Use of ndufb4 as a target in the preparation of a drug for treating bladder cancer

Abstract

The application discloses application of NDUFB4 as a target point in preparation of a drug for treating bladder cancer. Single cell analysis results show that NDUFB4 is highly enriched in bladder cancer epithelial cells, and can be used as a key coordinator to participate in the regulation of multiple carcinogenic signal pathways. Through shRNA-mediated gene silencing and CRISPR / Cas9-mediated gene knockout experiments, it is found that NDUFB4 deletion can significantly inhibit the proliferation, migration and invasion ability of bladder cancer cells, and cause a serious bioenergy crisis, and activate the endogenous apoptosis pathway. In a subcutaneous xenotransplant tumor model, it is further verified that NDUFB4 silencing can significantly inhibit tumor growth. The application discloses that NDUFB4 is a key coordinator between mitochondrial high-functionality and carcinogenic signal pathways, and it is suggested that NDUFB4 can become a potential target for bladder cancer treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and specifically relates to the application of NDUFB4 as a target in the preparation of drugs for treating bladder cancer. Background Technology

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system, ranking among the top urinary system cancers in both incidence and mortality, according to global cancer statistics. Current treatment strategies for bladder cancer mainly include transurethral resection of bladder tumors, intravesical chemotherapy, systemic chemotherapy, and immunotherapy. However, patients with non-muscle-invasive bladder cancer have a high recurrence rate after surgery, and some will progress to muscle-invasive bladder cancer; while patients with muscle-invasive bladder cancer have a worse prognosis, with a lower 5-year survival rate, and significant individual differences in response to existing radiotherapy, chemotherapy, and immunotherapy. Therefore, in-depth research into the molecular mechanisms of malignant progression of bladder cancer and the discovery of new therapeutic targets are of great significance for improving patient prognosis.

[0003] In recent years, metabolic reprogramming of tumor cells has been considered one of the core characteristics of cancer. Increasing research indicates that abnormal activation of mitochondrial oxidative phosphorylation, i.e., a hyperfunctional state of mitochondrial bioenergy, is a key driver of malignant progression in various tumors, including bladder cancer. Mitochondrial complex I (NADH: ubiquinone oxidoreductase), as the entry enzyme of the oxidative phosphorylation system, is a core complex regulating mitochondrial respiratory function and reactive oxygen species (ROS) generation. Studies have confirmed that targeting certain subunits of mitochondrial complex I or applying its inhibitors can inhibit tumor growth in various tumor models. For example, studies have found high expression of the NDUFS8 subunit in non-small cell lung cancer, which promotes tumor cell proliferation and motility by activating the Akt-mTOR signaling pathway; other studies have reported that complex I subunits NDUFA7 and NDUFS4 are specifically highly expressed in tumors, and knocking down these subunits can inhibit tumor progression without affecting T cell function; furthermore, using complex I inhibitors such as IACS-010759 can enhance tumor sensitivity to radiotherapy and immunotherapy through mechanisms such as inducing ROS accumulation, interfering with DNA repair, or triggering ferroptosis. These studies all suggest that specific subunits of mitochondrial complex I have the potential to become targets for anti-tumor therapy.

[0004] In the field of bladder cancer, studies have highlighted racial differences in mitochondrial metabolism, finding enhanced activity of mitochondrial complex I in tumors of African American bladder cancer patients. Knockdown of the NDUFB8 subunit significantly inhibited tumor cell proliferation and tumorigenicity in vivo. However, the specific expression pattern, biological function, and molecular mechanisms of NDUFB4, another important subunit of complex I, in bladder cancer remain largely unknown. As a helper subunit of complex I, NDUFB4 is located in the inner mitochondrial membrane, and its role in the development and progression of bladder cancer, as well as whether it participates in regulating key oncogenic signaling pathways, remains a mystery.

[0005] In summary, although the importance of mitochondrial metabolic abnormalities in tumors is widely recognized, and some subunits of complex I have been identified as potential intervention targets, the specific role of NDUFB4 in the malignant progression of bladder cancer, how it coordinates the cross-communication between mitochondrial hyperfunction and oncogenic signaling networks, and whether it can serve as an effective target for bladder cancer treatment remain unreported. Therefore, a deeper understanding of the expression characteristics, biological functions, and molecular regulatory mechanisms of NDUFB4 in bladder cancer is of significant theoretical and clinical translational value for developing novel targeted therapies for bladder cancer. Summary of the Invention

[0006] The purpose of this invention is to provide the application of NDUFB4 as a target in the preparation of drugs for treating bladder cancer.

[0007] Through shRNA-mediated gene silencing and CRISPR / Cas9-mediated gene knockout experiments, the inventors discovered that NDUFB4 deficiency significantly inhibits the proliferation, migration, and invasion of bladder cancer cells. Further mechanistic studies revealed that NDUFB4 deficiency triggers a severe bioenergetic crisis, characterized by decreased oxygen consumption, weakened mitochondrial complex I activity, and ATP depletion, subsequently inducing mitochondrial depolarization and the accumulation of lethal reactive oxygen species (ROS), ultimately activating the endogenous apoptosis pathway. Conversely, exogenous overexpression of NDUFB4 enhances mitochondrial respiration and strengthens the invasive malignant phenotype of bladder cancer cells. In a subcutaneous xenograft model, NDUFB4 silencing was further confirmed to significantly inhibit tumor growth, disrupt mitochondrial homeostasis, and suppress the STMN1 / Akt signaling cascade in the tumor microenvironment. This invention reveals NDUFB4 as a key coordinator between mitochondrial hyperfunction and oncogenic signaling pathways, suggesting it may be a potential target for bladder cancer treatment.

[0008] In view of this, the present invention provides the use of a reagent that inhibits NDUFB4 expression in the preparation of drugs for treating bladder cancer.

[0009] The reagents for inhibiting NDUFB4 expression include short hairpin RNA (shRNA) and its lentiviral expression vector that silence, knock down, or eliminate NDUFB4 expression, as well as sgRNA and its CRISPR / Cas9 system.

[0010] Furthermore, the shRNA targets NDUFB4 to mediate gene silencing, and its nucleotide sequence is any one of the following: shNDUFB4-S1: TATGTATTCCTGGCCTAAATAA; shNDUFB4-S2:GCCTATGCAAGAACAATAAAT.

[0011] Furthermore, the lentiviral expression vector contains the aforementioned shRNA. Preferably, the vector is a GV369 lentiviral vector.

[0012] Furthermore, the nucleotide sequence of the sgRNA is any of the following: koNDUFB4-C1Target: CACTCACGATGAGCCCT CGG; koNDUFB4-C2 Target: ACAACATATCTC CGG AAACC.

[0013] Furthermore, the CRISPR / Cas9 system is a dual-vector CRISPR / Cas9 system, comprising a lentiviral vector expressing Cas9 and a CRISPR vector carrying sgRNA that targets and knocks out NDUFB4.

[0014] The gene number of NDUFB4 is NM_004547.6.

[0015] This invention also provides a cell model for screening NDUFB4 inhibitors. Cells were infected using a lentiviral vector encoding human NDUFB4 (NM_004547.6) at an MOI of 12 for 36 hours. Subsequently, cells were screened with 3.5 μg / mL puromycin for 8 days to obtain a stable overexpressing cell population. The overexpression efficiency of the target protein was verified by qPCR and Western blot.

[0016] This invention systematically elucidates the crucial role of NDUFB4 in bladder cancer. As an important helper subunit of mitochondrial complex I, NDUFB4 is highly upregulated in malignant epithelial cells of bladder cancer and drives tumor proliferation, invasion, and survival by maintaining a high-functioning mitochondrial state and activating the STMN1 / Akt signaling axis. NDUFB4 deficiency induces significant mitochondrial dysfunction, ROS accumulation, and caspase-dependent apoptosis, while this effect is not significant in normal epithelial cells, suggesting that NDUFB4 may be a selective metabolic therapeutic target. Compared with existing technologies, this invention has the following advantages:

[0017] This invention, through single-cell sequencing analysis, clinical sample validation, and in vitro and in vivo functional experiments, is the first to demonstrate that NDUFB4 is specifically and highly expressed in malignant epithelial cells of bladder cancer, and that its expression level is positively correlated with tumor malignancy. More importantly, this invention reveals that targeted inhibition of NDUFB4 can significantly suppress the proliferation, migration, and invasion of bladder cancer cells, and effectively inhibit tumor growth in animal models, providing a new option for targeted therapy of bladder cancer.

[0018] The NDUFB4-targeting therapeutic strategy provided by this invention exhibits good tumor selectivity. Targeting NDUFB4 may selectively kill tumor cells while having minimal impact on normal cells. Therefore, the NDUFB4-based intervention strategy holds promise for achieving precise metabolic therapy that "specifically acts within tumor cells," reducing toxic side effects on normal tissues and potentially overcoming the clinical challenge of high toxicity associated with traditional metabolic inhibitors. This opens up new avenues for the precision treatment of bladder cancer and has significant clinical application prospects and translational value. Attached Figure Description

[0019] Figure 1 This study analyzed the single-cell expression characteristics and functional enrichment of NDUFB4 in bladder cancer. (A) UMAP dimensionality reduction and unsupervised clustering results for all cells in the GSE222315 dataset, with different colors representing different cell lineages; (B) UMAP visualization results grouped by sample origin (normal tissue vs. bladder cancer / BLCA); (C) Violin plots and dot plots show the expression distribution, average expression intensity, and proportion of cells expressing the NDUFB4 gene across all cell populations; (D) Comparative analysis of NDUFB4 expression levels in different cell populations in the normal group (NORM) and the bladder cancer group (BLCA); (E) Gene Ontology (GO) biological process enrichment analysis based on the top 100 genes with the highest Spearman rank correlation coefficient with NDUFB4 in malignant epithelial cell population; (F) Reactome pathway enrichment analysis shows signaling pathways that are significantly enriched with NDUFB4-related genes in malignant epithelial cell populations.

[0020] Figure 2 This indicates high expression of NDUFB4 in human bladder cancer tissues and cells. (A) qPCR quantitative analysis of NDUFB4 mRNA expression levels in 20 pairs of primary bladder cancer tissues (T) and their paired adjacent normal tissues (N), with data normalized by GAPDH; (B–C) Western blot results of NDUFB4 protein in 20 tissue samples (B) and corresponding gray-scale quantitative analysis (C); (D) Immunohistochemical (IHC) staining results of NDUFB4 in bladder cancer tissue (T) and paired adjacent normal tissue (N) in 4 representative patients; (E–F) Analysis results of NDUFB4 transcription levels in the TCGA-BLCA dataset, including overall comparison of tumor tissues and normal tissues (E) and paired sample analysis (F); (G–H) Results of qPCR (G) and Western blot (H) detection of NDUFB4 in primary bladder cancer cells (priBlCa-1, priBlCa-2, priBlCa-3), T24 cell line and primary normal bladder epithelial cells (priBEC-1, priBEC-2); In Figures A–C, each group contains 20 pairs of patient tissue samples (n = 20). In Figures E and F, n = 5 represents 5 biological replicates. * P < 0.05, compared to “N” tissue or priBEC-1 cells; *** P < 0.01. Scale bar = 100 μm.

[0021] Figure 3 NDUFB4 silencing selectively inhibits the proliferation and migration of bladder cancer cells. Among other things, (A–B) NDUFB4 was stably knocked down in priBlCa-1 cells using two independent shRNAs (shNDUFB4-S1 and shNDUFB4-S2). The knockdown efficiency and specificity (NDUFB4 and NDUFB7) were detected by qPCR (A) and Western blot (B). The control group was scrambled shRNA (shC). (C) CCK-8 assay to detect changes in cell viability over 96 hours; (D) Clonogenesis assays assess the long-term proliferative capacity of cells over a 12-day culture period; (E) BrdU ELISA detects DNA synthesis levels; (F) EdU incorporation experiment shows the DNA synthesis in the cell nucleus; (G) Transwell assay to detect cell migration ability; (H) Matrigel invasion assay to detect cell invasion ability; (I–J) Validation of the knockdown efficiency of shNDUFB4-S2 on NDUFB4 in priBlCa-2, priBlCa-3 and T24 cells; Effects of (K–L) NDUFB4 silencing on DNA synthesis capacity (K) and cell viability (L) in different bladder cancer cells; (M) NDUFB4 knockdown affects the migration ability of various bladder cancer cells; (N–O) Validation of NDUFB4 knockdown by shNDUFB4-S2 in primary normal bladder epithelial cells (priBEC-1 and priBEC-2); Effects of (P–Q) NDUFB4 silencing on viability (P) and proliferation (Q) of primary normal bladder epithelial cells.

[0022] Figure 4 NDUFB4 silencing specifically induces apoptosis in bladder cancer cells. (A) Results of Caspase-3 enzyme activity detection in priBlCa-1 cells after silencing NDUFB4 with shNDUFB4-S1 or shNDUFB4-S2; (B) Results of Caspase-9 enzyme activity detection in priBlCa-1 cells after silencing NDUFB4 with shNDUFB4-S1 or shNDUFB4-S2; (C) Western blot analysis was used to detect the protein expression levels of cleaved-caspase-3, cleaved-caspase-9, and cleaved-PARP-1 in priBlCa-1 cells; (D) ELISA method to detect the release of cytochrome c from mitochondria into the cytoplasm in priBlCa-1 cells after NDUFB4 silencing; (E) TUNEL staining shows the proportion of apoptotic nuclei in priBlCa-1 cells after NDUFB4 silencing; (F) Annexin V / PI double staining flow cytometry analysis of apoptosis in priBlCa-1 cells after NDUFB4 silencing; (G) Trypan blue staining to detect the overall cell death rate of priBlCa-1 cells after NDUFB4 silencing; (H) Changes in the proportion of TUNEL-positive cells after adding the Caspase-3 specific inhibitor z-DEVD-fmk (Cas3i) to priBlCa-1 cells treated with shNDUFB4-S2; (I) Changes in cell viability as detected by CCK-8 assay after adding the Caspase-3 specific inhibitor z-DEVD-fmk (Cas3i) to priBlCa-1 cells treated with shNDUFB4-S2; (J) Changes in cell death rate in priBlCa-1 cells treated with shNDUFB4-S2 after the addition of the broad-spectrum Caspase inhibitor z-VAD-fmk (Casi); (K) Results of Caspase-3 enzyme activity detection after NDUFB4 silencing in priBlCa-2, priBlCa-3 and T24 cells; (L) Statistical analysis of the proportion of TUNEL-positive apoptotic nuclei after NDUFB4 silencing in priBlCa-2, priBlCa-3 and T24 cells; (M) Results of cell death rate after NDUFB4 silencing in priBlCa-2, priBlCa-3 and T24 cells; (N) Results of Caspase-3 enzyme activity detection after NDUFB4 silencing in primary normal bladder epithelial cells priBEC-1; (O) Results of the detection of the proportion of TUNEL positive cells after NDUFB4 silencing in primary normal bladder epithelial cells priBEC-2; (P) Results of cell death rate after NDUFB4 silencing in primary normal bladder epithelial cells priBEC-1 and priBEC-2.

[0023] Figure 5 NDUFB4 deficiency induces mitochondrial dysfunction and oxidative stress in bladder cancer cells. Among these, (A) In priBlCa-1 cells, the changes in cellular oxygen consumption rate (OCR) after NDUFB4 silencing were detected using a Seahorse analyzer; (B) Results of detection of mitochondrial complex I enzyme activity after NDUFB4 silencing in priBlCa-1 cells; (C) Results of intracellular ATP content detection in priBlCa-1 cells after NDUFB4 silencing; (D) JC-1 staining shows changes in mitochondrial membrane potential in priBlCa-1 cells after NDUFB4 silencing; (E) CellROX fluorescent probes were used to detect the generation of reactive oxygen species (ROS) in priBlCa-1 cells after NDUFB4 silencing; (F) DCF-DA fluorescent probe detection of reactive oxygen species (ROS) generation in priBlCa-1 cells after NDUFB4 silencing; (G) Changes in the reduced / oxidized glutathione ratio (GSH / GSSG) after NDUFB4 silencing in priBlCa-1 cells; (H) Results of lipid peroxidation level (TBAR activity) after NDUFB4 silencing in priBlCa-1 cells; (I) Changes in Caspase-3 enzyme activity after NDUFB4 silencing combined with N-acetylcysteine ​​(NAC) treatment in priBlCa-1 cells; (J) Changes in the proportion of TUNEL-positive cells after NDUFB4 silencing combined with glutathione (Gluc) treatment in priBlCa-1 cells; (K) Changes in cell death rate in priBlCa-1 cells after NDUFB4 silencing combined with NAC or Gluc treatment; (L) Results of NDUFB4 silencing of mitochondrial complex I enzyme activity in priBlCa-2, priBlCa-3 and T24 cells; (M) Results of ATP content detection after NDUFB4 silencing in priBlCa-2, priBlCa-3 and T24 cells; (N) JC-1 staining was used to detect changes in mitochondrial membrane potential in priBlCa-2, priBlCa-3 and T24 cells; (O) Detection results of lipid peroxidation level after NDUFB4 silencing in priBlCa-2, priBlCa-3 and T24 cells; (P) Results of NDUFB4 silencing levels of reactive oxygen species (ROS) in priBlCa-2, priBlCa-3 and T24 cells.

[0024] Figure 6 Genetic knockout of NDUFB4 disrupts mitochondrial homeostasis and suppresses the malignant phenotype of bladder cancer cells. (A) Western blot was used to verify the construction efficiency and specificity of NDUFB4 knockout clones (koNDUFB4-C1 and koNDUFB4-C2) in priBlCa-1 cells, while NDUFB7 expression was detected as a control. (B) Changes in mitochondrial complex I enzyme activity in priBlCa-1 cells after NDUFB4 knockout; (C) Changes in ATP content in priBlCa-1 cells after NDUFB4 knockout; (D) Seahorse XF analysis shows the change in oxygen consumption rate (OCR) of priBlCa-1 cells after NDUFB4 knockout; (E) JC-1 staining shows changes in mitochondrial membrane potential in priBlCa-1 cells after NDUFB4 knockout; (F) CellROX fluorescence staining to detect ROS generation in priBlCa-1 cells after NDUFB4 knockout; (G) DCF-DA fluorescence staining was used to detect the generation of ROS in priBlCa-1 cells after NDUFB4 knockout; (H) EdU incorporation assay to detect changes in DNA synthesis capacity of priBlCa-1 cells after NDUFB4 knockout; (I) Transwell assay was used to detect changes in the migration ability of priBlCa-1 cells after NDUFB4 knockout; (J) Matrigel invasion assay to detect changes in the invasive ability of priBlCa-1 cells after NDUFB4 knockout; (K) TUNEL staining shows the change in the proportion of apoptotic nuclei in priBlCa-1 cells after NDUFB4 knockout; (L) Trypan blue staining to detect the overall cell death rate of priBlCa-1 cells after NDUFB4 knockout; (M) Results of apoptosis detection in primary normal bladder epithelial cells priBEC-1 after NDUFB4 knockout; (N) Results of cell viability changes after NDUFB4 knockout in primary normal bladder epithelial cells priBEC-2.

[0025] Figure 7 Overexpression of NDUFB4 enhances mitochondrial bioenergy and promotes an aggressive and malignant phenotype in bladder cancer cells. (A) qPCR was used to verify the construction efficiency of NDUFB4 stably overexpressing cell lines (stb-slc1 and stb-slc2) in priBlCa-1 cells; (B) Western blot was used to verify the stable overexpression level of NDUFB4 protein in priBlCa-1 cells; (C) Changes in mitochondrial complex I enzyme activity in priBlCa-1 cells after NDUFB4 overexpression; (D) Changes in ATP content in priBlCa-1 cells after NDUFB4 overexpression; (E) CCK-8 assay to detect the effect of NDUFB4 overexpression on priBlCa-1 cell viability; (F) EdU incorporation assay to detect the effect of NDUFB4 overexpression on DNA synthesis capacity of priBlCa-1 cells; (G) Transwell assay was used to detect the effect of NDUFB4 overexpression on the migration ability of priBlCa-1 cells; (H) Matrigel invasion assay to detect the effect of NDUFB4 overexpression on the invasive ability of priBlCa-1 cells; (I) qPCR validation results of NDUFB4 overexpression in priBlCa-2, priBlCa-3 and T24 cells; (J) Western blot results of NDUFB4 overexpression in priBlCa-2, priBlCa-3 and T24 cells; (K) Changes in mitochondrial complex I enzyme activity after NDUFB4 overexpression in priBlCa-2, priBlCa-3 and T24 cells; (L) Changes in ATP content after NDUFB4 overexpression in priBlCa-2, priBlCa-3 and T24 cells; (M) Effect of NDUFB4 overexpression on cell proliferation in priBlCa-2, priBlCa-3 and T24 cells; (N) Effects of NDUFB4 overexpression on cell migration and invasion in priBlCa-2, priBlCa-3 and T24 cells.

[0026] Figure 8 NDUFB4 silencing inhibits the growth of xenograft tumors in vivo and disrupts mitochondrial homeostasis and the STMN1 / Akt signaling axis. Among these, (A) Growth curve of tumor volume over time after subcutaneous inoculation of priBlCa-1 cells (shC or shNDUFB4-S2) into nude mice; (B) Daily growth rate analysis of xenograft tumors; (C) Representative photographs and comparison of tumor weight of the two groups at the end of the experiment; (D) Changes in body weight of the two groups of mice during the experiment; (E) qPCR was used to detect the expression level of NDUFB4 mRNA in xenograft tumor tissues; (F) Western blot analysis of NDUFB4 protein expression levels in xenograft tumor tissues; (G) Immunohistochemical staining (IHC) was used to verify the silencing efficiency of NDUFB4 in xenograft tumor tissue; (H) Results of detection of mitochondrial complex I enzyme activity in xenograft tumor tissue; (I) Results of ATP content detection in xenograft tumor tissue; (J) Results of the GSH / GSSG ratio detection in xenograft tumor tissue; (K) Results of lipid peroxidation level (TBAR activity) detection in xenograft tumor tissue; (L) qPCR was used to detect the expression level of STMN1 mRNA in xenograft tumor tissues; (M) Western blot was used to detect STMN1 protein expression and Akt phosphorylation levels in xenograft tumor tissues; (N) Ki-67 immunohistochemical staining was used to assess cell proliferation levels in xenograft tumor tissues; (O) ELISA method was used to detect the content of cytochrome c in xenograft tumor tissue; (P) Western blot was used to detect the expression levels of cleaved-caspase-3 and cleaved-PARP-1 in xenograft tumor tissues; (Q) TUNEL staining shows the proportion of apoptotic cell nuclei in xenograft tumor tissue. Detailed Implementation

[0027] The present invention will be described in detail below with reference to the embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0028] Unless otherwise specified, the experimental methods described in the following examples are generally performed under conventional conditions or as recommended by the respective manufacturers. Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention employ conventional techniques in molecular biology, biochemistry, analytical chemistry, cell culture, molecular cloning, and related fields.

[0029] Cell Counting Kit-8 (CCK-8) was purchased from DojindoMolecular Technologies (Kumamoto, Japan). Common chemical reagents, including puromycin, polybrene, basal culture medium, antibiotics, fetal bovine serum (FBS), and RNA extraction reagents, were purchased from Sigma-Aldrich (St. Louis, USA). Fluorescent probes and staining kits, including EdU, DAPI, TUNEL, JC-1, and Annexin V / PI, were purchased from Invitrogen (Thermo Fisher Scientific, Shanghai, China). All viral expression vectors and mRNA primers used in this study were purchased from Genechem (Shanghai, China) unless otherwise specified. Antibodies used were provided by Abcam (Cambridge, UK) and Cell Signaling Technology (Shanghai, China). Unless otherwise specified, all reagents and materials mentioned in the examples are commercially available products.

[0030] shRNA-mediated gene silencing: Two independent short hairpin RNAs (shRNAs) were used to target NDUFB4 and cloned into the GV369 lentiviral vector. The target sequences are as follows: shNDUFB4-S1: TATGTATTCCTGGCCTAAATAA shNDUFB4-S2:GCCTATGCAAGAACAATAAAT

[0031] Bladder cancer cells and epithelial cells were transfected with lentivirus at an MOI of 12 in a medium containing 8% FBS and polybrene. After 36 hours of culture, stable knockdown cell lines were obtained by selection with 3.5 μg / mL puromycin for 8 days. The knockdown efficiency was verified at the transcriptional and protein levels by qPCR and Western blot, respectively.

[0032] Lentiviral overexpression of NDUFB4: Cells were infected using a lentiviral vector encoding human NDUFB4 (NM_004547.6) at an MOI of 12 for 36 hours. A stable overexpressing cell population was then selected by 8 days with 3.5 μg / mL puromycin. The overexpression efficiency of the target protein was verified by qPCR and Western blot.

[0033] CRISPR / Cas9-mediated knockout: NDUFB4 gene knockout was performed using a dual-vector CRISPR / Cas9 system. Cells at 50–60% confluence were first infected with a lentivirus expressing Cas9, followed by infection with an sgRNA carrying NDUFB4-targeting RNA (koNDUFB4-C1Target:CACTCACGATGAGCCCT). CGG, koNDUFB4-C2 Target: ACAACATATCTC CGG The AAACC CRISPR vector was used. After antibiotic screening, monoclonal cells were obtained using a 96-well plate limiting dilution method.

[0034] NDUFB4 knockout was validated by Sanger sequencing and Western blot analysis of the target site. Two independent knockout clones (koNDUFB4-C1 and koNDUFB4-C2) completely lacking NDUFB4 protein expression were obtained for subsequent experiments. A homologous control cell line (koC) was established using an empty vector without sgRNA. The same method was used to establish an NDUFB4 knockout model in normal bladder epithelial cells.

[0035] Human clinical specimens Following previous study protocols, this study included 20 patients (age range: 65–76 years; clinical stage: T2–T4a, N0, M0) who underwent radical surgical treatment for muscle-invasive bladder cancer. Tumor tissue and adjacent normal bladder mucosa were rigorously separated under microscopic guidance. The obtained tissue samples were homogenized and then used for Western blot and quantitative real-time PCR (qPCR) analysis.

[0036] All patients received treatment at the Second People's Hospital of Changzhou, affiliated with Nanjing Medical University, and signed written informed consent forms before sample collection. This study protocol was approved by the Ethics Committee of the Second People's Hospital of Changzhou, affiliated with Nanjing Medical University (Approval No.: JCY-2021-032) and strictly followed the relevant principles of the Declaration of Helsinki.

[0037] Cell culture (Cells) The T24 bladder cancer cell line was purchased from the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Cell culture conditions were performed according to previously reported methods. The establishment of primary cells was also conducted as previously reported. Briefly, fresh tumor tissue and adjacent normal epithelial tissue were collected, washed with PBS, minced, and enzymatically digested using type I collagenase (Sigma-Aldrich) and DNase (Sigma-Aldrich). The digested cell suspension was filtered through a 70 μm cell sieve to obtain a single-cell suspension, which was then resuspended in complete culture medium.

[0038] This procedure successfully established three primary bladder cancer cells (priBlCa-1, priBlCa-2, and priBlCa-3) from different patients and two primary normal bladder epithelial cells (priBEC-1 and priBEC-2). All cells underwent quality control testing every 6–8 weeks, including STR typing, mycoplasma and microbial contamination screening, while cell doubling time and morphological changes were monitored. All experiments were approved by the ethics committee (approval number: JCY-2021-032).

[0039] Example 1: Expression characteristics and functional enrichment analysis of NDUFB4 at the single-cell level

[0040] To systematically elucidate the transcriptomic characteristics and potential biological functions of NDUFB4 in the development and progression of bladder cancer (BLCA), we conducted an in-depth analysis of the single-cell RNA sequencing dataset GSE222315.

[0041] Single-cell RNA sequencing (scRNA-seq) analysis

[0042] Following previously reported methods, the raw single-cell transcriptome data (GSE222315) were processed using the Seurat R software package. The data underwent normalization, scaling, principal component analysis (PCA, selecting the top 30 principal components), and dimensionality reduction visualization using UMAP (Uniform Manifold Approximation and Projection). Cell clustering analysis was performed at a resolution of 0.5, and artificial cell type annotation was performed based on classic cell marker genes.

[0043] Differential expression analysis between NDUFB4-positive and NDUFB4-negative epithelial cells was performed using the FindMarkers function (screening criteria: P < 0.05, |log2FC| > 1). Subsequently, GeneOntology (GO) biological process (BP) and Reactome pathway enrichment analyses were performed on the differentially expressed genes using the Enrichr platform.

[0044] Unsupervised clustering and UMAP (Uniform Manifold Approximation and Projection) dimensionality reduction analysis successfully identified the main cell types in the bladder tumor microenvironment, including B cells, T cells, epithelial cells, myeloid cells, endothelial cells, fibroblasts, and mast cells (Figure 1A). Further comparison of normal bladder tissue (NORM) and bladder cancer tissue (BLCA) samples revealed a high degree of consistency in the overall cell population structure between the two groups (Figure 1B).

[0045] Analysis of the NDUFB4 expression profile showed that it was mainly distributed in epithelial cells, endothelial cells, and fibroblast populations (Figure 1C, D). Notably, compared with normal controls, NDUFB4 showed significant and specific high expression in malignant epithelial cell populations of BLCA samples, with not only a significantly increased average expression level but also a significantly increased proportion of cells expressing this gene (Figure 1C).

[0046] To further explore the biological significance of NDUFB4 enrichment in malignant cells, we screened the top 100 genes positively correlated with NDUFB4 expression in malignant epithelial cell populations and performed functional enrichment analysis. GeneOntology (GO) biological process analysis showed that these NDUFB4-related genes are mainly involved in key oncogenic processes such as protein degradation regulation, DNA replication, and positive cell cycle regulation (Figure 1E). Meanwhile, Reactome pathway enrichment analysis further revealed that these genes are significantly enriched in signaling modules closely related to cell proliferation and structural remodeling, such as mitotic cell cycle regulation, immune system regulation, and the Rho GTPase signaling pathway (Figure 1F).

[0047] In summary, the single-cell analysis results indicate that NDUFB4 is highly enriched in malignant epithelial cells of bladder cancer and may act as a key coordinating factor in the regulation of multiple oncogenic signaling pathways.

[0048] Example 2: NDUFB4 was significantly upregulated in human bladder cancer tissues and cells.

[0049] To validate the clinical relevance of the single-cell analysis results, we further systematically evaluated the expression level of NDUFB4 in clinical samples and experimental models. qPCR analysis of 20 pairs of primary bladder cancer tissues (T) and their paired adjacent normal tissues (N) showed that, compared with normal tissues, the NDUFB4 mRNA level in bladder cancer tissues was significantly increased (T). Figure 2 A). This change was also verified at the protein level. Western blot and gray-scale quantitative analysis results showed that NDUFB4 protein expression in tumor tissue was significantly higher than that in paired normal tissue (Figure 2B, C).

[0050] In addition, immunohistochemical (IHC) staining of tissue sections from four representative patients showed that NDUFB4 exhibited strong cytoplasmic positive staining in tumor cell nests, while the staining signal was extremely weak in adjacent normal stroma and healthy urothelial tissue (Figure 2D).

[0051] To further extend the generalizability of these findings, we analyzed the TCGA-BLCA cohort. The results showed that NDUFB4 transcription levels were significantly elevated in bladder cancer tissue compared to normal bladder tissue (Figure 2E). In paired sample analysis, NDUFB4 expression was also significantly higher in tumor tissue from the same patient than in their normal tissue (Figure 2F).

[0052] At the cellular level, we examined NDUFB4 expression in various bladder cancer cell models. Compared with primary normal bladder epithelial cells (priBEC-1, priBEC-2), the mRNA and protein expression levels of NDUFB4 were significantly increased in primary bladder cancer cells (priBlCa-1, priBlCa-2, priBlCa-3) from different patients and in the T24 bladder cancer cell line (Figure 2G, H).

[0053] The above multi-level evidence consistently shows that NDUFB4 is significantly upregulated in bladder cancer tissues and various malignant cell models.

[0054] Example 3: NDUFB4 silencing selectively inhibits the proliferation and migration of bladder cancer cells.

[0055] To clarify the functional role of NDUFB4 in bladder cancer progression, we employed a shRNA-mediated knockdown strategy in primary bladder cancer cells (priBlCa-1). Two independent shRNAs (shNDUFB4-S1 and shNDUFB4-S2) significantly downregulated NDUFB4 expression at both the transcriptional and protein levels (Figures 3A and 3B), without affecting NDUFB7 expression in the same complex I, suggesting good specificity for knockdown.

[0056] Functional experiments showed that NDUFB4 silencing significantly inhibited the malignant biological behavior of priBlCa-1 cells. CCK-8 and colony formation assays indicated that NDUFB4 knockdown significantly reduced cell viability and long-term colony formation ability (Figures 3C and 3D). BrdU ELISA and EdU incorporation assays further confirmed that NDUFB4 deficiency significantly inhibited DNA synthesis and cell proliferation (Figures 3E and 3F). Furthermore, Transwell assays showed that NDUFB4 knockdown significantly inhibited the migration and invasion abilities of priBlCa-1 cells (Figures 3G and 3H).

[0057] To verify the generality of this effect, we applied shNDUFB4-S2 to other malignant cell models, including the priBlCa-2, priBlCa-3, and T24 cell lines. The results consistently showed that NDUFB4 silencing significantly inhibited DNA synthesis, cell viability, and migration in all bladder cancer cells (Figure 3I–M). Conversely, in primary normal bladder epithelial cells (priBEC-1, priBEC-2), although NDUFB4 expression was effectively downregulated, cell viability and proliferation were not significantly affected (Figure 3N–Q).

[0058] The above results indicate that bladder cancer cells are specifically dependent on NDUFB4 expression, while normal epithelial cells are highly tolerant to its absence.

[0059] Example 4: NDUFB4 deletion specifically induces apoptosis in bladder cancer cells.

[0060] To investigate the mechanism by which NDUFB4 silencing inhibits tumor cell survival, we focused on analyzing apoptosis. In priBlCa-1 cells, both shNDUFB4-S1 and shNDUFB4-S2 significantly upregulated the activities of Caspase-3 and Caspase-9 (Figures 4A and 4B). Western blot results further showed that NDUFB4 knockdown led to a significant accumulation of cleaved-caspase-3, cleaved-caspase-9, and cleaved-PARP-1, suggesting activation of the intrinsic apoptosis pathway (Figure 4C).

[0061] Cytochrome c ELISA assays showed that NDUFB4 silencing significantly promoted the release of cytochrome c from mitochondria into the cytoplasm (Fig. 4D). TUNEL staining and Annexin V / PI flow cytometry analysis further confirmed that NDUFB4 deficiency significantly increased the proportion of apoptotic cells (Fig. 4E, F) and led to an increase in overall cell death rate (Fig. 4G).

[0062] Notably, the use of a Caspase-3 specific inhibitor (z-DEVD-fmk) or a broad-spectrum Caspase inhibitor (z-VAD-fmk) can significantly reverse the NDUFB4 knockdown-induced apoptotic phenotype, including a decrease in the proportion of TUNEL-positive cells and the recovery of cell viability and survival (Figure 4H–J), suggesting that this process depends on Caspase activation.

[0063] Consistent results were observed in other bladder cancer cell models (priBlCa-2, priBlCa-3, and T24), while in primary normal epithelial cells, NDUFB4 silencing did not induce significant Caspase activation or apoptosis (Fig. 4K–P).

[0064] Example 5: NDUFB4 deficiency leads to mitochondrial dysfunction and increased oxidative stress.

[0065] Given the crucial role of mitochondrial hyperfunction in bladder cancer, we systematically evaluated the effects of NDUFB4 silencing on mitochondrial bioenergetics. OCR analysis showed that NDUFB4 knockdown significantly inhibited basal respiration, ATP-coupled respiration, and maximal respiratory capacity in priBlCa-1 cells (Figure 5A). Simultaneously, mitochondrial complex I activity and intracellular ATP levels were significantly decreased (Figures 5B and 5C).

[0066] JC-1 staining results showed that NDUFB4 deficiency led to a significant decrease in mitochondrial membrane potential (Fig. 5D). In addition, CellROX and DCF-DA fluorescence staining showed that NDUFB4 knockdown significantly induced ROS accumulation (Fig. 5E, F), accompanied by a decrease in the GSH / GSSG ratio and an increase in lipid peroxidation levels (Fig. 5G, H).

[0067] Treatment with the antioxidants NAC or glutathione significantly alleviated NDUFB4 deficiency-induced Caspase-3 activation, nuclear fragmentation, and cell death (Figure 5I–K), indicating that mitochondrial stress and ROS accumulation are key mechanisms for inducing apoptosis.

[0068] The aforementioned mitochondrial dysfunction and oxidative stress phenotypes have also been validated in other bladder cancer cell models. Figure 5 L–P).

[0069] Example 6: CRISPR / Cas9-mediated NDUFB4 knockout suppresses malignant phenotypes in bladder cancer

[0070] An NDUFB4 knockout model was constructed in priBlCa-1 cells using CRISPR / Cas9 technology. Two independent knockout clones (koNDUFB4-C1 and C2) both exhibited complete loss of NDUFB4 protein, while NDUFB7 expression remained unaffected (Figure 6A). Functional assays showed that NDUFB4 knockout significantly inhibited mitochondrial complex I activity, ATP production, and OCR (internal retrieval response). Figure 6 B–D), leading to mitochondrial depolarization and ROS accumulation (Figure 6E–G).

[0071] Furthermore, NDUFB4 knockout significantly inhibited cell proliferation, migration, and invasion, and induced apoptosis (Fig. 6H–L). Knockout of NDUFB4 in normal bladder epithelial cells did not produce significant toxic effects (Fig. 6M, N).

[0072] Example 7: NDUFB4 overexpression enhances mitochondrial function and promotes tumor malignant progression

[0073] Stable overexpression of NDUFB4 in priBlCa-1 cells significantly enhanced mitochondrial complex I activity and ATP levels (Fig. 7A–D), and significantly promoted cell proliferation, DNA synthesis, migration, and invasion (Fig. 7E–H). Consistent results were observed in other bladder cancer cell models (Fig. 7I–N).

[0074] Example 8: NDUFB4 silencing and inhibiting the growth of xenograft tumors in vivo

[0075] In a nude mouse subcutaneous xenograft model, NDUFB4 silencing significantly inhibited tumor growth and reduced tumor weight, but did not affect animal body weight. Figure 8 A–D). Tumor tissue exhibits impaired mitochondrial function, enhanced oxidative stress, and is accompanied by STMN1 / Akt signaling inhibition and enhanced apoptosis. Figure 8 E–Q).

[0076] This invention systematically elucidates the crucial role of NDUFB4 in bladder cancer. We discovered that NDUFB4, as an important helper subunit of mitochondrial complex I, is highly upregulated in malignant epithelial cells of bladder cancer and drives tumor proliferation, invasion, and survival by maintaining a high-functioning mitochondrial state and activating the STMN1 / Akt signaling axis.

[0077] NDUFB4 deficiency can induce significant mitochondrial dysfunction, ROS accumulation, and caspase-dependent apoptosis, while this effect is not significant in normal epithelial cells, suggesting that NDUFB4 may be a selective metabolic therapeutic target.

[0078] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of reagents that inhibit NDUFB4 expression in the preparation of drugs for treating bladder cancer.

2. The application according to claim 1, characterized in that, The reagents for inhibiting NDUFB4 expression include shRNA, sgRNA, lentiviral expression vectors, and CRISPR / Cas9 systems that silence, knock down, or eliminate NDUFB4.

3. The application according to claim 2, characterized in that, The shRNA nucleotide sequence is any one of the following: shNDUFB4-S1: TATGTATTCCTGGCCTAAATAA; shNDUFB4-S2:GCCTATGCAAGAACAATAAAT.

4. The application according to claim 2, characterized in that, The lentiviral vector contains the shRNA.

5. The application according to claim 2, characterized in that, The nucleotide sequence of the sgRNA is any of the following: koNDUFB4-C1 target sequence: CACTCACGATGAGCCCTCGG; koNDUFB4-C2 target sequence: ACAACATATCTCCGGAAACC.

6. The application according to claim 2, characterized in that, The CRISPR / Cas9 system is a dual-vector CRISPR / Cas9 system, comprising a lentiviral vector expressing Cas9 and a CRISPR vector carrying sgRNA that targets and knocks out NDUFB4.

7. The application according to claim 1, characterized in that, The gene number of NDUFB4 is NM_004547.

6.

8. A cell model for screening NDUFB4 inhibitors, characterized in that, Cells were infected with a lentiviral vector encoding human NDUFB4 (NM_004547.6), and after screening and culture, a stable overexpression cell population was obtained.

Images