Scn5a mutant gene, primer, kit, detection method and use

By using primers to identify base mutations at specific sites in the SCN5A genome and employing multiplex PCR amplification, the problem of distinguishing patients with sick sinus syndrome has been solved, enabling accurate gene mutation detection and clinical diagnosis. This provides new drug targets and promotes the treatment of sick sinus syndrome and guidance for eugenics.

CN116376918BActive Publication Date: 2026-06-26BIOLOGY INST OF SHANDONG ACAD OF SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BIOLOGY INST OF SHANDONG ACAD OF SCI
Filing Date
2023-02-07
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Current technologies are insufficient to effectively distinguish between patients with sick sinus syndrome and normal individuals, and the randomness and uncertainty of gene mutations result in a limited number of pathogenic genes being discovered, leading to a lack of effective clinical diagnostic methods.

Method used

This invention provides a method for detecting SCN5A mutant genes. It identifies base mutations in the SCN5A gene by identifying primers at specific sites in the genome, combining multiplex PCR amplification, digesting partial primer sequences and ligating amplicon adapters, constructing a library for gene detection, and using specific primer sequences to identify base mutations in the SCN5A gene.

Benefits of technology

It can accurately distinguish between patients with sick sinus syndrome and normal people, provide new drug targets, promote the development of innovative drugs, and be used for family evolution research, eugenics guidance and genetic counseling.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116376918B_ABST
    Figure CN116376918B_ABST
Patent Text Reader

Abstract

The application discloses an SCN5A mutant gene, wherein a base G at a genomic position chr3:38607917 is mutated into a base A, or a base G at a genomic position chr3:38620923 is mutated into a base T, with reference to a gene sequence GRCh37. The hybrid missense mutation of the base G at the genomic position chr3:38607917 into the base A and / or the hybrid missense mutation of the base G at the genomic position chr3:38620923 into the base T can distinguish a supraventricular syndrome patient from normal people, and can also be used as a biomarker for assisting clinical diagnosis of the supraventricular syndrome. The primers and the kit provided by the application provide a new drug target for human beings to conquer the supraventricular syndrome, and promote the research and development of innovative drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of human genetics and cardiovascular technology, and in particular to an SCN5A mutant gene, primers, kits, detection methods, and applications. Background Technology

[0002] Sick sinus syndrome (SSS) is a clinical syndrome primarily caused by sinoatrial node pacing dysfunction or sinoatrial / atrioventricular system perforation dysfunction, leading to arrhythmias. Clinically, it often results in blurred vision, fatigue, syncope, and sudden death. SSS is a cardiovascular disease and a major chronic non-communicable disease characterized by high incidence, high disability rate, and high mortality rate. SSS is common in elderly individuals with underlying heart disease, but it can also occur in fetuses, infants, and children. In recent years, the incidence of SSS has been gradually increasing and showing a trend towards affecting younger individuals.

[0003] Currently, more than 10 pathogenic genes associated with sick sinus syndrome have been reported. With the discovery of more and more genes affecting sick sinus syndrome (including SCN5A, ANK2, HCN4, MYH6, etc.) and mutation sites, gene testing has become an important means of diagnosing sick sinus syndrome. The SCN5A gene encodes the cardiac sodium channel protein Nav1.5 and is the first pathogenic gene for hereditary sick sinus syndrome. The SCN5A gene is 6048kb long and contains 28 exons, each ranging in size from approximately 53 (exon 24) to 3257 (exon 28) bases. Previous studies have identified more than 20 related gene mutation sites, including T220I, P1298L, delF1617, R1623X, and R1632H. However, due to the randomness and uncertainty of gene mutations, and the rarity of sick sinus syndrome, the number of mutated genes discovered so far is still very limited. Discovering any gene related to sick sinus syndrome would be a significant technological contribution to this field. Summary of the Invention

[0004] The purpose of this invention is to provide an SCN5A mutant gene, primers, kits, detection methods, and applications. Heterozygous missense mutations at the chr3:38607917 site (G to A) and / or at the chr3:38620923 site (G to T) can distinguish patients with sick sinus syndrome from healthy individuals and can also serve as biomarkers for the clinical diagnosis of sick sinus syndrome. The primers and kits provided by this invention offer new drug targets for tackling sick sinus syndrome and promote innovative drug development.

[0005] Therefore, the technical solution of the present invention is an SCN5A mutant gene, which has at least one of the following mutations compared with the human genome reference gene sequence GRCh37: a mutation of base G to base A at genomic position chr3:38607917, and a mutation of base G to base T at genomic position chr3:38620923.

[0006] A primer for detecting the SCN5A mutant gene, comprising at least one set of primers having the following sequence:

[0007] The forward primer sequence is: ATGTTGTGTTCTTGTGTTCTTTGCAGGC and the reverse primer sequence is: GCAAGGGCTGCGGGCTTCTGAGGCC;

[0008] The forward primer sequence is: CAAGACCTGCTACCACATCG and the reverse primer sequence is: AAAGGCAAGTCTCCCTCTGT;

[0009] The forward primer sequence is: CGCAAGACCTGCTACCAC and the reverse primer sequence is: CACGCCCATGATGCTGAA;

[0010] The forward primer sequence is: CTACCTAGAGGAGCGGAAGAC and the reverse primer sequence is: TGGTGTAGTTCAAAGGCAAGT.

[0011] Application of a primer for detecting SCN5A mutant genes in the preparation of a reagent for detecting sick sinus syndrome.

[0012] A kit for detecting SCN5A mutant genes, the kit comprising primers for detecting SCN5A mutant genes.

[0013] A method for detecting SCN5A mutant genes, using a kit for detecting SCN5A mutant genes, for non-diagnostic purposes, includes the following steps:

[0014] Step S100: DNA gene sample preparation;

[0015] Step S200: Multiplex PCR amplification;

[0016] Step S300: Digest part of the primer sequence;

[0017] Step S400: Amplicon adapter ligation and library purification.

[0018] Furthermore, the steps of multiplex PCR amplification in step S200 include:

[0019] S210. Prepare the first reaction solution on ice. The first reaction solution includes Nuclease-free H2O, DNA template, and 4x Multi-PCR Mix. Gently mix by pipetting and briefly centrifuge to collect the first reaction solution to the bottom of the tube.

[0020] S220. Add the prepared first reaction solution to the PCR reaction tube, add the forward primer and reverse primer respectively, mix well by pipetting, and centrifuge briefly.

[0021] S230. Place the PCR tube on the PCR instrument to perform a multiplex PCR reaction. After the PCR is completed, briefly centrifuge the tube.

[0022] Furthermore, step S300, which involves digesting a portion of the primer sequence, includes:

[0023] S310. Gently mix Digest Mix2, briefly centrifuge, place on ice, and prepare the second reaction solution on ice. The second reaction solution includes the reaction product mixed in step S200 and Digest Mix2. Mix by blowing and stirring.

[0024] S320. Place the PCR tube on the PCR instrument. The temperature of the hot cap is 105℃. The PCR program is 50℃ for 10 min, 55℃ for 10 min, 60℃ for 20 min, and then hold at 10℃.

[0025] Furthermore, step S400, the steps of amplicon adapter ligation and library purification, include:

[0026] S410. Prepare the third reaction solution on ice. The third reaction solution includes: the reaction product of step S300, Ligation Enhancer, Ligation Enzyme Mix2, and Ampseq Adapters.

[0027] S420. Place the PCR tube on the PCR instrument. The temperature of the hot cap is 105℃. PCR program: 22℃ for 30 min, 72℃ for 10 min, and hold at 10℃.

[0028] S430, library purification.

[0029] Furthermore, after step S400, which involves amplicon adapter ligation and library purification, the procedure further includes step S500, which involves library amplification and purification.

[0030] The beneficial effects of this invention are that the heterozygous missense mutations at the chr3:38607917 site (G to A) and / or the chr3:38620923 site (G to T) provided by this invention can distinguish patients with sick sinus syndrome from normal individuals and can also serve as biomarkers for the clinical auxiliary diagnosis of sick sinus syndrome. The non-diagnostic purposes described in this invention include, but are not limited to, studying SNP distribution and polymorphism, using them for family evolution studies or tracking gene mutations, and providing eugenic guidance and genetic counseling to subjects. The primers and kits provided by this invention offer new drug targets for conquering sick sinus syndrome in humans, promoting the development of innovative drugs. Attached Figure Description

[0031] Figure 1 This is a family tree of patients with sick sinus syndrome; Detailed Implementation

[0032] The present invention will be further described below with reference to embodiments.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0034] Example 1

[0035] Proforum verification experiment:

[0036] Sample source: Qilu Hospital of Shandong University. With the proband (male, 29 years old) and his family voluntarily signing informed consent forms, family members with sick sinus syndrome were summoned to the local hospital in batches for comprehensive physical examinations. 5-10 mL of peripheral venous blood was drawn and placed in EDTA anticoagulant tubes, gently shaken to ensure thorough mixing of whole blood and anticoagulant, for the preparation of genomic DNA. This study has been approved by the institution's ethics committee. The comprehensive physical examinations revealed that, in addition to the proband, the mother of the aforementioned family member with sick sinus syndrome also suffered from the syndrome. The family history of sick sinus syndrome patients is as follows: Figure 1 As shown.

[0037] Genetic testing was conducted on the proband and his / her family members. The specific steps are as follows:

[0038] (1) Genomic DNA was extracted from blood samples from both the proband and the validation sample using a kit method.

[0039] (2) DNA sample detection and library construction

[0040] After analyzing the degree of DNA degradation and contamination using agarose gel electrophoresis, DNA samples of 0.5 μg or more were used for library construction. Genomic DNA was randomly fragmented into segments of approximately 350 bp using a Covaris fragment disruptor. After end repair and A-tailing, adapters were ligated to both ends of the fragments to prepare the DNA library.

[0041] (3) Genome next-generation sequencing

[0042] After passing library inspection, high-throughput sequencing was performed using the Illumina platform. The raw image data files obtained from sequencing were converted into raw sequencing reads (Sequenced Reads) after base identification and analysis.

[0043] (4) Sequencing data filtering

[0044] The raw sequencing results contain low-quality reads with adapters. To ensure the quality of information analysis, the raw reads need to be finely filtered to obtain clean reads, and subsequent analyses are based on these clean reads. The data processing steps are as follows: 1) Remove read pairs with adapters; 2) When the proportion of N (where N represents undetermined base information) in a single-end sequencing read is greater than 10%, this read pair needs to be removed; 3) When the number of low-quality (below 5) bases in a single-end sequencing read exceeds 50% of the read length, this read pair needs to be removed.

[0045] (5) Sequencing depth and coverage statistics

[0046] Valid sequencing data were aligned to a reference genome (GRCh37 / hg19) using BWA software to obtain initial alignment results in BAM format. The alignment results were then sorted using SAMtools software; repeat reads were then labeled with Picard. Finally, the alignment results after repeat labeling were used to perform statistical analysis on coverage, depth, etc. Typically, sequencing reads from human samples achieve an alignment rate of over 95%; when the base coverage depth (read depth) at a site reaches 10X or higher, the SNP detected at that site is considered relatively reliable.

[0047] (6) Analysis of mutation detection results

[0048] SAMtool software identifies single nucleotide variants (SNVs) and somatic insertion or deletion mutations (InDel). CREST detects structural variations (SVs) in the genome, including large deletions, insertions, duplications, copy number variations, inversions, and translocations. Control-Freec software detects copy number variations (CNVs).

[0049] (7) Screening for suspected pathogenic mutations

[0050] After variant detection, the obtained SNV, InDel, SV, and CNV data underwent secondary screening. The specific screening process was as follows: 1) Filtering the 1000G genome database, retaining variant sites with a frequency below 0.01. The aim was to remove inter-individual diversity sites and obtain truly rare mutations that are likely to cause disease; 2) Retaining variants in exon regions or splice sites; 3) Removing synonymous mutations that do not cause changes in amino acid coding, obtaining mutations that affect gene expression products; 4) Screening variant sites based on scores from four software programs: SIFT, Polyphen, MutationTaster, and CADD. Only sites where at least half of the scoring software programs support the possibility of harm were retained. Finally, corresponding sites were screened based on genetic patterns to identify and locate gene mutation sites common to patients but not found in healthy controls. Phenolyzer software was used to predict the association between suspected pathogenic genes and sick sinus syndrome. The results showed that the SCN5A gene may be a potential pathogenic gene for hereditary sick sinus syndrome.

[0051] Through the above method, the inventors discovered, during the analysis of the above-mentioned sick sinus syndrome families, that all patients with sick sinus syndrome (the proband and his mother) in the families had the following two heterozygous missense mutations in the SCN5A gene:

[0052]

[0053] c.G3661A indicates that in the CDS region of the SCN5A gene, the base G at position 3661 is mutated to base A, and p.D1221N indicates that the amino acid at position 1221 of the protein encoded by the SCN5A mutant gene is changed from aspartic acid (Asp) to asparagine (Asn).

[0054] c.G3289T indicates that in the CDS region of the SCN5A gene, the base G at position 3289 is mutated to the base T. p.V1097L indicates that the amino acid at position 1097 of the protein encoded by the SCN5A mutant gene is changed from valine (Val) to leucine (Leu).

[0055] The wild-type SCN5A gene sequence number is SEQ ID NO:1, and the specific sequence is as follows: (chr3:38607901-chr:38607950)

[0056] AGATGCTACTCCTTCA G CTCGGTCGTGGTCCGTAACCACTTCATGAAGAA, where, G These are the bases before the mutation.

[0057] The sequence number of the SCN5A mutant gene is SEQ ID NO:2, and the specific sequence is as follows:

[0058] AGATGCTACTCCTTCA A CTCGGTCGTGGTCCGTAACCACTTCATGAAGAA, where, A These are the bases after the mutation.

[0059] The wild-type SCN5A gene sequence number is SEQ ID NO:3, and the specific sequence is as follows: (chr3:38620901-chr:38620950)

[0060] AGTCTCCTCCGTCAGCGACTGT G GACCGAGGTCCAGGACCTTAGGCCTCC, where... G These are the bases before the mutation.

[0061] The sequence number of the SCN5A mutant gene is SEQ ID NO:4, and the specific sequence is as follows:

[0062] AGTCTCCTCCGTCAGCGACTGT T GACCGAGGTCCAGGACCTTAGGCCTCC, where... T These are the bases after the mutation.

[0063] A search of population frequency databases revealed that the two variants mentioned above are rare (1000 Genomes Database: None, ESP6500: None, ExAC: None). Prior to the discovery of these two variants, no existing databases had reported cases of families carrying these variants related to sick sinus syndrome, including but not limited to populations from various regions of China. Multiple bioinformatics prediction software programs (SIFT, Polyphen, MutationTaster, CADD, etc.) indicated harmfulness. A literature search found no reports linking these two variants to sick sinus syndrome.

[0064] Furthermore, to verify the relationship between the two aforementioned mutations and sick sinus syndrome, the inventors used zebrafish, which share 87% genetic similarity with humans, as experimental animals. They conducted vector verification of the harmfulness of SCN5A gene mutations using the CRISPRi technology. The normal expression of the SCN5A gene in zebrafish was interfered with using the CRISPRi technology, and then an expression vector plasmid containing at least one of the aforementioned mutations was introduced into the zebrafish via microinjection. When the zebrafish reached day 5 of development, we found that any of the aforementioned mutations in the SCN5A gene resulted in a 10%–30% reduction in cardiac output and a 20%–40% reduction in stroke volume, exhibiting symptoms of sick sinus syndrome. These experimental results further demonstrate that any of the aforementioned mutations can affect cardiac function, thus further confirming that any of the aforementioned mutations can lead to sick sinus syndrome.

[0065] To facilitate the detection of any of the above-mentioned mutated genes, this invention provides a primer for detecting the SCN5A mutated gene. The SCN5A mutated gene, compared to the human genome reference gene sequence GRCh37, has at least one of the following mutations: a G mutation to A at genomic position chr3:38607917, and a G mutation to T at genomic position chr3:38620923. The primer is at least one set of primers having the following sequences:

[0066] Primers for specific recognition of the A base at position 38607917 of chr3: forward primer SEQ ID NO:5 and reverse primer SEQ ID NO:6.

[0067] Primers for specific recognition of the T base at position chr3:38620923: forward primer SEQ ID NO:7 and reverse primer SEQ ID NO:8, or forward primer SEQ ID NO:9 and reverse primer SEQ ID NO:10, or forward primer SEQ ID NO:11 and reverse primer SEQ ID NO:12.

[0068] sequence direction Primers Primer length NO:5 F(5’-3’) GGCCTCAGAAGCCCGCAGCCCTTGC 25 NO:6 R(5’-3’) GCAAGGGCTGCGGGCTTCTGAGGCC 25 NO:7 F(5’-3’) CAAGACCTGCTACCACATCG 20 NO:8 R(5’-3’) AAAGGCAAGTCTCCCTCTGT 20 NO:9 F(5’-3’) CGCAAGACCTGCTACCAC 18 NO:10 R(5’-3’) CACGCCCATGATGCTGAA 18 NO:11 F(5’-3’) CTACCTAGAGGAGCGGAAGAC 21 NO:12 R(5’-3’) TGGTGTAGTTCAAAGGCAAGT 21

[0069] Example 2

[0070] This invention also provides a kit for detecting SCN5A mutant genes, comprising the following reagents:

[0071]

[0072] In the specific implementation process, the kit also includes all the primers in Example 1, and the specification of each primer is 10uM / 24 doses.

[0073] The storage conditions for the reagent kit provided in this embodiment of the invention are: -30℃ to -15℃; transportation conditions are: ≤0℃.

[0074] When using the kit provided in this embodiment of the invention, the following reagents need to be used in conjunction:

[0075] Library construction reagents: VAHTS™ AmpSeq Cancer HotSpot Panel (Vazyme#NA102) or other equivalent products;

[0076] VAHTSTM AmpSeq Adapters for Illumina / Ion Torrent(Vazyme#NA111 / NA121);

[0077] Purified magnetic beads: VAHTS™ DNA Clean Beads (Vazyme#N411);

[0078] Library review: Equalbit dsDNA HS Assay Kit (Vazyme#EQ121);

[0079] VAHTSTM Library Quantification Kit for Illumina(Vazyme#NQ101-106);

[0080] Agilent Technologies 2100 Bioanalyzer or other equivalent products and related reagents;

[0081] Other materials: freshly prepared 80% ethanol, sterile ultrapure water; RNase-free PCR tubes, low-adsorption EP tubes; PCR instrument, magnetic rack, etc.

[0082] Example 3

[0083] This invention also provides a method for using the above-mentioned reagent kit:

[0084] Step S100: DNA gene sample preparation.

[0085] Prepare a DNA genome sample and perform DNA Qubit detection. Select an appropriate injection volume based on the sample concentration, with the initial DNA template amount ranging from 1 to 100 ng.

[0086] Additionally, remove the reagents from the kit, including 4x Multi-PCR Mix, DigestMix2, Ligation Enhancer, and Ligation Enzyme Mix2, as well as the Ampseq Adapters, and thaw them on ice. After thawing completely, invert the kit to mix thoroughly and centrifuge briefly. Place the kit on ice. Vortex the DNA Clean Beads to mix and equilibrate to room temperature. Prepare 80% ethanol and wash each sample with approximately 400 μL of 80% ethanol.

[0087] Step S200, Multiplex PCR amplification:

[0088] S210. Prepare the first reaction solution on ice:

[0089] Components volume <![CDATA[Nuclease-free H2O]]> To 20uL DNA template 1-2uL 4x Multi-PCR Mix 10uL

[0090] Gently mix the solution using a pipette, and collect the first reaction solution to the bottom of the tube after a short centrifugation.

[0091] S220. Add 20 μL of the prepared first reaction solution to the PCR reaction tube, and add 1 μL of the forward primer and the reverse primer respectively. Mix well by pipetting and centrifugation briefly.

[0092] S230. Place the PCR tube on the PCR instrument to perform a multiplex PCR reaction. The reaction procedure is as follows:

[0093] The hot cap was set to 105℃, 99℃ for 2 min; (99℃ for 15 sec, 60℃ for 4 min) for 24 cycles, 72℃ for 10 min, and held at 4℃.

[0094] After PCR, the sample was briefly centrifuged, and the final volume was 20 μL.

[0095] Step S300: Digestion of partial primer sequences

[0096] Specifically, the following steps are included:

[0097] S310. Gently mix Digest Mix 2, briefly centrifuge, place on ice, and prepare the second reaction solution as follows on ice, then mix by blowing and swishing.

[0098] Components volume The reaction products mixed in step S200 20uL Digest Mix2 2.5uL

[0099] S320. Reaction program: The hot cap is set to 105°C. The program is 50°C for 10 min, 55°C for 10 min, 60°C for 20 min, and then held at 10°C.

[0100] Step S400: Amplicon adapter ligation and library purification

[0101] Specifically, the following steps are included:

[0102] S410. Prepare the third reaction solution on ice:

[0103]

[0104] S420. Place the PCR tube on the PCR instrument, with the hot cap at 105℃. PCR program: 22℃ for 30 min, 72℃ for 10 min, and hold at 10℃.

[0105] S430. Library Purification

[0106] (1) Before use, shake the DNA Clean Beads to mix well and equilibrate to room temperature. Prepare 80% ethanol and wash each sample with approximately 400 μL of 80% ethanol.

[0107] (2) Add ddH2O (about 30uL) to make up the volume to 60uL, add 60uL (1x) DNA Clean Beads, mix well by pipetting, and incubate at room temperature for 8 minutes to allow the library to bind to the magnetic beads.

[0108] (3) Briefly centrifuge the reaction tube and place it on a magnetic rack. Let it stand at room temperature (about 5 minutes). After the solution becomes clear, discard the supernatant.

[0109] (4) Keep the PCR tube on the magnetic rack, add 200uL of 80% ethanol, incubate for 30 seconds and then remove the supernatant.

[0110] (5) Repeat step (4) above, rinse twice, and remove all residual ethanol with a pipette.

[0111] (6) After the magnetic beads are dried at room temperature for about 5 minutes, remove the PCR tube from the magnetic rack, add 22uL of Elution Buffer (or ddH2O) to cover the magnetic beads, and mix with a pipette.

[0112] (7) Incubate at room temperature for 2 min, centrifuge briefly, place on a magnetic rack, and wait for the solution to become clear (about 5 min). Then, transfer 20 μL of the supernatant into a new EP tube and store at -20 °C.

[0113] (8) Quality control

[0114] Qubit is used to detect library concentration. If the concentration is ≥50 ng / uL, step S500 is not required; if the concentration is <50 ng / uL, step S500 (library amplification and purification) is required.

[0115] Step S500: Library amplification and purification

[0116] Specifically, the following steps are included:

[0117] Take out reagents such as S510.HiFi Amplification Mix and PCR Primer Mix (for Ion Torrent), place them on ice to thaw, mix thoroughly by inverting, and centrifuge briefly. Place on ice.

[0118] S520. Ice-based configuration as follows:

[0119] Components volume HiFi Amplification Mix 25uL PCR Primer Mix(for Ion Torrent) 5uL Purified PCR products 20uL

[0120] S530. Place the PCR tube in the PCR instrument, set the hot cap temperature to 105℃, and run the PCR program:

[0121] 95℃ for 3 min, (98℃ for 20 sec, 60℃ for 15 sec, 72℃ for 30 sec) for 5 cycles, 72℃ for 10 min, and hold at 4℃.

[0122] S540. Library Purification

[0123] S540 specifically includes the following steps:

[0124] (1) Shake the DNA Clean Beads well and equilibrate to room temperature in advance, and prepare 80% ethanol. Use about 400uL of 80% ethanol for each sample.

[0125] (2) Transfer all samples to 1.5 mL EP tubes, add ddH2O to make up the volume to 100 μL, vortex DNA CleanBeads to mix them thoroughly, add 120 μL (1.2x) DNA CleanBeads, mix by pipetting, and incubate at room temperature for 8 min to allow the library to bind to the magnetic beads.

[0126] (3) Briefly centrifuge the reaction tube and place it on a magnetic rack. Let it stand at room temperature (about 5 minutes). After the solution becomes clear, discard the supernatant.

[0127] (4) Keep the PCR tube on the magnetic rack, add 200uL of 80% ethanol, incubate for 30 seconds and then remove the supernatant.

[0128] (5) Repeat step (4) twice in total, and remove all residual ethanol with a pipette.

[0129] (6) After the magnetic beads are dried at room temperature for about 5 minutes, remove the EP tube from the magnetic rack, add 22uL of Elution Buffer (or ddH2O) to cover the magnetic beads, and mix with a pipette.

[0130] (7) Incubate at room temperature for 2 min, centrifuge briefly, place on a magnetic rack, and wait for the solution to become clear (about 5 min). Then, transfer 20 μL of the supernatant into a new EP tube and store at -20 °C.

[0131] (8) Quality control

[0132] The concentration of each sample was detected using Qubit, with whole blood sample concentrations typically above 50 ng / µL. Samples were pooled at a total volume of 100 ng, and the concentration of the pooled sample was measured before sequencing.

[0133] To verify the efficacy of this kit, the inventors selected blood samples from 10 patients with sick sinus syndrome for testing. They also selected blood samples from 500 phenotypically healthy control individuals for testing. The test data are as follows:

[0134] Of the 10 patients with sick sinus syndrome, c.G3661A mutation and c.G3289T mutation were successfully detected at chr3:38607917 and chr3:38620923, respectively, in 5 patients; c.G3661A mutation was successfully detected only at chr3:38607917 in 3 patients; and c.G3289T mutation was successfully detected only at chr3:38620923 in 2 patients.

[0135] Neither of the two variants was detected in any of the 500 phenotypically healthy control members.

[0136] The heterozygous missense mutations at the chr3:38607917 site (G to A) and / or the chr3:38620923 site (G to T) provided by this invention can distinguish patients with sick sinus syndrome from normal individuals and can also serve as biomarkers for the clinical auxiliary diagnosis of sick sinus syndrome. The non-diagnostic purposes described in this invention include, but are not limited to, studying SNP distribution and polymorphism, using them for family evolution studies or tracking gene mutations, and providing eugenic guidance and genetic counseling to subjects; such applications are understandable to those skilled in the art. The primers and kits provided by this invention offer new drug targets for conquering sick sinus syndrome in humans, promoting the development of innovative drugs.

[0137] However, the above description is merely a specific embodiment of the present invention and should not be construed as limiting the scope of the present invention. Therefore, any substitution of equivalent components or equivalent changes and modifications made in accordance with the scope of protection of the present invention should still fall within the scope of the claims of the present invention.

Claims

1. An SCN5A mutant gene, characterized in that: The mutation of the SCN5A mutant gene compared with the human genome reference gene sequence GRCh37 is that the base G is mutated to the base A at the genomic position chr3:38607917.

2. A primer for detecting the SCN5A mutant gene as described in claim 1, characterized in that: The forward primer sequence is SEQ ID NO:5, and the reverse primer sequence is SEQ ID NO:

6.

3. The use of a primer for detecting the SCN5A mutant gene as described in claim 2 in the preparation of a reagent for detecting sick sinus syndrome.

4. The application of a primer for detecting the SCN5A mutant gene in the preparation of a reagent for detecting sick sinus syndrome, characterized in that: The SCN5A mutant gene, compared to the human genome reference gene sequence GRCh37, has a mutation where base G is changed to base T at genomic position chr3:38620923. The primers for the SCN5A mutant gene are at least one of the following: The forward primer sequence is SEQ ID NO:7, and the reverse primer sequence is SEQ ID NO:8; The forward primer sequence is SEQ ID NO:9, and the reverse primer sequence is SEQ ID NO:10; The forward primer sequence is SEQ ID NO:11, and the reverse primer sequence is SEQ ID NO:12.