A strain of Bacillus sp. H2-20 and its application

Abstract

This invention discloses a plant Bacillus This invention relates to strain sp. H2-20 and its application, belonging to the field of beneficial bacteria technology. Bacillus sp. The H2-20 strain was deposited at the China Center for Type Culture Collection on December 18, 2025, with accession number CCTCC M 20252960. The strain exhibits high salt and alkali tolerance and the ability to reduce salinity, with a reduction rate of 5.67%. It also possesses nitrogen fixation, potassium solubilization, organic phosphorus solubilization, inorganic phosphorus solubilization, protease production, siderophore production, cellulase production, and IAA production, which can significantly promote the growth of both the above-ground and underground parts of cucumber plants, increase cucumber yield, improve cucumber quality, and enhance the resistance of cucumber seedlings to salt and alkali stress.

Description

Technical Field

[0001] This invention relates to the field of beneficial bacteria technology, and in particular to a strain of beneficial bacteria. Bacillus sp. H2-20 strain and its application. Background Technology

[0002] Beneficial microorganisms in soil mainly include: bacteria, such as nitrogen-fixing bacteria (e.g., rhizobia), phosphate-solubilizing bacteria, potassium-solubilizing bacteria, photosynthetic bacteria, and actinomycetes; fungi, such as arbuscular mycorrhizal fungi and Trichoderma; and other microorganisms, such as protozoa, nematodes, and algae. Soil probiotics refer to beneficial microbial communities that can promote soil ecological health, improve soil structure, inhibit soil-borne diseases, and ultimately help plants grow healthily.

[0003] The beneficial effects of soil probiotics on soil mainly include: 1) Improving soil structure and fertility. They decompose organic matter such as plant and animal remains and excrement into small-molecule nutrients (such as humus) that plants can absorb; through metabolic activities, they activate and release mineral elements such as phosphorus, potassium, and iron that are fixed in the soil and cannot be absorbed by plants, making them available for plant use; some nitrogen-fixing bacteria can convert free nitrogen in the air into ammonia (NH3) that plants can use; the mycelium and secretions of microorganisms can bind fine soil particles into stable aggregate structures, increasing soil porosity and making the soil loose, breathable, and able to retain water and fertilizer.

[0004] 2) Suppressing pathogens and preventing soil-borne diseases. When the population of beneficial bacteria expands and occupies soil space and nutrient resources, it will squeeze out the living space of pathogens; the antibiotics, lysozymes and other substances produced by beneficial bacteria can directly inhibit or kill pathogenic fungi and bacteria; they can also stimulate the plant's own immune defense system and increase its resistance to diseases and pests.

[0005] 3) Promote plant growth. In addition to promoting plant growth by improving soil structure and fertility, some beneficial bacteria also secrete growth hormones such as auxin, cytokinin, and gibberellin, which directly stimulate seed germination, root development, and plant growth. Some beneficial bacteria can form symbiotic relationships with plant roots, expanding the root system's absorption area and helping plants acquire water and nutrients more efficiently.

[0006] 4) Degrading pollutants and restoring soil. Some probiotics can also decompose soil pollutants such as pesticide residues, petroleum hydrocarbons, and heavy metals, reducing their toxicity and residues, and playing a role in the bioremediation of soil.

[0007] 5) Alleviating continuous cropping obstacles. In greenhouses, orchards, and other places where the same crop is continuously grown for a long period of time, the imbalance of soil microbiota and the accumulation of pathogens can easily lead to poor crop growth and more diseases. Applying probiotics can rebuild a healthy microbial community and alleviate this problem. Summary of the Invention

[0008] The purpose of this invention is to provide a plant Bacillus The sp. H2-20 strain and its application provide a new beneficial bacterium for improving soil physicochemical properties, enhancing soil fertility, and promoting plant growth.

[0009] To achieve the above objectives, the present invention provides a plant Bacillus strain sp.H2-20 was deposited on December 18, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 20252960.

[0010] Preferably, the Bacillus The 16S rDNA sequence of strain sp.H2-20 is shown in SEQ ID NO.3.

[0011] A plant as described above Bacillus Application of strain sp. H2-20 in the preparation of saline-alkali land improvement products, wherein the product is added with the aforementioned strain. Bacillus strain sp.H2-20, the product is used to reduce soil salinity.

[0012] A plant as described above Bacillus Application of strain sp. H2-20 in fertilizer preparation, wherein the fertilizer is added with the strain described above. Bacillus The fertilizer is of strain H2-20; the fertilizer has at least one effect of promoting the growth of aboveground and / or underground parts of plants and photosynthetic capacity; the fertilizer includes foliar fertilizer.

[0013] Preferably, the fertilizer has the function of increasing soil nitrogen content, absorbable phosphorus content, absorbable potassium content and absorbable iron content.

[0014] A plant as described above Bacillus Application of strain sp. H2-20 in the preparation of a formulation that promotes the decomposition of organic matter, wherein the formulation is a formulation that promotes the decomposition of animal and plant residues, and wherein the formulation contains the aforementioned strain. Bacillus strain H2-20.

[0015] A plant as described above Bacillus Application of strain sp. H2-20 in the preparation of bactericidal agents, wherein the bactericidal agent contains the aforementioned strain. Bacillus strain H2-20.

[0016] A plant as described above Bacillus Application of strain sp. H2-20 in the preparation of vegetable quality improvement agents, wherein the preparation contains the aforementioned strain. Bacillussp. H2-20 strain; the preparation has the effect of promoting at least one of the following: increasing the content of vitamin C, soluble protein and soluble sugar.

[0017] A plant as described above Bacillus Application of strain sp. H2-20 in the preparation of a specific formulation for salt-stressed plants, wherein the formulation contains the aforementioned strain. Bacillus strain H2-20; the preparation is used to promote crop growth and development under salt stress conditions.

[0018] Therefore, the present invention provides a plant Bacillus strain H2-20 and its application, with specific technical effects as follows: (1) The present invention provides a plant Bacillus After being cultured at 28°C on LB agar for 24-48 hours, strain sp. H2-20 typically forms colonies with a diameter of 2-4 mm. These colonies are round, with smooth and regular edges, and are opaque milky white or pale yellow in color. The colony surface is smooth, moist, and glossy, with a thick texture, and remains soft and moist overall. It was deposited on December 18, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, China, with accession number CCTCC M 20252960. (2) The present invention provides Bacillus strain sp. H2-20 exhibits high salt and alkali tolerance, growing well on media containing 14% NaCl or pH=12, or simultaneously containing 10% NaCl and pH=9; it also possesses alkalinity-lowering ability, with a lowering rate of 5.67%. (3) The present invention provides Bacillus The sp.H2-20 strain also possesses growth-promoting abilities such as nitrogen fixation, potassium solubilization, organic phosphorus solubilization, inorganic phosphorus solubilization, protease production, cellulase production, and IAA production. Under normal conditions and salt-alkali stress conditions, it can significantly promote the growth of both the above-ground and underground parts of cucumber plants, increase cucumber yield, and improve cucumber quality.

[0019] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0020] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is in Embodiment 1 of the present invention Bacillus Photograph of strain sp.H2-20 growing on LB solid medium; Figure 2 It is the phylogenetic tree constructed in Embodiment 1 of the present invention; Figure 3 These are the salt and alkali tolerance test results in Example 2 of the present invention; where a is a culture medium containing 10% NaCl and pH=9; b is a culture medium with pH=12; and c is a culture medium containing 14% NaCl. Figure 4 These are the results of growth-promoting characteristic detection in Example 2 of this invention; where a is the nitrogen fixation result; b is the potassium solubilization result; c is the organic phosphorus solubilization result; d is the inorganic phosphorus solubilization result; e is the protease production result; f is the cellulase production result; g is the siderophore production result; h is the IAA production result (i is the negative control, ii is the positive control, and iii is H2-20). Figure 5 This is in embodiment 3 of the present invention Bacillus Results of growth-promoting effects of strain sp. H2-20 on cucumber seedlings; Figure 6 This is in embodiment 4 of the present invention. Bacillus The effects of strain sp.H2-20 on cucumber fruits; Figure 7 This is in embodiment 5 of the present invention. Bacillus Results of the stress relief effect of strain sp.H2-20 on cucumber seedlings under salt-alkali stress.

[0022] Bacillus strain sp.H2-20 was deposited on December 18, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 20252960. Detailed Implementation

[0023] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0024] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0025] The instruments, equipment, reagents, and materials used in the examples were all commercially available; methods not described in detail are conventional techniques in the art; letters after the values ​​in the table indicate significance, with different letters indicating significant differences.P <0.05.

[0026] The component information of the culture medium used in the examples is as follows: (1) LB solid medium: 5.0g yeast extract, 10g peptone, 10g sodium chloride, 15g agar, pH 7.0±0.1, 1L distilled water, autoclaved at 121℃ for 15 minutes; LB liquid medium is the same as LB solid medium, except that agar is not added; (2) Assabeth medium: 0.2g potassium dihydrogen phosphate, 10.0g mannitol, 0.2g sodium chloride, 0.1g calcium sulfate, 5.0g calcium carbonate, 15.0g agar, 0.2g magnesium sulfate, pH 7.0±0.1, 1L distilled water, autoclaved at 121℃ for 15min; (3) Skim milk culture medium: 10g skim milk powder and 20g agar are heated and dissolved in 1L of distilled water and autoclaved at 105℃ for 20min to avoid the formation of flocculent protein; (4) Organic phosphorus-soluble bacteria culture medium: glucose 10.0g, lecithin 0.2g, ammonium sulfate 0.5g, yeast extract 0.5g, potassium chloride 0.3g, magnesium sulfate 0.3g, ferrous sulfate 0.03g, manganese sulfate 0.03g, calcium carbonate 1.0g, sodium chloride 0.3g, agar 15.0g, pH 7.0-7.5. 1L distilled water, autoclaved at 121℃ for 15min; (5) Inorganic phosphate-solubilizing bacteria culture medium: glucose 10.0g, ammonium sulfate 0.5g, yeast extract 0.5g, sodium chloride 0.3g, potassium chloride 0.3g, magnesium sulfate 0.3g, ferrous sulfate 0.03g, manganese sulfate 0.03g, calcium phosphate 5.0g, agar 15.0g, pH 7.0-7.5, distilled water 1000mL, autoclave at 121℃ for 15min; (6) Sodium carboxycellulose medium: 10.0g peptone, 10.0g yeast powder, 10.0g sodium carboxycellulose, 5g sodium chloride, 1g potassium dihydrogen phosphate, 18g agar, 1L distilled water, autoclave at 121℃ for 15min; (7) Silicate bacterial culture medium: sucrose 5.0g, magnesium sulfate 0.5g, calcium sulfate 0.1g, disodium hydrogen phosphate 2.0g, ferric chloride 0.005g, glass powder 1.0g, agar 15.0g, pH 7.0±0.2. Weigh 23.6g of this product, add 1000mL of distilled water, and autoclave at 116℃ for 30min; (8) Chromium azurite CAS detection medium: Chromium azurite S (CAS) 0.06g, hexadecyltrimethylammonium bromide (HDTMA) 0.07g, ferric chloride hexahydrate 0.002g, sodium dihydrogen phosphate dihydrate 0.3g, disodium hydrogen phosphate dodecahydrate 0.3g, ammonium chloride 0.1g, potassium dihydrogen phosphate 0.04g, sodium chloride 0.06g, agar 9g, pH 6.8±0.1, distilled water 1000mL, autoclaved at 116℃ for 30min; (9) Preparation of bacterial suspension: The bacterial strain was activated to the logarithmic phase by culturing it in LB medium at 28°C, and OD was prepared. 600 A bacterial suspension with a concentration of approximately 0.8.

[0027] Example 1 strains Bacillus The isolation, identification, and preservation of sp. H2-20 are detailed below: (1) Sampling. Soil samples were collected from the rhizosphere of maize plants at the Xiangyang Base of Northeast Agricultural University in Harbin, Heilongjiang Province (45°50'24"N, 126°46'48"E) using the five-point sampling method. The method for collecting rhizosphere soil was as follows: First, use a shovel to dig out as much of the entire root system of the pepper plant as possible, including the rhizosphere soil. Then, gently shake the root system to remove large clumps of soil without roots. Use a brush to gently brush the soil attached to the plant roots and collect it into a resealable bag. Approximately 100g of rhizosphere soil was collected from each plant. Labels were affixed to the resealable bags, recording the collection location name, latitude and longitude, soil characteristics, plant name, and sampling time. After the samples were collected, the sampling bags were placed in an icebox and transported back to the laboratory as soon as possible for temporary storage at -20℃. The rhizosphere microbial isolation experiment was completed within 3-5 days.

[0028] (2) Isolation. Salt-tolerant bacterial strains were isolated from the collected soil samples using the dilution plating method. The soil suspension was diluted to 10... -1 10 -2 10 -3 10 -4 and 10 -5 For each gradient, 100 μL of LB solid medium was pipetted evenly onto plates, sealed with sealing film, numbered, labeled, and dated. The plates were then incubated upside down at 28°C for 24–48 h. Each concentration was repeated three times. Colonies with different morphologies were selected and promptly transferred to LB medium for streaking again until single colonies were isolated and labeled. The isolated colonies were purified twice. The selected single colonies were then transferred to LB medium containing 10% NaCl and pH=9 and streaked again. The plates were incubated upside down at 28°C for 48–72 h to screen for salt-tolerant strains, named H2-20. The strains were temporarily stored at 4°C on slant agar or at -80°C to prevent loss of activity.

[0029] (3) Morphological identification. The salt-tolerant strain H2-20, selected and activated on LB solid medium, was incubated in a 28℃ biochemical incubator for 2 days. Basic morphological characteristics such as colony morphology, size, color, texture viscosity, gloss, transparency, and edge smoothness were observed and recorded by photograph. (Photos are shown below.) Figure 1 As shown, under 28℃ incubation conditions, H2-20 grows rapidly on LB solid medium, usually forming colonies with a diameter of 2-4 mm. These colonies are round with smooth and neat edges, and are opaque milky white or pale yellow in color. The surface of the colonies is smooth, moist, and glossy, with a thick texture, and the whole colony remains soft and moist.

[0030] (4) Molecular identification: Single colonies of strain H2-20 were picked and placed in 1 mL of sterile water. Bacterial DNA was extracted by boiling lysis method, i.e., lysis at 100℃ for 10 min. Bacterial DNA was obtained. The strain was amplified by PCR using primers 27F (sequence shown in SEQ ID NO.1) and 1492R (sequence shown in SEQ ID NO.2).

[0031] A 50 μL PCR reaction system was used, and the amounts of each component were as per the instructions attached to the Taq enzyme package: 4 μL template (genomic DNA), 2 μL each of primers (27F and 1492R), 17 μL ddH2O, and 25 μL MIX (2×Taq plus Master Mix).

[0032] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; final extension at 72℃ for 10 min.

[0033] The PCR product was sent to the company for sequencing, and the 16S rDNA sequence of strain H2-20 was obtained, as shown in SEQ ID NO.3.

[0034] SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG SEQ ID NO.2: GGTTACCTTGTTACGACTT SEQ ID NO.3: The 16S rDNA sequence of strain H2-20 was subjected to multiple alignment in the NCBI database, and a phylogenetic tree was constructed using MEGA12 software (e.g., Figure 2 Homology comparison was performed on the strain (as shown), and the results indicated that the gene sequence of strain H2-20 was similar to that of strain OM144942.1:1-1423. Bacillus Based on the fact that the sp.s are in the same branch and adjacent to each other, strain H2-20 was identified as... Bacillus sp. bacteria, named Bacillus For convenience, sp.H2-20 will be referred to as strain H2-20 below.

[0035] Strain H2-20 was deposited on December 18, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 20252960.

[0036] Example 2 The salt and alkali tolerance and growth-promoting properties of strain H2-20 were tested, as detailed below: (1) Salt and alkali resistance test.

[0037] Single colonies of the isolated strain H2-20 were transferred to LB medium (modified LB medium) containing 10% NaCl and pH=9 (adjusted with 1% NaOH) and re-streaked. The plates were then incubated upside down at 28℃ for 48-72 hours. Strains that grew well on these plates were preliminarily considered salt-tolerant strains. Further labeling of the salt-tolerant strains and determination of their salt tolerance thresholds were performed. The preliminarily screened salt-tolerant strains were inoculated into LB medium containing 12%, 14%, and 16% NaCl, and into LB medium at pH=9, 10, 11, and 12, respectively. These were incubated upside down at 28℃ for 48-72 hours, and the presence or absence of colonies was used to determine their salt tolerance.

[0038] Test results as follows Figure 3 As shown. The results indicate that strain H2-20 can grow well on LB medium containing 10% NaCl and pH=9. Figure 3 (Part a) The strain H2-20 was inoculated onto LB medium at pH=12, and the results showed that strain H2-20 could grow well on LB medium at pH=12. Figure 3 (Part b); Strain H2-20 was inoculated onto LB medium containing 14% NaCl, and the results showed that strain H2-20 grew well on LB medium containing 14% NaCl. Figure 3 (Part C).

[0039] (2) Determine the alkali reduction rate of strain H2-20.

[0040] Strain H2-20 was activated to the logarithmic growth phase in LB liquid medium, centrifuged, washed, and resuspended in sterile water to prepare OD. 600 A bacterial suspension with a pH of approximately 0.8 was used. A specific liquid LB medium simulating a saline-alkali environment (containing 10% NaCl, pH=9) was initially adjusted to pH 9.0. 1 mL of the bacterial suspension was added as the treatment group, while 1 mL of sterile water was added to the blank control group. The culture was incubated at 28°C and 180 rpm for 24 h in a constant temperature shaker, and the pH was measured afterward. The culture was centrifuged at 8000 rpm for 10 min, and the supernatant was collected. The pH value of the supernatant was measured using a precisely calibrated pH meter and recorded.

[0041] Using the pH value of the blank control group as a benchmark, the relative alkalinity reduction rate of the treatment group was calculated using the following formula I to quantify the efficiency of the strain in reducing environmental alkalinity. The results are shown in Table 1. The alkalinity reduction rate of strain H2-20 was 5.67%.

[0042] Alkalinity reduction rate (%) = [(control group pH - treatment group pH) / control group pH] × 100 (Formula I).

[0043] Table 1 pH values ​​of the supernatant

[0044] (3) Detection of the growth-promoting characteristics of strain H2-20. This includes the detection of nitrogen fixation capacity, inorganic phosphorus solubility, organic phosphorus solubility, potassium solubilization, protease production, cellulase production, siderophore production, and IAA production capacity. The specific methods are as follows: Nitrogen fixation ability: Strain H2-20 was inoculated into Assumption medium and cultured at 28°C for 7 days. The presence or absence of bacterial growth on the medium was then observed.

[0045] Phosphorus solubility: Strain H2-20 was inoculated onto solid organic phosphorus-solubilizing bacteria culture medium and inorganic phosphorus-solubilizing bacteria culture medium plates, respectively, and cultured at 28°C for 7 days. The presence or absence of transparent phosphorus-solubilizing zones on the culture medium was then observed.

[0046] Iron-producing vector: Inoculate strain H2-20 onto a chromaine CAS detection medium plate and incubate at 28°C for 7 days, then observe for the appearance of a yellow-green halo.

[0047] Protease production capacity: The strain H2-20 was inoculated onto a skim milk culture medium plate and cultured at 28°C for 3 days. The presence or absence of a clear zone was then observed.

[0048] Cellulase production capacity: Strain H2-20 was inoculated onto sodium carboxycellulose medium plates and cultured at 28°C for 3 days. After staining with 1 mg / mL Congo red solution for 30 min, the staining solution was discarded, and the sample was washed with 1 mol / L sodium chloride for 30 min. The presence or absence of a clear zone was observed.

[0049] IAA Detection: 1 mL of H2-20 bacterial culture in the logarithmic growth phase was inoculated into LB liquid medium containing L-tryptophan (100 mg / L). The culture was incubated at 28°C and 200 rpm for 24 h. 100 μL of the bacterial culture was then added dropwise to a white ceramic plate, along with an equal volume of Salkowski colorimetric reagent. The mixture was incubated in the dark at room temperature for 30 min. A red color indicates the strain's ability to produce IAA; otherwise, it does not. LB medium served as a negative control, and 100 μL of 50 mg / L indoleacetic acid standard solution served as a positive control.

[0050] Potassium solubilization capacity: Strain H2-20 was inoculated into a silicate bacteria culture medium and cultured at 28°C for 7 days. The presence or absence of an oily liquid in the culture medium was then observed.

[0051] The results are as follows Figure 4 As shown in Table 2, strain H2-20 has the ability to promote growth by fixing nitrogen, solubilizing potassium, dissolving organic phosphorus, dissolving inorganic phosphorus, producing protease, producing cellulase, producing siderophores, and producing IAA.

[0052] Table 2. Results of growth-promoting characteristics detection for strain H2-20

[0053] Note: "+" indicates that the ability exists, and "-" indicates that the ability does not exist.

[0054] Example 3 Using cucumber seedlings as experimental material, the growth-promoting effect of strain H2-20 was tested, as detailed below: This experiment was conducted in an artificial climate chamber, with the following cultivation conditions: light intensity of 360 µmol·photons·m⁻¹. −2 ·s −1 The temperature was 25±1ºC / 18±1ºC (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60~80%. After soaking and germinating cucumber seeds, seeds with uniformly growing sprouts were selected and sown in seedling pots with a diameter × bottom diameter × pot height of 7cm × 5cm × 7.3cm, at a sowing depth of 2cm. After sowing, the seedling pots were placed on trays for perlite cultivation. When the seedlings grew to the first true leaf, they were watered with 1 / 2 Hoagland nutrient solution. For cucumber seedlings with uniform growth at the one-leaf-one-heart stage, four holes about 2cm deep were made around the base of the seedling stem, and the H2-20 bacterial suspension (OD) was injected. 600≈0.8) Pour evenly into the wells. Irrigate each cucumber seedling with 10 mL, and inoculate 12 seedlings per treatment, repeating 3 times. The control group (CK) is inoculated with only an equal volume of water. Inoculate again after 7 days. On day 7 after the second inoculation, measure and record the cucumber seedling height, stem diameter, leaf area, aboveground fresh weight, aboveground dry weight, underground fresh weight, and underground dry weight. Calculate the seedling vigor index using Formula II below.

[0055] Strong seedling index = (stem diameter / plant height + root dry weight / aboveground dry weight) × total plant dry weight (Formula II).

[0056] The results are as follows Figure 5 As shown in Table 3, inoculation with strain H2-20 significantly promoted cucumber seedling height, stem diameter, leaf area, aboveground fresh weight, aboveground dry weight, underground fresh weight, underground dry weight, and seedling vigor index, increasing by 59.67%, 21.99%, 50.43%, 37.98%, 13.70%, 21.40%, 50.00%, and 11.63% respectively compared to the control.

[0057] Table 3. Growth-promoting effect of strain H2-20 on cucumber seedlings

[0058] Example 4 The effects of strain H2-20 on the growth and yield of mature cucumber plants were investigated, as follows: After soaking and germination, cucumber seeds with uniform germination were selected and sown into 72-cell seed trays. The trays were then placed in an artificial climate chamber for seedling cultivation under the following conditions: light intensity of 360 µmol·photons·m -2 ·s -1 The temperature was 25±1ºC / 18±1ºC (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60~80%. When the seedlings reached the stage of one leaf and one bud, each tray was watered with 1L of half-filled Hoagland nutrient solution, changed every two days. When the seedlings reached the two-leaf and one-bud stage, four holes about 2cm deep were made around the base of the seedling stem. A suspension of strain H2-20 (OD200) was then placed inside. 600 ≈0.8) Pour evenly into the holes, and irrigate the roots of each cucumber seedling with 10 mL. The CK group is inoculated with only the same amount of water.

[0059] When the cucumber seedlings reached the three-leaf stage, they were transplanted into a plastic greenhouse in Yangling, Shaanxi Province, using a trough-type substrate cultivation system and an integrated drip irrigation system for water and fertilizer management. The experimental plot area was 18.6 m². 2 The plants measured 6m x 3.1m in length and width, with a plant spacing of 20cm x 90cm, arranged in a randomized block design. Each treatment had 25 plants, with three replicates. Ten days after transplanting, a suspension of strain H2-20 (OD200) was used. 600(≈0.8) Irrigate the roots with 20 mL of water around the base of the stem. In the control group, irrigate each plant with 20 mL of water. Irrigate the roots once every 10 days until the end of the peak fruiting period of cucumbers.

[0060] (1) Investigate the effect of strain H2-20 on cucumber growth.

[0061] Nine uniformly growing cucumber plants were selected for each treatment and tagged. Stem diameter was measured using calipers at the vine-growing stage, early fruiting stage, and peak fruiting stage. Plant height, leaf length, and leaf width were measured with a tape measure, and leaf area was calculated. The dry and fresh weights of the roots, stems, and leaves were determined, with nine replicates for each indicator. The measurement methods followed the cucumber germplasm resource description specifications and data standards formulated by Li Xixiang et al., such as... Figure 6 As shown.

[0062] Table 5 shows the statistical results of cucumber plant height, stem diameter, and leaf area at different stages. Inoculation with strain H2-20 significantly promoted the growth of cucumber plant height, stem diameter, and leaf area at different stages. During the vine-growing stage, plant height, stem diameter, and leaf area increased by 45.70%, 22.30%, and 45.50%, respectively; during the early fruiting stage, plant height, stem diameter, and leaf area increased by 16.34%, 18.16%, and 41.88%, respectively; and during the peak fruiting stage, plant height, stem diameter, and leaf area increased by 19.14%, 12.40%, and 7.37%, respectively.

[0063] Table 5. Effects of strain H2-20 on cucumber growth

[0064] The results of the fresh weight statistics of the aboveground and underground parts of cucumbers at the peak stage are shown in Table 6. Inoculation with strain H2-20 significantly promoted the fresh weight of the aboveground and underground parts of cucumber plants at different stages. The results showed that the aboveground and underground parts increased by 74.76% and 9.72% respectively at the peak stage.

[0065] Table 6. Effects of strain H2-20 on the fresh weight of cucumber plants

[0066] (2) Investigate the effect of strain H2-20 on cucumber photosynthetic pigments.

[0067] Select the fifth fully unfolded functional leaf (counting downwards from the growing point) from a healthy, vigorous plant in its peak fruiting period. Chop the leaf into small pieces, mix thoroughly, weigh 0.2g, and place it in a 50mL centrifuge tube. Add 20mL of extraction solution (alcohol:acetone:water volume ratio 4.5:4.5:1) to the tube and extract in the dark for 24 hours until the leaf tissue turns white. Use a WFZ UV-3802H UV-Vis spectrophotometer to measure the OD values ​​at wavelengths of 663nm, 645nm, and 440nm. Calculate the chlorophyll content in cucumber leaves using formulas III-VII. The results are shown in Table 7. Inoculation with strain H2-20 significantly promoted the increase of chlorophyll a, chlorophyll b, and carotenoids in cucumber plants, increasing by 8.36%, 20.20%, and 34.18%, respectively.

[0068] Chla (mg / g) = 12.7 OD 663 -2.69OD 645 (Formula III); Chlb (mg / g) = 22.9 OD 645 -4.68OD 663 (Formula IV); ChlT(a+b)(mg / g)=8.02OD 663 +20.2OD 645 (Formula V); Car (mg / g) = 4.7 OD 440 -0.27(Chla+Chlb)(Formula VI); Chl(Car) (mg / g) = Extraction liquid volume (mL) / mass (g) / 1000 (Equation VII).

[0069] Table 7. Effects of strain H2-20 on photosynthetic pigments in cucumber plants

[0070] (3) Investigate the effect of strain H2-20 on the photosynthetic parameters of cucumber.

[0071] On the 80th day after transplanting (the day and the two preceding days were sunny), from 08:00 to 18:00, photosynthetic efficiency was measured using a Li-6400 photosynthesis system equipped with a transparent leaf chamber. Measurements were taken every 2 hours, with 9 plants selected for each treatment. The measured parameters included photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), and intercellular carbon dioxide concentration (Ci). Light, CO2 concentration, and temperature in the greenhouse were set to natural environmental conditions. The results are shown in Table 8. Inoculation with strain H2-20 significantly promoted the increase in transpiration rate, net photosynthetic rate, and intercellular CO2 concentration in cucumber plants, increasing them by 16.67%, 6.89%, and 4.43%, respectively.

[0072] Table 8 Effects of strain H2-20 on photosynthetic parameters of cucumber plants

[0073] (4) Investigate the effect of strain H2-20 on cucumber roots.

[0074] Roots were collected from healthy, vigorous cucumber plants during their peak fruiting period. For each treatment, 0.5 g of the mid-root section was weighed and added to 10 mL of extract to fully submerge the roots. After incubation in a 37℃ water bath for 1 hour, 1 mol·L⁻¹ extract was added. -1 The reaction was stopped with 2 mL of sulfuric acid. The roots were then removed, dried, and ground with 10 mL of ethyl acetate and a small amount of quartz sand. The mixture was shaken well, filtered, and the filtrate was colorimetrically analyzed at 485 nm to determine root activity. Root morphology of cucumber plants was measured using a root sweeping instrument. The results are shown in Table 9. Inoculation with strain H2-20 significantly promoted the increase of total root length, root surface area, root volume, and root tip number in cucumber plants, increasing by 119.73%, 157.84%, 215.20%, and 84.67%, respectively.

[0075] Table 9 Effects of strain H2-20 on the root system of cucumber plants

[0076] (5) Investigate the effects of strain H2-20 on the weight and yield of cucumber per cucumber.

[0077] Nine cucumber plants of uniform growth and in their peak fruiting stage were selected for each treatment. They were tagged on the day of flowering (counting from the base upwards) at the 14th node. Nine days later, three uniformly growing cucumbers from each treatment were selected, and their individual cucumber weights were measured. Each commercially mature cucumber from the 15th node until the vine was pulled from the ground was harvested, and the corresponding individual cucumber weight per plant for each treatment was measured. Yield was measured using an electronic balance with an accuracy of 0.01 g. Cucumber yield per plant is the cumulative yield of all plants in each treatment group. Results are as follows: Figure 6 As shown in Table 10, inoculation with strain H2-20 promoted an increase in cucumber diameter, single cucumber weight, and yield per plant, by 11.70%, 52.55%, and 67.34%, respectively.

[0078] Table 10 Effects of strain H2-20 on cucumber yield

[0079] (6) Investigate the effect of strain H2-20 on the nutritional quality of cucumber.

[0080] During the peak fruiting period, female flowers around the 14th node that opened on the same day were tagged and harvested on the morning of the 9th day after tagging. The harvested cucumbers were placed in ice boxes and quickly transported back to the laboratory. For each material, three straight, undamaged, commercially ripe cucumbers were selected, and three sections (2-3 cm each) were cut from the head, middle, and tail. After quick-freezing in liquid nitrogen and grinding, they were stored at -80℃ for ultra-low temperature analysis. These were used for quality index determination. Vitamin C content was determined by LC-MS; soluble protein content was determined by the Coomassie Brilliant Blue G520 method; and soluble sugar content was determined by the anthrone colorimetric method. The results are shown in Table 11. Inoculation with strain H2-20 promoted the increase of vitamin C, soluble protein, and soluble sugar in cucumbers, increasing them by 66.67%, 6.27%, and 31.75%, respectively.

[0081] Table 11 Effects of strain H2-20 on the nutritional quality of cucumber

[0082] Example 5 Using cucumber seedlings as experimental material, the effect of strain H2-20 on alleviating salt-alkali stress in cucumbers was tested, as detailed below: This experiment was conducted in an artificial climate chamber, with the following cultivation conditions: light intensity of 360 µmol·photons·m⁻¹. −2 ·s −1 The temperature was 25±1ºC / 18±1ºC (day / night), the photoperiod was 16h / 8h (day / night), and the relative humidity was 60~80%. After soaking and germinating cucumber seeds, seeds with uniformly growing sprouts were selected and sown in seedling pots with a diameter × bottom diameter × pot height of 7cm × 5cm × 7.3cm, at a sowing depth of 2cm. After sowing, the seedling pots were placed on trays for perlite cultivation. When the seedlings grew to the first true leaf, they were watered with 1 / 2 Hoagland nutrient solution. For cucumber seedlings with uniform growth at the one-leaf-one-heart stage, four holes about 2cm deep were made around the base of the seedling stem, and the H2-20 bacterial suspension (OD) was injected. 600 ≈0.8) Pour evenly into the wells. Irrigate each cucumber seedling with 10 mL of the solution. Each treatment has 12 seedlings, and the treatment is repeated 3 times. The control (CK) is inoculated with only an equal volume of water. A second inoculation is performed 7 days later. On the 3rd day after the second inoculation, a solution of 75 mmol·L⁻¹ NaCl:Na₂SO₄:Na₂CO₃:NaHCO₃ in a molar ratio of 1:9:1:9 is prepared. -1 A compound saline-alkali solution (pH=8.9±0.1) was used. 40 mL of the compound saline-alkali solution was applied to each pot, and treatment was repeated every 2 days. Based on previous laboratory research, after 5 days of treatment, the fresh weight of the whole cucumber seedling, proline, and malondialdehyde content were measured and recorded. The salt damage index was calculated using formula VIII below.

[0083] Salt damage grading standards: Grade 0, no salt damage characteristics; Grade 1, true leaves intact, leaf edges yellowed; Grade 2, 25% of true leaves are wilted and yellowed; Grade 3, 50% of the true leaves are wilted and yellowed; Grade 4, 75% of true leaves are wilted and yellowed; Level 5, all leaves are wilting due to water loss.

[0084] (VIII).

[0085] The results are as follows Figure 7 As shown in Table 12, inoculation with strain H2-20 significantly promoted the fresh weight of cucumber seedlings under salt-alkali stress, increasing it by 51.40% compared to the control group. It also reduced the proline, malondialdehyde (MDA) content, and salt damage index in cucumber roots, decreasing them by 33.33%, 28.57%, and 48.91% respectively compared to the control.

[0086] Table 12. Alleviating effect of strain H2-20 on cucumber seedlings under salt-alkali stress.

[0087] Therefore, the present invention provides Bacillus The sp. H2-20 strain was isolated for the first time and deposited at the China Center for Type Culture Collection on December 18, 2025, with accession number CCTCC M 20252960. It exhibits good salt and alkali tolerance and can grow well on LB medium containing 14% NaCl or pH=12. It also has the ability to reduce alkali, fix nitrogen, solubilize potassium, dissolve organic phosphorus, dissolve inorganic phosphorus, produce protease, produce cellulase, produce siderophores, and produce IAA. Under normal conditions and salt and alkali stress conditions, it can significantly promote the photosynthetic capacity of cucumber plants, the growth of above-ground and underground parts, increase cucumber yield, and improve cucumber quality.

[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A plant Bacillus strain sp.H2-20 was deposited on December 18, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Bayi Road, Hongshan District, Wuhan, Hubei Province, with accession number CCTCC M 20252960.

2. A plant according to claim 1 Bacillus strain sp.H2-20, characterized by: The Bacillus The 16S rDNA sequence of strain sp.H2-20 is shown in SEQ ID NO.

3.

3. A plant as described in claim 1 or 2 Bacillus The application of strain sp. H2-20 in the preparation of saline-alkali land improvement products is characterized by: The product contains the aforementioned Bacillus strain sp.H2-20, the product is used to reduce soil salinity.

4. A plant as described in claim 1 or 2 Bacillus The application of strain sp.H2-20 in fertilizer preparation is characterized by: The fertilizer contains the aforementioned Bacillus The fertilizer is of strain H2-20; the fertilizer has at least one effect of promoting the growth of aboveground and / or underground parts of plants and photosynthetic capacity; the fertilizer includes foliar fertilizer.

5. A plant according to claim 4 Bacillus The application of strain sp.H2-20 in fertilizer preparation is characterized by: The fertilizer has the function of increasing soil nitrogen content, absorbable phosphorus content, absorbable potassium content and absorbable iron content by at least one.

6. A plant as described in claim 1 or 2 Bacillus The application of strain sp. H2-20 in the preparation of agents that promote the decomposition of organic matter is characterized by: The formulation is a preparation that promotes the decomposition of animal and plant residues, and the formulation contains the aforementioned... Bacillus strain H2-20.

7. A plant as described in claim 1 or 2 Bacillus The application of strain sp. H2-20 in the preparation of bactericidal agents is characterized by: The bactericidal agent contains the aforementioned Bacillus strain H2-20.

8. A plant as described in claim 1 or 2 Bacillus The application of strain sp. H2-20 in the preparation of vegetable quality improvement agents is characterized by: The formulation contains the aforementioned Bacillus sp. H2-20 strain; the preparation has the effect of promoting at least one of the following: increasing the content of vitamin C, soluble protein and soluble sugar.

9. A plant as described in claim 1 or 2 Bacillus The application of strain sp.H2-20 in the preparation of a specific formulation for salt-stressed plants is characterized by: The formulation contains the aforementioned Bacillus strain H2-20; the preparation is used to promote crop growth and development under salt stress conditions.

Images