Application of InDel molecular marker related to overgrowth of hooves on pig chromosome 7

By detecting the InDel molecular marker rs712521922 on pig chromosome 7, the dewclaw overgrowth trait was identified and marker-assisted selection was performed, which solved the limb and hoof health problems caused by dewclaw overgrowth and achieved genetic improvement and economic benefits for pig herds.

CN122168772APending Publication Date: 2026-06-09SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610626552.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-08
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

In existing technologies, excessive growth of the dewclaw leads to limb and hoof health problems in pigs, affecting the reproductive performance and lifespan of sows. Furthermore, manual physical trimming methods are time-consuming, labor-intensive, and prone to causing stress and secondary damage, failing to address the problem at its root.

Method used

By detecting the InDel molecular marker rs712521922 located on chromosome 7 of pigs, the dewclaw overgrowth trait was identified. Then, through molecular marker-assisted selection technology, pigs with the ATGT/ATGT genotype were preferentially bred, while individuals with the A/A genotype were culled, thereby reducing the incidence of dewclaw overgrowth.

Benefits of technology

This approach enables the early culling of high-risk individuals with overgrown undead hooves during the early stages of pig growth, improving the efficiency of genetic improvement in pig herds, extending the productive lifespan of sows, and enhancing the economic benefits and animal welfare of pig farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168772A_ABST
    Figure CN122168772A_ABST
Patent Text Reader

Abstract

The application discloses application of an InDel molecular marker related to overgrowth of a hoof on a pig chromosome 7, wherein the site of the InDel molecular marker is rs712521922, and the genotype is ATGT / ATGT, ATGT / A or A / A. By means of the InDel molecular marker, the frequency of a protective allele (ATGT) of the InDel molecular marker can be improved generation by generation in a breeding process through molecular marker assisted selection, the incidence of overgrowth of a hoof of a pig can be effectively reduced, the service life of a breeding sow is prolonged, and the economic benefit and the animal welfare level of pig breeding are remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding technology and relates to the application of an InDel molecular marker located on chromosome 7 of pigs that is associated with dewclaw overgrowth. Background Technology

[0002] The health of a pig's limbs and hooves directly affects its reproductive performance and lifespan. Abnormal growth of the dewclaw is one of the most prominent limb and hoof problems in breeding pigs. Excessive horn growth in the dewclaw not only leads to changes in the sow's standing posture and gait abnormalities, causing pain and stress, but also easily induces mechanical damage to the hoof and secondary joint infections, ultimately severely affecting the sow's feeding, reproductive, and lactation performance. This often results in the premature culling of high-producing, high-yielding breeding sows, preventing them from reaching their optimal reproductive potential and causing significant economic losses to pig farms.

[0003] Currently, the main approach to treating dewclaw overgrowth relies on manual physical trimming to alleviate symptoms. This phenotype-based intervention is time-consuming and labor-intensive, and the restraint and trimming processes can easily cause severe stress in sows, even resulting in secondary physical damage to the limbs and hooves, failing to address the root cause of the problem. With the rapid development of molecular genetics and sequencing technologies, high-density SNP chips and genome-wide association analysis (GWAS) have been widely used to identify desirable traits. GWAS can precisely locate single nucleotide polymorphisms (SNPs) and insertion / deletion mutations (InDels) that affect economically important traits. If key molecular markers related to dewclaw development can be identified and combined with marker-assisted selection (MAS) technology, early culling of individuals with dewclaw overgrowth can be achieved in early-age individuals, leading to genetic improvement of the population at its source. Summary of the Invention

[0004] The purpose of this invention is to provide an application of the InDel molecular marker located on pig chromosome 7 that is significantly associated with dewclaw overgrowth.

[0005] According to a first aspect of the invention, an application is provided for detecting the InDel molecular marker rs712521922 located on chromosome 7 of pigs and associated with dewclaw overgrowth, the application comprising at least one of the following (1) to (4): (1) Identify the dewclaw overgrowth trait in pigs; (2) Prepare products for identifying the overgrowth trait of pig hooves; (3) Pig genetic improvement, based on breeding pigs with the InDel molecular marker genotype of ATGT / ATGT in this invention to reduce the incidence of pig dewclaw overgrowth; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of the genotype of the InDel molecular marker of the present invention to assist in the genetic improvement of the overgrowth trait of pig dewclaws.

[0006] The InDel molecular marker provided by this invention, located on chromosome 7 of pigs and significantly associated with the dewclaw overgrowth trait, is at locus rs712521922. This corresponds to a 3-nucleotide (TGT) deletion mutation at positions 12224790 bp to 12224792 bp on chromosome 7 in International Swine Reference Genome Version 11.1, or denoted as the ATGT>A mutation at positions 12224789 bp to 12224792 bp on chromosome 7 in International Swine Reference Genome Version 11.1. This mutation leads to significant differences in the incidence of dewclaw overgrowth among different pig genotypes. The genotypes of the InDel molecular marker of this invention are ATGT / ATGT (wild type), ATGT / A (heterozygous deletion), or A / A (homozygous deletion).

[0007] The InDel molecular marker provided by this invention is significantly correlated with the incidence of dewclaw hyperplasia in pigs. Specifically, pigs with a homozygous deletion genotype of InDel (A / A) have a significantly higher incidence of dewclaw hyperplasia than wild-type pigs (ATGT / ATGT), indicating that the deletion mutation of this invention is detrimental to dewclaw growth in pigs. By detecting whether pigs carry the InDel molecular marker of this invention, the dewclaw hyperplasia trait in pigs can be identified. This allows for early culling of individuals at high risk of dewclaw hyperplasia during their early stages. Furthermore, in pig crossbreeding, selecting pigs with the InDel molecular marker genotype of ATGT / ATGT can fundamentally improve the genetic makeup of the dewclaw hyperplasia trait within the population, thereby reducing the incidence of dewclaw hyperplasia in pigs.

[0008] In some embodiments, products for detecting the InDel molecular markers of the present invention may include at least one of the following: reagents, kits, chips, and devices for detecting the InDel molecular markers of the present invention.

[0009] In some embodiments, the reagents used to detect the InDel molecular markers of the present invention may include at least one of the following: primers or probes for detecting the InDel molecular markers of the present invention.

[0010] In some implementations, the pig is a Large White pig.

[0011] In some embodiments, the primers used to detect the InDel molecular marker of the present invention include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0012] The primers provided by this invention can specifically amplify amplified fragments containing or without the InDel molecular marker of this invention. They can be used to detect the presence of a 3-nucleotide (TGT) deletion in the nucleotide sequence shown in SEQ ID NO:1, from position 88 to 90 from the 5' end, corresponding to positions 12224790 bp to 12224792 bp on chromosome 7 of the International Pig Reference Genome Version 11.1.

[0013] In some embodiments, the kit for detecting the InDel molecular marker of the present invention may include primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0014] In some embodiments, the kit for detecting the InDel molecular marker of the present invention may further include: dNTPs, DNA polymerase, and Mg. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0015] According to a second aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the InDel molecular marker rs712521922, which is associated with dewclaw overgrowth and is located on chromosome 7 of pigs; (2) Prioritize the breeding of individuals with the InDel molecular marker genotype ATGT / ATGT and eliminate individuals with the InDel molecular marker genotype A / A, thereby reducing the incidence of dewclaw overgrowth in offspring pigs.

[0016] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0017] In some implementations, in step (1), the breeding pig is a Large White pig.

[0018] In some implementations, step (1), determining the genotype of the InDel molecular marker located on chromosome 7 of pigs and associated with dewclaw overgrowth, includes the following steps: Whole-genome DNA was extracted from breeding pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotype of the InDel molecular marker located on chromosome 7 of pigs and associated with dewclaw overgrowth was determined based on the sequencing results.

[0019] Compared with the prior art, the beneficial effects of the present invention include: This invention validated, through large-sample testing, that the InDel molecular marker rs712521922, located on chromosome 7 of pigs and associated with dewclaw overgrowth (DOG), has a significant impact on DOG in pigs. This contributes to establishing a molecular marker-assisted selection breeding technology for rapid improvement of DOG in pigs, accelerating the breeding process of Large White pigs. By progressively increasing the frequency of the protective allele (ATGT) of the InDel molecular marker of this invention during the breeding process, the incidence of DOG in pigs can be effectively reduced, the productive lifespan of breeding sows can be extended, and the economic benefits and animal welfare of pig farming can be significantly improved. Attached Figure Description

[0020] Figure 1 This is a Manhattan plot of genome-wide association analysis (GWAS) on chromosome 7 of Large White pigs for the overgrowth trait of dewclaws; where: the horizontal axis represents the chromosome number of the pig; and the vertical axis represents the significance of the association. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0022] Example 1: Identification and Validation of InDel Molecular Markers Associated with Excessive Dewclaw Growth in Pigs (1) Experimental pig herd This invention used a total of 653 Large White sows, and the experimental pig population was the core resource group of the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd. All experimental sows were under the same nutritional standards and uniform feeding and management conditions.

[0023] (2) Phenotypic measurement The phenotypic determination of this invention uses the direct measurement method with vernier calipers. All pigs measured are of similar age. The pigs are in a side-lying and quiet state. The surface of their dewclaws is cleaned, and the starting point of the upper edge of the dewclaw root and the apex of the horn end are located and the straight-line distance is measured.

[0024] The phenotypic criteria are as follows: if the length of the dewclaw on either side of the left or right hind limb is greater than or equal to 7 cm, it is considered dewclaw overgrowth (Case group); if the length of the dewclaw on both sides of the left and right hind limbs is less than or equal to 4 cm, it is considered normal dewclaw (Control group). Based on the above criteria, 275 Large White sows with either dewclaw overgrowth or normal dewclaw were selected for further analysis.

[0025] (3) Extraction of porcine genomic DNA Ear tissues were collected from 275 Large White sows, and whole-genome DNA was extracted using the standard phenol-chloroform method. The concentration and purity were determined using Nanodrop 2000C, and the integrity was verified by 1% agarose gel electrophoresis. The DNA samples were then diluted to approximately 50 ng / μL. The qualified DNA samples were sent to Neocin Biotech (Shanghai) Co., Ltd., where whole-genome genotyping was performed using Illumina Porcine 80 K SNP BeadChip according to the company's standard procedures.

[0026] (4) Genome-wide genotyping and quality control Whole-genome filling of microarray data was performed using the Swine Imputation (SWIM) database platform. Rigorous quality control was performed using PLINK v1.90 software to retain data that met the Hardy-Weinberg equilibrium (HWE) test. P Value greater than 10 -6 Autosomal variants with an individual and locus detection rate greater than 90% and a minimum allele frequency (MAF) greater than 5%.

[0027] (5) Genome-wide association analysis (GWAS) GWAS analysis of the dewclaw phenotype in Large White sows was performed using a univariate mixed linear model (LMN) in GEMMA v0.98.5. To balance the risk of false positives with the risk of missing multiple genes with minor effects on complex traits, this invention employed a genome-wide suggested significance threshold to screen candidate associated molecular markers. Simultaneously, the population stratification effect of the study population was evaluated and validated using the genome expansion coefficient.

[0028] GWAS analysis results are as follows Figure 1 As shown.

[0029] from Figure 1 It can be seen that there is a signal peak in chromosome 7 of Large White pigs that is significantly associated with the overgrowth trait of dewclaws. Among them, the most significantly associated site is the InDel mutation g.12224789_12224792delinsA ( P =5.27×10 -8 The site is rs712521922, which corresponds to a 3-nucleotide (TGT) deletion mutation on chromosome 7 from 12224790 bp to 12224792 bp in the International Pig Reference Genome Version 11.1.

[0030] (6) Distribution statistics of InDel molecular markers in different phenotype populations The genotypic distribution frequency of the InDel molecular marker rs712521922 in the overgrown and normal pig groups is shown in Table 1.

[0031] Table 1 shows that the risk genotype leading to dewclaw hyperplasia is A / A, with a detection frequency as high as 67.7% in affected pig populations; while individuals carrying the homozygous ATGT / ATGT genotype account for only 2.6% of the affected population. Conversely, the proportion of ATGT allele carriers is significantly higher in healthy pig populations. Therefore, the A allele is a pathogenic risk factor, while ATGT is a protective dominant allele. In breeding, the incidence of dewclaw hyperplasia can be reduced by culling A / A type breeding pigs and selecting ATGT / ATGT type breeding pigs.

[0032] Table 1. Genotype frequency distribution of InDel molecular markers among pig populations with different phenotypes (number of individuals in parentheses).

[0033] (7) Effect analysis Table 1 shows that the ATGT allele of the InDel marker rs712521922 is a dominant protective gene for normal dewclaw development. Therefore, by using marker-assisted selection to preferentially retain boars and sows with the ATGT / ATGT genotype while gradually culling individuals with the A / A genotype, the lag in traditional phenotypic selection can be overcome. This allows for a rapid increase in the frequency of the ATGT allele within the population at an early stage, effectively curbing and reducing the incidence of dewclaw overgrowth in offspring, and helping companies recover losses from abnormal sow culling caused by limb diseases.

[0034] Example 2: Methods for genetic improvement of pigs The nucleotide sequence of the target fragment containing the InDel site, which is significantly associated with the overgrowth trait of the large white pig, is shown in SEQ ID NO:1, and the primer pairs for PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0035] SEQ ID NO:1 GCTGTTCATCATTGTATGTTTCCATCTTTCCTTGTTATAAGAGGGGACCTTGAAAATGTAAGGTTGCATCTCCCAGCTGCCAGCTGA TGTTGTTCTGAGAATGGCTGGCGGATTAAAGTGTGTCTAAACCTTAAATTTTTCAGCAATACAAGCATTTGTCTGGTATTACCTTGGATGTCTGAACCACAGCTATTCCACTTGTCTTTGAATTGTATTCTTCTC CTAAATGGCTAAAGCAGATGTCACTGTTAATGAGCTCAGTGTTTCCTAGATATGAGAAGATGCAAGCATTTGGGCTCATAAAAATCTTGACCTGAAAATACCTAACTCTCGGAAGGCCCATTCCATCAGT. The 3 bp long sequence (TGT) marked by underline in the sequence is the missing sequence; the primer binding positions are shown in bold at the beginning and end of the sequence.

[0036] Upstream primer-F: 5'-GCTGTTCATCATTGTATGTTTCCATC-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-ACTGATGGAATGGGCCTTCC-3' (SEQ ID NO:3).

[0037] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of the InDel molecular marker associated with dewclaw overgrowth in pigs.

[0038] (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0039] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA template, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0040] PCR reaction program: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0041] (3) DNA sequence sequencing identification The PCR amplification products were purified and bidirectionally sequenced. The sequencing results were compared with the International Swine Reference Genome to determine whether there was a 3-nucleotide (TGT) deletion in the nucleotide sequence shown in SEQ ID NO:1 from position 88 to 90 from the 5' end, corresponding to positions 12224790 bp to 12224792 bp on chromosome 7 of International Swine Reference Genome Version 11.1, thus determining the genotype of the InDel molecular marker of the pig to be tested.

[0042] S2. Select pigs with the InDel molecular marker genotype ATGT / ATGT and cull pigs with the InDel molecular marker genotype A / A.

[0043] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of products that detect InDel molecular markers located on porcine chromosome 7 and associated with dewclaw overgrowth, characterized in that, The InDel molecular marker is located at rs712521922, and the application includes at least one of the following items (1) to (4): (1) Identify the dewclaw overgrowth trait in pigs; (2) Prepare products for identifying the overgrowth trait of pig hooves; (3) Pig genetic improvement, based on breeding pigs with the InDel molecular marker genotype ATGT / ATGT to reduce the incidence of pig dewclaw overgrowth; (4) Prepare a product for assisting in the genetic improvement of pigs, the product being based on the identification of the genotype of the InDel molecular marker to assist in the genetic improvement of the overgrowth trait of pig dewclaws.

2. The application according to claim 1, characterized in that, The product for detecting the InDel molecular marker located on pig chromosome 7 and associated with dewclaw overgrowth includes at least one of the following: reagents, kits, chips, and devices for detecting the InDel molecular marker.

3. The application according to claim 2, characterized in that, The reagents used to detect the InDel molecular marker include at least one of the following: primers or probes for detecting the InDel molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the InDel molecular marker include an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:2 and the nucleotide sequence of which is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pig in question is a Large White pig.

6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the InDel molecular marker on chromosome 7 of pigs that is associated with dewclaw overgrowth; (2) Select individuals with the InDel molecular marker genotype ATGT / ATGT; The InDel molecular marker site is rs712521922.

7. The genetic improvement method according to claim 6, characterized in that, In step (1), the method for determining the genotype of the InDel molecular marker located on chromosome 7 of pigs and associated with dewclaw overgrowth includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplification products were sequenced, and the genotype of the InDel molecular marker located on chromosome 7 of pigs, which is associated with dewclaw overgrowth, was determined based on the sequencing results.

8. The genetic improvement method according to claim 6 or 7, characterized in that, The pig in question is a Large White pig.