AsMYB19 gene and its application

Abstract

This invention discloses AsMYB19 Genes and their applications, relating to the field of biotechnology, the aforementioned AsMYB19 The nucleotide sequence of the gene is shown in SEQ ID NO.1. It can regulate the number of oat tillers and oat yield, providing gene resources and strategies for oat breeding and the improvement of oat germplasm resources, thereby accelerating the breeding speed and improving the breeding efficiency.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to oats. AsMYB19 Genes and their applications. Background Technology

[0002] oat( Avena sativa L.) belongs to the genus *Oat* of the family Poaceae. Avena Oats (L.) are an annual crop used for both grain and forage, characterized by their cold and drought resistance, tolerance to poor soil, salt and alkali tolerance, and rich nutritional value, and are currently widely cultivated globally. Due to their large biomass, rich nutritional value, palatability, and wide adaptability, oats are an important source of high-quality forage for ruminants. However, with changes in people's dietary structure and the rapid development of the livestock industry, the scarcity of high-quality forage such as oats has become a key factor restricting the healthy and rapid development of the agricultural industry. Therefore, it is urgent to cultivate oat varieties with high forage yields. Tiller number is not only a key factor determining oat plant architecture but also one of the main factors affecting forage yield. Related studies have shown a significant positive correlation between oat tiller number and forage yield; therefore, breeding new oat varieties with high tiller numbers can, to some extent, increase oat forage yield. However, due to the genetic diversity of the oat genome, traditional breeding methods have many shortcomings. Transgenic technology can provide a solution by introducing genes to alter plant regulatory pathways, overcoming genetic limitations, and thus accelerating breeding speed and improving breeding efficiency. Summary of the Invention

[0003] To achieve the above objectives, the present invention provides a AsMYB19 Genes that regulate oat tiller number and yield provide important genetic resources for oat breeding and the improvement of oat germplasm resources. They can also accelerate breeding speed and improve breeding efficiency.

[0004] To achieve the technical objective of this invention, this invention provides... AsMYB19 The gene, whose coding region sequence is shown in SEQ ID NO.1.

[0005] To achieve the technical objective of this invention, a second aspect of this invention provides a primer set for amplifying the above-mentioned gene, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0006] To achieve the technical objective of this invention, a third aspect of this invention provides a recombinant expression vector comprising the above-described... AsMYB19 Gene.

[0007] Wherein, the recombinant expression vector is the vector into which the recombinant expression vector is used. AsMYB19 The gene was obtained by inserting it into the plant binary expression vector pEXT06.

[0008] In particular, the AsMYB19 The gene is generated via the nucleotide sequences shown in SEQ ID NO.8 and SEQ ID NO.9, as well as the restriction endonucleases BamHⅠ and HindⅢ.

[0009] To achieve the technical objective of this invention, a fourth aspect of this invention provides a recombinant engineered bacterium having the above-mentioned recombinant expression vector.

[0010] To achieve the technical objective of this invention, the fifth aspect of this invention provides a primer set for detecting whether the above-mentioned recombinant engineered bacteria are positive colonies, the nucleotide sequences of which are shown in SEQ ID NO.10 and SEQ ID NO.11.

[0011] To achieve the technical objective of this invention, a sixth aspect of this invention provides a method for increasing oat forage yield, which utilizes the above-mentioned... AsMYB19 This can be achieved through genes, recombinant expression vectors, or recombinant engineered bacteria.

[0012] In particular, utilizing the above AsMYB19 Genes, recombinant expression vectors, or recombinant engineered bacteria are expressed through overexpression of oat forage. AsMYB19 Genetic implementation.

[0013] To achieve the technical objective of this invention, a seventh aspect of this invention provides a primer set for detecting oat tiller number or oat yield, the nucleotide sequences of which are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7.

[0014] Compared with the prior art, the present invention has at least the following beneficial effects: The present invention provides AsMYB19 Genes can regulate the number of tillers in oats, thereby regulating oat yield, providing important genetic resources for oat germplasm improvement and molecular breeding. Attached Figure Description

[0015] Figure 1 Oatmeal in the example AsMYB19 Schematic diagram of PCR products from the CDS region of a gene; Figure 2 For the example AsMYB19 A schematic diagram showing the changes in gene expression levels in different tissues at different growth stages of oats. In the diagram, SS represents the seedling stage; TS represents the tillering stage; JS represents the jointing stage; BS represents the booting stage; HS represents the heading stage; FS represents the grain-filling stage; and MS represents the milk stage. Figure 3 For the example AsMYB19 A schematic diagram showing the relative expression levels of gene-transgenic and wild-type oat plants at the milk stage. WT represents wild-type oats; OE-1 and OE-2 represent... AsMYB19 Oat strains with overexpressed genes; Figure 4 For the example AsMYB19 A comparative analysis of phenotypic patterns and tiller numbers at the milk stage of oats between transgenic lines and wild-type plants. Figure 4 A is a phenotypic diagram; Figure 4 B is a comparative analysis chart of tiller number, where WT represents wild-type oats; OE-1 and OE-2 represent... AsMYB19 In oat lines with overexpressed genes, TN represents the number of tillers and ETN represents the number of effective tillers; Figure 5 These are four materials with different tillering numbers used in the examples. Detailed Implementation

[0016] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0018] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0019] Example 1: Oats AsMYB19 Gene acquisition and sequence identification Preliminary field phenotypic identification yielded four extreme materials of oat tillering trait (materials with high tillering number and materials with low tillering number). Figure 5 Transcriptome analysis of tiller nodes from materials exhibiting extreme tiller number differences identified a differentially expressed gene encoding the MYB transcription factor, which was named... AsMYB19 Amplification primers were designed using SnapGene online software. AsMYB19 -F: ATGGACGCCATGAGCAG (SEQ ID NO.2), AsMYB19 -R: CTAGCACTCGCCTGAGTTG (SEQ ID NO. 3). Total RNA was extracted from seedling leaves of the forage oat variety "Zhongchuyan No. 1" (provided by the Forage Germplasm Resource Conservation and Utilization Innovation Team of Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences) using FastPuree® Universal PlantTotal RNA Isolation Kit, and then reverse transcribed into cDNA using HiScript III All-in-one RT SuperMix Perfectfor qPCR. cDNA was then used as a template to obtain... AsMYB19CDS sequence cloning of the gene; reaction system: 25µL, including 1.5µL cDNA and 12.5µL 2×PhantaMax Master Mix (Dye) high-fidelity enzyme. AsMYB19 -F / R 1µL each, ddH2O 9µL; Reaction program: Pre-denaturation: 95℃, 3min; Denaturation: 95℃, 30s; Annealing: 65℃, 30s; Extension: 72℃, 90s; 35 cycles; Extension: 72℃, 3min; Isothermal: 12℃, ∞. PCR products were detected by 1% agarose gel electrophoresis at 150 V, 30W, for 12min. The obtained electrophoretic bands are shown below. Figure 1 As shown, the size of its CDS region is 747 bp. After completion, the target gene with the correct band was recovered using a V-ELUTE Gel MiniPurification Kit, and the target fragment was ligated into the One Step ZTOPO-Blunt / TA vector, then transformed into DH5α E. coli competent cells for colony PCR identification. The identification primers were F: TGTAAAACGACGGCCAGT, R: CAGGAAACAGCTATGACC. Positive single clones were selected and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. The sequenced sequences were aligned using SnapGene software to obtain the correct gene sequence, as shown in SEQ ID NO.1, as follows: .

[0020] Example 2 AsMYB19 Spatiotemporal expression pattern analysis of genes in oats Selected plump, uniformly sized "Zhongchu Yan No. 1" forage oat varieties were sown in pots (18cm high, 23cm inner diameter at the top, and 14cm diameter at the bottom) filled with a mixture of nutrient soil and vermiculite (2:1 ratio) and cultivated in a greenhouse. Cultivation conditions: 22 / 20℃ (day / night), relative humidity 50-60%, light intensity... The photoperiod was 16 h / 8 h (day / night). Tissues including roots, stems, leaves, tillering nodes, nodes (excluding tillering nodes), and panicles were collected at seven stages: seedling stage, tillering stage, jointing stage, booting stage, heading stage, grain-filling stage, and milk stage. These tissues were flash-frozen in liquid nitrogen for 15 min, then pulverized using a tissue homogenizer with a frequency of 30 Hz and a homogenization time of 4.5 s. Total RNA was extracted using the FastPuree® Universal Plant Total RNA Isolation Kit, reverse transcribed into cDNA, and quantitative primers were designed using the NCBI website. AsMYB19 -qF: AAGATCACACCCGACGAGGA (SEQ ID NO.4), AsMYB19 Real-time quantitative PCR (RT-qPCR) was performed using the following primers: -qR: CGTCCGCCAGTAGTTCTTGA (SEQ ID NO.5) and oat internal control primers Asaction-F: CACTGCCGAGCGGGAAATTG (SEQ ID NO.6) and Asaction-R: TGATGGAAGGCTGGAAGAGGAC (SEQ ID NO.7). The reaction volume was 10 µL, containing 2 µL of cDNA. AsMYB19 0.5 µL each of -qF / R, 5 µL of 2×HQ SYBR qPCR Mix (Low ROX), and 2 µL of ddH2O. Reaction program: 95℃ for 30 s, 35 cycles, each cycle consisting of 95℃ for 10 s, 60℃ for 30 s, and 72℃ for 30 s. Three biological replicates were performed. The relative expression level of genes can be calculated using this method. For detailed analysis of relative expression levels, please refer to [link to relevant documentation]. Figure 2 .

[0021] The results showed that the relative expression level was highest in leaves during the seedling stage, followed by roots, and lowest in stems; during the tillering stage, the relative expression level was highest in leaves, followed by stems, and third highest in tillering nodes; during the jointing stage, the relative expression level was highest in roots, followed by leaves, and third highest in nodes, with some expression in tillering nodes, but not high; during the heading stage, the relative expression level was highest in roots, followed by leaves, and third highest in stems, but the relative expression level in tillering nodes gradually increased, reaching 0.5% higher than that at the jointing stage. 0.13; During the heading stage, the relative expression level was highest in the roots, followed by the stems, and ranked third in the tillers, which was 2.69 higher than during the heading stage; During the grain-filling stage, the relative expression level was highest in the roots, followed by the leaves, and ranked third in the stems, with the relative expression level in the tillering nodes also gradually increasing, which was 5.18 higher than during the heading stage; During the milk stage, the relative expression level was highest in the roots, followed by the leaves, and ranked third in the panicles, with the relative expression level in the tillering nodes increasing, which was 0.74 higher than during the grain-filling stage.

[0022] visible, AsMYB19 The relative expression level of the gene was highest in the roots, but the relative expression level in the tillering nodes gradually increased from the jointing stage to the milk stage, rising from 0.37 to 9.10. This was significantly correlated with the increase in the number of oat tillers, indicating that... AsMYB19 Genes may play a regulatory role in promoting the number of oat tillers.

[0023] Example 3: Oats AsMYB19 Construction of gene transgenic vectors by AsMYB19 Using the gene's CDS as a template, primers pEXT06- containing the homologous arm of the pEXT06 overexpression vector were used. AsMYB19 -F: tgttacttctgcagaagcttATGGACGCCATGAGCAGC (as shown in SEQ ID NO.8), pEXT06- AsMYB19 -R: tctttgtagtccatggatccCTAGCACTCGCCTGAGT (as shown in SEQ ID NO. 9) was used for PCR amplification to obtain the target fragment containing the adapter sequence. The PCR reaction system was 25 µL, including 1.5 µL template, 12.5 µL 2×PhantaMax Master Mix (Dye) high-fidelity enzyme, 1 µL each of bidirectional primers, and 9 µL ddH2O. The reaction program was as follows: pre-denaturation: 95℃, 3 min; denaturation: 95℃, 30 s; annealing: 65℃, 30 s; extension: 72℃, 90 s; 35 cycles; extension: 72℃, 3 min; isothermal: 12℃, ∞. The plant binary expression vector pEXT06 was digested with restriction endonucleases BamHⅠ and HindⅢ at 37℃ for 6 h. Homologous recombination was used to recombine the target fragment containing the adapter sequence with the linearized pEXT06 vector. The resulting material was transformed into DH5α Escherichia coli competent cells, plated on LB agar plates supplemented with 50 mg / L ampicillin, and positive clones were picked for sequencing. After successful alignment, the recombinant expression vector plasmid was extracted.

[0024] Example 4: Acquisition, screening, and tiller number observation and analysis of transgenic oats Select plump, undamaged seeds of the oat variety "Hinoat" (provided by the Forage Germplasm Resource Conservation and Utilization Innovation Team of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences) and pour them into 50 mL centrifuge tubes. Sterilize with 75% ethanol and rinse once with sterile water. Transfer the seeds to induction medium; transform the recombinant expression vector plasmid into Agrobacterium EHA105 strain. Screen for positive colonies using P_Uflag-F: CCTGCCTTCATACGCTATTTAT (SEQ ID NO.10) and P_Uflag-R: GCCAAATGTTTGAACGATCG (SEQ ID NO.11), and then... AsMYB19 Gene-positive Agrobacterium EHA105 strain (OD600=0.6) was inoculated into liquid LB medium and cultured at 28℃ and 200 rpm for 12 h on a shaker. The Agrobacterium suspension was then used to infect the cultured callus tissue for 20 min, and the callus tissue was cultured in the dark at 28℃ for 3 days. After 3 days of co-culture, the callus tissue was washed and dried. It was then transferred to a selection medium for further selection and culture, and then the callus tissue was picked and transferred to a differentiation medium for regeneration culture. When the seedlings differentiated to a height of 2-3 cm and developed obvious roots, they were transferred to bottles containing rooting medium to promote further growth of the seedlings.

[0025] It should be noted that the induction medium, screening medium, differentiation medium and rooting medium used in the embodiments of the present invention can be conventional media used in the art, as long as oat seedlings can be cultivated, the technical purpose of the present invention can be achieved.

[0026] The pre-mixed potting soil was then placed into individual pots, and the rooted transgenic seedlings were transplanted into them and placed in a greenhouse for cultivation. The infected oat T0 generation seeds were then harvested. The T1 and T2 generation materials were then screened for positive seedlings using RT-qPCR technology, yielding a total of 32 seedlings. AsMYB19 Transgenic lines were further analyzed for T2 generation segregation. Stable homozygous transgenic lines were selected and propagated to obtain stable T3 generation offspring. Homozygous oat plants and wild-type plants were cultured, and RNA was extracted from seedlings and reverse transcribed into cDNA. AsMYB19 -qF: AAGATCACACCCGACGAGGA (SEQID NO.4), AsMYB19-qR:CGTCCGCCAGTAGTTCTTGA (SEQ ID NO.5) and oat internal reference primers Asaction-F:CACTGCCGAGCGGGAAATTG (SEQ ID NO.6) and Asaction-R:TGATGGAAGGCTGGAAGAGGAC (SEQ ID NO.7) are specific primers.

[0027] use Technology for transgenic lines and wild-type plants AsMYB19 The gene expression was analyzed, and the results are as follows: Figure 3 As shown.

[0028] It should be noted that the nutrient soil used in the embodiments of the present invention can be conventional nutrient soil, as long as it enables the oat seedlings to grow normally and achieves the technical objective of the present invention.

[0029] The results show that AsMYB19 The overexpression lines (OE-1 and OE-2) showed significantly higher expression levels than the wild-type (WT) lines. Figure 3 ).

[0030] To further determine AsMYB19 The effects of genes on oat growth, development, and tiller number were investigated. Ten transgenic lines with high expression levels were selected, and phenotypic characteristics such as plant height, tiller number, effective tiller number, flag leaf length, flag leaf width, and node number were measured at the tillering and maturity stages. Three biological replicates were set up for each line. The phenotypic results were analyzed as follows: Figure 4 As shown.

[0031] The results showed that during the tillering stage, compared to WT, the 10 transgenic lines were 10.44 cm taller, had 8.1 more tillers, 1.2 more effective tillers, and 0.3 more nodes. The flag leaf width was 0.3 cm wider, but the flag leaf length was 0.015 cm shorter. At maturity, compared to WT, the 10 transgenic lines had 30.6 more tillers and 24.7 more effective tillers, indicating that… AsMYB19 Genes have a positive regulatory effect on the number of tillers in oats.

[0032] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. AsMYB19 Genes that regulate the number of oat tillers, among which, The AsMYB19 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. An amplification method according to claim 1 AsMYB19 The primer set for the gene, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. A recombinant expression vector comprising the components described in claim 1. AsMYB19 Gene.

4. The recombinant expression vector as described in claim 3, wherein the recombinant expression vector is used to express the recombinant expression vector. AsMYB19 The gene was obtained by inserting it into the plant binary expression vector pEXT06.

5. The recombinant expression vector as described in claim 4, characterized in that, The nucleotide sequences shown in SEQ ID NO. 8 and SEQ ID NO. 9, along with the restriction endonucleases BamHⅠ and HindⅢ, were used to synthesize the... AsMYB19 The gene was inserted into the plant binary expression vector pEXT06.

6. A recombinant engineered bacterium having the recombinant expression vector as described in claim 3.

7. A primer set for detecting whether the recombinant engineered bacteria of claim 6 is a positive colony, the nucleotide sequence of which is shown in SEQ ID NO.10 and SEQ ID NO.

11.

8. A method for increasing oat forage yield, characterized in that, Using the method described in claim 1 AsMYB19 The gene or the recombinant expression vector of claim 3 or the recombinant engineered bacteria of claim 6 are used to achieve this.

9. The method as described in claim 8, characterized in that, Using the method described in claim 1 AsMYB19 The gene or the recombinant expression vector of claim 3 or the recombinant engineered bacteria of claim 6 are obtained by overexpressing oat forage. AsMYB19 Genetic implementation.

10. A primer set for detecting oat tiller number or oat yield, the nucleotide sequences of which are shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7.

Images