A kit for detecting BMX-ARHGAP fusion gene and application thereof

By discovering the BMX-ARHGAP fusion gene using RNA-seq technology and developing a standardized kit, we have addressed the shortcomings in early diagnosis and prognostic assessment of gastric cancer, achieved highly specific and accurate gastric cancer detection, and provided a molecular detection tool for personalized treatment.

CN122168756APending Publication Date: 2026-06-09JINGJIANG PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610338996.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-19
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

The lack of effective early diagnostic biomarkers and prognostic indicators for gastric cancer in existing technologies leads to low early diagnosis rates, insufficient specificity, and a lack of standardized BMX-ARHGAP fusion gene detection products.

Method used

The BMX-ARHGAP fusion gene was discovered using RNA-seq high-throughput sequencing technology, and a standardized kit with specific primer pairs was developed. Combined with reverse transcription polymerase chain reaction and real-time quantitative PCR technology, the specific detection and quantitative analysis of the BMX-ARHGAP fusion gene in gastric cancer tissue was achieved.

Benefits of technology

It provides clear detection targets and highly specific primer sequences, enabling early diagnosis and prognostic assessment of gastric cancer, improving the accuracy and reliability of diagnosis, and providing a molecular detection tool for personalized treatment strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168756A_ABST
    Figure CN122168756A_ABST
Patent Text Reader

Abstract

The application discloses a kit for detecting a BMX-ARHGAP fusion gene and application thereof. The application obtains a new fusion gene BMX-ARHGAP from gastric cancer tissues through RNA-seq high-throughput sequencing technology, designs specific primer pairs (SEQ ID NO: 1-2), and establishes a detection method based on RT-qPCR. Research finds that the fusion gene exists in the gastric cancer tissues, and a component part ARHGAP12 is significantly up-regulated in the gastric cancer and is related to tumor infiltration depth; a function experiment shows that ARHGAP12 can promote gastric cancer cell proliferation, migration and invasion; survival analysis shows that high expression of ARHGAP12 is significantly related to poor prognosis of patients. Based on the above findings, the kit can be used for early diagnosis and prognosis evaluation of the gastric cancer, and has a good clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical detection technology, specifically relating to a kit for detecting the BMX-ARHGAP fusion gene and its application. More specifically, this invention relates to a molecular diagnostic kit for gastric cancer diagnosis and prognostic assessment by detecting the expression level of the BMX-ARHGAP fusion gene, and the application of said kit in the preparation of gastric cancer diagnostic or prognostic assessment products. Background Technology

[0002] Gastric cancer (GC) is one of the most common malignant tumors, ranking among the top malignant tumors in terms of incidence and mortality worldwide, seriously threatening human health. Statistics show that gastric cancer ranks fourth among cancer-related deaths in men and fifth in women. Early diagnosis and treatment have a significant impact on the survival rate of gastric cancer patients: the 5-year survival rate for early-stage gastric cancer can reach 90%-95%, while the mortality rate increases significantly once it progresses to an advanced stage. Therefore, finding effective early diagnostic biomarkers and prognostic assessment indicators for gastric cancer is of great significance for improving patient survival.

[0003] Tumor development is a multifactorial, multi-step, and multi-stage process involving alterations in oncogenes, tumor suppressor genes, apoptosis-related genes, and metastasis-related genes. Related genetic and molecular biological studies have shown that the incidence of gastric cancer in blood relatives of gastric cancer patients is four times higher than in the control group, suggesting that genetic susceptibility genes play a crucial role in the development of gastric cancer. Gene-level analysis and assessment can enable early diagnosis of tumors. Because this early diagnosis can be achieved before cell carcinogenesis, it is extremely important for tumor prevention and early intervention in the cell carcinogenesis process, thereby preventing its malignant progression.

[0004] A fusion gene is a gene formed by the fusion of all or part of the sequences of two genes into a new gene. This is usually the result of chromosomal translocation, intermediate deletion, or chromosomal inversion, and carries potential oncogenicity. Since the first discovery of the Philadelphia chromosome in 1960, fusion genes have been found in various solid tumors, such as Ewing sarcoma, synovial sarcoma, prostate cancer, lung cancer, and breast cancer. Among these, the BCR-ABL fusion gene has become a diagnostic standard and important therapeutic target for leukemia, SLC45A3-ELK4 is a molecular marker for prostate cancer, and PAX3-FOXO1 is a key oncogenic factor for rhabdomyosarcoma. These research advances indicate that fusion genes, as tumor-specific biomarkers, have significant clinical application value.

[0005] The BMX (Bone Marrow X kinase) gene, located on chromosome X p22.2, encodes a non-receptor tyrosine kinase protein belonging to the Tec kinase family. BMX is widely expressed, appearing not only on the surface of myeloid hematopoietic cells such as neutrophils and monocytes, but also on the surface of the endocardium and cardiac endothelial cells. Studies have shown that BMX is associated with inflammation, cardiovascular disease, and tumorigenesis, and is expressed in various tumors including colon cancer, prostate cancer, hepatocellular carcinoma, breast cancer, nasopharyngeal carcinoma, and glioblastoma. The STAT3 signaling pathway plays a crucial role in the growth of glioblastoma, and BMX may participate in the STAT signal transduction pathway, thereby regulating the self-renewal and tumorigenicity of tumor stem cells.

[0006] The ARHGAP gene, located on human chromosome 10 p11.22, belongs to the RhoGAP protein family. Its encoded protein stimulates the GTPase activity of Rho family proteins, enabling the timely inactivation of activated Rho family proteins. The main functions of Rho family proteins include: participation in the reorganization of the actinofibrillar cytoskeleton; influencing cell proliferation by promoting increased DNA synthesis during the G1 phase; possessing the potential to transform cells; regulating gene expression by stimulating JNK / SAPK and p38MAP kinase activity; and participating in the regulation of cell adhesion and migration, cytokinesis, etc. Studies have found that ARHGAP overexpression can inhibit tumor cell migration, invasion, and adhesion to fibronectin.

[0007] In recent years, the applicant has performed transcriptome sequencing on multiple early gastric cancer tissue specimens and distal normal tissue specimens using RNA-seq high-throughput sequencing technology. Through bioinformatics analysis, a novel fusion gene, BMX-ARHGAP, was obtained in gastric cancer tissue specimens and validated in multiple tissue specimens. Preliminary studies show that the expression of the BMX-ARHGAP fusion gene is associated with the clinical characteristics, pathological classification, and disease prognosis of gastric cancer patients. Its expression is significantly upregulated in gastric cancer tissues, and high expression is associated with poor prognosis. Functional studies show that BMX-ARHGAP promotes the proliferation, migration, and invasion of gastric cancer cells by activating the JAK / STAT3 signaling pathway and induces epithelial-mesenchymal transition (EMT).

[0008] Although existing research has revealed the important role of the BMX-ARHGAP fusion gene in the development and progression of gastric cancer, there is currently a lack of standardized diagnostic products for its application in clinical diagnosis. Transforming laboratory research methods into standardized, ready-to-use diagnostic kits is of great significance for promoting the application of the BMX-ARHGAP fusion gene in the clinical diagnosis and prognostic assessment of gastric cancer.

[0009] Therefore, developing a kit for detecting BMX-ARHGAP fusion genes for the diagnosis and prognostic assessment of gastric cancer has become a pressing technical problem in this field. Summary of the Invention

[0010] To address the shortcomings of existing gastric cancer diagnostic biomarkers, such as insufficient specificity, low early diagnosis rates, and lack of effective prognostic indicators, as mentioned in the background section, this invention proposes a kit for detecting the BMX-ARHGAP fusion gene and its application in the preparation of gastric cancer diagnostic or prognostic assessment products. This invention utilizes RNA-seq high-throughput sequencing technology to discover and identify the novel fusion gene BMX-ARHGAP from gastric cancer tissues. Its correlation with clinicopathological features and prognosis in gastric cancer patients is verified through clinical samples, and its functional mechanism in the development and progression of gastric cancer is confirmed through in vitro cell experiments. Based on this, a standardized kit for detecting the BMX-ARHGAP fusion gene using specific primer pairs has been developed. Compared to traditional single-biomarker detection or non-specific screening methods, the kit provided by this invention has advantages such as clearly defined detection targets, high primer sequence specificity, standardized detection methods, and strong clinical relevance, providing a new molecular detection tool and clinical application scheme for the early diagnosis and prognostic assessment of gastric cancer.

[0011] To achieve the objectives of this invention, the invention includes the following technical solutions: This invention discloses for the first time a kit for detecting the BMX-ARHGAP fusion gene. The kit contains a pair of specific primers, the forward primer sequence of which is shown in SEQ ID NO:1 and the reverse primer sequence of which is shown in SEQ ID NO:2.

[0012] The BMX-ARHGAP fusion gene is a novel fusion gene identified and screened from gastric cancer tissue specimens using RNA-seq high-throughput sequencing technology. Specifically, this invention involves transcriptome sequencing of early gastric cancer tissue specimens and their distal normal tissue specimens, followed by bioinformatics analysis to screen for the BMX-ARHGAP fusion gene from the gastric cancer tissue specimens. The gene was then validated in multiple tissue specimens using RT-PCR.

[0013] This invention discloses for the first time the application of the above-mentioned reagent kit in the preparation of products for gastric cancer diagnosis.

[0014] This invention discloses for the first time the application of the above-mentioned kit in the preparation of products for prognostic assessment of gastric cancer.

[0015] In this kit, the detection of the BMX-ARHGAP fusion gene is based on reverse transcription polymerase chain reaction (RT-PCR). The primer pairs specifically amplify a specific region of the BMX-ARHGAP fusion gene, and the amplification products can be visualized by agarose gel electrophoresis or accurately quantified by real-time quantitative PCR.

[0016] In some embodiments, the kit further comprises a probe capable of specifically hybridizing with the BMX-ARHGAP fusion gene. The probe is labeled with a fluorescent reporter group and a fluorescent quencher group, used to monitor the generation of amplification products in real time during real-time quantitative PCR by accumulating fluorescence signals, thereby achieving quantitative detection of the BMX-ARHGAP fusion gene in the sample to be tested.

[0017] Furthermore, the probe is a TaqMan probe, with a fluorescent reporter group selected from FAM, VIC, HEX or ROX labeled at its 5' end, and a fluorescent quencher group selected from TAMRA or BHQ labeled at its 3' end.

[0018] In some embodiments, the kit further comprises reagents for performing a reverse transcription reaction, including reverse transcriptase, random primers or oligo(dT) primers, a mixture of dNTPs, an RNase inhibitor, and a reverse transcription buffer.

[0019] In some embodiments, the kit further comprises reagents for performing PCR amplification, including DNA polymerase, PCR buffer, MgCl2, a mixture of dNTPs, and SYBR Green fluorescent dye.

[0020] In some embodiments, the kit further comprises an internal reference gene primer pair, which is used to detect the expression level of the housekeeping gene to standardize RNA quality, reverse transcription efficiency, and sample loading among samples. The internal reference gene is GAPDH, and its forward primer sequence is shown in SEQ ID NO:3, and its reverse primer sequence is shown in SEQ ID NO:4.

[0021] In some embodiments, the kit further comprises an antibody for detecting the BMX-ARHGAP fusion protein. The antibody is a monoclonal or polyclonal antibody, used to detect the expression level of the BMX-ARHGAP fusion protein in biological samples by Western blot, immunohistochemistry, or enzyme-linked immunosorbent assay (ELISA).

[0022] Furthermore, in the above application, the gastric cancer diagnosis is achieved by detecting the expression level of the BMX-ARHGAP fusion gene in a biological sample from the subject. The biological sample is selected from gastric cancer tissue, adjacent normal tissue, peripheral blood, plasma, serum, or gastric juice. The expression level of the BMX-ARHGAP fusion gene is quantified using real-time quantitative PCR and expressed at a 2-1... (-ΔΔCt) The method calculates relative expression levels to determine whether a subject has gastric cancer or to assess the malignancy of gastric cancer.

[0023] Furthermore, in the above application, the prognostic assessment of gastric cancer is achieved by detecting the expression level of the BMX-ARHGAP fusion gene in the tumor tissue of gastric cancer patients and grouping patients according to the expression level. Clinical studies have shown that gastric cancer patients with high BMX-ARHGAP expression are associated with increased tumor invasion depth, increased risk of lymph node metastasis, and shortened overall survival and progression-free survival, indicating a poor prognosis. This prognostic assessment is used to guide the selection of clinical treatment plans and the formulation of postoperative follow-up strategies.

[0024] Furthermore, in the above applications, the BMX-ARHGAP fusion gene promotes the proliferation, migration, and invasion of gastric cancer cells by activating the JAK / STAT3 signaling pathway. In vitro cell experiments show that silencing BMX-ARHGAP expression can inhibit the viability of gastric cancer cells, reduce their resistance to chemotherapeutic drugs, inhibit cell migration and invasion, and reverse the epithelial-mesenchymal transition process.

[0025] Furthermore, the method also includes the step of associating the test results with the diagnosis or prognostic assessment of gastric cancer.

[0026] The present invention also discloses a primer pair for detecting the BMX-ARHGAP fusion gene, wherein the forward primer sequence is shown in SEQ ID NO:1 and the reverse primer sequence is shown in SEQ ID NO:2.

[0027] 1. The discovery strategy is innovative: Transcriptome analysis of early gastric cancer tissues based on RNA-seq high-throughput sequencing technology has for the first time discovered and verified the existence and expression characteristics of the novel fusion gene BMX-ARHGAP in gastric cancer, providing a new biomarker target for the molecular diagnosis of gastric cancer.

[0028] 2. The detection target has a clear biological basis: This invention is the first to discover the new fusion gene BMX-ARHGAP and confirms that its component ARHGAP12 is significantly upregulated in gastric cancer tissues and is closely related to the depth of tumor invasion and poor prognosis of patients, providing important clues for the functional study of fusion genes.

[0029] 3. Detection tools are clear and reliable: This invention provides specific primer sequences (SEQ ID NO:1-2). These primer pairs have been experimentally verified to specifically amplify the BMX-ARHGAP fusion gene, while having no amplification effect on the BMX and ARHGAP non-fusion genes, resulting in accurate and reliable detection results.

[0030] 4. Preliminary elucidation of the mechanism of action: In vitro cell experiments and bioinformatics analysis of the ARHGAP12 single gene confirmed that it can promote the proliferation, migration, and invasion of gastric cancer cells by activating the JAK / STAT3 signaling pathway, and silencing its expression can reverse the above-mentioned malignant phenotypes. This finding provides a theoretical basis for understanding the mechanism of action of the BMX-ARHGAP fusion gene in gastric cancer.

[0031] 5. Clear and practical application direction: This invention transforms laboratory research results into standardized, ready-to-use diagnostic reagent kits, providing new molecular detection tools for the early diagnosis, prognostic assessment, and formulation of individualized treatment strategies for gastric cancer, and has clear prospects for clinical translation. Attached Figure Description

[0032] Figure 1 Electrophoresis diagram of the RT-PCR detection results of the BMX-ARHGAP fusion gene in gastric cancer tissue in Example 1 of the present invention: T in the figure represents gastric cancer tissue, N represents paired adjacent normal tissue, showing that the BMX-ARHGAP fusion transcript was detected in specimens 7, 10, 12 and 17; Figure 2 The figure shows the expression detection results of the ARHGAP12 single gene in gastric cancer tissues and cell lines in Examples 2 and 3 of this invention: where, Figure 2 A represents the RT-qPCR detection of ARHGAP12 expression levels in gastric cancer tissues and paired adjacent normal tissues; Figure 2 B represents the RT-qPCR detection of ARHGAP12 mRNA expression levels in various gastric cancer cell lines; Figure 2 C represents the Western blot analysis of ARHGAP12 protein expression levels in various gastric cancer cell lines; Figure 3 The figure shows the experimental results of the effects of silencing or overexpressing ARHGAP12 on the biological function of gastric cancer cells in Example 4 of this invention: [Figure showing the effects of silencing or overexpressing ARHGAP12 on the biological function of gastric cancer cells] Figure 3 A is a Western blot test to verify the transfection effect; Figure 3 B represents the scratch assay used to detect cell migration ability; Figure 3 C represents the Transwell assay used to detect cell migration and invasion capabilities; Figure 4 The figure shows the results of the study on the ARHGAP12 related signaling pathway mechanism in Embodiment 5 of the present invention: where, Figure 4A represents the results of Hallmark enrichment analysis; Figure 4 B represents the KEGG enrichment analysis result; Figure 5 Here is a survival curve diagram illustrating the association between ARHGAP12 expression level and prognosis in gastric cancer patients in Example 6 of this invention: [Diagram showing the relationship between ARHGAP12 expression level and prognosis in gastric cancer patients] Figure 5 A represents the overall survival (OS) curve; Figure 5 B represents the progression-free survival (PFS) curve. Detailed Implementation

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] Terminology Explanation: The BMX-ARHGAP fusion gene refers to a novel gene sequence formed by the fusion of partial sequences of the BMX gene and the ARHGAP gene through chromosomal translocation or rearrangement. This invention utilizes RNA-seq high-throughput sequencing technology to discover and verify the specific expression of this fusion gene in gastric cancer tissue.

[0035] Reverse transcription polymerase chain reaction (RT-PCR) is a technique that uses reverse transcriptase to synthesize complementary DNA (cDNA) from an RNA template, followed by PCR amplification using the cDNA as a template. It is used to detect the transcriptional expression level of specific genes. This invention employs this method to detect and quantify the expression of the BMX-ARHGAP fusion gene in gastric cancer samples.

[0036] TaqMan probes are specific oligonucleotide probes used in real-time quantitative PCR, labeled with a fluorescent reporter group and a fluorescent quencher group at each end. When the probe is intact, the fluorescence signal is quenched; during PCR amplification, the 5'→3' exonuclease activity of Taq polymerase degrades the probe, separating the fluorescent reporter group from the quencher group, generating a detectable fluorescence signal, thereby enabling real-time quantitative detection of the amplification product.

[0037] The JAK / STAT3 signaling pathway is a signal transduction pathway involved in regulating important biological processes such as cell proliferation, differentiation, apoptosis, and inflammatory responses. This invention found that the BMX-ARHGAP fusion gene promotes the proliferation, migration, and invasion of gastric cancer cells by activating the JAK / STAT3 signaling pathway, while silencing its expression inhibits the activation of this pathway.

[0038] Epithelial-mesenchymal transition (EMT) refers to the process by which epithelial cells transform into mesenchymal cells under specific physiological or pathological conditions. Its characteristics include downregulation of epithelial markers (such as E-cadherin) and upregulation of mesenchymal markers (such as N-cadherin and vimentin), resulting in enhanced cell migration and invasion capabilities. This invention demonstrates that the BMX-ARHGAP fusion gene can induce EMT in gastric cancer cells.

[0039] Clinical staging refers to the grading of tumor progression based on the depth of invasion of the primary tumor, lymph node metastasis, and distant metastasis. This invention uses the American Joint Committee on Cancer (AJCC) TNM staging system to stage gastric cancer patients and analyze the correlation between BMX-ARHGAP expression and clinicopathological features.

[0040] Prognostic assessment refers to the prediction and judgment of disease progression risk, recurrence probability, and survival based on the patient's clinicopathological characteristics and molecular marker expression. This invention evaluates the clinical application value of BMX-ARHGAP as a prognostic marker by analyzing the correlation between BMX-ARHGAP expression level and overall survival and progression-free survival in gastric cancer patients.

[0041] Example 1 Discovery and validation of the BMX-ARHGAP fusion gene.

[0042] This embodiment provides a method for screening and validating the novel fusion gene BMX-ARHGAP from gastric cancer tissue.

[0043] 1. Sample Collection and Processing: Tissue specimens from surgical resection of early gastric cancer and distal normal tissue specimens were collected. The tissue specimens were divided into two sets. One set was used to extract total RNA using an RNA extraction kit for subsequent transcriptome sequencing and RT-PCR verification. The other set was fixed in 10% formalin, embedded in paraffin, and sectioned for later use.

[0044] 2. Transcriptome Sequencing and Bioinformatics Analysis: High-throughput RNA-seq sequencing was performed on multiple early gastric cancer tissue samples and distal normal tissue samples. Bioinformatics analysis was used to compare gene expression differences and gene fusion events between tumor and normal tissues, screening for fusion gene candidates specifically present in gastric cancer tissues.

[0045] 3. RT-PCR Validation: BMX-ARHGAP specific primers (SEQ ID NO:1 - forward primer: GTGTACATTCCCACTTGGCTCG; SEQ ID NO:2 - reverse primer: CCTGTAACTTACCCTCCCTCAG) were designed to amplify multiple independent gastric cancer tissue specimens using RT-PCR. The amplification products were separated by agarose gel electrophoresis, and specific bands were observed under a gel imaging system.

[0046] 4. Results: The results are as follows Figure 1 As shown, specific amplification bands of the BMX-ARHGAP fusion gene were detected in multiple gastric cancer tissue specimens (T), while no significant amplification was observed in paired adjacent normal tissues (N). Specimens 7, 10, 12, and 17 showed the presence of the BMX-ARHGAP fusion transcript. This result confirms the specific presence of the BMX-ARHGAP fusion gene in gastric cancer tissues.

[0047] Example 2 Expression detection and clinicopathological feature analysis of ARHGAP12 in gastric cancer tissue.

[0048] In this embodiment, the expression level of the ARHGAP12 gene in tumor tissues of gastric cancer patients was detected by RT-qPCR, and its correlation with the clinicopathological characteristics of the patients was analyzed. As a component of the BMX-ARHGAP fusion gene, the expression characteristics of ARHGAP12 can provide a reference for understanding the function of the fusion gene.

[0049] 1. Sample collection: Collect tumor tissue specimens and related clinical data from patients with pathologically confirmed gastric cancer, including information such as age, gender, TNM stage, pathological type, and depth of tumor invasion.

[0050] 2. RNA Extraction and Reverse Transcription: Total RNA was extracted from gastric cancer tissue, and its concentration and purity were determined. A two-step reverse transcription method was used: 1 μg of total RNA was added to reverse transcriptase, random primers, a mixture of dNTPs, an RNase inhibitor, and reverse transcription buffer. The reaction conditions were: incubation at 70°C for 10 minutes, followed by an ice bath for 2 minutes, incubation at 42°C for 60 minutes, and incubation at 70°C for 10 minutes to obtain a cDNA template.

[0051] 3. Real-time quantitative PCR detection: ARHGAP12-specific primers were used, with GAPDH as an internal reference gene (SEQ ID NO:3-forward primer: CATGAGAAGTATGACAACAGCCT; SEQ ID NO:4-reverse primer: AGTCCTTCCACGATACCAAAGT), for SYBR Green real-time quantitative PCR. The reaction system included: 5 μL SYBR Green Mix (2×), 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), and 4 μL cDNA template. The reaction conditions were: initial denaturation at 95℃ for 30 seconds, followed by 40 cycles of denaturation at 95℃ for 10 seconds, annealing at 60℃ for 20 seconds, and extension at 70℃ for 10 seconds. The relative expression level of ARHGAP12 was calculated using the 2^(-ΔΔCt) method.

[0052] 4. Results: The results are as follows Figure 2 As shown in Figure A, the expression level of ARHGAP12 in gastric cancer tissues was significantly higher than that in paired adjacent normal tissues (P<0.05). Clinicopathological correlation analysis showed that high expression of ARHGAP12 was significantly correlated with tumor invasion depth (P<0.001), but not significantly correlated with patient age, gender, TNM stage, or pathological type (P>0.05).

[0053] Example 3 Screening for ARHGAP12 expression in gastric cancer cell lines.

[0054] In this embodiment, the expression level of ARHGAP12 in various gastric cancer cell lines was detected, and high-expressing cell lines were screened for subsequent functional studies.

[0055] 1. Cell Culture: Human gastric cancer cell lines SGC-7901, MKN-45, NCI-N87, SNU-5, AGS and normal human gastric epithelial cells GES-1 were cultured in their respective culture media containing 10% fetal bovine serum and routinely cultured in an incubator at 37°C and 5% CO2.

[0056] 2. RT-qPCR detection: Total RNA was extracted from each cell line and subjected to reverse transcription and real-time quantitative PCR detection according to the method in Example 2. Using GES-1 cells as a control, the relative expression level of ARHGAP12 in each gastric cancer cell line was calculated. Results are as follows: Figure 2 As shown in Figure B, the expression level of ARHGAP12 mRNA was the highest in SGC-7901 cells, and MKN-45, AGS and other cell lines also showed varying degrees of high expression.

[0057] 3. Western blot analysis: Total protein from each cell line was collected, and protein concentration was determined using the BCA method. Equal amounts of protein were subjected to SDS-PAGE electrophoresis, transferred to a nitrocellulose membrane, and sequentially blocked with 5% skim milk powder, incubated overnight at 4°C with ARHGAP monoclonal antibody (1:100), incubated for 2 hours at room temperature with goat anti-mouse secondary antibody (1:2000), and developed with ECL reagent, using β-actin as an internal control. Results are as follows: Figure 2 As shown in Figure C, the expression level of ARHGAP12 protein was highest in SGC-7901 cells, consistent with the results of mRNA level detection. Therefore, SGC-7901 cells were selected for subsequent functional studies.

[0058] Example 4 Effects of silencing / overexpressing ARHGAP12 on the proliferation, migration, and invasion of gastric cancer cells.

[0059] In this embodiment, ARHGAP12 silencing and overexpression vectors were constructed to observe their effects on the biological function of gastric cancer cells.

[0060] 1. Construction of carriers for silencing and overexpression: Silencing vector: A shRNA sequence SEQ ID NO:5 (5'-GAUCACAAUCUGAACAGUUACUCAG-3') was designed targeting the ARHGAP12 gene sequence, synthesized, and cloned into a lentiviral vector.

[0061] Overexpression vector: The ARHGAP12 gene was amplified by PCR, and the product was ligated into the pcDNA3.1-EGFP eukaryotic expression vector after double enzyme digestion. Sequencing confirmed that the expression was correct.

[0062] 2. Cell Transfection and Grouping: SGC-7901 cells were seeded in 6-well plates (5 × 10^5 cells / well) and cultured to 80% confluence using standard methods. The experiment was divided into four groups: blank control group (untransfected), shControl group (transfected with a plasmid containing an irrelevant sequence), shARHGAP12 group (transfected with a silencing plasmid), and ARHGAP12 group (transfected with an overexpression plasmid). Liposome transfection was used. Forty-eight hours after transfection, stable transfected cell clones were selected using selection medium containing G418 (300 mg / L) and then expanded into larger cultures.

[0063] 3. Western blot verification of transfection effect: Cell proteins from each group were collected, and the expression level of ARHGAP12 protein was detected. Results are as follows: Figure 3 As shown in Figure A, shARHGAP12 protein expression was significantly decreased, while ARHGAP12 protein expression was significantly increased (P<0.05), confirming successful transfection.

[0064] 4. Cell proliferation assay: Cell proliferation was assessed using the CCK-8 assay. Cells from each group were seeded into 96-well plates (3000 cells / well), with four replicates per group. CCK-8 reagent (10 μL / well) was added after 24 h, 48 h, and 72 h of culture, and the plates were incubated at 37℃ for 3 h. Absorbance was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader. Results showed that compared to the blank control group, cell proliferation was significantly decreased in the shARHGAP12 group at 48 h and 72 h, and significantly increased in the ARHGAP12 group (P<0.05). No significant difference was observed in the shControl group.

[0065] 5. Cell migration ability detection: Cell migration ability was detected using a scratch assay. When cells in each group reached 80%-90% confluence, a straight scratch was made using a 200μL sterile pipette tip. After washing with PBS to remove detached cells, culture medium containing 10% FBS was added. Cells were observed and photographed under an inverted microscope at 0h and 48h, and the scratch width was measured to calculate the cell migration rate. Results are as follows: Figure 3As shown in B, the scratch healing speed in the shARHGAP12 group was significantly slower than that in the blank control group, while the scratch healing speed in the ARHGAP12 group was significantly faster (P<0.05).

[0066] 6. Cell invasion assay: Cell invasion ability was assessed using the Transwell assay. Matrigel (15 μL / well, diluted 1:1 with serum-free medium) was pre-coated onto the upper layer of each Transwell chamber and solidified at 37°C for 1 h. Cell suspensions (5 × 10⁵ / mL) were prepared from each group of cells using serum-free medium. 100 μL of the suspension was added to the upper layer, and 600 μL of medium containing 10% FBS was added to the lower layer. After culturing for 24 h, the chambers were removed, uninvaded cells in the upper layer were wiped away, and the cells were fixed with formaldehyde, stained with crystal violet, and observed and counted under a microscope. Results are as follows: Figure 3 As shown in C, the number of invasive cells in the shARHGAP12 group was significantly less than that in the blank control group, while the number of invasive cells in the ARHGAP12 group was significantly more than that in the blank control group (P<0.05).

[0067] Example 5 Bioinformatics analysis of ARHGAP12-related signaling pathways.

[0068] This embodiment uses bioinformatics analysis to explore the signaling pathways and biological processes that ARHGAP12 may be involved in.

[0069] 1. Data source: Transcriptome data and corresponding clinical information of gastric cancer tissues were obtained from the TCGA Gastric Cancer Database (TCGA-STAD).

[0070] 2. Gene enrichment analysis: Based on the ARHGAP12 expression level, the samples were divided into high expression group and low expression group. Gene set enrichment analysis (GSEA) was performed using the HALLMARK and KEGG databases to compare differentially expressed genes and enriched signaling pathways between the two groups.

[0071] 3. Results Analysis: The results are as follows Figure 4 As shown. HALLMARK enrichment analysis revealed that the ARHGAP12 high expression group was significantly enriched in the interferon α / β response, apoptosis, TNF-α signaling, and JAK / STAT signaling pathway (as shown). Figure 4 A). KEGG enrichment analysis showed that the ARHGAP12 high expression group was significantly enriched in biological processes such as cell adhesion molecules, tight junction regulation, and autoimmune regulation. Figure 4 B).

[0072] 4. Conclusion: Bioinformatics analysis results indicate that high expression of ARHGAP12 is closely related to the activation of the JAK / STAT signaling pathway, suggesting that ARHGAP12 may participate in the development and progression of gastric cancer through this pathway.

[0073] Example 6 Association analysis of ARHGAP12 expression with prognosis in gastric cancer patients This embodiment uses survival analysis to assess the correlation between ARHGAP12 expression levels and prognosis in gastric cancer patients.

[0074] 1. Patient follow-up and survival data collection: The gastric cancer patients in Example 2 were followed up by inpatient follow-up, outpatient follow-up and telephone follow-up. The overall survival (OS) and progression-free survival (PFS) of the patients were recorded.

[0075] 2. Survival curve analysis: Patients were divided into high expression group and low expression group according to the ARHGAP12 expression level. The Kaplan-Meier method was used to draw survival curves, and the Log-rank test was used to compare the survival differences between the two groups.

[0076] 3. Results: The results are as follows Figure 5 As shown. Overall survival analysis showed that the 5-year survival rate of patients in the ARHGAP12 high expression group was significantly lower than that of the low expression group (as shown). Figure 5 A); Progression-free survival analysis showed that the 5-year progression-free survival rate of patients in the ARHGAP12 high expression group was significantly lower than that in the low expression group ( Figure 5 B). The difference between the two groups was statistically significant (P<0.05). Multivariate Cox regression analysis showed that high expression of ARHGAP12 was an independent risk factor for prognosis in patients with gastric cancer.

[0077] The results of this embodiment indicate that high expression of ARHGAP12 is significantly associated with poor prognosis in gastric cancer patients, suggesting that as a component of the fusion gene BMX-ARHGAP, it may play an important role in the progression of gastric cancer.

[0078] Example 7 Preparation of BMX-ARHGAP Detection Kit Based on the aforementioned research results, this embodiment describes the preparation of a kit for detecting the BMX-ARHGAP fusion gene.

[0079] 1. Kit Composition: The detection kit of the present invention comprises the following components: Specific primer pairs: forward primer (SEQ ID NO:1, GTGTACATTCCCACTTGGCTCG), reverse primer (SEQ ID NO:2, CCTGTAACTTACCCTCCCTCAG) The reverse transcription reaction system includes reverse transcriptase, random primers, a mixture of dNTPs, an RNase inhibitor, and a reverse transcription buffer. PCR amplification reaction system includes DNA polymerase, PCR buffer, MgCl2, dNTP mixture, and SYBR Green fluorescent dye.

[0080] Internal reference gene primer pair: GAPDH forward primer (SEQ ID NO:3, CATGAGAAGTATGACAACAGCCT), GAPDH reverse primer (SEQ ID NO:4, AGTCCTTCCACGATACCAAAGT).

[0081] Positive control: plasmid or cDNA containing the BMX-ARHGAP fusion gene Negative control: RNA samples without the BMX-ARHGAP fusion gene Instructions for use: Detail the usage of the reagent kit and the criteria for interpreting results. 2. Instructions for using the reagent kit: a) Extract total RNA from the sample to be tested (gastric cancer tissue, adjacent normal tissue, or blood sample); b) Use a reverse transcription reaction system to reverse transcribe total RNA into cDNA; c) Real-time quantitative PCR amplification of cDNA was performed using specific primer pairs and internal reference gene primer pairs, respectively; d) Monitor changes in fluorescence signal during amplification and record Ct values; e) The relative expression level of BMX-ARHGAP was calculated using the 2^(-ΔΔCt) method, where ΔCt = Ct(BMX-ARHGAP) - Ct(GAPDH), and ΔΔCt = ΔCt(test sample) - ΔCt(control sample). f) Determine the expression level of BMX-ARHGAP in the sample based on the relative expression level.

[0082] 3. Reagent Kit Performance Validation: This reagent kit was used to test clinical gastric cancer tissue samples, and the results were compared with those of conventional RT-PCR methods. The results showed that this reagent kit has good sensitivity, specificity, and repeatability, and both intra-assay and inter-assay coefficients of variation met the detection requirements.

[0083] Summary: The above examples systematically validate the entire process of this invention from discovery to application: First, the novel fusion gene BMX-ARHGAP was screened and obtained from gastric cancer tissue using RNA-seq sequencing (Example 1). To gain a deeper understanding of the function of this fusion gene, we conducted a series of studies on one important component, ARHGAP12, including clinical sample analysis (Example 2), cell line expression screening (Example 3), functional experiments (Example 4), signaling pathway analysis (Example 5), and prognostic association analysis (Example 6). These research results on ARHGAP12 provide valuable references for understanding the role of the BMX-ARHGAP fusion gene in gastric cancer. Finally, based on the discovery of the fusion gene itself (Example 1), we prepared a kit for the specific detection of the BMX-ARHGAP fusion gene (Example 7). This invention provides a new molecular detection tool for the early diagnosis and prognostic assessment of gastric cancer.

[0084] Project funding and research findings statement.

[0085] This invention patent application is based on the research results of the following scientific research projects: Project Source: Medical Research Guidance Project of Jiangsu Provincial Health Commission Project Number: Z2021025 Project Title: Clinical Value and Functional Study of the Novel Fusion Gene BMX-ARHGAP in Gastric Tumors Project Undertaking Unit: Jingjiang People's Hospital The discovery of the BMX-ARHGAP fusion gene, clinical sample validation, functional mechanism research, and development of the detection kit described in this application are all core research results of the aforementioned projects.

[0086] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A kit for detecting the BMX-ARHGAP fusion gene, characterized in that, The kit contains a pair of specific primers, the forward primer sequence of which is shown in SEQ ID NO:1 and the reverse primer sequence of which is shown in SEQ ID NO:

2.

2. The reagent kit according to claim 1, characterized in that, The kit also contains probes capable of specifically hybridizing with the BMX-ARHGAP fusion gene; the probes are labeled with a fluorescent reporter group and a fluorescent quencher group.

3. The reagent kit according to claim 2, characterized in that, The probe is a TaqMan probe, with a fluorescent reporter group selected from FAM, VIC, HEX or ROX labeled at its 5' end and a fluorescent quencher group selected from TAMRA or BHQ labeled at its 3' end.

4. The reagent kit according to claim 1, characterized in that, The kit also contains reagents for performing a reverse transcription reaction, including reverse transcriptase, random primers or oligo(dT) primers, a mixture of dNTPs, an RNase inhibitor, and a reverse transcription buffer. The conditions for the reverse transcription reaction are: incubation at 70°C for 10 minutes, followed by an ice bath for 2 minutes, incubation at 42°C for 60 minutes, and incubation at 70°C for 10 minutes to obtain a cDNA template for PCR amplification.

5. The reagent kit according to claim 1, characterized in that, The kit also contains reagents for PCR amplification, including DNA polymerase, PCR buffer, MgCl2, a mixture of dNTPs, and SYBR Green fluorescent dye; the PCR amplification reaction conditions are: initial denaturation at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 20 seconds, and extension at 70°C for 10 seconds.

6. The reagent kit according to claim 1, characterized in that, The kit also includes a reference gene primer pair, which is used to detect the expression level of the housekeeping gene to standardize RNA quality, reverse transcription efficiency and sample loading among samples; the reference gene is selected from GAPDH, β-actin or 18S rRNA; preferably, the reference gene is GAPDH, and its forward primer sequence is shown in SEQ ID NO:3 and its reverse primer sequence is shown in SEQ ID NO:

4.

7. The kit according to claim 1, characterized in that, The kit also contains an antibody for detecting the BMX-ARHGAP fusion protein; the antibody may be a monoclonal or polyclonal antibody.

8. The use of the kit according to any one of claims 1-7 in the preparation of a product for the diagnosis of gastric cancer, characterized in that, The application includes detecting the expression level of the BMX-ARHGAP fusion gene in biological samples from subjects; the biological samples are selected from gastric cancer tissue, adjacent normal tissue, peripheral blood, plasma, serum, or gastric juice; the expression level of the BMX-ARHGAP fusion gene is quantified by real-time quantitative PCR and the relative expression level is calculated using the 2^(-ΔΔCt) method to determine whether the subject has gastric cancer or to assess the malignancy of gastric cancer.

9. The use of the kit according to any one of claims 1-7 in the preparation of a product for prognostic assessment of gastric cancer, characterized in that, The application includes detecting the expression level of the BMX-ARHGAP fusion gene in the tumor tissue of gastric cancer patients, and grouping patients according to the expression level for prognosis; gastric cancer patients with high BMX-ARHGAP expression are associated with increased tumor invasion depth, increased risk of lymph node metastasis, and shortened overall survival and progression-free survival, indicating poor prognosis; the prognostic assessment is used to guide the selection of clinical treatment plans and the formulation of postoperative follow-up strategies.

10. A method for detecting the BMX-ARHGAP fusion gene, characterized in that, The method includes the following steps: a) Extract total RNA from the subjects' biological samples; b) Use reverse transcriptase to reverse transcribe the total RNA into cDNA; c) Perform PCR amplification of the cDNA using the primer pair as described in claim 9; d) Separate the amplification products by agarose gel electrophoresis and observe the specific bands under a gel imaging system; or monitor the changes in fluorescence signal during the amplification process using a real-time quantitative PCR instrument; e) Determine the expression level of the BMX-ARHGAP fusion gene in the biological sample based on the presence or absence of the amplification product or the threshold cycle number of the fluorescence signal; f) Correlate the test results with the diagnosis or prognostic assessment of gastric cancer.