Method for preventing panax root rot based on cross-boundary synthetic community and application thereof

Abstract

This invention discloses a method for controlling root rot in Panax notoginseng based on a cross-species synthetic community and its application, belonging to the field of agricultural biological control. This cross-species synthetic community consists of a specific ratio of Bacillus bacteria and Trichoderma fungi. Biological agent capsules are prepared and applied as a basal soil treatment before planting. At the time of Panax notoginseng emergence, 5-10 capsules (equivalent to 100-200 mg per plant) are buried in each planting hole. The capsules slowly release the microbial community in the soil for 2-3 months. This synthetic community can significantly reduce the incidence of root rot in Panax notoginseng, promote plant growth, and increase the content of Panax notoginseng saponins. It achieves comprehensive control by inhibiting pathogens, reshaping the rhizosphere microecology, activating plant immunity, and regulating metabolism. It is suitable for green planting of Panax notoginseng and the management of continuous cropping obstacles, possessing both high efficiency and ecological safety.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biological control technology, specifically relating to a method for controlling root rot of Panax notoginseng based on cross-species synthetic communities and its application. Background Technology

[0002] Panax notoginseng is a traditional and precious Chinese medicinal herb, and its active ingredient, notoginsenoside, plays an important role in the treatment of cardiovascular diseases. However, root rot caused by various pathogens such as Fusarium spp. is a key factor restricting the development of the Panax notoginseng industry, with an annual incidence rate of 5%-20%, and up to 70% in severe cases.

[0003] Currently, the control of root rot in Panax notoginseng mainly relies on chemical fungicides (such as carbendazim and chloropicrin), but long-term use can lead to problems such as soil microecological imbalance, increased pathogen resistance, and contamination of medicinal materials. Biological control, as a green and sustainable alternative, has become a research hotspot. In existing technologies, the control effect of single antagonistic strains (such as Bacillus and Trichoderma) is greatly affected by the environment and lacks stability; while synthetic communities of a single kingdom (bacteria or fungi) often have limited functions and are difficult to cope with the complex rhizosphere microecological environment. In particular, whether exogenous microorganisms can survive and function in the rhizosphere is highly uncertain, requiring effective regulation of the rhizosphere microenvironment simultaneously. Therefore, developing cross-kingdom synthetic communities with synergistic effects and artificially regulating the rhizosphere environment to achieve efficient and stable biological control has significant theoretical and applied value. Summary of the Invention

[0004] This invention aims to overcome the shortcomings of existing chemical control and single biological control methods, and provides a method for controlling root rot of Panax notoginseng based on cross-species synthetic communities. By synergistic interaction between bacteria and fungi, supplemented by rhizosphere microenvironment regulation, it achieves efficient control of root rot, while promoting the growth and quality improvement of Panax notoginseng.

[0005] To achieve the above-mentioned technical objectives and effects, the present invention provides the following technical solution:

[0006] A transboundary synthetic community for controlling root rot in Panax notoginseng includes the following strains:

[0007] Bacterial strains: 1 strain of Bacillus stercoris, 6 strains of Bacillus velezensis, 1 strain of Bacillus subtilis, 2 strains of Bacillus amyloliquefaciens;

[0008] Fungal strains: Trichoderma atroviride 1 strain, Trichoderma hamatum 2 strains, Trichoderma petersenii 1 strain, Trichoderma neokoningii 1 strain, Trichoderma virilente 1 strain, Phanerochaete concrescens 1 strain.

[0009] Furthermore, the inoculation ratio of each strain was determined based on the natural abundance of the strain in the rhizosphere soil of healthy Panax notoginseng, and the specific ratio was: Bacillus subtilis: Bacillus velezensis: Bacillus stercoris: Bacillus amyloliquefaciens: Trichoderma atroviride: Trichoderma neokoningii: Trichoderma virilente: Trichoderma hamatum: Trichoderma petersenii: Phanerochaete concrescens = 1:5:13:20:1:14:30:350:590:755.

[0010] On the other hand, the present invention also provides a method for controlling root rot of Panax notoginseng based on the above-mentioned cross-species synthetic community, comprising the following steps:

[0011] Step 1: Prepare a cross-species synthetic community formulation, wherein the formulation is a capsule.

[0012] Capsule formulation: A mixture was prepared by dissolving 10 g / L sodium alginate, 5 g / L polyethylene glycol, 10 μM ferrous sulfate (FeSO4·7H2O), and 5 ml / L glycerol in deionized water; a cross-linking agent was added, and cross-linking was carried out for 1 hour to form a gel matrix; the bacterial precipitate and fungal spores of the cross-boundary synthetic community were mixed with the mixture, wherein each 1 mL contained >1×10⁻⁶ bacteria. 8 CFUs are made into gel capsule granules;

[0013] Step 2: Preparation and application of mixed organic materials

[0014] Three raw materials were selected: corn stalks, sweet potato stalks, and biochar. Two of the stalks had a moisture content of 5-8%. All three were pulverized into powder with a particle size of <2mm. Then, they were mixed in a ratio of corn stalks: sweet potato stalks: biochar of 1:1:0.3 to make a powdered or granular mixture. 5g of this mixture was applied per hole.

[0015] Step 3: Administration of capsule formulation

[0016] (1) Prepare the cross-species synthetic community capsule formulation according to the method described in step 1;

[0017] (2) When applying, use soil basal application. When Panax notoginseng seedlings emerge, bury 5-10 capsules (equivalent to 100-200mg per plant) in each hole. The capsules slowly release the microbial community in the soil, and the effective period is 2-3 months.

[0018] On the other hand, the present invention also provides an application of the aforementioned transboundary synthetic community in promoting the growth of Panax notoginseng and increasing the content of Panax notoginseng saponins, characterized in that the transboundary synthetic community is inoculated through the capsule formulation described in claim 3, and after inoculation, the fresh weight of the underground part of Panax notoginseng increases by more than 20% and the total saponin content increases by more than 25%.

[0019] Furthermore, the notoginseng saponins include notoginseng R1, notoginseng Rg1, notoginseng Rb1, notoginseng Re, and total notoginseng saponins.

[0020] The present invention has the following advantages:

[0021] (1) Significant control effect: The cross-border synthetic community can reduce the incidence of root rot of Panax notoginseng from 26.54% (pathogen control group) to 12.92%, which is significantly better than single bacterial or fungal communities;

[0022] (2) Synergistic growth-promoting effect: Promotes the increase of biomass in the aboveground and underground parts of Panax notoginseng, and increases plant height, with the fresh weight of the underground parts increasing by more than 30% compared with the control group;

[0023] (3) Quality improvement: Significantly increased the content of monomeric saponins such as R1, Rg1, and Rb1 and total saponins in Panax notoginseng, with the total saponin content increasing by 25%-40% compared to the control group;

[0024] (4) Ecological safety: By reshaping the rhizosphere microecology (increasing fungal diversity and reducing pathogen abundance), chemical pollution is avoided, making it suitable for green planting. Attached Figure Description

[0025] Figure 1 This is a line graph showing the change in the incidence of diseases of Panax notoginseng under different microbial treatments over time in this invention.

[0026] Figure 2 This is a bar chart comparing the dry weight of the above-ground and underground parts of Panax notoginseng in different treatment groups in this invention;

[0027] Figure 3 This is a bar chart comparing the fresh weight of the above-ground and underground parts of Panax notoginseng in different treatment groups in this invention;

[0028] Figure 4This is a heatmap showing the correlation between key strains in the transboundary synthetic community and Fusarium in this invention;

[0029] Figure 5 This is a bar chart showing the effects of different microbial treatments on the content of ginsenoside monomers (R1, Rg1, Re, Rb1, Rd) and total saponins in the main root of Panax notoginseng in this invention.

[0030] Figure 6 This is a bar chart comparing the plant height of Panax notoginseng in different treatment groups in this invention. Detailed Implementation

[0031] The present invention will be further described below with reference to the accompanying drawings. The present invention will be further described in detail below with reference to examples from Yunnan Province, but the scope of protection of the present invention is not limited to the following description.

[0032] Example 1: Strain screening and identification of trans-species synthetic communities

[0033] In this embodiment, the strains of the cross-species synthetic community were all derived from the rhizosphere soil of healthy Panax notoginseng from continuously cropped fields in Wenshan, Yunnan. The specific screening and identification steps are as follows:

[0034] 1. Sample collection

[0035] In October 2022, rhizosphere soil samples were collected from healthy Panax notoginseng plants grown in fields that had been continuously cropped for more than three years at the Panax notoginseng planting experimental base in Miao Township, Wenshan City, Yunnan Province. During sampling, the loose soil on the root surface was gently shaken off, and the rhizosphere soil attached to the roots was collected with a sterile brush. The rhizosphere soil samples from 4-6 healthy plants were mixed to form a composite sample, and a total of 3 biological replicates were collected. The samples were stored at -80℃ for later use.

[0036] 2. Strains Isolation and Purification

[0037] Bacterial isolation: Soil samples were serially diluted to 10⁻ using the dilution plating method. 6 100 μL of the culture was spread onto five different bacterial culture media, including TSA medium, R2A medium, and King's medium B, and incubated at 28°C for 1-2 days. Single colonies with different morphologies and colors were picked and purified three times using the streak plate method to obtain pure cultures.

[0038] Fungal isolation: The dilution-spreading method was also used. Soil samples were diluted and spread onto modified Martin medium and PDA medium, and incubated at 28°C for 3-5 days. Fungal colonies of different morphologies were picked and transferred to PDA medium for purification 3-5 times to obtain pure culture strains.

[0039] 3. Strain identification

[0040] Bacterial identification: Genomic DNA was extracted from the strain, and the 16S rRNA gene was amplified using universal primers 27F (AGTTTGATCMTGGCTCG) / 1492R (GGTTACCTTGTTACGACT). PCR conditions were: 98℃ pre-denaturation for 2 minutes, 98℃ denaturation for 10 seconds, 55℃ annealing for 30 seconds, 72℃ extension for 1 minute, for 35 cycles, followed by a final extension at 72℃ for 1 minute. The amplified products were sequenced by Sanger sequencing and compared with the NCBI database using BLAST to determine the strain's taxonomic position.

[0041] Fungal identification: Genomic DNA was extracted using the CTAB method. The ITS sequence was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) / ITS4 (TCCTCCGCTTATTGATATGC). PCR conditions were: 95℃ pre-denaturation for 3 minutes, 94℃ denaturation for 25 seconds, 56℃ annealing for 25 seconds, 72℃ extension for 30 seconds, repeated 35 times, with a final extension at 72℃ for 5 minutes. Species were identified by BLAST alignment after sequencing.

[0042] 4. Screening for antagonistic activity

[0043] Plate confrontation experiment: The antibacterial ability of the strains was determined using the main pathogens of root rot of Panax notoginseng, Fusarium oxysporum, F. solani, and F. acutatum, as targets.

[0044] Bacterial confrontation: Place a 5 mm pathogenic bacterial disc in the center of a TSA plate, and inoculate with 10 μL of bacterial suspension (OD) 3 cm away from the disc. 600 =0.8), with sterile water as a control, incubated at 28℃ for 5 days, the diameter of pathogen colonies was determined using the cross-cross method, and the inhibition rate was calculated:

[0045] Inhibition rate (%) = (Radius of control pathogen - Radius of treated pathogen) / Radius of control pathogen × 100%;

[0046] Fungal confrontation: 5 mm pathogenic fungal discs and test fungal discs were symmetrically placed on PDA plates and incubated at 28°C for 7 days. The inhibition rate was calculated as above.

[0047] Screening results: A total of 53 bacterial strains and 47 fungal strains with antagonistic activity were obtained. Among them, 11 bacterial strains (such as Bacillus velezensis E35, with an inhibition rate of 83.75% ± 1.99) and 7 fungal strains (such as Trichoderma neokoningii Z77, with an inhibition rate of >74% against 3 pathogens) showed strong antibacterial activity and were included as candidate strains.

[0048] 5. Determination of growth-promoting characteristics

[0049] Nitrogen fixation ability: The strain was inoculated on nitrogen-free Assumption medium and cultured at 28°C for 7 days. The strain that could grow and survive three consecutive subcultures was determined to have nitrogen fixation activity.

[0050] Phosphorus solubility: The strain was inoculated on Pikovaskaya medium and cultured at 28°C for 7 days. The strain that observed the phosphorus solubility zone was positive. For quantitative determination, the strain was inoculated on liquid medium and cultured for 48 hours. The phosphorus solubility rate was determined by the molybdenum antimony colorimetric method. Strains with a phosphorus solubility rate >3.5% were screened.

[0051] Potassium solubilization capacity: The strain was inoculated on potassium feldspar medium and cultured at 28°C for 14 days. Strains that could grow were considered positive. For quantitative determination, the content of available potassium in the culture medium was measured using a flame photometer, and the effective potassium solubilization rate was calculated.

[0052] IAA production capacity: The strain was inoculated into Czapek's liquid medium containing tryptophan and cultured at 30°C for 4 days. Salkowski chromogenic reagent was added. The strain that turned pink was positive. The absorbance was measured at 530 nm using a spectrophotometer. The IAA concentration was calculated according to the standard curve. Strains with a content >15 ng / mL were screened.

[0053] Screening results: All 11 bacterial strains had at least three growth-promoting functions, including nitrogen fixation, phosphorus solubilization, potassium solubilization, and IAA production. Among the 7 fungi, Trichoderma hamatum and Phanerochaete concrescens showed strong IAA synthesis capabilities (up to 20.3 ng / mL).

[0054] Example 2: Construction and preparation of cross-species synthetic communities

[0055] 1. Determination of strain ratio

[0056] The natural abundance (copy number / g soil) of candidate strains in the rhizosphere soil of healthy Panax notoginseng was quantified by qPCR. The results showed that:

[0057] Among bacteria, Bacillus amyloliquefaciens had the highest abundance, followed by Bacillus stercoris;

[0058] Among fungi, Phanerochaete concrescens had the highest abundance, followed by Trichoderma hamatum.

[0059] Based on abundance ratios, the strain ratios for the transboundary synthetic community were determined as follows:

[0060] Bacillus subtilis: B. velezensis: B. stercoris: B. amyloliquefaciens:Trichoderma atroviride: T. neokoningii: T. virilente: T. hamatum: T.petersenii: Phanerochaete concrescens = 1:5:13:20:1:14:30:350:590:755.

[0061] 2. Capsule Formulation Preparation

[0062] Preparation of capsule formulation: Sodium alginate (10 g / L), polyethylene glycol (5 g / L), ferrous sulfate (FeSO4·7H2O, 10 μM), and glycerol (5 ml / L) were dissolved in deionized water to prepare a mixture; a cross-linking agent (such as 20 g / L calcium nitrate) was added, and cross-linking was carried out for 1 hour to form a gel matrix; the bacterial precipitate and fungal spores of the cross-boundary synthetic community were mixed with the mixture (the bacterial count per 1 mL was >1 × 10⁻⁶). 8 CFUs (Chemical Fuels) are used to prepare gel capsule particles. A cross-linking agent promotes rapid curing, forming a protective encapsulation structure. The mixture is sterilized at 121°C for 20 minutes and then cooled. A cross-border synthetic community of bacteria is added and mixed to obtain the capsule particles. The particle diameter is controlled at 2-5 mm for easy soil application.

[0063] Example 3: Verification of the effect of cross-species synthetic communities in controlling root rot of Panax notoginseng

[0064] 1. Pot Experiment Design

[0065] Experimental materials: 1-year-old Panax notoginseng seedlings (from Wenshan Nursery), continuously cropped red soil (sieved and air-dried, pH 6.0-6.5), plastic pots (33cm in diameter and 18cm in height), each pot containing 10kg of soil and 5 Panax notoginseng plants.

[0066] Treatment group settings: 5 treatments in total, 15 pots per group, repeated 3 times:

[0067] CK1: Root irrigation with an equal volume of sterile water;

[0068] CK2: Root dredging pathogen suspension (F. oxysporum: F. solani: F. acutatum = 1000:8:1, concentration 1×10⁻⁶) 6 (cfu / g soil)

[0069] CK3: After inoculation with pathogens, spray with 50% carbendazim wettable powder (500 times dilution, 200 mL per plant).

[0070] Cross group: root drenching pathogen suspension + cross-border synthetic community capsules (concentration 1×10⁻⁶) 8 (cfu / mL).

[0071] Application method:

[0072] For capsule formulations: they can be applied as a soil basal application. When Panax notoginseng seedlings emerge, 5-10 capsules (equivalent to 100-200mg per plant) are buried in each hole. The capsules slowly release the microbial community in the soil, and the effective period is 2-3 months.

[0073] 2. Measurement of prevention and control efficacy

[0074] Incidence rate statistics: The number of diseased plants was investigated in April, May, and June, and the incidence rate was calculated.

[0075] Incidence rate (%) = Number of infected plants / Total number of plants × 100%

[0076] The results showed that in June, the incidence rate in the CK2 group was 26.54%, while the incidence rate in the Cross group dropped to 12.92%, which was significantly lower than that in the CK2 group (p<0.05) and better than that in the CK3 group (10.60%).

[0077] Growth index determination: At harvest in June, plant height, underground fresh weight and other indicators were measured. The average plant height of the Cross group was 28.6 cm, which was 48.9% higher than that of the CK2 group (19.2 cm); the average underground fresh weight was 8.6 g / plant, which was more than 20% higher than that of the CK group.

[0078] Saponin content determination: The saponin content in the main root was determined by HPLC (referring to the Chinese Pharmacopoeia (2020 edition)). The chromatographic conditions were: octadecylsilane-bonded silica column, acetonitrile-water gradient elution, and detection wavelength of 203 nm. The results showed that the total saponin content in the Cross group was 8.7 mg / g, which was more than 25% higher than that in the CK group.

[0079] Example 4: Verification of the mechanism of action of cross-species synthetic communities

[0080] 1. Rhizosphere microbial community remodeling

[0081] Rhizosphere microbial structure was analyzed using 16S and ITS amplicon sequencing. The results showed that the Shannon index of fungi in the Cross group increased from 1.8 in the CK2 group to 2.5, and the relative abundance of the genus Fusarium decreased from 35.2% to 12.7%. Bacillus showed a non-linear negative correlation with Fusarium (R²=0.72, p<0.0001), while Trichoderma showed a linear negative correlation with Fusarium (R²=0.86, p<0.0001).

[0082] 2. Plant immune activation

[0083] Defense enzyme activity: The POD activity in the leaves of the Cross group was 320.5 U / g, which was significantly lower than that of the CK2 group (712.36 U / g) (p<0.05); the PAL activity was 28.3% lower than that of the CK2 group.

[0084] Signaling molecules: The SA content in the Cross group decreased by 40.2% and the JA content increased by 35.6% compared with the CK2 group, indicating that JA-mediated systemic resistance was activated.

[0085] 3. Metabolic regulation

[0086] Transcriptome analysis showed that the expression levels of key genes for saponin synthesis, HMGR1, FPS2, and CYP716A47, were upregulated in the Cross group by 2.1-3.2 times compared with the CK2 group, promoting saponin biosynthesis.

[0087] The above embodiments are all based on the core technical solution of the present invention, and the experimental results fully verify the control effect and mechanism of action of the cross-species synthetic community on root rot of Panax notoginseng, which can provide clear guidance for those skilled in the art to repeat the implementation.

[0088] The above description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or related technologies or knowledge. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.

Claims

1. A transboundary synthetic community for controlling root rot in Panax notoginseng, characterized in that, Including the following strains: Bacterial strains: Bacillus stercoris 1 strain, Bacillus velezensis 6 strains, Bacillus subtilis 1 strain, Bacillus amyloliquefaciens 2 strains; Fungal strains: 1 strain Trichoderma atroviride, 2 strains Trichoderma hamatum, 1 strain Trichodermapetersenii, 1 strain Trichoderma neokoningii, 1 strain Trichoderma virilente, 1 strain Phanerochaete concrescens.

2. The cross-species synthetic community according to claim 1, characterized in that, The inoculation ratio of each strain was determined based on the natural abundance of these strains in the rhizosphere soil of healthy Panax notoginseng, and the specific ratio was: Bacillus subtilis: Bacillus velezensis: Bacillus stercoris: Bacillus amyloliquefaciens: Trichoderma atroviride: Trichoderma neokoningii: Trichoderma virilente: Trichoderma hamantum: Trichoderma petersenii: Phanerochaete concrescens = 1:5:13:20:1:14:30:350:590:

755.

3. A method for controlling root rot of Panax notoginseng based on the cross-species synthetic community described in claim 2, characterized in that, Includes the following steps: Step 1: Prepare a cross-species synthetic community formulation, wherein the formulation is a capsule. Capsule formulation: A blend of 10 g / L sodium alginate, 5 g / L polyethylene glycol, 5 ml / L glycerol, and 10 μM ferrous sulfate (FeSO4·7H2O) was prepared in deionized water; 2% calcium nitrate was added as a cross-linking agent, and cross-linking was carried out for 1 hour to form a gel matrix; the bacterial precipitate and fungal spores of the cross-boundary synthetic community were mixed with the blend, wherein each 1 mL contained >1×10⁻⁶ bacteria. 8 CFUs are made into gel capsule granules; Step 2: Preparation and application of mixed organic materials Three raw materials were selected: corn stalks, sweet potato stalks, and biochar. Two of the stalks had a moisture content of 5-8%. All three were pulverized into powders <2mm in size. Then, they were mixed in a ratio of corn stalks: sweet potato stalks: biochar of 1:1:0.3 to form a powdered or granulated mixture. 5g of this mixture was applied per hole. Step 3: Administration of the capsule formulation When applying, use soil basal application. When Panax notoginseng seedlings emerge, bury 5-10 capsules (equivalent to 100-200mg per plant) in each hole. The capsules slowly release the microbial community in the soil, and the effective period is 2-3 months.

4. The prevention and control method according to claim 3, characterized in that, In step 1, bacterial culture was performed using TSB liquid medium at 28°C with shaking at 200 rpm for 1-2 days; fungal culture was performed using PDB liquid medium at 28°C with shaking at 180 rpm for 3-7 days.

5. The application of the transboundary synthetic community described in claim 2 in the preparation of a biocontrol agent for root rot of Panax notoginseng, characterized in that, The biocontrol agent is a capsule formulation containing the aforementioned cross-species synthetic community. The capsule formulation encapsulates the microbial community using sodium alginate, polyethylene glycol, glycerin, ferrous sulfate, and calcium nitrate to form gel particles, with a viable bacteria concentration of 1×10⁻⁶. 7 -1×10 9 cfu / g.

6. The application of the cross-species synthetic community described in claim 2 in promoting the growth of Panax notoginseng and increasing the content of Panax notoginseng saponins, characterized in that, The cross-species synthetic community is applied through the capsule formulation described in claim 3, and after inoculation, the fresh weight of the underground parts of Panax notoginseng increases by more than 20% and the total saponin content increases by more than 25%.

7. The application according to claim 6, characterized in that, The notoginseng saponins include notoginseng R1, notoginseng Rg1, notoginseng Rb1, notoginseng Re, and total notoginseng saponins.

Images