graft-versus-host disease (GVHD) is a major challenge for patients after allogeneic hematopoietic stem cell transplantation (alto-HSCT). This complication occurs when the donor's immune cells, particularly T cells, mistakenly recognize and attack tissues in the recipient's body, leading to widespread inflammation and damage. GVHD presents with diverse clinical manifestations, primarily affecting multiple organ systems, including the skin, gastrointestinal tract, liver, and eyes, manifesting as severe erythema, diarrhea, abnormal liver function, and vision problems. These symptoms not only significantly impact a patient's quality of life but can also be life-threatening in severe cases.

[0003] Traditional treatments for GVHD rely on immunosuppressive drugs and corticosteroids. These drugs reduce damage to recipient tissues by suppressing the activity of donor T cells, but their use comes with a host of problems. Side effects include increased risk of infection, drug-related metabolic disorders, osteoporosis, and other long-term health issues. In particular, current immunosuppressants cause widespread systemic immunosuppression, often weakening the crucial graft-versus-leukemia (GVL) effect, creating a critical treatment dilemma. Summary of the Invention

[0004] This invention provides a peptide and expression system for targeting graft-versus-host disease (GVHD) and a local in situ regulatory system. By orally administering engineered probiotics and arabinose, it achieves precise inhibition of NLRP3-driven pyroptosis in intestinal macrophages. It can effectively and locally control GVHD without significantly impairing GVL activity, providing a novel targeted treatment option for the treatment of gastrointestinal inflammatory diseases.

[0005] This invention provides the application of a polypeptide in the preparation of a macrophage pyroptosis inhibitor, the amino acid sequence of which is shown in SEQ ID No. 1.

[0006] In one specific embodiment of the present invention, the nucleotide sequence of the gene encoding the polypeptide is shown in SEQ ID No. 2.

[0007] The present invention also provides a fusion protein based on arabinose-induced expression, wherein the fusion protein comprises at least one polypeptide element and one ClyA element; The polypeptide elements are linked together using a linker, and the amino acid sequence of the polypeptide elements is shown in SEQ ID No. 1; The amino acid sequence of the ClyA element is shown in SEQ ID No. 3.

[0008] The present invention also provides a recombinant expression vector comprising the encoding gene of the above-mentioned fusion protein.

[0009] The present invention also provides a recombinant probiotic comprising the above-described recombinant expression vector.

[0010] In one specific embodiment of the present invention, the base bacteria of the recombinant probiotics include wild-type or genetically modified mutant strains of Escherichia coli Nissle1917.

[0011] In one specific embodiment of the present invention, the genetically modified mutant strain includes Escherichia coli Nissle1917 knocked out. msbB and tolRA Gene.

[0012] The present invention also provides a method for constructing recombinant probiotics based on arabinose-induced expression of a fusion protein, comprising the following steps: linking the encoding gene of the above-mentioned fusion protein with an expression vector to construct a recombinant expression vector, and using the recombinant expression vector to transform a genetically modified Escherichia coli Nissle 1917 mutant strain to obtain the recombinant probiotics; The genetic modification includes knockout. msbB and tolRA Gene.

[0013] In one specific embodiment of the present invention, the knockout of the msbB The nucleotide sequence of the gene target sequence is shown in SEQ ID No. 17; Knock out the tolRA The nucleotide sequence of the target sequence during gene processing is shown in SEQ ID No. 21 or SEQ ID No. 22.

[0014] The present invention also provides a drug for improving graft-versus-host disease, comprising the above-described recombinant probiotics or recombinant probiotics constructed using the above-described construction method and arabinose.

[0015] Beneficial effects: This invention provides the application of a polypeptide (BigLEN) in the preparation of macrophage pyroptosis inhibitors. The BigLEN has a high affinity for the NLRP3 NACHT domain, and in vitro experiments have confirmed that it can effectively inhibit NLRP3-mediated pyroptosis in macrophages.

[0016] This invention constructs a fusion protein and expression vector based on arabinose-induced expression, and an arabinose-inducible engineered EcN strain. After oral administration, these vesicles generate outer membrane vesicles OMV-BigLEN in the intestinal lumen. These vesicles can cross the epithelial barrier, be taken up by macrophages in the lamina propria, and deliver BigLEN to inhibit the assembly of the NLRP3 inflammasome and its pyroptosis. In a mouse GVHD model, gavage administration of the engineered EcN strain and arabinose induction significantly improved survival, reduced intestinal pathological damage, decreased infiltration of pro-inflammatory T cells, and promoted macrophage polarization towards an anti-inflammatory phenotype. Furthermore, in a GVHD / leukemia dual model, the treatment method of this invention significantly controls GVHD while retaining a strong graft-versus-leukemia (GVL) effect, achieving separation between GVHD suppression and anti-leukemia immunity.

[0017] This invention develops an orally administered engineered probiotic that serves as a "biofactory" for the in-situ production of therapeutic vesicles, enabling precise inhibition of NLRP3-driven pyroptosis in intestinal macrophages. This strategy can potently and locally control GVHD without significantly impairing GVL activity, providing a novel targeted therapeutic paradigm for the treatment of gastrointestinal inflammatory diseases. Attached Figure Description

[0018] Figure 1 A schematic diagram illustrating the treatment of intestinal GVHD with engineered probiotics; Figure 2This image illustrates the results of single-cell transcriptomic and histopathological analysis revealing NLRP3-mediated pyroptosis in intestinal macrophages during GVHD. Figure A: UMAP visualization of single-cell RNA sequencing data from intestinal tissues of GVHD patients and healthy controls, showing seven major cell populations; B: Lineage-specific markers of these seven cell populations; C: Relative proportions of each cell population in different groups; D: GSVA analysis showing significant enrichment of pyroptosis-related pathways in GVHD samples compared to controls; E: UMAP projection showing NLRP3 expression, specifically upregulated in macrophage clusters under GVHD conditions; F: Violin plot showing pyroptosis-related genes (NLRP3, IL-1β, GBP2, ...) in intestinal macrophages of GVHD patients. ZEB2 expression levels were elevated and correlated with disease severity; G: H&E staining of colon tissue from syngeneic and allogeneic transplanted mice showed significant inflammatory infiltration and mucosal destruction in GVHD mice; H: IHC staining confirmed increased NLRP3 protein expression in the intestinal tissue of GVHD mice; IJ: Immunofluorescence staining of colon tissue showed increased F4 / 80+ macrophage infiltration, elevated NLRP3 expression, and increased pyroptosis executive protein GSDMD levels in GVHD mice compared to controls; Scale bars: 200 μm (H&E, IHC) and 50 μm (IF); Data represent results from at least three independent experiments; Figure 3The figure shows the screening and validation results of BigLEN as a novel NLRP3 inhibitory peptide. Figure A: Flowchart of the virtual screening process for NLRP3 inhibitory peptides; B: Structural analysis of the complex of the NLRP3 NACHT domain with known inhibitors, highlighting the conserved hydrophobic binding pocket; C: Pharmacophore model constructed based on key inhibitor-protein interactions, including four key chemical features (hydrogen bond acceptor and donor) for virtual screening; D: Molecular docking conformation of candidate peptide BigLEN in the hydrophobic pocket of the NACHT domain; E: Detailed interaction diagram of BigLEN with key residues (His367, Arg578, Glu369, Glu629) of the NLRP3 NACHT domain, with corresponding binding energies; F: Surface plasmon resonance (SPR) sensing image showing the concentration-dependent binding of different concentrations of BigLEN to immobilized NLRP3 protein; GH: Flow cytometry analysis of mouse bone marrow-derived macrophage (BMDM) death; I: Representative Western blotting of key pyroptosis-related proteins and ASCs in different groups of BMDMs. blot images; J: Measurement of lactate dehydrogenase (LDH) release in the supernatant of BMDMs after stimulation with LPS and nigerminol, with or without the addition of BigLEN (10 or 50 μM); K: Representative transmission electron microscopy images of BMDMs from different groups; Scale bar = 1 μm, data represent three independent experiments, and statistical significance was determined by one-way ANOVA and Tukey post-hoc test. p <0.05), quantitative data are expressed as mean ± standard error; Figure 4 This diagram illustrates the engineering process and results of the EcN-e strain. Figure A shows the genetic engineering strategy for EcN; Figures BC show successful gene deletion confirmed by gel electrophoresis and PCR products displayed in the knockout strain (EcN-e). msbB (B) and tolRA (C) The site shows the expected size shift compared to the wild-type (WT) EcN; D: via OD 600 Growth curves of wild-type EcN and EcN-e monitored; E: relative quantification of OMV production; F: representative TEM images of OMVs isolated from EcN and EcN-e, scale bar = 100 nm; G: nanoparticle tracking analysis (NTA) of OMVs, confirming that their particle size distribution conforms to the typical characteristics of bacterial OMVs (peak value approximately 80 nm); H: relative quantification of LPS content in bacterial lysates; I: survival status of mice in each group (n = 6 / group); J: representative images of complete blood cell count analysis after oral administration of PBS / EcN / EcN-e; KL: in vitro biocompatibility of purified OMVs, data represent at least three independent experiments, statistical significance was determined by unpaired two-tailed Student's t test (…). p <0.05) and one-way ANOVA with Tukey post-hoc test ( p <0.05) is defined, and quantitative data are expressed as mean ± standard error; Figure 5 Figure 1 shows the results of a study on the targeted delivery and pyroptosis inhibition of engineered E. coli EcN strains induced by arabinose. A: Bioluminescence imaging of EcN / engineered EcN (Luc-HA) under the control of the araBAD promoter in the presence (+) or absence (-) of arabinose; B: Representative Western blot image; C: Representative immunofluorescence images of colonic tissue from mice treated with EcNSmart (a strain displaying BigLEN) in the presence (+) or absence (-) of arabinose, with HA (red) signal indicating the presence of engineered OMVs, F4 / 80 (green) labeling of macrophages, and DAPI (blue) staining of nuclei, scale bar = 50 µm; D: In vivo bioluminescence imaging over time after oral administration of luciferase-expressing EcN and arabinose, showing a sustained luminescent signal in the gastrointestinal tract; EF: Flow cytometry analysis of BMDM cell death; G: Representative TEM images of different groups of BMDMs, scale bar = 1. μm, data represent three independent experiments; H: representative Western blot images of key pyroptosis-related proteins and ASC in different groups of BMDMs; I: determination of lactate dehydrogenase (LDH) release in the supernatant of BMDMs after stimulation with LPS and nigerminol, with or without the addition of OMVs displaying BigLEN. Statistical significance was determined by one-way ANOVA and Tukey post-hoc test. p <0.05), quantitative data are expressed as mean ± standard error; Figure 6 The figure shows the results of engineered EcNSmart treatment in alleviating intestinal GVHD and inhibiting pyroptosis in vivo. Figure A: Survival curves of allogeneic HSCT recipient mice treated with free BigLEN peptide, wild-type EcN, or EcNSmart, treatment starting one week post-transplantation (n=10); B: Representative H&E staining of colon tissue harvested on day 28 post-transplantation, scale bar = 100 µm; C: Representative immunofluorescence images of colon tissue from mice in different treatment groups, scale bar = 50 µm; D: Clinical GVHD severity scores of mice in different treatment groups; E: Measurement of lactate dehydrogenase (LDH) activity in intestinal lavage fluid from mice in different treatment groups; F: Representative Western blot images of key pyroptosis-related proteins and ASC in colon tissue lysates from mice in different treatment groups. Statistical significance of survival was determined by log-rank test. Clinical scores and other data were analyzed by one-way ANOVA and Tukey post-hoc test. p <0.05), data are expressed as mean ± standard error; Figure 7 This is a graph showing the results of EcNSmart regulating T cell response and macrophage polarization in intestinal GVHD. AB in the graph: CD4 levels in the spleen (A) and colon (B) of mice on day 14 after treatment. + IFN-γ + (Th1) and CD4 + IL-17 + (Th17) Flow cytometry analysis of T cells; CD: Quantitative data from flow cytometry in different groups (n=5); EF: Immunofluorescence staining of macrophage polarization markers in colon sections; Representative images showing macrophages (F4 / 80) + (Pink) was co-stained with the pro-inflammatory marker iNOS (green, left image) or the anti-inflammatory marker eNOS (yellow, right image), and cell nuclei were stained with DAPI (blue). Scale bar = 50 µm. Statistical significance was determined by one-way ANOVA and Tukey post-hoc test. p <0.05), data are expressed as mean ± standard error; Figure 8 Figure 1 shows the results of preserving the GVL effect of EcNSmart treatment. Figure A: Survival analysis of mice receiving BM cell + A20 cell / BM cell + T cell + A20 cell / BM cell + T cell + A20 cell + EcNSmart treatment (n=10); Figure B: Clinical GVHD scores of different groups on day 28 post-transplantation; Figure C: Representative in vivo bioluminescence imaging of leukemia burden. Statistical significance of survival was determined by log-rank test, and clinical scores were analyzed by one-way ANOVA and Tukey post-hoc test. p <0.05), data are expressed as mean ± standard error, abbreviated as NS, not significant; Figure 9 This image shows the results of single-cell transcriptome analysis revealing NLRP3-mediated pyroptosis in intestinal macrophages during GVHD, along with cell communication results. Figure A: Relative proportions of major cell populations in intestinal tissues of healthy controls and GVHD patients based on single-cell RNA sequencing analysis; B: Enrichment map showing upregulated NLRP3 expression in macrophage clusters of GVHD samples compared to healthy controls; C: Selected typical T-cell marker genes used for T-cell subset identification and clustering in single-cell datasets; D: UMAP visualization of T-cell subsets identified in single-cell data; E: Violin plot depicting NLRP3 expression levels in intestinal macrophages of healthy, mild, and severe GVHD groups; F: CD8+ expression in GVHD samples. +GZMB + Diagram of the intercellular communication network between T cells and macrophages; G: Kaplan-Meier survival curves of Balb / c mice after syngeneic or allogeneic hematopoietic stem cell transplantation; HI: Relative quantitative data of immunofluorescence signals in colon tissue; Data in AF are based on a reanalysis of the public single-cell dataset GSE234357; Data in GI are from independent experiments (n=5 mice per group), and statistical significance was determined by Student's t-test. p <0.05), data are expressed as mean ± standard error; Figure 10 The graph shows the results of GVHD treatment with free BigLEN. Figure A: Survival curves of allogeneic HSCT receptor mice treated with PBS and free BigLEN peptide (n=10); Figure B: Clinical GVHD severity scores of mice in different treatment groups. Statistical significance of survival was determined by the log-rank test. Clinical scores and other data were analyzed using one-way ANOVA and Tukey's post-hoc test. p <0.05), data are expressed as mean ± standard error; Figure 11 The figures show the complete blood count results of mice after EcN-e treatment. Figure A: Violin plot depicts the white blood cell count in whole blood of mice treated with PBS, EcN, and EcN-e; Figure B: Violin plot depicts the red blood cell count in whole blood of mice treated with PBS, EcN, and EcN-e; Figure C: Violin plot depicts the hemoglobin concentration in whole blood of mice treated with PBS, EcN, and EcN-e; Figure D: Violin plot depicts the platelet count in whole blood of mice treated with PBS, EcN, and EcN-e. Figure 12 This figure shows the quantitative data of GSDMD, ROS, and iNOS / eNOS immunofluorescence signals in the intestinal tissue of mice after EcNSmart treatment. In the figure, A: relative quantitative data of GSDMD immunofluorescence signal in colon tissue of different groups; BC: flow cytometry analysis of reactive oxygen species levels in colon tissue of mice of different groups; DE: relative quantitative data of iNOS / eNOS immunofluorescence signal in colon tissue of different groups. Detailed Implementation

[0019] This invention provides the application of a polypeptide in the preparation of a macrophage pyroptosis inhibitor, the amino acid sequence of which is shown in SEQ ID No.1: LENPSPQAPARRLLPP.

[0020] This invention analyzes publicly available single-cell RNA sequencing data (GEO:GSE234357) from intestinal biopsy samples of GVHD patients and validates this data using a mouse model. During GVHD, NLRP3 and pyroptosis-related signals are significantly enriched in intestinal macrophages, demonstrating that NLRP3-driven macrophage pyroptosis is a key pathogenic characteristic of the disease. This invention identifies a novel NLRP3 inhibitory peptide, BigLEN, through computer pharmacophore screening and verifies its binding affinity and functional activity in vitro. Ultimately, it demonstrates that BigLEN has a high affinity for the NLRP3 NACHT domain, and in vitro experiments confirm its effective inhibition of NLRP3-mediated pyroptosis in macrophages.

[0021] The amino acid sequence of BigLEN described in this invention is shown in SEQ ID No. 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID No. 2.

[0022] The present invention also provides a fusion protein based on arabinose-induced expression, wherein the fusion protein comprises at least one polypeptide element and one ClyA element; The polypeptide elements are linked together using a linker, and the amino acid sequence of the polypeptide elements is shown in SEQ ID No. 1; The amino acid sequence of the ClyA element is shown in SEQ ID No. 3.

[0023] The fusion protein of this invention has the structure ClyA-(BigLEN)n, where n is an integer greater than or equal to 1, and the BigLENs are tandemly linked by a linker, named the BigLEN-ClyA fusion protein. In one embodiment of this invention, to ensure the inhibitory effect of the BigLENs, three BigLENs are tandemly linked, and an HA tag is inserted to facilitate subsequent purification and verification, thereby constructing the fusion protein ClyA-(BigLEN)3-HA. The amino acid sequence of ClyA is shown in SEQ ID No. 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID No. 4. The nucleotide sequence of the linker between the BigLENs is shown in SEQ ID No. 5: TTTAAGGGAGGC, and the nucleotide sequence of the HA tag is shown in SEQ ID No. 6: TACCCATACGATGTTCCAGATTACGCT.

[0024] The present invention also provides a recombinant expression vector comprising the encoding gene of the above-mentioned fusion protein.

[0025] This invention does not specifically limit the base vector of the recombinant expression vector; probiotics can be used to express the target gene. In one embodiment, pBAD is used as an example, and the coding gene of the fusion protein is linked between NcoI and HindIII of pBAD to construct the recombinant expression vector pBAD-NcoI-ClyA-BigLEN-HA-HindIII. The complete nucleotide sequence of the fusion protein inserted into pBAD is shown in SEQ ID No. 7.

[0026] The present invention also provides a recombinant probiotic comprising the above-described recombinant expression vector.

[0027] The recombinant probiotics of this invention are based on wild-type or genetically modified mutant strains of *Escherichia coli* Nissle 1917 (EcN), wherein the genetic modification includes knocking out *E. coli* EcN. msbB and tolRA Gene.

[0028] In one embodiment of the present invention, deletion is used. msbB and tolRA Taking the EcN gene as an example, the construction of recombinant probiotics can enhance the production of outer membrane vesicles (OMVs) and reduce endotoxin toxicity; and the recombinant probiotics can express the BigLEN-ClyA fusion protein using an arabinose induction system, so that after oral administration of bacteria and inducers, OMVs displaying BigLEN (OMV-BigLEN) can be generated in situ in the intestine.

[0029] The present invention also provides a method for constructing recombinant probiotics based on arabinose-induced expression of a fusion protein, comprising the following steps: linking the encoding gene of the above-mentioned fusion protein with an expression vector to construct a recombinant expression vector, and using the recombinant expression vector to transform a genetically modified Escherichia coli Nissle 1917 mutant strain to obtain the recombinant probiotics; The genetic modification includes knockout. msbB and tolRA Gene.

[0030] In this invention, *E. coli* is constructed based on the SpCas9 system. msbB Gene knockout strains. Firstly, based on... msbB Gene sequence-specific sgRNAs were designed, with the target sequence being SEQ ID No. 17: 5'-CAGGTGTATTGTTCTGGTCG-3', whose adjacent PAM sequence is CGG, which can be efficiently recognized by SpCas9 and mediate DNA double-strand breaks; The target sequence chosen was SEQ ID No. 18: 5'-AAAGATCTTTGCGCTTATA-3', whose adjacent PAM sequence is AGG, which can be efficiently recognized by SpCas9 and mediate DNA double-strand breaks. The designed sgRNA sequences are as follows: msbB -sgRNA1 (SEQ ID No. 19): CAGGUGUAUUGUUCUGGUCG GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCU; msbB -sgRNA2 (SEQ ID No. 20): AAAAGAUCUUUGCGCUUAUA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU; This invention utilizes the same knockout method as described above. tolRA The target sequence for the gene was selected as SEQ ID No. 21: 5'-ATGGCCAGAGCGCGTGGACG-3', with the PAM sequence being AGG; the target sequence for the gene was selected as SEQ ID No. 22: AGTGCGGGTGTGAAATCGGT, with the PAM sequence being TGG. The designed sgRNA sequences are as follows: tolRA -sgRNA1 (SEQ ID No. 23): AUGGCCAGAGCGCGUGGACGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU; tolRA -sgRNA2 (SEQ ID No. 24): AGUGCGGGUGUGAAAUCGGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU; The present invention also provides a drug for improving graft-versus-host disease, comprising the above-described recombinant probiotics or recombinant probiotics constructed using the above-described construction method and arabinose.

[0031] The recombinant probiotics described in this invention can produce and deliver BigLEN in situ in vivo via a "living delivery platform." Utilizing outer membrane vesicles (OMVs) derived from EcN, this invention develops an inducible system, EcNSmart, capable of preferentially delivering NLRP3 inhibitory peptides to the intestinal immune microenvironment, including macrophages. In a mouse allo-HSCT model, this invention demonstrates that the OMVs generated by EcNSmart can cross the intestinal barrier, inhibit the activation and pyroptosis of macrophage NLRP3 inflammasomes in vivo, significantly alleviate intestinal GVHD, and retain GVL effects.

[0032] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a peptide and expression system for targeted graft-versus-host disease and a local in situ regulatory system provided by the present invention, should not be construed as limiting the scope of protection of the present invention.

[0033] Unless otherwise specified, the materials and methods used in the embodiments of this invention are conventional materials and methods in the art. The following is an explanation of some of the materials and methods used in the embodiments: 1. Animals and Cells: Female Balb / C and C57BL / 6 mice (6-8 weeks old) were purchased from the Experimental Animal Center of the Fourth Military Medical University. All animal experiments were approved by the Animal Experiment Ethics Committee of the Fourth Military Medical University (Approval No.: 250751). Mice were housed in an environment with a temperature of 22-24℃, humidity of 40-60%, and a 12-hour light-dark cycle. Bone marrow-derived macrophages (BMDM) were isolated from the bone marrow of the femur and tibia of mice. A20 cells were provided by Dr. Zhang from the Department of Hematology, Tangdu Hospital (ISSN 0092-8674, https: / / doi.org / 10.1016 / j.cell.2026.02.004. (https: / / www.sciencedirect.com / science / article / pii / S0092867426001698). BMDM cells were cultured in DMEM complete medium containing 10% fetal bovine serum and 1% penicillin / streptomycin (Hyclone); A20 cells were cultured in RPMI 1640 complete medium containing 10% fetal bovine serum and 1% penicillin / streptomycin (Hyclone).

[0034] 2. Graft-versus-host disease (GVHD) model: One week prior to transplantation, recipient Balb / C mice were given antibiotic-containing water to prevent infection. On the day of transplantation, mice received 8 Gy whole-body irradiation (linear accelerator) and were then kept still for 4–6 hours. Donor mice were euthanized by cervical dislocation, disinfected by immersion in 75% ethanol for 10 minutes, and dissected in a biosafety cabinet to remove the femur, tibia, and spleen. Bone marrow cells (BM) were obtained by washing the bone marrow with RPMI 1640 medium. Spleen tissue was gently mechanically ground and filtered through a 70 μm screen to prepare a spleen cell suspension. After cell counting and concentration adjustment, recipient mice were injected via tail vein with a mixed cell suspension (containing 5 × 10⁶ cells / mL). 6 7.5 × 10 bone marrow cells and 7.5 × 10 6 (Spleen cells). The clinical GVHD scoring system used a semi-quantitative scoring system to assess five indicators: weight change, posture, activity level, coat condition, and skin integrity; each indicator was scored from 0 to 2 points (0 = normal; 1 = moderately abnormal; 2 = severely abnormal), with a maximum total score of 10 points. The mice were scored by researchers every 7 days after transplantation.

[0035] 3. Treatment intervention in an acute GVHD model: Mice were treated with PBS, BigLEN, EcN, or EcNSmart in different groups. BigLEN was dissolved in sterile PBS at a dose of 3 mg / kg and administered intravenously; EcN and EcNSmart were administered at a dose of 1×10⁻⁶ per mouse. 9 CFU dose, 200 μL sterile PBS volume, was administered orally by gavage. All treatments began on day 7 post-transplantation, administered every 3 days until day 40. To induce BigLEN expression in EcNSmart in vivo, L-arabinose (final concentration 5 mg / mL) was added to the mice's drinking water from day 7 post-transplantation and maintained throughout; the arabinose-containing water was changed every 2–3 days. In short-term induction experiments, L-arabinose was administered orally by gavage at a concentration of 10 mg / mL, 200 μL per mouse.

[0036] 4. BMDM Isolation: After euthanizing mice, the femur and tibia were aseptically removed, and surrounding muscle and connective tissue were thoroughly cleared. Bone marrow cells were obtained by repeatedly rinsing the bone cavity with pre-cooled culture medium. The resulting cell suspension was gently pipetted and sieved to prepare a single-cell suspension. After erythrocyte lysis, washing, and counting, M-CSF factor was added to the cell suspension, and the cells were cultured at 37°C and 5% CO2. The culture medium was changed on day 3, and adherent mature macrophages were obtained on days 6-7.

[0037] 5. Plasmid Construction: The Luc-HA fusion gene (SEQ ID No. 8) was cloned into the NcoI and EcoRI restriction sites of the pBAD vector; the ClyA-BigLEN-HA fragment (SEQ ID No. 7) was cloned into the NcoI and HindIII restriction sites of the pBAD vector. Nissle 1917 strain carrying the expression plasmids pBAD-Luc-HA or pBAD-ClyA-BigLEN-HA was cultured in LB liquid medium containing ampicillin (50 μg / mL) at 37°C with shaking at 220 rpm.

[0038] 6. Genetic modification of Nissle 1917 strain: Construction of... msbB and tolR The detailed modification process for the double gene deletion strain is as follows: First, based on the Nissle 1917 genome annotation information, determine... msbB and tolR The genome-wide sgRNA was targeted, and two highly specific sgRNAs and their corresponding homology repair templates were designed for each gene. The homology arms were both 500-600 bp in length, and four phosphate-thio derivatives were introduced at the 5′ end of the donor DNA to improve recombination efficiency. Specifically, the pREDCas9 thermosensitive plasmid system (Li et al Metab Eng. 2015 Sep;31:13-21. doi: 10.1016 / j.ymben.2015.06.006. Epub 2015 Jun 30.Addgene:Plasmid #71541) was used to target the specific sgRNAs. msbB After cloning the sgRNA into the plasmid, it was electroporated into Nissle 1917 competent cells (electroplation conditions: 1.8-2.0 kV, 200 Ω, 25 μF). Cells were recovered at 30°C and plated on kanamycin plates to screen for positive clones. Subsequently, λ-Red recombinase expression was induced in medium containing 0.2% L-arabinose to prepare electroporable competent cells, which were then transformed into 300-500 ng of PT-modified sgRNA. msbB Donor DNA, after being revived at 30°C for 4 hours, was plated on antibiotic-free plates. The next day, the deleted region was verified by colony PCR and sequencing. The temperature-sensitive plasmid was then naturally lost through overnight incubation at 37°C, yielding a ΔmsbB single-deletion strain. The next step will be to target... tolR The sgRNA was cloned into the same plasmid system, transformed into ΔmsbB competent cells, and the donor DNA electroporation and screening process was repeated. Finally, the results were verified by cross-deletion PCR and sequencing. tolRSuccessful deletion yielded a double-deleted strain of ΔmsbBΔtolR. Negative and positive controls were set up throughout the process to ensure transformation efficiency. Finally, the double-deleted strain was verified by whole-genome sequencing to ensure that there were no off-target mutations and to ensure genetic stability.

[0039] After gene knockout, primers were designed for validation: msbB-up-F and msbB-down-R are homologous arm identification primers; the original strain can amplify a 1589bp product. msbB The amplification product after knockout was 617bp; msbB-up-F (SEQ ID No.9):AAGCGGTTTAATCTGCTGCGTGAT; msbB-down-R (SEQ ID No. 10):ATGCACTTGCGCAAGATCCTGGT; msbB-ter-F and msbB-ter-R were used as primers for identifying the target gene. The original strain could amplify a 936bp product. msbB No amplification products were generated after knockout; msbB-ter-F (SEQ ID No. 11): GATCTTTGCGCTTATACGGTTGG; msbB-ter-R (SEQ ID No.12):ATAGCGAATACATTCCTGAGTTT; tolRA-up-F and tolRA-down-R are homologous arm identification primers; the original strain can amplify a 2378bp product. tolRA The amplification product after knockout was 619bp; tolRA-up-F (SEQ ID No. 13): CCTTTCCTCGGTACGGTTGGCTC; tolRA-down-R (SEQ ID No. 14): CGATGCCGCCAATATCTTCAGGT; tolRA-ter-F and tolRA-ter-R were used as primers for identifying the target gene. The original strain could amplify a 1605 bp product. tolRA No amplification products were generated after knockout; tolRA-ter-F (SEQ ID No. 15):GCGCCCATCATCACCCAGAGC; tolRA-Ter-R (SEQ ID No. 16): TGGCTTGGTGGTTTCGGGATC.

[0040] 7. Construction of engineered EcN: First, remove competent cells from the -80℃ freezer and immediately thaw them on ice. Under aseptic conditions, add 1-10 ng of plasmid DNA (the volume should not exceed one-tenth of the competent cells), gently mix, and continue to incubate on ice for 30 minutes. Then, quickly place the centrifuge tube into a 42℃ water bath for precise heat shock for 90 seconds, and then quickly transfer it to ice and let it stand for 2-3 minutes. Next, add 500-900 μL of antibiotic-free LB liquid medium to the tube in a clean bench, and incubate at 37℃ with shaking at 180-220 rpm for 45-60 minutes. Finally, take an appropriate amount of bacterial suspension (50-100 μL for conventional plasmids, and centrifuge and resuspend the ligation product) and spread it evenly on LB agar plates containing the appropriate antibiotics. Invert the plates and incubate overnight at 37℃. The growth of transformants can be observed the next day. The entire process requires strict low temperature and aseptic operation, and it is recommended to set up positive and negative control groups to ensure the reliability of experimental results.

[0041] 8. In vitro and in vivo bioluminescence detection: EcN carrying the Luc-HA plasmid was cultured with or without 2 mg / mL L-arabinose (Ara). Engineered EcN and wild-type EcN were resuspended in PBS, and 200 μL of 5 mg / mL D-fluorescein potassium solution was added. Female Balb / C mice were orally administered 1×10 9 CFU of *E. coli* was administered concurrently with 200 μL of 10 mg / mL L-arabinose solution. Mice were sacrificed 12 hours later, and the contents of the stomach, small intestine, cecum, and colon (including feces) were collected and placed in 1.5 mL centrifuge tubes. 500 μL of 5 mg / mL D-fluorescein potassium solution was added and mixed thoroughly. Signal detection was performed using the IVIS® Lumina II in vivo imaging system (PerkinElmer, USA). Mice were also sacrificed at 3 h, 6 h, 12 h, and 24 h, and the stomach and the entire lower digestive tract (duodenum to colon) were dissected. 2 mL of 5 mg / mL D-fluorescein potassium solution was injected into the digestive tract, and luminescence signals were immediately acquired within 30 seconds.

[0042] 9. Preparation and characterization of outer membrane vesicles (OMVs): EcN cultured to OD 600When the concentration reached 0.6, 2 mg / mL L-arabinose was added to induce protein expression, followed by overnight shaking at 16°C and 160 rpm. The supernatant was collected and filtered through a 0.45 μm polyvinylidene fluoride (PVDF) membrane. The filtrate was centrifuged at 4°C and 4,000 × g for 15 minutes, and the precipitate was discarded. The supernatant was then ultracentrifuged at 4°C and 150,000 × g for 2 hours, and the precipitate was collected. The precipitate was resuspended in 200 μL PBS. To remove residual protein and bacteria, the PBS washing and ultracentrifugation steps were repeated once. Finally, the OMVs were resuspended in PBS and stored at -80°C. The morphology of the OMVs was observed using a transmission electron microscope (JEM-2000 EXTEM, JEOL, Japan); the particle size distribution was analyzed using a dynamic light scattering instrument (Zetasizer Nano ZS90, Malvern Instruments).

[0043] 10. Single-cell RNA sequencing (scRNA-Seq) data acquisition and analysis: scRNA-Seq data from intestinal tissues of GVHD patients were obtained from the GEO database (GSE234357) and analyzed using R. The analysis workflow was completed using the Seurat software package (v3.1.5): First, the gene expression matrix was standardized, and the top 2000 hypervariable genes were selected for subsequent analysis; dimensionality reduction was performed using principal component analysis (PCA), and the optimal number of principal components was determined using the JackStraw method; based on this, graph clustering and UMAP nonlinear visualization were performed. For pseudo-temporal analysis, Monocle 2 (v14.0) was used to perform pseudo-temporal sorting of macrophage-like cells, and DDR Tree dimensionality reduction and the orderCells function were used to achieve cell sorting. Differentially expressed genes (|log2FC|≥1 and corrected) between each cluster were analyzed. p For values ​​<0.05, GO and KEGG functional annotations are performed, and core pathway analysis is conducted in conjunction with Ingenuity pathway analysis (IPA, QIAGEN).

[0044] 11. Virtual Screening: The high-resolution crystal structure (PDB ID: 7ALV) of the human NACHT domain complex with the inhibitor was obtained from the protein database (PDB, http: / / www.rcsb.org). Protein structure processing and interaction energy analysis were performed using Molecular Operation Environment (MOE) software. Based on the binding mode of this protein with the small molecule inhibitor, a ligand-guided pharmacophore model was constructed. Virtual screening was then conducted on a self-built library of 1041 short peptides (12-20 amino acids in length); this peptide library design considered both structural diversity and physicochemical compatibility with intracellular delivery systems. Compared to small molecules, the selection criteria for candidate peptides included: stronger interfacial complementarity with the target protein and suitability for recombinant expression in *E. coli* (facilitating large-scale production and integration into engineered outer membrane vesicle (OMV) delivery platforms). Peptides meeting the pharmacophore characteristics were molecularly docked with the target protein, and the resulting complexes were ranked according to docking scores. The binding free energy was calculated using the MOE's built-in scoring function; lower values ​​indicated stronger affinity. The top 10% of peptides with the highest scores were selected for subsequent experimental validation.

[0045] 12. Surface Plasmon Resonance (SPR): The binding affinity between NACHT protein (HY-P701027, MCE, USA) and BigLEN (501036-69-7, MCE, USA) was determined using a Biacore T200 instrument (GE Healthcare, USA). NACHT protein was diluted with 10 mM acetate buffer (pH 4.0) and immobilized on the surface of a CM5 dextran chip (Cytiva, USA) via amino coupling. BigLEN was serially diluted to 3200, 1600, 800, 400, 200, and 100 nM and flowed through the immobilized NACHT chip surface at a flow rate of 30 μL / min. The entire run buffer was 1×HBS-EP+. The dissociation constant (KD) was calculated using a Biacore Kinetic Analysis Wizard model based on the response data.

[0046] 13. Western blot: Taking total cell protein extraction as an example: Protein was extracted using RIPA lysis buffer according to the manufacturer's instructions, centrifuged at 12,000×g for 20 minutes at 4°C, and the supernatant was transferred to a protein-free tube. Protein concentration was determined using a BCA protein quantification kit (Beyotime, Beijing). 40 μg of protein was taken from each sample, separated by SDS-PAGE electrophoresis (ACE Biotechnology), and then transferred to a PVDF membrane (Merck Millipore). The membrane was blocked with 5% skim milk powder, and then incubated sequentially with primary and secondary antibodies. Finally, protein expression levels were detected using ECL ultrasensitive chemiluminescent substrate imaging.

[0047] 14. Lactate dehydrogenase (LDH) release assay: Collect cell culture supernatant, centrifuge to remove debris; take an appropriate amount of clear supernatant, add lactate and NAD+. + The reaction system with tetrazolium salts. LDH-catalyzed NAD. + The product is reduced to NADH, which further reduces the tetrazolium salt to the colored formazan product. After the reaction is terminated with a weak acid, the absorbance of formazan is measured at a wavelength of 490 nm. The LDH activity is quantified by comparing the absorbance with that of the control group cells.

[0048] 15. Safety evaluation of oral administration of EcN: To assess safety, mice were randomly divided into three groups: EcN treatment group, ΔmsbBΔtolR (EcN-e) treatment group, and control group. Mice in the EcN and EcN-e groups were administered 1×10⁻⁶ EcN via oral gavage every 7 days. 9 Live CFU of Escherichia coli (dissolved in 200 μL PBS) was administered for 40 consecutive days; the control group received an equal volume of sterile PBS. Mouse weight and general health status were recorded daily. Mice were sacrificed 24 hours after the last gavage, and EDTA-anticoagulated blood was collected via cardiac puncture for routine blood tests. Immediately afterward, tissues from the heart, liver, spleen, lungs, kidneys, and various segments of the gastrointestinal tract (duodenum, jejunum, ileum, and colon) were harvested.

[0049] 16. Hematoxylin-Eosin (H&E) staining: The collected tissues were fixed in 4% paraformaldehyde at room temperature for 24-48 hours, then dehydrated with graded ethanol, cleared with xylene, and embedded in paraffin. 5 μm thick tissue sections were cut using a rotary microtome (Leica RM2255). Before staining, the tissues were dewaxed and hydrated, and H&E staining was performed according to standard procedures: hematoxylin (with modified Harris solution) was used to stain the nuclei; after differentiation and blue reversion, eosin was used to stain the cytoplasm; after dehydration and clearing, the sections were mounted with neutral resin.

[0050] 17. Immunofluorescence staining: Colon tissue was collected, rinsed with cold PBS, and immediately embedded in OCT embedding medium. The tissue was then flash-frozen in liquid nitrogen and stored at -80°C until sectioning. 10 μm thick frozen sections were cut using a cryostat (Leica CM1950), fixed with 4% paraformaldehyde for 15 minutes at room temperature, permeabilized with 0.3% Triton X-100 / PBS for 10 minutes, blocked with 5% normal donkey serum / PBS at room temperature for 1 hour, and then incubated with primary antibodies overnight at 4°C. The primary antibodies used included: anti-F4 / 80 (macrophage marker, Cell Signaling Technology, D2S9R, 1:200), anti-GSDMD (pyroptosis marker, Abmart, 1:200), anti-iNOS (M1 macrophage marker, Abmart, 1:250), and anti-eNOS (M2 macrophage marker, Abmart, 1:200). After developing the slides, they were incubated with the appropriate fluorescent secondary antibody (Alexa Fluor 488 / 594 / 647, Invitrogen, 1:500) at room temperature in the dark for 1 hour; Hoechst counterstaining of cell nuclei was performed for 5 minutes; and the slides were mounted with anti-quenching mounting medium (Beyotime). Images were acquired using a confocal laser scanning microscope (Olympus FV3000) and analyzed using ImageJ (NIH) software; at least three fields of view were randomly selected from each slide for positive cell counting or fluorescence intensity quantification.

[0051] 18. Flow cytometry: Colon tissue was harvested, washed with PBS, and fat and Peyer's lymph nodes were removed. The tissue was then longitudinally cut open and diced into small pieces. Preheated digestion buffer (HBSS containing 5% FBS, 1 mM DTT, 5 mM EDTA, 1 mg / mL collagenase D, Roche) was added, and the cells were gently shaken at 37°C for 30-45 minutes. The cell suspension was filtered through a 70 μm filter, washed, and resuspended in FACS buffer (PBS containing 2% FBS). Red blood cells were lysed with ACK lysis buffer. Surface staining: Approximately 1 × 10⁻⁶ cells. 6 Cells were incubated on ice for 10 minutes in the dark with Fc receptor blocking antibody (anti-CD16 / CD32, BD Biosciences), followed by incubation at 4°C for 30 minutes in the dark with fluorescently labeled surface antibody. Intracellular factor staining: Fixation and permeabilization were performed using the Cytofix / Cytoperm kit (BD Biosciences). Data acquisition was performed using a CytoFLEX flow cytometer (Beckman). Gating strategy: Debris and double-cell pairs were excluded based on forward / lateral scattering, and target cell populations were then delineated sequentially according to markers. The antibody combination used included: PerCP-Cy5.5 labeled anti-CD4, FITC labeled anti-IFN-γ, PE labeled anti-IL-17, and APC labeled anti-F4 / 80 (all purchased from BioLegend).

[0052] 19. Transmission Electron Microscopy (TEM): To observe pyroptosis morphology, isolated primary macrophages were prepared for TEM. After centrifugation, cells were fixed in 1% osmium tetroxide (prepared with 0.1 M phosphate buffer) at 4°C for 1.5 hours; dehydrated with a gradient of ethanol (50%, 70%, 90%, 100%), impregnated with propylene oxide, and embedded in Epon 812 epoxy resin; 70 nm sections were cut using a Leica EM UC7 microtome, slides were retrieved from copper mesh, and double-stained with 2% uranium acetate and Reynolds lead citrate. Observation was performed under a Hitachi HT7800 TEM (80 kV), and images were acquired using a digital camera. Pyroptosis cells were identified based on typical morphological characteristics: cell membrane rupture, macropores, cell swelling, and leakage of cytoplasmic contents, while early organelles remained intact.

[0053] 20. Experimental Timeline: Recipient mice received a lethal dose of irradiation on day 0, followed by bone marrow and spleen cell transplantation. Early mechanism validation studies were conducted on day 14 post-transplantation; efficacy assessment studies began administration on day 7 post-transplantation, with tissue samples collected on day 28 (unless otherwise specified); mouse survival was monitored until day 40 post-transplantation.

[0054] Example 1: Integrated single-cell analysis and in vivo validation reveal NLRP3-mediated macrophage pyroptosis as a contributing factor to intestinal GVHD. This invention compares the differences between intestinal tissue from GVHD patients and healthy controls (adjacent normal colon tissue after colorectal cancer surgery) using single-cell RNA sequencing data from the GSE database. Cell clustering analysis was performed based on known lineage-specific markers. UMAP dimensionality reduction analysis identified seven major cell populations: B cells, proliferating cells, epithelial cells, mast cells, myeloid monocytes, plasma cells, and T cells. Figure 2 (A–B). Samples were divided into a healthy control group and a disease group based on clinical status. The latter was further subdivided into mild and severe GVHD groups according to disease severity. The relative proportions of different cell populations between each group were quantified. Figure 2 (C) Compared with healthy controls, the proportions of T cells, macrophages, mast cells, and epithelial cells were significantly increased in the HSCT group. Figure 9 (Among them, A), T cells showed the most significant increase.

[0055] Given the central role of abnormal T cell activation in the pathogenesis of GVHD, this invention further analyzes T cell subsets. Based on known T cell markers ( Figure 9 (C) divides T cells into multiple subsets, including CD4 + ANXA1 + CD4 + CD40LG + CD4 +IL7R + CD4 + CCR7 + CD4 + FOXP3 + (Regulatory T cells, Treg), CD4 + MKi67 + CD8 + GZMB + CD8 + ITGAE + and CD8 + LAG3 + ( Figure 9 (D).

[0056] Because GVHD involves complex intercellular interactions, this invention conducted cell interaction analysis. The results showed that CD8... + GZMB + There is a strong interaction between T cells and macrophages. Figure 9 The results suggest that cytotoxic T cells and macrophages synergistically participate in the progression of GVHD. To investigate the transcriptional changes of macrophages during GVHD, this invention compared differentially expressed genes between the control group and the disease group. Gene set variation analysis (GSVA) ​​showed that as GVHD worsened, pyroptosis-related pathways were significantly enriched (…). Figure 2 (D). Further enrichment analysis showed that NLRP3, a key regulator of pyroptosis, was significantly upregulated in macrophages of GVHD patients (D). Figure 9 (B) indicates that these cells are undergoing pyroptosis. UMAP visualization ( Figure 2 The middle E) and violin plots confirmed that NLRP3 was specifically highly expressed in macrophage clusters, and the expression levels in both mild and severe GVHD groups were significantly higher than those in the healthy control group, with the severe group showing higher levels than the mild group. Figure 9 (E). Furthermore, the violin plot also showed that multiple pyroptosis biomarkers (including NLRP3, IL-1β, GBP2, and ZEB2) were upregulated in the disease group and positively correlated with the severity of GVHD. Figure 2 (Middle F).

[0057] To verify the above findings in vivo, this invention established an allogeneic hematopoietic stem cell transplantation model in Balb / c mice, using bone marrow and spleen cells from C57BL / 6 mice as donors, with the syngeneic transplantation group serving as a control. The survival time of mice in the allogeneic transplantation group was significantly shorter than that in the control group. Figure 9 GVHD mouse colon tissue was analyzed by HE staining, immunohistochemistry (IHC), and immunofluorescence (IF). HE staining showed that, compared with the control group, GVHD mouse colon tissue exhibited significant inflammatory infiltration, mucosal edema, and structural destruction. Figure 2GVHD mice (GVHD) were found to have elevated NLRP3 expression levels in their intestinal tissue by IHC staining. Figure 2 (H). IF staining further showed that the proportion of macrophages was increased in the colon tissue of GVHD mice, NLRP3 expression was upregulated, and the level of pyroptosis executive protein GSDMD was enhanced ( Figure 2 (I–J). Relative fluorescence data are shown in [reference needed]. Figure 9 In summary, this indicates that macrophage infiltration and pyroptosis occurred in the colon during GVHD, consistent with human single-cell sequencing data, suggesting that macrophage pyroptosis is involved in GVHD progression, and highlighting NLRP3 as a potential target for local therapeutic intervention.

[0058] Example 2: Identification and verification of BigLEN as a novel NLRP3 inhibitory peptide that can alleviate pyroptosis This invention anticipates that macrophage pyroptosis is a key effector mechanism exacerbating GVHD, and NLRP3 is its core regulatory molecule. Therefore, according to Figure 3 The process shown in section A, screening for potent NLRP3 inhibitors, may provide a new therapeutic strategy for alleviating GVHD. First, high-resolution crystal structures of the NLRP3 NACHT domain were obtained from the PDB database; this structure is highly conserved in humans and mice. Structural analysis of complexes of NLRP3 with known inhibitors revealed a conserved hydrophobic binding pocket within the NACHT domain. Figure 3 (B). Detailed interaction analysis showed that the inhibitor forms hydrogen bonds with residues such as Arg351, Gln624, Glu629, Arg578, and Ala228, with corresponding binding energies of -4.7, -2.0, -2.5, -8.7, and -0.7 kcal / mol, respectively. Based on these key interactions, this invention constructs a pharmacophore model containing four features (F1: hydrogen bond acceptor; F2: hydrogen bond acceptor; F3: hydrogen bond donor; F4: hydrogen bond acceptor). Figure 3 The pharmacophore model (C) was used for virtual screening of novel NLRP3 inhibitors. An internal library of 1041 peptides was initially screened using this model, yielding 196 candidate molecules. Molecular docking analysis was then performed on these candidates, and the top 10% of compounds with the highest binding scores were selected for further validation. Among them, a 16-amino acid peptide, BigLEN, exhibited significant inhibitory activity. Further molecular docking analysis (score: -14.48 kcal / mol) showed that BigLEN occupies the hydrophobic pocket of the NACHT domain. Figure 3 (D) and forms hydrogen bonds with key residues such as His367, Arg578, Glu369 and Glu629, with binding energies of -1.1, -0.8, -13.76 and -0.6 kcal / mol, respectively. Figure 3(E), suggesting the potential mechanism of action of BigLEN as an NLRP3 inhibitor.

[0059] The binding of BigLEN to NLRP3 was verified using SPR experiments. The results showed that it has rapid binding and dissociation kinetics, with an equilibrium dissociation constant (KD) of 1.749 × 10⁻⁶. -7 M, confirming a high-affinity interaction between BigLEN and NLRP3 protein ( Figure 3 Next, we investigated the ability of BigLEN to counteract LPS-induced pyroptosis in mouse bone marrow-derived macrophages (BMDMs). Cells were first incubated with 0.5 μg / ml LPS for 4 hours, followed by stimulation with 10 μM nigermectin. Flow cytometry analysis showed that BigLEN (10 and 50 μM) significantly inhibited cell death in a dose-dependent manner. Figure 3 Consistent with this, Western blot analysis showed that in LPS- and nigerminol-stimulated BMDMs, BigLEN treatment attenuated the expression of key downstream pyroptosis executive molecules activated by NLRP3, including cleaved Caspase-1, GSDME-N, mature IL-18, and cleaved IL-1β. Figure 3 (I). ASC oligomerization is a necessary step for NLRP3 activation, and BigLEN can inhibit LPS and nigerminol-induced ASC oligomerization in a dose-dependent manner. Figure 3 The results suggest that BigLEN acts upstream of ASC oligomerization, inhibiting NLRP3 activation. Furthermore, the release of lactate dehydrogenase (LDH) in the culture supernatant showed a significant increase in the LPS and nigermin groups compared to the PBS control group, while BigLEN treatment significantly reduced this increase. Figure 3 (J). Transmission electron microscopy (TEM) further confirmed the inhibitory effect of BigLEN on pyroptosis. Cells in the BigLEN-treated group maintained their intact morphology, while the control group showed typical pyroptosis morphological changes. In summary, this invention successfully identified and verified that BigLEN is a high-affinity peptide that binds to NLRP3 and can effectively inhibit NLRP3-mediated pyroptosis in macrophages in vitro.

[0060] Example 3: BigLEN dissolved in PBS was administered via tail vein injection (1 mg / kg), with limited in vivo efficacy. Intravenous injection of BigLEN failed to significantly improve the overall survival rate of GVHD mice. Figure 10 (A). Although no survival benefit was observed, mice in the BigLEN-treated group showed measurable reduction in disease severity in the early stages. In mice receiving intravenous BigLEN, clinical GVHD scores on days 7 and 14 post-transplantation were significantly lower than those in the untreated GVHD control group (A). Figure 10 The results (B) indicate that it possesses some biological activity. However, this improvement is transient and insufficient to translate into durable disease control or survival advantage. These results suggest that systemic administration may not be suitable for achieving sustained modulation of the intestinal immune response, indicating that effective inhibition of NLRP3-driven macrophage pyroptosis in intestinal GVHD is limited by the delivery pathway.

[0061] Example 4: Development of engineered Escherichia coli Nissle 1917 for local immunomodulatory payload delivery This invention utilizes CRISPR / Cas9 technology to knock out the lpxM gene (i.e., myristyl transferase, encoding lipid A biosynthesis) in the probiotic Escherichia coli Nissle 1917 (EcN). msbB ), and the components encoding the Tol-Pal system tolR and tolA Gene( Figure 4 (A). Successful gene knockout was confirmed by DNA gel electrophoresis. Figure 4 (BC), and named the genetically modified strain EcN-e.

[0062] By monitoring OD 600 Growth curves revealed that the proliferation rate of EcN-e was slightly slower than that of wild-type EcN. Figure 4 (D), and BCA protein quantification analysis showed that the OMV production of EcN-e was significantly higher than that of wild-type EcN (D). Figure 4 Transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) confirmed that genetic modification did not alter the typical morphology or particle size distribution of OMVs. Figure 4 (FG). This invention further evaluated the potential reduction in toxicity of EcN-e. LPS content quantification showed that the LPS level of EcN-e was significantly lower than that of the parental strain (FG). Figure 4 (H). To evaluate in vivo safety, mice were orally administered EcN-e (1×10⁻⁶ H) every three days. 9 CFU dissolved in 200 µL, for 40 days. No mouse death or obvious signs of distress were observed during this period, indicating no acute toxicity. Figure 4 (I). Complete blood count analysis showed that long-term administration of EcN-e did not significantly alter key hematological parameters such as white blood cell count, red blood cell count, hemoglobin concentration, and platelet count. Figure 4 J, Figure 11 (AD). Finally, this invention also evaluated the in vitro biocompatibility of purified OMVs. Co-incubation of macrophages with EcN-e-derived OMVs did not induce significant apoptosis (AD). Figure 4(KL). In summary, this invention successfully constructed an engineered EcN strain (EcN-e) that exhibits enhanced OMV production and good safety characteristics both in vivo and in vitro.

[0063] Example 5: Construction of an arabinose-inducible Escherichia coli Nissle strain for targeted intestinal delivery and pyroptosis inhibition To visualize bacterial localization, an EcN strain expressing a fusion protein of luciferase (Luc) and human influenza virus hemagglutinin (HA) was first constructed. Specifically, the Luc-HA fusion gene (SEQ ID No. 8) was cloned into the NcoI and EcoRI restriction sites of the pBAD vector, and then transformed into the EcN strain, named EcN-Luc-HA. This fusion gene is controlled by an arabinose-inducible promoter and is expressed only upon arabinose induction. Figure 5 As shown in Figure A, bacteria emitting bright bioluminescence after being cultured in a medium containing arabinose and then supplemented with a luciferin substrate. Western blot analysis ( Figure 5 (B) This also confirmed that HA-tagged proteins are expressed only under arabinose induction. Subsequently, this engineered EcN expressing luciferase was orally administered to mice. Figure 5 As shown in Figure D, the luminescent signal is mainly located in the colon and can still be detected within 24 hours after administration.

[0064] Next, the present invention fuses the BigLEN peptide with an HA tag and links the fusion protein to the C-terminus of the ClyA protein to display it on the surface of bacterial outer membrane vesicles (OMVs). This construct (SEQ ID No. 7) was also cloned into the pBAD vector and then transformed into EcN, and the resulting strain was named EcNSmart. Western blot analysis of bacterial outer membrane proteins confirmed the successful expression of the HA-tagged fusion protein. Figure 5 (See Figure B), indicating that EcNSmart effectively displays the fusion peptide on the surface of OMVs. Twelve hours after oral administration of EcNSmart (with simultaneous induction by arabinose), mouse colon tissue was collected for immunofluorescence staining. Unlike systemically administered free peptides, engineered OMVs readily entered the intestinal tissue. Results showed that HA-labeled OMVs exhibited fluorescent signals in colon tissue and co-localized with macrophages (Figure B). Figure 5 (C). This indicates that oral administration of engineered probiotics can achieve targeted delivery to intestinal tissues and be taken up by intestinal macrophages.

[0065] This invention utilizes in vitro experiments to evaluate the inhibitory effect of OMVs secreted by EcNSmart on LPS- and nigermin-induced pyroptosis. BMDMs were first incubated with 0.5 μg / mL LPS for 4 hours, followed by stimulation with 10 μM nigermin to induce pyroptosis. Flow cytometry results showed that treatment with BigLEN-displaying OMVs (50 μg / mL and 200 μg / mL) significantly inhibited cell death in a dose-dependent manner. Figure 5 (E–F). Transmission electron microscopy (TEM) showed that BigLEN-OMVs inhibited LPS and nigermin-induced pyroptosis morphological changes (E–F). Figure 5 Western blot analysis showed that BigLEN-OMVs inhibited the expression or activation of key pyroptosis-related proteins induced by LPS and nigermin, including cleaved caspase-1, GSDMD-N, IL-18, and mature IL-1β (cleaved-IL-1β). Figure 5 (H). Furthermore, it was found that BigLEN-OMVs could inhibit LPS and nigermectin-induced ASC oligomerization in a dose-dependent manner. Additionally, this invention also measured the release of lactate dehydrogenase (LDH) in cell supernatants. Compared with the PBS control group, LPS and nigermectin-stimulated groups showed significantly increased LDH levels, while BigLEN-OMV treatment effectively reduced LDH release (H). Figure 5 (I). In summary, this invention successfully constructed an engineered Escherichia coli strain, EcNSmart, achieving controlled delivery of therapeutic peptides into the gut.

[0066] Example 6: EcNSmart treatment improves survival and inhibits pyroptosis in GVHD To directly compare the therapeutic effects of systemic NLRP3 inhibition and intestinal-restricted delivery, this invention evaluated the effects of intravenous BigLEN, oral wild-type EcN, and EcNSmart in a mouse allogeneic HSCT-induced GVHD model. Treatment began one week post-transplantation, at which point neutrophils had engrafted. Consistent with previous observations, intravenous BigLEN did not result in a statistically significant improvement in overall survival in GVHD mice. Figure 6 (A). Similarly, treatment with wild-type EcN alone failed to provide a survival advantage. In contrast, mice treated with EcNSmart showed a significant and sustained improvement in survival. Histopathological analysis of colon tissue showed no significant reduction in tissue damage in the BigLEN or EcN treatment groups, while EcNSmart treatment significantly improved intestinal structure and reduced inflammatory damage. Figure 6(Middle B). Despite the lack of survival or histopathological benefit, both the BigLEN and wild-type EcN treatment groups showed measurable reductions in pyroptosis-related phenotypes. Immunofluorescence staining showed that, compared with untreated GVHD mice, the expression of the pyroptosis executive protein GSDMD was reduced in colonic macrophages in both the BigLEN and EcN groups, but the reduction was significantly greater in the EcNSmart group. Figure 6 (C). Consistent with this, lactate dehydrogenase (LDH) levels in intestinal lavage fluid were slightly decreased in the BigLEN and EcN treatment groups, but were significantly inhibited after administration of EcNSmart. Figure 6 Western blot analysis of colon tissue lysates further confirmed that the BigLEN and EcN groups only partially inhibited ASC oligomerization and downstream pyroptosis-related signaling, while EcNSmart treatment achieved a strong inhibition of inflammasome activation in vivo. Figure 6 (Middle F). In the BigLEN and wild-type EcN groups, despite the reduction in pyroptosis markers, there was a lack of survival or histopathological improvement, suggesting that partial or transient inhibition of inflammasome activity is insufficient to interrupt the established auto-persistent inflammatory cascade of GVHD. Although systemic administration of BigLEN and wild-type EcN attenuated macrophage pyroptosis to some extent, the degree, spatial distribution, and duration of inhibition may not be sufficient to prevent downstream amplification of tissue damage and pathogenic T cell responses.

[0067] Notably, wild-type EcN alone can moderately suppress pyroptosis-related markers, consistent with previous reports that probiotic strains can exert basal immunomodulatory effects through interactions with the microbiome, strengthening the barrier, or fundamentally regulating innate immune signaling. However, these non-specific effects do not reach therapeutic levels in the absence of targeted payload delivery.

[0068] Example 7: EcNSmart regulates T cell response and macrophage polarization in GVHD Since pyroptotic macrophages release IL-1β and IL-18, factors crucial for the differentiation and expansion of pathogenic CD4+ helper T cell subsets, this invention also evaluated the effects of EcNSmart treatment on T cell infiltration and macrophage polarization in the intestinal tissue of acute GVHD mice. T cells were collected from the spleen and colon on day 14 post-treatment. Flow cytometry analysis showed that, compared to the control group, CD4+ helper T cell infiltration in the spleen and colon of EcNSmart-treated mice was significantly reduced. + IFN-γ + T cells and CD4 + IL-17 + T cell infiltration was significantly reduced ( Figure 7(AD). Simultaneously, EcNSmart administration significantly reduced the level of reactive oxygen species (ROS) in colonic tissue. Figure 12 (Central BC). This invention further assesses the polarization state of intestinal macrophages using immunofluorescence staining. In the colon tissue of EcNSmart-treated mice, the expression of the macrophage anti-inflammatory marker eNOS increased, while the expression of the pro-inflammatory marker iNOS decreased, indicating a shift of macrophages towards an anti-inflammatory phenotype. Figure 7 (Middle EF). Quantitative data of immunofluorescence images are shown in [reference needed]. Figure 11 The results showed that EcNSmart treatment not only reduced pro-inflammatory T cell subsets and oxidative stress, but also reprogrammed intestinal macrophages to an anti-inflammatory state, jointly contributing to the remission of GVHD.

[0069] Example 8: EcNSmart preserves GVL effect after bone marrow transplantation Preserving graft-versus-leukemia (GVL) effects while treating GVHD is crucial for preventing relapse of malignant hematological diseases. To evaluate the effect of EcNSmart treatment on GVL, this invention established a stable luciferase-expressing A20 mouse B-cell lymphoma model. In the lentiviral packaging steps involved in constructing the stable luciferase-expressing A20 cell model, plasmid transfection typically uses a three-plasmid system for co-transfection of HEK293T cells. The commonly used mass ratio of the core plasmid (carrying the luciferase gene), helper plasmid psPAX2, and envelope plasmid pMD2.G is 4:3:1. Taking a 10 cm culture dish as an example, the total DNA amount is 20 μg, i.e., 10 μg core plasmid, 7.5 μg psPAX2, and 2.5 μg pMD2.G. The transfection reagent, such as PEI, is approximately 50-60 μg (i.e., 2.5-3 times the total plasmid mass). If a 6-well plate is used, the total DNA amount is correspondingly reduced to 4 μg (2 μg core plasmid, 1.5 μg psPAX2, and 0.5 μg pMD2.G). The transfection reagent, such as HighGene, is approximately 8 μL (plasmid to reagent ratio is 1:2). In practice, it is necessary to ensure that the plasmid is of high purity, free of endotoxin, and has a concentration in the range of 400-1000 ng / μL. On the day of transfection, the confluence of HEK293T cells should reach 70%-90%. Dilute the plasmid and transfection reagent separately in Opti-MEM, mix them, and let them stand at room temperature for 15-20 minutes to form a complex. Then slowly add the complex to the cell culture dish. 6-24 hours after transfection, the culture medium should be replaced with fresh medium to remove the transfection reagent. The viral supernatant is usually harvested 48 hours after changing the medium, at which time the viral titer reaches its peak.

[0070] All recipient mice received a co-transplantation of donor bone marrow and A20 cells transfected with luciferase. Mice in the BMT group received spleen T cells concurrently with bone marrow cell transplantation. Mice in the EcNSmart group received oral EcNSmart one week post-transplantation. Survival analysis showed that mice treated with EcNSmart had significantly prolonged survival, while mice receiving only BM and A20 cells died from leukemia progression, and mice receiving both BMT and A20 cells primarily died from GVHD (glucose-induced leukemia). Figure 8 (A). Correspondingly, clinical scores showed that the EcNSmart treatment group mice had significantly lower scores on day 28 than the untreated control group (A). Figure 8 (Middle B). In vivo bioluminescence imaging showed rapid tumor progression in non-transplanted mice. All transplanted mice exhibited significant control of tumor growth, but mice not treated with EcNSmart showed high mortality due to GVHD ( Figure 8 (C). In summary, EcNSmart treatment effectively separates GVL from GVHD by maintaining strong antitumor activity while significantly reducing GVHD-related mortality.

[0071] In summary, this invention demonstrates in a mouse allo-HSCT model that the OMVs generated by EcNSmart can cross the intestinal barrier, inhibit the activation and pyroptosis of macrophage NLRP3 inflammasomes in vivo, significantly alleviate intestinal GVHD, and retain the GVL effect. Figure 1 ).

[0072] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a polypeptide in the preparation of a macrophage pyroptosis inhibitor, characterized in that, The amino acid sequence of the polypeptide is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the polypeptide is shown in SEQ ID No.

2.

3. A fusion protein based on arabinose-induced expression, characterized in that, The fusion protein contains at least one polypeptide element and one ClyA element; The polypeptide elements are linked together using a linker, and the amino acid sequence of the polypeptide elements is shown in SEQ ID No. 1; The amino acid sequence of the ClyA element is shown in SEQ ID No.

3.

4. A recombinant expression vector comprising the encoding gene of the fusion protein of claim 3.

5. A recombinant probiotic comprising the recombinant expression vector of claim 4.

6. The recombinant probiotic according to claim 5, characterized in that, The base strain of the recombinant probiotic includes wild-type or genetically modified variants of Escherichia coli Nissle 1917.

7. The recombinant probiotic according to claim 6, characterized in that, The genetically modified mutant strains include those that knock out E. coli Nissle 1917. msbB and tolRA Gene.

8. A method for constructing recombinant probiotics based on arabinose-induced expression of a fusion protein, characterized in that, The process includes the following steps: linking the encoding gene of the fusion protein described in claim 3 with an expression vector to construct a recombinant expression vector, and using the recombinant expression vector to transform a genetically modified Escherichia coli Nissle 1917 mutant strain to obtain the recombinant probiotic; The genetic modification includes knockout. msbB and tolRA Gene.

9. The construction method according to claim 8, characterized in that, Knock out the msbB The nucleotide sequence of the gene target sequence is shown in SEQ ID No. 17; Knock out the tolRA The nucleotide sequence of the target sequence during gene processing is shown in SEQ ID No. 21 or SEQ ID No.

22.

10. A drug for improving graft-versus-host disease, characterized in that, It includes the recombinant probiotics as described in any one of claims 5 to 7, or the recombinant probiotics constructed using the construction method described in claim 8 or 9, and arabinose.