Molecular marker associated with alfalfa branch number, identification method, kit and application

Abstract

This invention belongs to the field of molecular marker technology and discloses a molecular marker, identification method, kit, and application related to the number of branches in alfalfa. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 and SEQ ID NO.5, the upstream primer sequence of the primer pair for amplifying the molecular marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2. The molecular marker is located on chromosome 6 of alfalfa, and the nucleotide sequence of its inserted or deleted fragment is shown in the sequence listing SEQ ID NO.3. The InDel molecular marker and primer pair provided by this invention can predict, identify, or assist in the identification of the number of branches in alfalfa. This invention also provides a method for identifying the number of branches in alfalfa using the molecular marker; this method is simple, fast, and provides accurate identification results, with good prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker, identification method, reagent kit, and application related to the number of branches in alfalfa located on chromosome 6. Background Technology

[0002] alfalfa ( Medicago sativa Alfalfa (L.) is the world's most widely cultivated and important economic legume forage grass, renowned for its high nutritional value, large production potential, and drought and salt tolerance, earning it the title of "King of Forages." Alfalfa yield is determined by several factors, such as plant height, stem diameter, leaf area, number of branches, and stem-to-leaf ratio. The number of branches refers to the branches produced at the root collar, main stem, or twigs, determining the size of the alfalfa clump. Many studies have shown that the number of basal branches near the ground is a major, even decisive, factor affecting yield, having a significant direct effect and contribution to yield formation. Currently, alfalfa breeding in my country is still in the conventional breeding stage, with limited precise evaluation and identification of germplasm resources, resulting in low identification efficiency and accuracy, and insufficient in-depth exploration and identification of important traits such as the number of branches. By studying genes related to the number of branches and their regulatory mechanisms, molecular markers closely linked to the branching trait can be developed for marker-assisted breeding, improving breeding efficiency and accuracy.

[0003] In molecular marker development and genetic diversity analysis, Indel markers represent the richest source of genetic variation in plant genomes and have been widely used in genetic diversity analysis, genome-wide association mapping (GWAM), and marker-assisted selection (MAG). Indel markers are segments of the same genome at the same insertion or deletion site between different individuals of the same species. Due to their high stability and polymorphism, they are widely used in fingerprinting. Indels are PCR-based markers with advantages such as biallelicity, co-dominance, high abundance, and low cost, and have been extensively used in crops. Their high diversity makes them an important tool for QTL mapping and marker-assisted selection. This invention utilizes 258 alfalfa accessions to construct a population, resequencing them and performing GWAM analysis based on branching traits to develop an InDel locus associated with branching. This invention provides theoretical support and genetic resources for breeding new alfalfa materials with a high number of branches. Summary of the Invention

[0004] One of the objectives of this invention is to provide a molecular marker related to the number of branches in alfalfa.

[0005] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the number of branches in alfalfa.

[0006] The third objective of this invention is to provide a method for identifying the number of branches in alfalfa.

[0007] The fourth objective of this invention is to provide a kit containing primer pairs with the above-mentioned molecular markers and its application in identifying the genotype of alfalfa branch number.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: This invention discloses a molecular marker related to the number of branches in alfalfa, located on chromosome 6 of alfalfa, and the molecular marker is named Ms_Chr6_23161293.

[0009] The primer pairs for amplifying the above molecular markers have the following primer pair sequences: Ms_Chr6_23161293-F: GTTAGTGAATCCCTGCAATCCAA (shown in SEQ ID NO.1); Ms_Chr6_23161293-R: TCCGCGAGTTTTTGGTGTATC (shown in SEQ ID NO.2); This invention also discloses the application of the above-mentioned molecular marker primer pairs in branch-assisted breeding of alfalfa. That is, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying branch-related traits in alfalfa materials. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0010] This invention also discloses the application of the above-mentioned molecular markers in identifying the branching trait of alfalfa, especially in screening and identifying the number of branches in alfalfa. Specifically, the specific steps for identifying the number of branches in alfalfa are as follows: (1) Using the DNA of the tested germplasm as the template for PCR amplification, and Ms_Chr6_23161293-F and Ms_Chr6_23161293-R as the primer pairs, the PCR amplification reaction system is shown in Table 1: Table 1. Reaction system for PCR amplification

[0011] (2) Pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 70℃ for 30 s, extension at 72℃ for 15 s, 32 cycles; extension at 72℃ for 10 min; storage at 4℃.

[0012] (3) Detection of PCR products by agarose gel electrophoresis: Take 3 μL and judge the number of branches of alfalfa based on the band results.

[0013] PCR amplification was performed using primers Ms_Chr6_23161293-F and Ms_Chr6_23161293-R. If the PCR amplification product contained only one characteristic band of 248 bp as shown in SEQ ID NO.4, then the alfalfa was a type with a large number of branches. If the PCR amplification product contained both one characteristic band of 248 bp as shown in SEQ ID NO.4 and one characteristic band of 202 bp as shown in SEQ ID NO.5, then the alfalfa was a type with a small number of branches.

[0014] In addition, this invention also protects a kit for identifying the branching trait of alfalfa, the kit containing primer pairs Ms_Chr6_23161293-F and Ms_Chr6_23161293-R. Other components of the kit are conventional reagents. Specifically, it also includes PCR buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the PCR buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0015] The kit of this invention can rapidly identify the number of branches in alfalfa, and can also rapidly identify the genotype of branch quantity in alfalfa. The specific method is the same as for identifying whether alfalfa has a high number of branches. The specific steps are as follows: By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product has only one characteristic band of 248 bp as shown in SEQ ID NO.4, then the alfalfa is homozygous with a high number of branches; if the PCR amplification product has both one characteristic band of 248 bp as shown in SEQ ID NO.4 and one characteristic band of 202 bp as shown in SEQ ID NO.5, then the alfalfa is heterozygous with a low number of branches.

[0016] The present invention has the following advantages: (1) This invention constructs a population using 258 alfalfa materials, resequencing them and performing whole-genome association analysis in conjunction with branching traits, and develops an InDel locus related to branching, providing theoretical support and genetic resources for breeding new alfalfa germplasm materials with a large number of branches.

[0017] (2) Using the molecular markers of the present invention to screen the branching traits of alfalfa is beneficial to molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0018] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to the identification and breeding of alfalfa materials with a large number of branches. Attached Figure Description

[0019] Figure 1 The genome-wide association analysis results for alfalfa branches are based on the Manhattan diagram obtained from EMMAX software analysis. The green dots indicate the InDel positions associated in this invention.

[0020] Figure 2 This is a box plot showing the branching distribution of the genotype at the Ms_Chr6_23161293 locus in the alfalfa population of this invention; 0 / 0 indicates that the genotype at the Ms_Chr6_23161293 locus is homozygous with a large number of branches, and 0 / 1 indicates that the genotype at the Ms_Chr6_23161293 locus is heterozygous with a small number of branches; the dots represent extreme values ​​of the data, and **** represents... P <0.0001.

[0021] Figure 3 This is a partial sequence alignment result between materials with a large number of branches and materials with a small number of branches in the branch association region.

[0022] Figure 4 Electrophoresis images of molecular markers amplified from 24 alfalfa germplasm resources, using agarose gels with a concentration of 2.5%. Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0024] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0026] Example 1: Development of molecular markers associated with alfalfa branch number This invention uses the number of branches (in units) at the initial flowering stage of alfalfa as a metric. A higher value indicates more branches, while a lower value indicates fewer branches. After measuring the branch number in 258 alfalfa accessions, GWAS analysis located an InDel locus in alfalfa. Figure 1 The green locus, named Ms_Chr6_23161293, is located at locus 23161293 on chromosome 6 of the alfalfa reference genome (downloadable from https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960; the downloaded file "ZhongmuNo.1_genome.fasta.gz" is the alfalfa genome sequence). The first allele is 0 / 0, and the second allele is 0 / 1. A box plot showing the distribution of branch numbers corresponding to genotypes at locus Ms_Chr6_23161293 in the population is shown. Figure 2 This indicates that alfalfa lines with genotype 0 / 0 have significantly more branches than those with genotype 0 / 1. An insertion / deletion fragment, TATATTTTCTCTAATTGATGTCGGATAGAAGAATTCAGTAGAGATAC (shown in SEQ ID NO. 3), is present at locus 23161293 on chromosome 6 of alfalfa. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the number of branches in alfalfa. Alfalfa with the fragment shown in SEQ ID NO.3 has more branches, while alfalfa without the fragment shown in SEQ ID NO.3 has fewer branches.

[0027] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using NCBI software: Ms_Chr6_23161293-F: GTTAGTGAATCCCTGCAATCCAA (shown in SEQ ID NO.1); Ms_Chr6_23161293-R: TCCGCGAGTTTTTGGTGTATC (shown in SEQ ID NO.2); Then, PCR amplification was performed on the test samples using the above primers. The results showed that the PCR product of homozygous alfalfa samples with a large number of branches had only a characteristic band of 248 bp, while the PCR product of heterozygous alfalfa samples with a small number of branches had both a characteristic band of 248 bp and a characteristic band of 202 bp.

[0028] Example 2: Accuracy verification of the molecular markers described in this invention The above molecular marker primer pairs were used to identify 130 germplasm accessions. The specific germplasm materials used are shown in Table 2. Table 2. Genotypes and branch numbers of 130 materials based on the Ms_Chr6_23161293 locus.

[0029]

[0030]

[0031] (1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain PCR products; (2) The PCR amplification reaction system is as follows: template DNA 10-100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×SanTaq PCR Mix, and deionized water to a final volume of 20 μL; the preferred PCR amplification reaction program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 70℃ annealing for 30 s, 72℃ extension for 15 s, 32 cycles; 72℃ extension for 10 min; storage at 4℃. Separate samples by electrophoresis on a 2.5% agarose gel. After spotting, electrophoresis is performed at 120V DC voltage for 50 min, and then the PCR banding of each sample is read.

[0032] (3) Determine the number of branches of alfalfa based on the size of the PCR product: When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with a large number of branches. When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, the alfalfa to be identified is an alfalfa with few branches. Specifically, when the PCR product of the alfalfa to be identified contains the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 248 bp, then the alfalfa to be identified is an alfalfa with a large number of branches.

[0033] SEQ ID The sequence of NO.4 is as follows: GTTAGTGAATCCCTGCAATCCAAGGGTAGTTTTGGTGACTCATCATATTATATTTCTCTAATTGATGTCGGATAGAAGAATTCAGTAGAGATACATATTTCATAGAGCATGGTTGTTCT CCTTGATTTGGACATCAAGCAAAATGACAATGGGTCTCTAATATTCTTGTTGCAACAATCTTTTTTTTTTAAAACGGCAAATATTCATCGATGAGGTGGTGTAAGATACACCAAAAACTCGCGGA.

[0034] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, the band length of the PCR product is 202bp, then the alfalfa to be identified is an alfalfa with few branches.

[0035] The sequence of SEQ ID NO. 5 is as follows: GTTAGTGAATCCCTGCAATCCAAGGGTAGTTTTGGTGACTCATCATATATATTTCATAGAGCATGGTTGTTCTCCTTGATTTGGACATCAAGCAAAATGACAATGGGTCTCTAATATTCTTGTTGCAACAATCTTTTTTTTTTAAAACGGCAAATTATTCATCGATGAGGTGGTGTAAGATACACCAAAAACTCGCGGA.

[0036] Furthermore, Table 2 shows that among the 130 alfalfa accessions identified in this study, 70 accessions were identified as homozygous genotypes with a high number of branches (0 / 0), with an average of 46 branches. Conversely, 60 accessions were identified as heterozygous genotypes with a low number of branches (0 / 1), with an average of 31 branches, lower than the average of the 70 high-branch-number accessions. Analysis of variance showed a highly significant difference in the number of branches between the high-branch-number and low-branch-number genotypes (P<0.0001). Figure 424 accessions were displayed (CF048298, CF040911, CF039888, CF048304, Dp). The PCR results for the following samples (Vela, Consay, WL323, Victoria, Giant, Potus, Giant Energy, SK3010, CF040664, CF020822, CF031930, CF050249, Mufeng, P610216018, Dongmu No. 3, Gannong No. 6, Wudi, Reindeer, P610623015, P610831017) show that the 0 / 0 type material only amplified one band of 248 bp, indicating a homozygous genotype with a large number of branches, consistent with the results of the first 12 materials having a large number of branches. The 0 / 1 type material amplified both one band of 248 bp and one band of 202 bp, indicating a heterozygous genotype with a small number of branches, consistent with the results of the last 12 materials having a small number of branches. Therefore, the InDel molecular marker of the present invention can effectively identify the number of branches in alfalfa and can be used for the prediction and screening of alfalfa materials with a high number of branches.

[0037] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Molecular markers associated with the number of branches in alfalfa, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion fragment TATATTTCTCTAATTGATGTCGGATAGAAGAATTCAGTAGAGATAC on chromosome 6 of the alfalfa reference genome. The primer pair sequences for amplifying the molecular marker are as follows: Ms_Chr6_23161293-F:GTTAGTGAATCCCTGCAATCCAA; Ms_Chr6_23161293-R: TCCGCGAGTTTTTGGTGTATC.

2. To test the application of the primer pair of the molecular marker described in claim 1 in molecular marker-assisted breeding of alfalfa.

3. The application according to claim 2, characterized in that, The molecular markers are used to identify or assist in identifying the number of branches in alfalfa.

4. A method for determining the number of branches in alfalfa, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr6_23161293-F and Ms_Chr6_23161293-R. If the PCR amplification product contained only one characteristic band of 248 bp as shown in SEQ ID NO.4, then alfalfa was of the high branching type. If the PCR amplification product contained both one characteristic band of 248 bp as shown in SEQ ID NO.4 and one characteristic band of 202 bp as shown in SEQ ID NO.5, then alfalfa was of the low branching type.

5. An application of a reagent kit in identifying the genotype of branch quantity in alfalfa, characterized in that, The kit contains primer pairs for the molecular marker described in claim 1. A method for identifying or assisting in the identification of alfalfa branching genotypes using the kit includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification products have only one characteristic band of 248 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous genotype with a large number of branches; if the PCR amplification products have both one characteristic band of 248 bp as shown in SEQ ID NO.4 and one characteristic band of 202 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous genotype with a small number of branches.

Images