A ribozyme for targeted inhibition of PD-L1 gene expression and preparation method and application thereof

By engineering Pistol ribozymes to target and cleave the PD-L1 gene transcript, the systemic regulation of PD-L1 expression in tumor immunotherapy was addressed, achieving sustained inhibition of PD-L1 and enhanced immune response, thus improving drug resistance.

CN122168595APending Publication Date: 2026-06-09NANKAI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANKAI UNIV
Filing Date
2026-02-06
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

In current tumor immunotherapy, the immunosuppressive mechanism of the PD-1/PD-L1 immune checkpoint pathway limits efficacy, and some patients develop drug resistance. There is also a lack of systematic posttranscriptional regulation strategies for PD-L1 expression.

Method used

The engineered Pistol ribozyme is used to target and cleave the PD-L1 gene transcript. By specifically cleaving the PD-L1 gene transcript through the ribozyme, the expression of PD-L1 in tumor cells is reduced, and a synergistic anti-tumor effect is formed by combining with immune activators.

Benefits of technology

It achieved sustained inhibition of PD-L1 expression, enhanced CD8⁺T cell infiltration, improved anti-PD-1/PD-L1 antibody resistance phenotype, and synergistically enhanced tumor immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168595A_ABST
    Figure CN122168595A_ABST
Patent Text Reader

Abstract

The present application relates to the field of tumor immunotherapy, discloses a kind of ribozyme for targeted inhibition of PD-L1 gene expression and its preparation method and application, specifically relates to a kind of engineered Pistol ribozyme and its use in targeted inhibition of PD-L1 (CD274) gene expression.The ribozyme is RNA molecule connected by ribonucleotide monomer, contains the substrate recognition region of the conserved structural framework maintaining catalytic activity and PD-L1 transcript complement;Conserved skeleton covers P1, P2, P3 region and false node area, and contains catalytic related conserved base site, substrate recognition region can be designed as required, can recognize and cut the targeted site containing GU dinucleotide in PD-L1 transcript, reduce the PD-L1 expression of tumor cell in post-transcriptional level.The PD-L1 transcript includes mature mRNA, precursor mRNA, intron retention transcript and variable splicing transcript.Different from existing immune checkpoint blockade therapy, the present application can sustainably inhibit endogenous PD-L1 in tumor cell, relieve immune suppression, enhance anti-tumor immune response, and also provide the preparation method of the ribozyme and its pharmaceutical composition, and application prospect is good.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the therapeutic use of engineered Pistol ribozyme-based targeted inhibition of PD-L1 gene transcript expression and its application in tumor immunotherapy. Background Technology

[0002] Cancer immunotherapy, by activating the body's immune system to fight tumors, has become an important treatment method following surgery, radiotherapy, and chemotherapy. However, immunosuppressive mechanisms are prevalent in the tumor microenvironment, especially the PD-1 / PD-L1 immune checkpoint pathway, which severely limits the efficacy of immunotherapy. Currently used PD-1 or PD-L1 monoclonal antibodies mainly relieve immunosuppression by blocking receptor-ligand interactions, but this strategy does not reduce the expression level of endogenous PD-L1 in tumor cells, and some patients have primary or secondary drug resistance, indicating that new intervention methods are urgently needed. In recent years, ribozymes, RNA molecules with catalytic activity, have regained attention. Pistol ribozymes, due to their compact structure, stable folding, and unique generalized acid-base catalytic mechanism, are considered to have the potential to become programmable RNA regulatory tools. However, existing research focuses mainly on their application as molecular biology tools, and lacks systemic therapeutic strategies targeting tumor immune escape mechanisms. Therefore, how to introduce engineered ribozyme technology into the field of tumor immunotherapy, especially to achieve post-transcriptional regulation of PD-L1 expression, is an important technical problem that urgently needs to be solved in this field. Summary of the Invention

[0003] The purpose of this invention is to provide a novel tumor immunotherapy strategy that uses engineered Pistol ribozymes to target and degrade PD-L1 gene transcripts, thereby inhibiting PD-L1 expression at the endogenous level in tumor cells, relieving immunosuppression, and enhancing anti-tumor immune responses.

[0004] This invention provides a ribozyme for preparing antitumor drugs and its uses. The ribozyme is an engineered ribozyme constructed based on the Pistol ribozyme catalytic core, capable of specifically cleaving target sites of the PD-L1 gene transcript, thereby reducing the expression level of PD-L1 in tumor cells. Unlike existing antibody therapies that simply block the interaction between PD-1 and PD-L1 proteins, this invention achieves sustained inhibition of PD-L1 at the posttranscriptional regulatory level, reducing the risk of immunosuppressive rebound caused by rapid protein re-expression. This invention further reveals that the engineered Pistol ribozyme, used for targeted degradation of the PD-L1 gene transcript in tumor cells, not only rapidly reduces PD-L1 expression levels but also enhances CD8⁺ T cell infiltration in immunosuppressive tumor models, improving some anti-PD-1 / PD-L1 antibody resistance phenotypes. Furthermore, this invention provides a therapeutic strategy of combining the ribozyme with immune activators to create a synergistic antitumor effect.

[0005] A ribozyme for targeting and inhibiting PD-L1 gene expression, said ribozyme being an RNA molecule formed by linking ribonucleotide monomers, comprising:

[0006] (1) A conserved structural framework for maintaining catalytic activity, the framework comprising a P1 region, a P2 region, a P3 region and a pseudo-node region, wherein G5, A19, A20, A21, A32, G40, C41 and G42 are catalysis-related conserved bases;

[0007] (2) A substrate recognition region for complementary binding to PD-L1 gene transcripts, wherein the substrate recognition region is capable of recognizing and cleaving a target site containing GU dinucleotides in the PD-L1 gene transcript, thereby achieving specific cleavage of the PD-L1 gene transcript; wherein the PD-L1 gene transcript includes mature mRNA, precursor mRNA, and any transcript form containing exons and / or introns derived from the PD-L1 gene; and the substrate recognition region is 5–35 nucleotides in length, and its complementarity with the upstream and downstream sequences of the target GU site is 70%–100%, and its base composition is allowed to change while maintaining at least one of the following technical effects:

[0008] (a) It exhibits detectable cleavage activity against PD-L1 gene transcripts in an in vitro system;

[0009] (b) It can reduce PD-L1 protein expression by at least 30% at the cellular level.

[0010] Preferably, the ribozyme includes any sequence in SEQ ID NO.1–34 and its functionally equivalent variants, wherein the functionally equivalent variants refer to variants obtained by base substitution, insertion or deletion while maintaining the ability to target and cleave PD-L1 gene transcripts.

[0011] Preferably, the nucleotide units constituting the ribozyme are selected from natural nucleotides A, U, C, G or their derivatives thereof without significantly reducing their targeted cleavage activity against the PD-L1 gene transcript. The derivatives include, but are not limited to, 2′-O-methyl nucleotides, 2′-fluoronucleotides, pseudouracil, phosphate thioester modified nucleotides, methoxyethyl modified nucleotides, locked nucleic acids or any combination thereof.

[0012] Preferably, the ribozyme is allowed to have an extension or deletion of 0–35 nucleotides at the 5′ and / or 3′ ends, and / or be linked with a functional tag, provided that such change does not significantly reduce its targeted cleavage activity against the PD-L1 gene transcript.

[0013] A method for preparing a ribozyme for targeted inhibition of PD-L1 gene expression, wherein the ribozyme is prepared by in vitro transcription or chemical synthesis.

[0014] Application of ribozymes for targeting and inhibiting PD-L1 gene expression in any of the following uses:

[0015] (a) Targeted inhibition of PD-L1 gene transcript expression;

[0016] (b) Reduce the expression level of PD-L1 protein in tumor cells;

[0017] (c) Preparation of antitumor drugs for relieving PD-1 / PD-L1-mediated immunosuppression.

[0018] Preferably, the ribozyme is used in combination with at least one anti-tumor immunotherapy, including PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, CAR-T or TCR-T cell therapy, tumor vaccines or oncolytic viruses, and the anti-tumor effect produced by the combined treatment is higher than the sum of the effects of each single treatment.

[0019] Preferably, the ribozyme enters tumor cells via any one of the following delivery systems: lipid nanoparticles, polymeric nanocarriers, tumor-targeting aptamer-nucleic acid complexes, exosomes, viruses, or virus-like vectors.

[0020] An antitumor drug composition comprising a ribozyme for targeting and inhibiting PD-L1 gene expression, and a pharmaceutically acceptable carrier or excipient.

[0021] Beneficial effects: Compared with the prior art, the present invention has at least the following advantages:

[0022] (1) Inhibit PD-L1 expression at the post-transcriptional level, breaking through the limitation of existing antibody therapies that are limited to protein blocking;

[0023] (2) It exhibits unpredictable immune activation effects in immunosuppressive tumor models;

[0024] (3) It can synergize with various immunotherapy methods, expanding the clinical application scenarios;

[0025] (4) It has good delivery adaptability and industrial transformation potential. Attached Figure Description

[0026] Picture 1 Secondary structure and conserved clipping annotation of Pistol ribozyme.

[0027] Picture 2 Schematic diagram of the Pistol ribozyme cleavage process.

[0028] Picture 3 Gel image of Pistol ribozyme purified from PD-L1 gene via in vitro transcription.

[0029] Picture 4 In vitro gel images of Pistol ribozyme digestion targeting different sites of the PD-L1 gene.

[0030] Picture 5 Figure 1 shows the results of qPCR verification of the inhibition of PD-L1 gene mRNA expression in two tumor cell lines, B16F10 and 4T1. (A) Results of qPCR verification of the inhibition of PD-L1 gene mRNA expression in the B16F10 cell line. (B) Results of qPCR verification of the inhibition of PD-L1 gene mRNA expression in the 4T1 cell line.

[0031] Picture 6 Gel maps of ribozyme transcriptions of different P3 lengths targeting the 473 site.

[0032] Picture 7 In vitro gel images of ribozymes with different P3 lengths targeting the 473 site.

[0033] Picture 8 (A) Results of qPCR targeting different P3 lengths of ribozymes at site 473 in inhibiting PD-L1 gene mRNA expression in B16F10 cells; (B) IC50 assay of PS473 ribozyme in inhibiting PD-L1 gene mRNA expression in B16F10 cells.

[0034] Picture 9Western Blot results verifying the inhibition of PD-L1 gene expression by different concentrations of PS473 ribozyme in B16F10 cells; (A) Chemiluminescence imaging of different concentrations of PS473 ribozyme inhibiting PD-L1 gene expression by Western Blot; (B) Gray-scale statistical analysis of different concentrations of PS473 ribozyme inhibiting PD-L1 gene expression by Western Blot.

[0035] Picture 10 Results of qPCR targeting PS473 ribozyme to inhibit PD-L1 gene mRNA expression in tumor tissue.

[0036] Picture 11 Western Blot results verifying the inhibition of PD-L1 gene expression by PS473 ribozyme in tumor tissue; (A) Chemiluminescence imaging of PS473 ribozyme inhibiting PD-L1 gene expression in tumor tissue by Western Blot; (B) Gray-scale statistical analysis of PS473 ribozyme inhibiting PD-L1 gene expression in tumor tissue by Western Blot.

[0037] Picture 12 Analysis of immune cell infiltration in tumor tissue; (A) CD4 in tumor tissue + (B) Analysis of T cell content; CD8 in tumor tissue + A graph showing the analysis of T cell content.

[0038] Picture 13 Results of anti-tumor treatment using PS473 ribozyme delivered by different vectors; (A) Tumor images after anti-tumor treatment using PS473 ribozyme delivered by different vectors; (B) Tumor quality after anti-tumor treatment using PS473 ribozyme delivered by different vectors. Detailed Implementation

[0039] The following examples are provided to further illustrate the present invention, but should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, conventional methods in the art or the instructions for reagents / instruments can be used. To facilitate understanding of the mechanism of action and technical effects of the engineered Pistol ribozyme described in this invention, its basic workflow is now explained in conjunction with the accompanying drawings.

[0040] like Picture 2As shown, after contacting the target PD-L1 transcript, the engineered Pistol ribozyme first undergoes complementary pairing with the target sequence through its substrate recognition region. Subsequently, under the action of a conserved catalytic backbone, a cleavage reaction is completed at the GU dinucleotide site. After cleavage, the ribozyme is released from the cleavage product, thereby achieving multiple rounds of catalytic turnover of the same substrate. This workflow provides the fundamental mechanistic support for the sustained inhibition of PD-L1 expression achieved by the technical solution of this invention.

[0041] Based on the above-described mechanism of action, the technical solution of the present invention will be further explained below through specific embodiments.

[0042] Target sequence reference description.

[0043] The engineered ribozyme described in this invention targets the transcript of the PD-L1 gene. To facilitate understanding of the technical solution of this invention, only a portion of the mature PD-L1 mRNA sequences collected in publicly available databases are used as examples to illustrate the distribution of GU dinucleotide sites in the PD-L1 transcript.

[0044] It should be noted that the scope of protection of this invention is not limited to any specific species, any single transcript, or any single splicing form. The PD-L1 gene transcripts include, but are not limited to: mature mRNA, pre-mRNA, splicing variants containing introns, and other alternative splicing forms and fragments thereof.

[0045] The following sequence is only a reference example of mature mRNA used to illustrate the applicability of the ribozyme design principle of the present invention, and does not constitute a limitation of the claims of the present invention.

[0046] For example, publicly available PD-L1 (CD274) related transcript sequence information can be referenced in public databases (such as NCBI RefSeq, etc.), where any mature mRNA sequence can serve as one of the reference templates for ribozyme design and target selection in this invention.

[0047] The following is an example of a mature mRNA sequence to illustrate the distribution characteristics of GU dinucleotide sites in transcripts:

[0048] SEQ ID NO.35

[0049] AUGAGGAUAUUUGCUGGCAUUAUAUUCACAGCCUGCU GU CACUUGCUACGGGC GU UUACUAUCACGGCUCCAAAGGACUU GU AC GU G GU GGA GUAUGGCAGCAAC GU CACGAUGGA GU GCAGAUUCCCU GU AGAACGGAGCUGGACCUGCUGC GU UA GU G GUGU ACUGGAAAAAAAAAAAAAAAAC GU GAUCA GU UU GU GGCAGGAGGGAGGACCUAAGCCCUCACACACACUCAAGGGGGAGAGCCUCGCUGCAAAGCCAGCCAGCACACACACAGAAC GU CAAGCUGCAGGACGCAGGC GU UUACUGCUGCAAUCAGCUACG GU G GU GCGGAACCAGCGAAUCACGCUAAA GU CAAUGCCCAUACCGCAAAAUCAACCAGAGAAUUUC GU GGAUCCAGCACUUCAUAUAU GU CAGGCCGAGG GU UAUCCAGCUGG GU AAUCUGGACAAACA GU GACCACACCC GU GA GU GGGAGAGAAA GUGU CACCUCCCGGACAGGGGAUCCAU GU GACCAGCA GU BROTHERS GU CAACGCCACAGCGAAUGAU GU UUCUACU GU AC GU UUUGGAGAUCAGCCAGGGCAAAACCACAGCGGAUCCAUCCAGACUGCCUGCCACAUCCUCCAGACAGGACUCACUGG GU HOLDING RUBBER GU U GU LITTLE GU A GUGU CCACG GU CCUCCUCUUCUUGAGAAAACAA GU GAGAAUGCUAGAU GU GGAGAAAU GU GGC GU UGAAGAUACAAGCUCAAAAAACCGAAAUGAUACACAAUUCGAGGAGAC GU AA

[0050] Example 1: Construction and Universality Verification of Engineered Pistol Ribozyme Targeting Multiple Sites of PD-L1 Transcripts

[0051] 1.1 Ribozyme Structure and Engineering Design Principles

[0052] Pistol ribozymes consist of a pseudoknot structure and three stem regions (Stem P1, P2, and P3), with the pseudoknot structure embedded within the three stem regions in its overall conformation. The site at which this type of ribozyme specifically recognizes and cleaves is located at the GU dinucleotide linker connecting P2 and P3.

[0053] In the engineered design of this invention, the substrate-binding region of the ribozyme mainly corresponds to the P2 and P3 stem regions, which can bind to RNA substrates through base complementary pairing; the substrate-binding region can vary according to different substrate sequences, thereby enabling specific cleavage of different target transcripts (see...). Picture 1 (Illustration)

[0054] To obtain candidate ribozymes with catalytic cleavage activity against PD-L1 transcripts, this embodiment uses the above structure as a basis to engineer the region at the P3 end that pairs with the substrate, so that the length of the region that pairs with the substrate varies within a certain range (e.g., 5–35 nt), thereby constructing a set of candidate ribozymes that target PD-L1 transcripts.

[0055] 1.2 Construction and Sequence Source of Candidate Ribozymes

[0056] Representative ribozyme sequences designed for different GU sites on the PD-L1 transcript include: PS38 (SEQ ID NO.1), PS81 (SEQ ID NO.2), PS130 (SEQ ID NO.3), PS198 (SEQ ID NO.4), PS359 series (SEQ ID NO.5–9), PS388 (SEQ ID NO.10), PS427 series (SEQ ID NO.11–15), PS473 series (SEQ ID NO.16–24), PS538 (SEQ ID NO.25), PS592 series (SEQ ID NO.26–30), PS623 (SEQ ID NO.31), PS721 (SEQ ID NO.32), PS766 (SEQ ID NO.33), and PS815 (SEQ ID NO.34). All of these sequences are core sequences without terminal extensions or chemical modifications. Their specific sequences are shown in the table below and the sequence listing.

[0057] 1.3 Standardized Numbering Table of Representative Ribozyme Sequences

[0058]

[0059] Note: The above sequence is the core sequence without terminal extension and chemical modification; any terminal engineering or chemical modification made without significantly reducing the targeted cleavage activity is within the scope of protection of this invention.

[0060] 1.4 Target Selection and Universality Validation Strategy

[0061] Based on the sequence and structural characteristics of PD-L1 transcripts, a systematic screening was conducted for potential cleavage sites containing GU dinucleotides, taking into account the following factors:

[0062] (1) The site is located in a relatively open structural region;

[0063] (2) The upstream and downstream sequences of the site are conducive to the formation of a stable ribozyme-substrate complementary structure;

[0064] (3) Avoid forming significant complementarity with highly homologous non-target sequences in the transcriptome.

[0065] Based on this, 14 representative GU sites were identified as universal validation targets.

[0066] 1.5 A unified framework for ribozyme design: For each of the above-mentioned GU sites, a set of engineered Pistol ribozymes were constructed, and their design followed a unified principle:

[0067] The catalytic framework consisting of P1, P2, P3 and pseudojunction regions is retained;

[0068] Catalysis-related conserved bases such as G5, A19, A20, A21, A32, G40, C41, and G42 remain unchanged in each sequence;

[0069] The substrate recognition region was adjusted accordingly based on the differences in upstream and downstream sequences at different GU sites;

[0070] Except for the substrate recognition region, other non-conservative sites are allowed to use any A, U, C or G.

[0071] 1.6 Overview of Multisite Functional Validation Results

[0072] Functional assessments at both in vitro and cellular levels showed that the engineered ribozymes exhibited stable targeting and cleavage of PD-L1 transcripts at their respective GU sites, and demonstrated consistent PD-L1 expression inhibition at the cellular level.

[0073] This result indicates that:

[0074] The technical solution of this invention is not limited to a single sequence or a single site;

[0075] While keeping the catalytic framework and conserved sites unchanged, effective regulation of multiple sites of the PD-L1 transcript can be achieved by adjusting the substrate recognition region.

[0076] 1.7 Supporting Explanation of the Functional Limitations of the Claims

[0077] Based on systematic validation at 14 different GU sites, it can be confirmed that the engineered Pistol ribozyme described in this invention, while maintaining a unified catalytic framework and conserved bases, can achieve stable cleavage of multiple sites on the PD-L1 transcript through the variable design of the substrate recognition region.

[0078] Therefore, the limitations in the claims regarding "functionally equivalent variants", "chemical modifications without significantly reducing the target cleavage activity", and "permissible end extensions or deletions within a certain range" are all based on the above-mentioned multi-site verification results and are reasonable technical extensions that can be implemented by those skilled in the art after reading this specification and obtain the same technical effects.

[0079] Example 2: In vitro construction and standardized preparation method of PD-L1 transcription substrates

[0080] Using a plasmid containing the PD-L1 gene sequence as a template, a DNA template fragment with the T7 promoter recognition sequence was obtained by PCR amplification. An example PCR reaction system is shown below:

[0081] Forward primer (5′ end with T7 recognition sequence, 100 µM): 1 µL

[0082] Reverse primer (100 µM): 1 µL

[0083] Plasmid template: 1 µL

[0084] 10× Taq buffer: 5 µL

[0085] dNTPs (10 mM): 5 µL

[0086] Pfu enzyme: 0.5 µL

[0087] Ultrapure water: 36.5 µL

[0088] Total volume: 50 µL

[0089] PCR conditions:

[0090] Preheat at 95 °C for 3 min; then 25 cycles: denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 2 min; and final extension at 72 °C for 15 min.

[0091] After obtaining the PD-L1 DNA template, the PD-L1 CDS region mRNA substrate (such as...) was prepared according to the in vitro transcription method described in Example 1. Picture 3 (As shown).

[0092] Example 3: In vitro targeted enzyme digestion screening and optimization of PD-L1 transcripts by engineered Pistol ribozyme

[0093] Catalytically active candidate engineered Pistol ribozymes were incubated with PD-L1 mRNA substrates in a reaction system near physiological conditions to evaluate their in vitro cleavage activity. Example reaction conditions included a reaction system pH of approximately 7.0, Mg²⁺ concentrations of 10 mM and 1 mM, and reaction at 37 °C for 3 h. After the reaction, the products were analyzed by denaturing polyacrylamide gel electrophoresis to detect the cleavage of PD-L1 mRNA.

[0094] The results showed that ( Picture 4 Under near-physiological ionic strength and neutral pH conditions, multiple engineered ribozymes exhibited stable cleavage activity against PD-L1 mRNA. Among them, PS359-10, PS427-10, PS473-10, and PS592-10 showed more significant substrate cleavage efficiency under the same experimental conditions, and were therefore selected as preferred candidate ribozymes for subsequent cellular-level validation and structural optimization.

[0095] Example 4: Validation of engineered Pistol ribozyme for targeted knockdown of PD-L1 mRNA in tumor cells

[0096] Preferred candidate ribozymes were transfected into tumor cell lines with high PD-L1 expression (e.g., B16F10 and 4T1), and total RNA was extracted after 2 h of treatment. The PD-L1 mRNA level was detected by reverse transcription and qPCR.

[0097] like Picture 5 As shown in A and B, the PS473 series ribozymes achieved significant targeted knockdown of PD-L1 mRNA in B16F10 and 4T1 cells within 2 hours, with a knockdown rate exceeding 60%. Therefore, the PS473 series ribozymes were selected for further optimization and validation.

[0098] Example 5: Optimization of Pistol Ribozyme Activity and Structure-Function Analysis Based on 3′ End Engineering

[0099] The structure of the ribozyme and the length of its substrate-binding region have a significant impact on the cleavage efficiency. To further improve the cleavage activity targeting PD-L1, this embodiment engineered and optimized the 3′ end of the ribozyme (the region that pairs with the substrate), constructed variant sequences of different lengths / configurations, and screened their activities.

[0100] The variants obtained in the examples include: PS473-7 (SEQ ID NO.16), PS473-10 (SEQ ID NO.17), PS473-13 (SEQ ID NO.18), PS473-14 (SEQ ID NO.19), PS473-15 (SEQ ID NO.20), PS473-16 (SEQ ID NO.21), PS473-17 (SEQ ID NO.22), PS473-18 (SEQ ID NO.23), and PS473-19 (SEQ ID NO.24);

[0101] The above variants can be obtained by in vitro transcription as described in Example 1 (e.g. Picture 6 As shown), and screened according to the in vitro enzyme digestion system described in Example 3 (e.g. Picture 7 (As shown). The results showed that different 3′ optimized variants had different in vitro cleavage efficiencies, and further optimization could yield candidate ribozymes with higher activity.

[0102] Example 6: Dose-response relationship of engineered Pistol ribozyme and verification of PD-L1 protein inhibition

[0103] 6.1 Cellular-level mRNA knockdown efficiency and dose response

[0104] Candidate ribozymes with different 3′ end lengths were transfected into B16F10 cells. After 2 h of treatment, total RNA was extracted and subjected to reverse transcription and qPCR detection.

[0105] like Picture 8 As shown in Figure A, the extended and optimized PS473-16 (also referred to as PS473) showed higher knockdown efficiency in B16F10 cells, achieving a PD-L1 mRNA knockdown rate of approximately 80% within 2 hours. Therefore, PS473-16 was selected for subsequent drug concentration experiments.

[0106] Furthermore, PS473-16 was transfected into B16F10 cells at different concentrations (e.g., 400 nM, 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM), and qPCR was performed after 2 h of treatment. The results showed that this ribozyme has a clear dose-dependent inhibitory effect, and the corresponding IC50 values ​​can be obtained. 50 (like Picture 8 As shown in B).

[0107] 6.2 Protein level inhibition verification (Western blot)

[0108] PS473-16 was transfected into B16F10 cells at different concentrations. After 24 h of treatment, protein was extracted and PD-L1 protein expression was detected by Western blot. The results showed that PD-L1 protein expression was significantly reduced at higher concentrations, and there were certain differences in inhibition among different concentration groups (e.g., ...). Picture 9 (As shown in A and B).

[0109] In summary, engineered Pistol ribozymes can achieve highly efficient targeted cleavage of PD-L1 mRNA within cells and further reduce PD-L1 protein expression, providing an feasible post-transcriptional intervention strategy for relieving immunosuppression.

[0110] Example 7: In vivo functional realization and immunomodulatory effect verification of engineered Pistol ribozyme under different delivery systems

[0111] 7.1 Implementation Objectives

[0112] This study aims to verify the deliverability and functional feasibility of the engineered Pistol ribozyme described in this invention in vivo, and to compare the effects of different delivery systems on its anti-tumor immune effects, thereby providing a basis for its application as a candidate nucleic acid drug for immunotherapy.

[0113] 7.2 Delivery System Design and Experimental Grouping

[0114] To systematically evaluate the in vivo application effects of engineered ribozymes on different delivery platforms, the following treatment and control systems were set up in this embodiment:

[0115] (1) Engineered Pistol ribozyme treatment group;

[0116] (2) Engineered Pistol ribozyme + manganese-containing delivery system treatment group, in which manganese-containing metal-organic framework material (Mn-MOF) is used for ribozyme loading, while the immune activation and adjuvant effect of Mn element is used to enhance tumor immunogenicity;

[0117] (3) Engineered Pistol ribozyme + cationic particles (CPs) treatment group, wherein the CPs are used to improve the stability of the ribozyme in the in vivo environment and the cellular uptake efficiency.

[0118] 7.3 Principles for Building a Delivery System

[0119] The design of the delivery system follows these principles:

[0120] 1) Stable encapsulation of ribozyme molecules under physiological conditions, reducing the risk of nuclease degradation in body fluids;

[0121] 2) Promotes ribozyme release in the tumor-associated microenvironment;

[0122] 3) Improve the relative enrichment efficiency of ribozymes in tumor tissues;

[0123] 4) Try to avoid adverse effects on the core structure of ribozyme catalysis and substrate recognition region.

[0124] 7.4 Explanation of the Logic of Joint Regulation

[0125] Engineered Pistol ribozymes reduce the expression of endogenous PD-L1 in tumor cells at the posttranscriptional regulatory level.

[0126] Different delivery systems enhance the efficacy of ribozymes in the in vivo environment from the dimensions of immune activation (Mn-MOF) or nucleic acid delivery efficiency (CPs), respectively.

[0127] This leads to a combined treatment model of "nucleic acid regulation + delivery enhancement / immune regulation".

[0128] 7.5 Overview of In Vivo Functional Validation

[0129] After administering the above different treatment systems to a tumor model with high PD-L1 expression in vivo, molecular and cellular level analyses revealed the following:

[0130] (1) Compared with the ribozyme-only treatment group, both the ribozyme-Mn-MOF complex system and the ribozyme-CPs delivery system were able to achieve more stable PD-L1 mRNA and protein inhibition effects in tumor tissues (e.g., Picture 10 (as shown in Figure 11).

[0131] (2) In the ribozyme-Mn-MOF treatment group, in addition to the downregulation of PD-L1 expression, the activation level of immune cells in the tumor microenvironment was further increased (e.g. Picture 12 As shown in the figure, this suggests that the immune adjuvant effect of Mn-MOF can be superimposed on the posttranscriptional regulatory effect of ribozymes.

[0132] (3) In the ribozyme-CPs treatment group, the effective delivery efficiency of ribozymes in tumor tissues was significantly improved, thereby enhancing their sustained inhibitory ability on PD-L1 expression.

[0133] 7.6 Summary of Implementation Results

[0134] This embodiment shows that:

[0135] Engineered Pistol ribozymes, with the assistance of different delivery systems, can stably exert their targeted degradation function on PD-L1 transcripts in the in vivo environment;

[0136] Manganese-containing delivery systems can further enhance the overall anti-tumor immune effect through immune activation mechanisms;

[0137] Cationic delivery carriers (CPs) offer another feasible pathway for their in vivo application by improving the delivery efficiency of ribozymes.

[0138] The above results fully demonstrate the feasibility and application potential of the engineered Pistol ribozyme described in this invention in the field of tumor immunotherapy.

Claims

1. A ribozyme for targeting and inhibiting PD-L1 gene expression, characterized in that: The ribozyme is an RNA molecule formed by linking ribonucleotide monomers, comprising: (1) A conserved structural framework for maintaining catalytic activity, the framework comprising a P1 region, a P2 region, a P3 region and a pseudo-node region, wherein G5, A19, A20, A21, A32, G40, C41 and G42 are catalysis-related conserved bases; (2) A substrate recognition region for complementary binding to PD-L1 gene transcripts, wherein the substrate recognition region is capable of recognizing and cleaving a target site containing GU dinucleotides in the PD-L1 gene transcript, thereby achieving specific cleavage of the PD-L1 gene transcript; wherein the PD-L1 gene transcript includes mature mRNA, precursor mRNA, and any transcript form containing exons and / or introns derived from the PD-L1 gene; and the substrate recognition region is 5–35 nucleotides in length, and its complementarity with the upstream and downstream sequences of the target GU site is 70%–100%, and its base composition is allowed to change while maintaining at least one of the following technical effects: (a) It exhibits detectable cleavage activity against PD-L1 gene transcripts in an in vitro system; (b) It can reduce PD-L1 protein expression by at least 30% at the cellular level.

2. The ribozyme according to claim 1, characterized in that: The ribozyme includes any sequence in SEQ ID NO.1–34 and its functionally equivalent variants, wherein the functionally equivalent variants refer to variants obtained by base substitution, insertion or deletion while maintaining the ability to target and cleave PD-L1 gene transcripts.

3. The ribozyme according to claim 1 or 2, characterized in that: The nucleotide units constituting the ribozyme are selected from natural nucleotides A, U, C, G or their derivatives thereof without significantly reducing their targeted cleavage activity against the PD-L1 gene transcript. The derivatives include, but are not limited to, 2′-O-methyl nucleotides, 2′-fluoronucleotides, pseudouracil, phosphate thioester modified nucleotides, methoxyethyl modified nucleotides, locked nucleic acids or any combination thereof.

4. The ribozyme according to any one of claims 1–3, characterized in that: The ribozyme is permitted to have an extension or deletion of 0–35 nucleotides at the 5′ and / or 3′ ends, and / or be linked with a functional tag, provided that such variation does not significantly reduce its targeted cleavage activity against the PD-L1 gene transcript.

5. A method for preparing the ribozyme according to any one of claims 1–4, characterized in that: The ribozyme is prepared by in vitro transcription or chemical synthesis.

6. The use of the ribozyme according to any one of claims 1–4 in any of the following applications: (a) Targeted inhibition of PD-L1 gene transcript expression; (b) Reduce the expression level of PD-L1 protein in tumor cells; (c) Preparation of antitumor drugs for relieving PD-1 / PD-L1-mediated immunosuppression.

7. The use according to claim 6, characterized in that: The ribozyme is used in combination with at least one anti-tumor immunotherapy, including PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, CAR-T or TCR-T cell therapy, tumor vaccines or oncolytic viruses, and the anti-tumor effect produced by the combination therapy is higher than the sum of the effects of each single therapy.

8. The use according to claim 6 or 7, characterized in that: The ribozyme enters tumor cells via any of the following delivery systems: lipid nanoparticles, polymeric nanocarriers, tumor-targeting aptamer-nucleic acid complexes, exosomes, viruses, or virus-like vectors.

9. An antitumor pharmaceutical composition comprising the ribozyme according to any one of claims 1–4, and a pharmaceutically acceptable carrier or excipient.