A LAMP primer-probe composition and kit for differentiating between MS-H strain and wild-type strain of Mycoplasma synoviae in chickens.

By designing specific LAMP primer-probe compositions and RNase H2-mediated blocking probe technology, the problem of differentiating between MS-H strain and wild-type Mycoplasma synoviae strain in chickens has been solved. This enables efficient and accurate single-base differential identification under isothermal amplification conditions, which is suitable for detection and purification in chicken flocks.

CN122303461APending Publication Date: 2026-06-30SHANDONG SINDER TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610686156.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-19
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies make it difficult to reliably identify single SNP differences between the MS-H strain and the wild-type strain of Mycoplasma synoviae under isothermal amplification conditions, leading to difficulties in identification, false positives or missed diagnoses, and affecting vaccine use and poultry flock eradication.

Method used

We designed specific LAMP primer-probe compositions, combined with RNase H2-mediated blocking probe technology and enhancers, improved probe thermal stability through MGB and LNA modification, suppressed non-specific amplification, and achieved single-base differential recognition through RNase H2-mediated blocking probe specific activation technology.

Benefits of technology

The test can be completed within 40 minutes at 62°C, with a detection limit of 1 copy/µL. It is suitable for on-site screening in breeder farms and hatcheries, improving the accuracy and sensitivity of identification and reducing the risk of false positives and missed diagnoses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303461A_ABST
    Figure CN122303461A_ABST
Patent Text Reader

Abstract

This invention relates to the field of identification technology for Mycoplasma synoviae MS-H strain and wild-type strain, specifically a LAMP primer-probe composition and kit for identifying Mycoplasma synoviae MS-H strain and wild-type strain. It includes an upstream outer primer with the nucleotide sequence shown in SEQ NO:1, a downstream outer primer with the nucleotide sequence shown in SEQ NO:2, an upstream inner primer with the nucleotide sequence shown in SEQ NO:3, a downstream inner primer with the nucleotide sequence shown in SEQ NO:4, an MS-H strain probe with the nucleotide sequence shown in SEQ NO:5, and an MS wild-type strain probe with the nucleotide sequence shown in SEQ NO:6. This invention uses MGB to enhance the thermostability of the probe and combines RNase H2-mediated blocking probe specific activation technology with an enhancer to improve the specificity of the reaction system, enabling LAMP to recognize single-base differences at isothermal conditions, with a detection limit reaching 1 copy / µL.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of identification technology of Mycoplasma synoviae MS-H strain and wild-type strain, specifically to a LAMP primer-probe composition and kit for identifying Mycoplasma synoviae MS-H strain and wild-type strain. Background Technology

[0002] Mycoplasma synoviae (MS) is a major pathogen causing chronic respiratory disease and synovitis in poultry. It is widespread in commercial laying hens and breeder flocks globally, leading to air sacculitis, synovitis, decreased egg production, and reduced hatching egg quality, resulting in significant economic losses to the poultry industry. MS is characterized by the lack of a cell wall, a highly simplified genome, high susceptibility to mutation, and immune evasion. In particular, its highly variable surface antigens, such as the variable lipoprotein hemagglutinin (vlhA), result in significant differences in virulence, tissue tropism, and immunological characteristics among different strains.

[0003] In recent years, with the increase in intensive poultry production, the infection rate of MS has been on the rise, and it is often mixed with pathogens such as Mycoplasma gallisepticum (MG) and Escherichia coli, exacerbating clinical symptoms and losses. MS infection is insidious and often leads to immunosuppression, affecting the effectiveness of vaccines. Therefore, all countries have included MS monitoring and eradication as an important part of their poultry breeding systems.

[0004] To control MS infection, the internationally widely used MS-H vaccine strain (a horizontally passaged attenuated strain of *M. synoviae*) has been proven effective in reducing clinical symptoms and production losses in chicken flocks, and has therefore been approved for use in several countries. In my country, the MS-H vaccine is also used in some regions and by some companies. However, the MS-H vaccine is a live vaccine strain, which can spread and colonize in chicken flocks to a limited extent. Its genetic background is highly similar to that of wild-type strains, with differences often limited to minor variations such as single nucleotide polymorphisms (SNPs).

[0005] In practical applications, due to the high homology and genetic similarity between the MS-H vaccine strain and the wild-type strain, differentiation between the two is difficult. Failure to accurately identify them can easily lead to various detection and control problems. 1. In disease-free farms and poultry purification areas, once MS positivity is detected, it is crucial to quickly distinguish whether the positive source is vaccine strain residue or wild-type virus infection. If accurate identification cannot be achieved, the vaccine strain may be misidentified as wild-type virus, leading to unnecessary poultry culling, farm lockdown, and excessive disinfection. Conversely, if wild-type virus infection is misidentified as vaccine interference, missed diagnoses may occur, causing disease spread and ultimately resulting in the failure of poultry purification efforts.

[0006] 2. MS-H is a live vaccine strain that can be detected after the flock has been colonized for a certain period of time. Without accurate identification, it is impossible to determine whether immunization has been successful, whether wild-type virus breakthrough infection has occurred in the flock, or to monitor the spread and clearance patterns of the vaccine in the flock at different time points.

[0007] 3. During testing by vaccine manufacturers, breeding farms, hatcheries, or regulatory authorities, it is impossible to confirm whether the detected MS is from the vaccine or from an exogenous wild virus, thus making it impossible to ensure the safety and compliant use of the vaccine.

[0008] Currently, the methods used to distinguish between MS-H and wild-type strains mainly include the following categories, but all of them have obvious drawbacks: 1. Sequencing (Sanger or next-generation sequencing): It can distinguish SNPs, but it is costly and time-consuming (1-3 days), not friendly to on-site testing, and depends on expensive instruments and professional personnel. It cannot be used as a routine rapid monitoring method.

[0009] 2. Conventional PCR / Real-time Fluorescent PCR: Due to the high homology between MS-H and wild-type strains (difference of only 1–several SNPs), conventional PCR primers and TaqMan probes are difficult to completely distinguish single bases; Taq enzyme has a high tolerance for 3' end mismatches, often resulting in false positives or cross-amplification; if ARMS-PCR (allelic-specific PCR) is used, specificity is improved but sensitivity is reduced, it is highly dependent on template amount, and it is easy to generate non-specific bands; in actual clinical samples (complex background, low viral load), recognition performance is significantly reduced.

[0010] 3. RFLP enzyme digestion identification method: depends on whether the SNP changes the restriction site; however, MS-H and wild-type SNPs mostly do not have enzyme digestion site characteristics; it has many steps, a long cycle, and limited applicability.

[0011] LAMP (loop-mediated isothermal amplification) has the advantages of being rapid, sensitive, and easy to use in the field, but its primer redundancy, high mismatch tolerance, and high risk of nonspecific amplification make it difficult to distinguish single-base differences; the loop region and FIP / BIP are not sensitive to single-base mismatches, often resulting in false positives in wild-type samples; dye (SYBR / HNB) type interpretation cannot avoid false positives caused by nonspecific amplification. Currently, there is no mature LAMP method specifically for MS typing.

[0012] Therefore, how to reliably identify a single SNP under isothermal amplification conditions and achieve rapid and accurate identification between MS-H and wild-type strains is an urgent problem to be solved. Summary of the Invention

[0013] The technical problem to be solved by the present invention is to overcome the existing defects and provide a LAMP primer-probe composition and kit for identifying Mycoplasma synoviae MS-H strain and wild-type strain.

[0014] To achieve the above objectives, the present invention provides the following technical solution: a LAMP primer-probe composition for identifying the MS-H strain of Mycoplasma synoviae and the wild-type strain. It includes an upstream outer primer with a nucleotide sequence as shown in SEQ NO:1, a downstream outer primer with a nucleotide sequence as shown in SEQ NO:2, an upstream inner primer with a nucleotide sequence as shown in SEQ NO:3, a downstream inner primer with a nucleotide sequence as shown in SEQ NO:4, an MS-H strain probe with a nucleotide sequence as shown in SEQ NO:5, and an MS wild-type strain probe with a nucleotide sequence as shown in SEQ NO:6.

[0015] Furthermore, the 5' end of SEQ NO:5 is modified with FAM, and the 3' end is modified with a 3-carbon chain blocking group and MGB.

[0016] Furthermore, the 4th and 11th bases at the 5' end of SEQ NO:5 are modified with locked nucleic acid.

[0017] Furthermore, the 14th base at the 5' end of SEQ NO:5 is a ribonucleotide base.

[0018] Furthermore, the 5' end of SEQ NO:6 is modified with VIC, and the 3' end is modified with a 3-carbon chain blocking group and MGB.

[0019] Furthermore, the 7th, 10th, and 13th bases at the 5' end of SEQ NO:6 are modified with locked nucleic acid.

[0020] Furthermore, the 16th base at the 5' end of SEQ NO:6 is a ribonucleotide base.

[0021] A kit for differentiating between MS-H strain and wild-type Mycoplasma synoviae strain includes the primer-probe composition described above, with a final probe concentration of 0.2–0.8 µM, a final concentration of 0.2 µM for the upstream and downstream outer primers, and a final concentration of 1.2–1.6 µM for the upstream and downstream inner primers.

[0022] Furthermore, it also includes an enhancer, which is a trehalose solution with a final concentration of 0.2–0.5 M, a formamide solution with a volume fraction of 1–6%, and an L-proline solution with a final concentration of 0.1–0.5 M.

[0023] Furthermore, it also includes RNase H2, Bst DNase, buffer, MgSO4, dNTPs, positive control, and negative control. The final concentration of Bst DNase was 0.16–0.32 U / µL, the final concentration of dNTPs was 0.1–1.6 mM, the final concentration of MgSO4 was 4–8 mM, and the final concentration of RNase H2 was 0.01–0.04 U / µL.

[0024] Compared with the prior art, the beneficial effects of the present invention are: This invention innovatively employs MGB to enhance probe thermal stability, and combines RNase H2-mediated blocking of probe-specific activation technology with enhancers to improve the specificity of the reaction system and inhibit non-specific probe binding. This enables LAMP to reliably identify single-base differences at isothermal conditions, and detection can be completed at 62°C for 40 minutes. It does not require a PCR instrument or sequencing platform, and the detection limit can reach 1 copy / µL. It is suitable for on-site screening in breeder farms and hatcheries, as well as for evaluating the effectiveness of vaccine immunization. Attached Figure Description

[0025] Figure 1 This is a diagram of single nucleotide mutation sites in the gap gene of this invention; Figure 2 This is a schematic diagram of the LAMP primers and probes of this invention; Figure 3 Amplification curves of positive samples used to verify the effectiveness of primers in this invention; Figure 4 Amplification curves of specific control samples used to verify the effectiveness of primers in this invention; Figure 5 The amplification curves of MS-H strain samples from the experimental group used to verify the probe effectiveness of this invention; Figure 6 The amplification curves of MS wild-type virus samples from the experimental group used to verify the probe effect of this invention; Figure 7 The amplification curves of mixed-infected virus strain samples in the experimental group for verifying the probe effect of this invention; Figure 8 The amplification curves of the MS-H strain samples in the control group were used to verify the probe effect of this invention. Figure 9 The amplification curves of MS wild-type virus samples were used to verify the probe effect of this invention. Figure 10The amplification curves of the mixed strain samples in the control group were used to verify the probe effect of this invention. Figure 11 The amplification curves of the MS-H strain samples in the control group were optimized for the reaction system of this invention; Figure 12 The amplification curves of MS wild-type virus samples were used to optimize the reaction system of this invention. Figure 13 The amplification curves of the mixed strain samples of the control group were optimized for the reaction system of this invention; Figure 14 The amplification curves of MS-H strain samples from the optimized reaction system group of this invention are shown. Figure 15 The amplification curves of MS wild-type virus samples from the optimized reaction system group of this invention are shown. Figure 16 The amplification curves of the mixed strain samples from the optimized reaction system group of this invention are shown. Figure 17 This is a specific sample amplification curve for the optimized reaction system of this invention; Figure 18 The amplification curve of MS-H strain sample at 60℃ is obtained for temperature gradient detection in this invention. Figure 19 This invention provides a temperature gradient detection method for the amplification curve of MS wild-type virus samples at 60℃. Figure 20 The amplification curve of MS-H strain sample at 62℃ is obtained for temperature gradient detection in this invention. Figure 21 This invention provides a temperature gradient detection method for the amplification curve of MS wild-type virus samples at 62℃. Figure 22 The amplification curve of MS-H strain sample at 64℃ is obtained for temperature gradient detection in this invention. Figure 23 This invention provides a temperature gradient detection method for detecting the amplification curve of MS wild-type virus samples at 64℃. Figure 24 The amplification curve of the MS-H strain for sensitivity detection in this invention is shown. Figure 25 The amplification curve of the MS wild-type virus strain is shown for sensitivity detection in this invention. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] A LAMP primer-probe composition for differentiating between MS-H strain and wild-type Mycoplasma synoviae strain. Including the upstream outer primer with the nucleotide sequence shown in SEQ NO:1: TCCTACTGTGGTTTATAACGTAA, The downstream outer primer with the nucleotide sequence shown in SEQ NO:2 is: AGGAACTACAAGGCCAATT. The upstream inner primer with the nucleotide sequence shown in SEQ NO:3 is: CGCAAGGCAGTTTGTAGTACATGAAAACTCTAAAAAGTAGTGATACCG. The downstream inner primer with the nucleotide sequence shown in SEQ NO:4 is: ACATAAAGATTTAAGAAGAGCGCGTCTTTTGCAGCTCCAGTTG. The nucleotide sequence of the MS-H strain probe, as shown in SEQ NO:5, is: FAM-TCAcTCATATaCT(rG)TTGATC- / 3SpC3 / -MGB. The nucleotide sequence of the MS wild-type probe is shown in SEQ NO:6: VIC-TTCACTcATaTAcTG(rC)TGAT- / 3SpC3 / -MGB.

[0028] In sequences SEQ NO:5 and SEQ NO:6, lowercase letters represent LNA locked nucleic acid modified bases, parentheses represent ribonucleotide bases, and / 3SpC3 / represents a 3-carbon chain blocking group.

[0029] The primer and probe design principle of this invention is as follows: This invention utilizes whole-genome sequence alignment of multiple strains (MS-H strain CP021129.1, MS wild-type strains CP082194.1, CP163305.1, LS991953.1, CP011096.1, CP069379.1, CP107525.1, AE017245.1, CP163307.1, CP082195.1, CP083748.1, etc.) to systematically screen for stable differentially expressed sites between vaccine strains and wild-type strains. A total of 32 nucleotide differentially expressed (SNP) sites were identified in the alignment results. Several highly conserved, specific SNP sites suitable as molecular targets for genotyping were further located and confirmed within the gap gene and other candidate gene regions. Figure 1 This diagram shows the single nucleotide mutation sites in the gap gene. The MS-H strain of the gap gene exhibits a single nucleotide mutation C→T at position 242477. Primers and probes were designed based on this SNP site.

[0030] 1. LAMP primer design After determining the genotyping SNP sites, two sets of primers specific to MS-H were designed based on the primer structure requirements for LAMP amplification (F3, F2, F1, B1c, B2c, and B3). To match the system requirements of the RNase H2-dependent probe method used in this invention, the probe binding region was limited to the segment between F1 and B1c on the linear template (corresponding to the F1c–B1 region of the LAMP stem-loop structure). This region has the following advantages: The probe can rapidly occupy the target site in the early stages after primer opening, avoiding the influence of competitive secondary structures and improving probe hybridization efficiency; this segment has moderate stability, suitable for RNase H2 to recognize and cleave single ribonucleotides (rNMPs); the intermediate spatial structure formed by the amplification of the F1c–B1 segment is more conducive to probe annealing and refolding, which helps to improve the cleavage reaction efficiency, thereby improving the signal-to-noise ratio of the amplification curve; this region avoids the key segment for the formation of interference loop structures, reducing non-specific background signals.

[0031] 2. Probe Design (1) Ribonucleotide substitution At the SNP position recognized by the probe, the corresponding deoxyribonucleotide (dNMP) is replaced with a ribonucleotide (rNMP). RNase H2 only produces specific cleavage when the rNMP is perfectly complementary to the target sequence, thereby releasing the probe 3′-OH and forming an activated primer that can be extended by DNA polymerase; if there is a mismatch, the RNase H2 cleavage rate decreases significantly, thus effectively inhibiting erroneous amplification.

[0032] To achieve optimal recognition efficiency for RNase H2, the probe of this invention retains at least four adjacent deoxyribonucleotide bases at its 3′ end to ensure that the cleaved 3′-OH has sufficient Tm and primer extension capability.

[0033] (2) MGB and LNA modification To further improve the thermodynamic resolution of the probe for single-base differences, the present invention may introduce the following modifications to the 3′ or internal structure of the probe: MGB (Minor Groove Binder): Improves the Tm of probe-target hybridization, enabling short probes to maintain high stability; LNA (Locked Nucleic Acid): Due to its structural immobility, the introduction of one LNA monomer can increase the Tm by 2–8°C, thereby ensuring that the probe Tm is higher than the effective annealing temperature of the LAMP primer (usually >60°C).

[0034] Such modifications significantly amplify the thermodynamic difference (ΔTm) between perfectly matched and mismatched sequences, providing a more stable basis for subsequent RNase H2 enzymatic recognition.

[0035] (3) Modification of the 3-carbon chain blocking group of the blocking structure The probe has a 3-carbon chain blocking group at its 3′ end to prevent uncut probe from being mistakenly extended. Only when RNase H2 cleaves the probe at the rNMP site and the 3-carbon chain blocking group is separated from the blocking fragment can the probe be truly converted into a functional primer.

[0036] Figure 2 This is a schematic diagram of LAMP primers and probes. The present invention utilizes rNMP-triggered cleavage, LNA and MGB to increase probe Tm, and a 3-carbon chain blocking group to block the extension of the uncut probe, thereby simultaneously enhancing the binding difference between perfectly paired and single-base mismatched probes.

[0037] A kit for differentiating between MS-H strain and wild-type Mycoplasma synoviae strain includes the primer and probe composition described above, as well as an enhancer, RNase H2, Bst DNase, buffer, MgSO4, dNTPs, a positive control, and a negative control. The enhancer is a trehalose solution, a formamide solution, and an L-proline solution.

[0038] The optimal reaction system (1×, 20µL / reaction) is shown in Table 1:

[0039] Nuclease-free water was used as a negative control; recombinant vectors were constructed using the amplified target sequences of MS-H vaccine strain and MS wild-type virus strain as templates as positive controls.

[0040] Amplification target sequence of MS-H vaccine strain such as SEQ NO:7 shows: aggtaaaaacactcttcttagcttttacaaaaataaatttataatcgcagaagatggcgttaaaaggtgggcctaaaaatctatacggagctaaaggaaaagataccatcgttaaagttccgcttggaacgctggtatacaaaaacaaaaaaatagttgccgatgt tattaaagaaaatcatctttatttagttgctaaaggcggaaaaggcagaagaggaaataataaatttaaaacctctaaaaacaccgctcctagaattgccgaaaatggaatgcccggagaaaaatacgaagctaatatcgtattaaaaattctttcagatgtaggtcttgtag Amplification target sequence of MS field strain such as SEQ NO:8 shows: aggtaaaaacactcttcttagcttttacaaaaataaatttataatcgcagaagatggcgttaaaggtgggcctaaaaatctatacggagctaaaggaaaagataccatcgttaaagttccgcttggaacgctggtatacaaaaacaaaaaaatagttgccgatgt tattaaagaaaatcatctttatttagttgctaaaggcggaaaaggcggaagaggaaataataaatttaaaacctctaaaaacaccgctcctagaattgccgaaaatggaatgcccggagaaaaatacgaagctaatatcgtattaaaaattctttcagatgtaggtcttgtag The trehalose in this application has dual functions of enzyme protection and nucleic acid destabilization: on the one hand, it can significantly improve the thermostability and catalytic activity of thermally unstable polymerases such as reverse transcriptase, Bst DNA polymerase, and Taq polymerase, helping enzyme molecules maintain their native conformation under high temperature or isothermal amplification conditions and avoid thermal inactivation; on the other hand, trehalose can weaken the thermodynamic stability of local secondary structures of DNA (such as hairpins and stem-loops), reduce the interference of nonspecific folding on the template, and promote the complete pairing of primers, probes, and target sequences, thereby improving amplification efficiency and the formation efficiency of probe-template complexes.

[0041] The formamide in this application weakens the thermodynamic stability of nucleic acid double strands through specific effects: its molecules can insert into the hydration layer between base pairs, disrupting the local hydrogen bond network and weakening base stacking forces, producing a uniform destabilizing effect on the double-stranded structure, causing the melting temperature of the DNA double strand to decrease nearly linearly. Compared with perfectly matched double strands, regions containing single-base mismatches have lower binding energies and weaker base stacking forces; therefore, in the presence of formamide, the stability of mismatch sites is preferentially and significantly weakened. Adding an appropriate amount of formamide to the isothermal amplification system can significantly improve the primer / probe's ability to identify single-base differences, enhance the discrimination of SNP sites, and ultimately improve the specificity and accuracy of genotyping detection.

[0042] The L-proline in this application combines enzyme structural stability with non-specific amplification inhibition: it can maintain the native conformation and correct folding of polymerase through interaction with the enzyme surface and regulation of the solvent environment, thereby improving the enzyme's thermal stability and catalytic specificity and reducing the generation of non-specific amplification products.

[0043] The trehalose in this application maintains the thermal stability of the polymerase and ensures high-temperature isothermal amplification activity; formamide effectively downregulates the Tm value of nucleic acids, enhancing the sensitivity to mismatched sequences; L-proline further stabilizes the enzyme's spatial conformation and inhibits non-specific molecular binding. The synergistic effect of these three components maintains optimal enzyme activity and ensures efficient amplification, while also amplifying the binding difference between the perfectly matched probe-template complex and the mismatched sequence from a kinetic perspective by lowering the overall melting temperature and weakening the local secondary structure of DNA. This optimizes the real-time amplification curve and simultaneously improves the sensitivity and specificity of detection.

[0044] Instructions for using a kit to distinguish between MS-H strain and wild-type Mycoplasma synoviae strain: 1. Nucleic acid extraction Nucleic acid extraction was performed using a commercially available nucleic acid extraction kit (DNA / RNA Extraction Kit, catalog number RM201-02, manufacturer: Nanjing Novizan Biotechnology Co., Ltd.).

[0045] 2. PCR amplification Calculate the number of samples to be tested, take n+2 PCR reaction tubes, and add 20µL of the reaction system from Table 1 to each tube; add 5µL each of the negative control, positive control, and extracted sample nucleic acid to the above PCR reaction tubes, and place them in a real-time PCR instrument or a constant-temperature fluorescence instrument. Table 2 shows the instrument amplification parameters.

[0046]

[0047] 3. Result Determination (1) Determination of reagent kit validity: 1) Weak positive control: Ct value of FAM and VIC channels ≤32, and the amplification curve shows an obvious exponential growth phase.

[0048] 2) Blank control: FAM and VIC channels have no amplification curve, or the amplification curve is a straight line or a slightly sloping line, with no obvious exponential growth period.

[0049] (2) The determination of the test results is shown in Table 3:

[0050] Note: Samples with an exponential growth curve and a Ct value ≤ 36 are considered "+", while those without an amplification curve are considered "-". Samples with a Ct value < 36 and < 40 are considered suspicious and require retesting for confirmation.

[0051] MGB-modified probes were designed for SNP sites and combined with RNase H2 differential cleavage to amplify single-base differences, ensuring that only correctly matched sequences trigger amplification, while incorrect sequences do not generate amplification. Single-base resolution between vaccine strains and wild-type strains is achieved under isothermal amplification conditions, improving detection accuracy. Through gradient optimization of reaction solution components, the detection limit can reach 1 copy / µL, making it suitable for detecting samples with low viral load. Detection can be completed in 40 minutes at an isothermal temperature of 62°C, without the need for thermal cyclers or sequencing equipment, and is compatible with portable isothermal fluorescence detectors or real-time quantitative PCR devices.

[0052] Experimental verification: 1. Primer efficacy verification The dye-based Bst III LAMP kit (model LP312 01, Beijing TransGen Biotech Co., Ltd.) and the four primers described in this application were used. MSH strain, MS wild-type strain, and two mixed strains were used as positive samples, and Mycoplasma gallisepticum, chicken infectious laryngotracheitis virus, chicken infectious anemia virus, and avian reovirus were used as specific control samples. Figure 3 Amplification curves of positive samples for primer effectiveness verification. Figure 4 The amplification curves of specific control samples were used to verify the effectiveness of the primers. The results showed that the primers could effectively detect positive samples of MSH strain, wild-type strain, and the two mixed strains, while there was no cross-amplification of the above specific control samples, and the detection results were negative, indicating that the designed LAMP primers have good amplification effectiveness and specificity.

[0053] 2. Probe effect verification Based on the four effective primers verified in Experiment 1 (Primer Effect Verification), an experiment was set up to evaluate the effects of MGB modification and LNA modification on genotyping detection.

[0054] (1) Experimental grouping and conditions The reaction system was amplified at a constant temperature of 62 ℃ for 40 min; the fluorescence channels were: FAM for the MS H strain and VIC for the MS wild-type strain.

[0055] 1) Experimental group: MS H strain probe: The nucleotide sequence shown in SEQ NO:5 is FAM-TCAcTCATATaCT(rG)TTGATC- / 3SpC3 / -MGB; MS wild-type virus probe: The nucleotide sequence shown in SEQ NO:6 is VIC-TTCACTcATaTAcTG(rC)TGAT- / 3SpC3 / -MGB; Reaction system: The reaction system after removing trehalose, formamide and L-proline as shown in Table 1; Templates: MS H strain, MS wild-type strain, and samples of two mixed strains.

[0056] 2) Control group: MS H strain probe: The nucleotide sequence shown in SEQ NO:5 is modified by removing LNA locked nucleic acid modification and MGB modification; MS wild-type virus probe: The nucleotide sequence shown in SEQ NO:6 is modified by removing LNA locked nucleic acid modification and MGB modification; Reaction system: The reaction system after removing trehalose, formamide and L-proline as shown in Table 1; Templates: MS H strain, MS wild-type strain, and samples of two mixed strains.

[0057] (2) Experimental results The results of the experimental group were from Figures 5-7 As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 5 The amplification curves of the MSH strain samples in the experimental group were used to verify the probe effect: the FAM channel showed a typical amplification curve with no crossover signal; Figure 6 To verify the probe's effectiveness, the MS wild-type strain samples in the experimental group showed a typical amplification curve in the VIC channel with no crossover signal. Figure 7 The amplification curves of the two mixed strains in the experimental group were used to verify the probe's effectiveness: both FAM and VIC were positive. Therefore, the experimental group's system can specifically distinguish between the MSH strain and the MS wild-type strain.

[0058] The results of the control group were obtained from Figures 8-10 As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 8 To verify the probe's effectiveness, the amplification curves of the control group MSH strain samples were used. Figure 9 The amplification curves of MS wild-type virus samples in the control group were used to verify the probe's effectiveness. Figure 10The amplification curves of the two mixed strains in the control group were used to verify the probe's effectiveness. As shown in the figure, after removing MGB and LNA modifications from the MSH and MS wild-type strain probes, weak cross-signals and non-specific amplification were observed, the genotyping boundaries were not clear, and misidentification was prone to occur at low concentrations. Therefore, MGB and LNA probe modification can improve the specificity of detection, but further optimization of the reaction system is needed.

[0059] 3. Optimization of the reaction system (1) Experimental conditions and grouping Detection conditions: LAMP isothermal amplification dual-probe fluorescence method, using the two probes from the experimental group in Experiment 2 (probe effect verification); reaction temperature: 62℃, reaction time: 40min; templates: MS-H strain, MS wild-type strain recombinant plasmid standard (synthesized by Sangon Biotech), mixed plasmid of MS-H strain and MS wild-type strain, specific sample nucleic acids (Mycoplasma gallisepticum, Infectious laryngotracheitis virus, Infectious anemia virus, Avian reovirus); Control group: The reaction system in Table 1 with trehalose, formamide and L-proline removed; Optimization group: The reaction systems in Table 1.

[0060] (2) Experimental results The results of the control group were obtained from Figures 11-13 As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 11 To optimize the reaction system, the amplification curve of the MS-H strain sample in the control group was optimized: the FAM channel showed a peak, but the VIC channel showed slight non-specific amplification, the genotyping boundary was blurred, and it was easy to misjudge as double positive at low concentrations. Figure 12 To optimize the reaction system, the amplification curves of the control group's MS wild-type virus samples were obtained: the VIC channel showed a peak, the FAM channel showed a non-specific signal, the signal-to-noise ratio was low, and the single-base resolution was poor. Figure 13 To optimize the reaction system, the amplification curves of the two mixed strains in the control group were optimized: both positive signals appeared, but the non-specific signal interference was strong, making it difficult to distinguish between true amplification and background noise.

[0061] The results of the optimization group are Figures 14-17 As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 14 The amplification curves of the MS-H strain samples in the optimized reaction system group showed that only the FAM channel exhibited a typical S-shaped amplification curve, while the VIC channel showed no non-specific signals and no cross-interference. Figure 15 The MS wild-type virus sample amplification curves of the optimized reaction system group showed that only the VIC channel had a clear amplification curve, the FAM channel had no background signal, and the typing results were accurate. Figure 16The amplification curves of the two mixed strains in the optimized reaction system were obtained: typical amplification curves were observed in both FAM and VIC channels, with no signal interference between them, and the plateau fluctuations were normal isothermal amplification noise. Figure 17 The specific sample amplification curves for the optimized reaction system were obtained: the detection results of specific control samples for Mycoplasma gallisepticum, Infectious Laryngotracheitis Virus (ILV), Infectious Anemia Virus (IAV), and Avian Reovirus were all negative.

[0062] Because the typing target of this application is a single nucleotide polymorphism (SNP) site, the specificity of the reaction system is extremely high. This invention effectively optimizes the reaction conditions by adding three PCR enhancers to the reaction system, significantly improving the specificity and anti-interference ability of the probe recognition. Experimental results show that the optimized system exhibits no non-specific amplification of MS-H strain and MS wild-type strain samples, and the detection results for specific control samples such as Mycoplasma gallisepticum and Infectious Laryngotracheitis Virus are all negative, demonstrating that this typing system has excellent specificity.

[0063] 4. Temperature gradient detection To optimize the LAMP isothermal amplification reaction temperature, three temperature gradients of 60℃, 62℃, and 64℃ were set for verification.

[0064] Experiment 1 (Primer Effectiveness Verification) was used to verify effective primers; Experiment 2 (Probe Effectiveness Verification) was used to verify the two probes in the experimental group; and Experiment 3 (Reaction System Optimization) was used to optimize the reaction system of the experimental group.

[0065] The experimental results at 60℃ were obtained from Figures 18-19 As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 18 Amplification curves of MS-H strain samples at 60℃ were obtained for temperature gradient detection: the FAM channel showed a peak, but the VIC channel showed slight non-specific amplification, which could easily be misjudged as double infection. Figure 19 The amplification curve of MS wild-type virus samples at 60℃ was obtained for temperature gradient detection: the VIC channel showed a peak, but the FAM channel also showed a slight peak, which could easily be misjudged as double infection.

[0066] The experimental results at 62℃ were obtained from Figures 20-21 As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 20 To detect the amplification curve of MS-H strain samples at 62℃ using a temperature gradient, Figure 21 The amplification curves of MS wild-type virus samples at 62℃ were obtained for temperature gradient detection. No non-specific amplification was observed in either sample, and both amplification efficiency and specificity were optimal.

[0067] The experimental results at 64℃ were obtained from Figures 22-23As shown in the figure, the green amplification curve represents the FAM channel, and the blue amplification curve represents the VIC channel. Figure 22 To detect the amplification curve of MS-H strain samples at 64℃ using a temperature gradient, Figure 23 The amplification curves of MS wild-type virus samples at 64℃ were detected using temperature gradient detection. Due to the excessively high temperature, the binding of some primers / probes was inhibited, the peak time was delayed, the amplification efficiency of low-concentration template decreased, and the signal intensity during the plateau phase weakened.

[0068] Therefore, 62℃ is the optimal reaction temperature for the LAMP typing system, balancing amplification efficiency and specificity.

[0069] 5. Sensitivity Testing The effective primers were verified in Experiment 1 (Primer Effectiveness Verification), the two probes in Experiment 2 (Probe Effectiveness Verification), and the reaction system of the optimized group in Experiment 3 (Reaction System Optimization) were used. The reaction temperature of the LAMP typing system was 62℃. MS-H strain and wild-type strain recombinant plasmid standards were serially diluted 10-fold to 1×10⁻⁶. 5 ~1×10 0 Copy / μL, used for sensitivity testing. Results are as follows: Figures 24-25 As shown, Figure 24 The amplification curves for the MS-H strain are shown in the sensitivity test. Figure 25 The amplification curves for the MS wild-type strain are shown for sensitivity detection. The detection limits for both the MS-H strain and the wild-type strain are 1×10⁻⁶. 0 It exhibits good sensitivity at 1 copy / μL.

[0070] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A LAMP primer-probe composition for identifying the MS-H strain of Mycoplasma synoviae from wild-type strains, characterized in that: It includes an upstream outer primer with a nucleotide sequence as shown in SEQ NO:1, a downstream outer primer with a nucleotide sequence as shown in SEQ NO:2, an upstream inner primer with a nucleotide sequence as shown in SEQ NO:3, a downstream inner primer with a nucleotide sequence as shown in SEQ NO:4, an MS-H strain probe with a nucleotide sequence as shown in SEQ NO:5, and an MS wild-type strain probe with a nucleotide sequence as shown in SEQ NO:

6.

2. The LAMP primer probe combination composition for identifying Mycoplasma synoviae MS-H strain from wild strain according to claim 1, characterized by: The 5' end of SEQ NO:5 is modified with FAM, and the 3' end is modified with a 3-carbon chain blocking group and MGB.

3. The LAMP primer probe composition for differentiating Mycoplasma synoviae MS-H strain from wild strain according to claim 1, characterized in that: The 4th and 11th bases at the 5' end of SEQ NO:5 are modified with locked nucleic acid.

4. The LAMP primer probe composition for differentiating Mycoplasma synoviae MS-H strain from wild strain according to claim 1, characterized in that: The 14th base at the 5' end of SEQ NO:5 is a ribonucleotide base.

5. The LAMP primer probe composition for differentiating Mycoplasma synoviae MS-H strain from wild strain according to claim 1, characterized in that: The 5' end of SEQ NO:6 is modified with VIC, and the 3' end is modified with a 3-carbon chain blocking group and MGB.

6. The LAMP primer-probe composition for identifying MS-H strain and wild-type strain of Mycoplasma synoviae according to claim 1, characterized in that: The 7th, 10th, and 13th bases at the 5' end of SEQ NO:6 are modified with locked nucleic acid.

7. The LAMP primer-probe composition for identifying MS-H strain and wild-type strain of Mycoplasma synoviae according to claim 1, characterized in that: The 16th base at the 5' end of SEQ NO:6 is a ribonucleotide base.

8. A kit for differentiating between MS-H strain and wild-type Mycoplasma synoviae strain, characterized in that: Includes the primer-probe composition according to any one of claims 1-7.

9. The kit for distinguishing between MS-H strain and wild-type Mycoplasma synoviae strain according to claim 8, characterized in that: It also includes enhancers, which are trehalose solutions with a final concentration of 0.2–0.5 M, formamide solutions with a volume fraction of 1–6%, and L-proline solutions with a final concentration of 0.1–0.5 M.

10. The kit for distinguishing between MS-H strain and wild-type Mycoplasma synoviae strain according to claim 8, characterized in that: It also includes RNase H2, Bst DNA enzyme, buffer, MgSO4, dNTPs, positive control, and negative control.