Use of homoharringtonine in the preparation of a medicament for treating dry eye

Abstract

The present disclosure discloses the use of high homoharringtonine, pharmaceutically acceptable salts thereof or plant extracts containing the same in the preparation of a medicament for treating and / or preventing dry eye.

Description

Technical Field

[0001] This disclosure relates to the field of pharmaceutical technology, and in particular to the use of homoharringtonine in the preparation of medicaments for treating dry eye. Background Technology

[0002] Dry eye is a common ophthalmic disease characterized by abnormalities in the quality, quantity, or dynamics of tears, leading to decreased tear film stability and accompanied by eye discomfort and ocular surface lesions. The causes of dry eye are complex, including insufficient tear secretion, excessive evaporation, ocular surface inflammation, abnormal neuroregulation, and environmental factors. Currently, commonly used clinical treatments mainly include artificial tear replacement therapy, anti-inflammatory treatment (such as cyclosporine A and tacrolimus), secretagogues (such as pilocarpine), and physical therapy.

[0003] Among existing dry eye treatments, artificial tears can temporarily relieve symptoms, but their effects are short-lived and they cannot fundamentally improve tear secretion or reduce ocular surface inflammation. Anti-inflammatory drugs such as cyclosporine A eye drops (e.g., Restasis®) and tacrolimus eye drops can suppress ocular surface inflammation and increase tear secretion, but they suffer from slow onset of action (usually taking weeks to months), strong local irritation, and poor patient compliance. Furthermore, some patients do not respond well to these immunosuppressants, and long-term use may pose safety risks.

[0004] In recent years, some novel compounds have been explored for the treatment of dry eye, such as tyrosine kinase inhibitors and lacrimal secretion receptor agonists. However, most of these drugs are still in the research and development stage, or have problems such as insufficient selectivity, risk of systemic absorption, and poor dosage form stability. For example, some small molecule compounds have low solubility in aqueous solutions, making it difficult to formulate stable eye drop dosage forms; some compounds have poor permeability, making it difficult to achieve effective concentrations in the target tissues of the ocular surface; and some compounds are prone to degradation during preparation or storage, affecting efficacy and safety.

[0005] Furthermore, researchers often face numerous challenges in developing single-compound treatments for dry eye. These include: ocular surface barrier limitations: the corneal and conjunctival barriers make it difficult for many compounds to penetrate to their intraocular targets, resulting in low local bioavailability; stability issues: many active compounds are easily hydrolyzed or oxidized in the aqueous environment of eye drops, requiring complex formulation techniques for stability; irritation: compounds or their excipients may cause ocular surface irritation, burning sensations, or blurred vision, affecting patient compliance; limited mechanism of action: many compounds target only a single aspect of the dry eye pathogenesis (e.g., only anti-inflammatory or only secretion-promoting), making it difficult to comprehensively improve the complex pathological state; and complex formulation processes: to improve stability or permeability, multiple excipients or complex technologies such as nano-formulations are often required, increasing production costs and the difficulty of quality control.

[0006] Therefore, there is an urgent need for a new compound that has good ocular surface permeability, stability, low irritation, and can effectively treat dry eye through a multi-target mechanism of action (such as simultaneously promoting tear secretion, inhibiting inflammation, and repairing the ocular surface), and is easy to formulate into an ophthalmic preparation with high patient compliance. Summary of the Invention

[0007] In order to solve one of the aforementioned technical problems in the prior art, this disclosure provides the use of homoharringtonine (HHT) in the preparation of medicaments for treating dry eye.

[0008] The first aspect of this disclosure provides the use of homoharringtonine, a pharmaceutically acceptable salt thereof, or a plant extract containing thereof, in the preparation of a medicament for treating and / or preventing dry eye.

[0009] In some embodiments, the plant extract is Cephalotaxus fortunei or an extract of a plant of the same genus.

[0010] In some embodiments, the drug for treating and / or preventing dry eye may be used in one or more of the following (1) to (6): (1) Used to improve corneal epithelial damage in subjects; (2) Used to improve tear film stability in subjects; (3) Used to promote tear secretion in subjects; (4) Used to improve ocular irritation or itching in subjects; (5) Used to suppress the expression levels of inflammatory factors; (6) Used to suppress the overactivation of the subject’s ocular surface innate immunity.

[0011] In some embodiments, the method of inhibiting the expression level of inflammatory factors includes inhibiting the expression level of inflammatory factors on the ocular surface of the subject.

[0012] In some embodiments, the inflammatory factors include one or more of TNF-α, IL-6, IL-1α, IL-1β, IL-8, IL-17, IL-23, and IFN-γ.

[0013] In some implementations, the subjects include mammals.

[0014] In some embodiments, the mammal includes primates or rodents.

[0015] In some implementations, the primates include humans, orangutans, or monkeys.

[0016] In some embodiments, the rodents include rats, mice, guinea pigs, hamsters, or voles.

[0017] In some embodiments, the medicament comprises a pharmaceutically acceptable carrier, and optionally also contains other pharmaceutically active agents.

[0018] In some embodiments, the homoharringtonine, its pharmaceutically acceptable salt or plant extract containing it, is provided as a separate component or as a mixed component with other pharmaceutically active agents.

[0019] In some embodiments, the other pharmaceutically active agent is a biologically active drug, such as a drug that can prevent or treat dry eye.

[0020] In some embodiments, the other pharmaceutically active agents include one or more of the following: drugs that lubricate the ocular surface and promote repair (such as artificial tears, eye drops that promote tear secretion, eye drops that promote ocular surface repair, ocular serum preparations, etc.), anti-inflammatory drugs (such as glucocorticoids, tacrolimus and cyclosporine A, NSAIDs, tetracyclines, azithromycin and fusidic acid, etc.), and antibacterial drugs (such as metronidazole, erythromycin, chlortetracycline, tetracycline drugs, macrolide drugs, etc.).

[0021] In some embodiments, the drug is an ophthalmic preparation.

[0022] In some embodiments, the ophthalmic preparation is an ophthalmic liquid preparation, an ophthalmic semi-solid preparation, or an ophthalmic solid preparation.

[0023] In some embodiments, the ophthalmic preparation is present in any of the following forms: eye drops, eye wash, intraocular injection solution, ophthalmic ointment, ophthalmic cream, ophthalmic gel, ophthalmic film, ophthalmic pill, or intraocular insertion.

[0024] In some embodiments, the pharmaceutically acceptable carrier includes pH adjusters, osmotic pressure adjusters, viscosity adjusters, antioxidants, preservatives, buffers, suspending agents, surfactants, solubilizers, wetting agents, emulsifiers, fillers, gel matrix components, or any combination thereof.

[0025] In some embodiments, the concentration of the homoharringtonine in the drug, either a pharmaceutically acceptable salt or a plant extract containing it, is 100-400 nM (e.g., 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, or 400 nM) or 0.05-0.2 μg / mL (e.g., 0.05 μg / mL, 0.10 μg / mL, 0.15 μg / mL, or 0.20 μg / mL). Wherein, when the concentration of the homoharringtonine in the drug, either a pharmaceutically acceptable salt or a plant extract containing it, is 100-400 nM, the drug is suitable for rodents, such as mice; when the concentration of the homoharringtonine in the drug, either a pharmaceutically acceptable salt or a plant extract containing it, is 0.05-0.2 μg / mL, the drug is suitable for primates, such as humans.

[0026] In some embodiments, the drug is an eye drop containing homoharringtonine, tartaric acid, propylene glycol, and PBS buffer.

[0027] In some embodiments, the concentration of the homoharringtonine is 100-400 nM (e.g., 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM or 400 nM). The concentration of tartaric acid is 0.01% - 0.3% (w / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25% or 0.30%), preferably 0.075% to 0.125% (w / v); and / or The concentration of the propylene glycol is 0.01%-0.5% (v / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.40% or 0.50%), preferably 0.225% to 0.375% (v / v).

[0028] In some embodiments, the concentration of homoharringtonine is 0.05-0.2 μg / mL (e.g., 0.05 μg / mL, 0.10 μg / mL, 0.15 μg / mL or 0.20 μg / mL). The concentration of tartaric acid is 0.01% - 0.3% (w / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25% or 0.30%), preferably 0.075% to 0.125% (w / v); and / or The concentration of the propylene glycol is 0.01%-0.5% (v / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.40% or 0.50%), preferably 0.225% to 0.375% (v / v).

[0029] In some embodiments, the pH value of the drug is 7.2-7.6 (e.g., 7.2, 7.25, 7.3, 7.35, 7.4, 7.45, 7.5, 7.55, or 7.6); and / or, The osmotic pressure of the drug is 280-320 mOsm / kg (e.g., 280, 290, 300, 310, 320 mOsm / kg).

[0030] A second aspect of this disclosure provides an ophthalmic pharmaceutical composition comprising 100-400 nM or 0.05-0.2 μg / mL of homoharringtonine, a pharmaceutically acceptable salt thereof, or a plant extract comprising it. Wherein, when the concentration of homoharringtonine, its pharmaceutically acceptable salt, or the plant extract comprising it in the pharmaceutical composition is 100-400 nM, the pharmaceutical composition is suitable for rodents, such as mice; when the concentration of homoharringtonine, its pharmaceutically acceptable salt, or the plant extract comprising it in the pharmaceutical composition is 0.05-0.2 μg / mL, the pharmaceutical composition is suitable for primates, such as humans.

[0031] In some embodiments, the plant extract is Cephalotaxus fortunei or an extract of a plant of the same genus.

[0032] In some embodiments, the ophthalmic pharmaceutical composition further comprises a pharmaceutically acceptable carrier and optional other pharmaceutically active agents.

[0033] In some embodiments, the ophthalmic pharmaceutical composition is an ophthalmic liquid formulation, an ophthalmic semi-solid formulation, or an ophthalmic solid formulation.

[0034] In some embodiments, the ophthalmic pharmaceutical composition is present in any of the following forms: eye drops, eye wash, intraocular injection solution, ophthalmic ointment, ophthalmic cream, ophthalmic gel, ophthalmic film, ophthalmic pill, or intraocular insert.

[0035] In some embodiments, the pharmaceutically acceptable carrier includes pH adjusters, osmotic pressure adjusters, viscosity adjusters, antioxidants, preservatives, buffers, suspending agents, surfactants, solubilizers, wetting agents, emulsifiers, fillers, gel matrix components, or any combination thereof.

[0036] In some embodiments, the homoharringtonine, its pharmaceutically acceptable salt or plant extract containing it, is provided as a separate component or as a mixed component with other pharmaceutically active agents.

[0037] In some embodiments, the other pharmaceutically active agent is a biologically active drug, such as a drug that can prevent or treat dry eye.

[0038] In some embodiments, the other pharmaceutically active agents include one or more of the following: drugs that lubricate the ocular surface and promote repair (such as artificial tears, eye drops that promote tear secretion, eye drops that promote ocular surface repair, ocular serum preparations, etc.), anti-inflammatory drugs (such as glucocorticoids, tacrolimus and cyclosporine A, NSAIDs, tetracyclines, azithromycin and fusidic acid, etc.), and antibacterial drugs (such as metronidazole, erythromycin, chlortetracycline, tetracycline drugs, macrolide drugs, etc.).

[0039] In some embodiments, the ophthalmic pharmaceutical composition is an eye drop containing homoharringtonine, tartaric acid, propylene glycol, and PBS buffer.

[0040] In some embodiments, the concentration of the homoharringtonine is 100-400 nM (e.g., 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM or 400 nM). The concentration of tartaric acid is 0.01% - 0.3% (w / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25% or 0.30%), preferably 0.075% to 0.125% (w / v); The concentration of the propylene glycol is 0.01%-0.5% (v / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.40% or 0.50%), preferably 0.225% to 0.375% (v / v).

[0041] In some embodiments, the concentration of homoharringtonine is 0.05-0.2 μg / mL (e.g., 0.05 μg / mL, 0.10 μg / mL, 0.15 μg / mL or 0.20 μg / mL). The concentration of tartaric acid is 0.01% - 0.3% (w / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25% or 0.30%), preferably 0.075% to 0.125% (w / v); The concentration of the propylene glycol is 0.01%-0.5% (v / v) (e.g., 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.40% or 0.50%), preferably 0.225% to 0.375% (v / v).

[0042] In some embodiments, the pH value of the pharmaceutical composition is 7.2-7.6 (e.g., 7.2, 7.25, 7.3, 7.35, 7.4, 7.45, 7.5, 7.55, or 7.6); and / or, The osmotic pressure of the pharmaceutical composition is 280-320 mOsm / kg (e.g., 280, 290, 300, 310, 320 mOsm / kg).

[0043] Compared with the prior art, this disclosure has the following beneficial effects: This disclosure provides a novel use of homoharringtonine in the preparation of medicaments for treating dry eye. Compared with existing dry eye treatment technologies, the technical solution of this disclosure achieves significant improvements in terms of mechanism of action, onset speed, comprehensiveness of efficacy, and safety potential, bringing groundbreaking beneficial effects. Attached Figure Description

[0044] Figure 1The results of tear secretion assessment are shown. A is a statistical graph of tear secretion in the positive control group at D0 and D6, B is a statistical graph of tear secretion in each group at D6, and C is a schematic diagram of the phenol red cotton thread wetting in experimental group 1 and the positive control group.

[0045] Figure 2 The results of the tear film stability assessment in Example 3 are shown, where A is a statistical graph of tear film breakup time (TBUT) of the positive control group at D0 and D6, and B is a statistical graph of tear film breakup time (TBUT) of each group at D6.

[0046] Figure 3 The results of sodium fluorescein staining of the cornea at D6 in Example 3 are shown.

[0047] Figure 4 The results of the eye-rubbing frequency statistics in Example 3 are shown, where A is the eye-rubbing frequency statistics of the positive control group at D0 and D6, and B is the eye-rubbing frequency statistics of each group at D6.

[0048] Figure 5 The results of detecting the expression levels of inflammatory factors in samples taken from D6 in Example 3 are shown.

[0049] Figure 6 The results of pharmacodynamic index detection in Example 4 are shown, where A is the result of tear secretion, B is the result of corneal fluorescein sodium staining score, C is the result of eye rubbing frequency detection, and D is the result of tear film breakup time detection.

[0050] Figure 7 The results of corneal fluorescein sodium staining in Example 4 are shown. Detailed Implementation

[0051] This disclosure provides a novel use of homoharringtonine in the preparation of medicaments for treating dry eye. Compared with existing dry eye treatment technologies, the technical solution of this disclosure achieves significant improvements in terms of mechanism of action, onset speed, comprehensiveness of efficacy, and safety potential, bringing groundbreaking beneficial effects.

[0052] Current mainstream dry eye treatments (such as cyclosporine A and tacrolimus) primarily target T-cell-mediated adaptive immunity, with limited inhibitory effects on innate immunity (such as NLRP3 inflammasomes activated by neutrophils and macrophages) and downstream multiple inflammatory pathways. This results in insufficient efficacy for some patients, especially those with dry eye caused by non-single immune factors. This disclosure utilizes homoharringtonine (HHT) to treat dry eye, achieving a multi-synergistic effect of "anti-inflammation-immunomodulation-promoting repair." Even at low concentrations, homoharringtonine effectively inhibits the expression of pro-inflammatory cytokines (such as TNF-α, IL-6, and IL-1β), thereby reducing inflammatory responses, regulating the immune environment, and promoting tissue repair, achieving multiple synergistic effects. This allows it not only to regulate adaptive immunity but also to directly and rapidly inhibit the overactivation of ocular surface innate immunity, thus more comprehensively blocking the inflammatory cascade response from its source. In some implementations, preclinical animal experiments have shown that homoharringtonine treatment can significantly promote the repair of corneal epithelial damage, achieving a shift from "simply suppressing the disease" to "actively promoting the restoration of ocular surface health and homeostasis." The synergistic effect of multiple mechanisms—"source-level anti-inflammatory + immune regulation + tissue repair"—overcomes the limitations of existing drugs with relatively simple mechanisms of action.

[0053] Existing dry eye medications, such as cyclosporine A eye drops, typically require continuous use for weeks or even months to observe significant symptom improvement, leading to poor patient compliance and a poor initial treatment experience. This disclosure utilizes homoharringtonine (HTT) to treat dry eye, significantly improving the onset of action and providing faster symptom relief. In a hyoscyamine-induced dry eye mouse model, just 5 days of treatment with homoharringtonine eye drops significantly increased tear secretion and prolonged tear film breakup time in a dose-dependent manner. This indicates that homoharringtonine can more rapidly improve the core pathophysiological functions of dry eye. A significant decrease in corneal epithelial damage scores was observed concurrently, suggesting a similarly rapid effect in promoting ocular surface repair. If this "rapid onset of action" characteristic is translated into clinical practice, it will greatly enhance patient confidence and medication adherence, filling the current market's urgent need for fast-acting dry eye treatments.

[0054] Existing medications for dry eye have limitations in terms of the comprehensiveness and intensity of their efficacy. Artificial tears only provide temporary symptom relief, secretion-stimulating drugs may have systemic side effects, and topical anti-inflammatory drugs have limited efficacy or are intolerable to some patients. This disclosure utilizes homoharringtonine (HHT) to treat dry eye, offering advantages in both the comprehensiveness and intensity of its efficacy. In the same animal model and evaluation period, homoharringtonine ophthalmic preparations (especially 100 nM HHT eye drops) showed significantly greater improvements than the model control group and the blank carrier group in key indicators such as increased tear secretion, tear film stabilization, and corneal damage repair, demonstrating powerful therapeutic efficacy. Homoharringtonine ophthalmic preparations not only improve symptoms (tear volume, BUT) but also directly target and reverse the core pathological changes of dry eye—ocular surface inflammation and damage. This intervention at the root of the disease suggests a more lasting therapeutic effect and the potential to delay disease progression.

[0055] Homoharringtonine, as an antitumor drug, is primarily limited by its systemic toxicity, such as myelosuppression. Some existing dry eye drugs also pose risks of ocular surface irritation or potential systemic absorption. This disclosure utilizes an HTT ophthalmic formulation for treating dry eye, exhibiting extremely high local safety and a therapeutic window advantage. This disclosure reveals that even extremely low local concentrations (nM levels) of homoharringtonine can effectively treat dry eye, concentrations far below those that cause cytotoxicity (μM levels). In animal experiments, the formulation at this concentration showed no ocular surface irritation. After ophthalmic instillation, homoharringtonine is primarily distributed in the cornea and conjunctiva, with extremely low concentrations in the aqueous humor and systemic blood circulation, effectively avoiding its known systemic toxicity risks. This characteristic of "high local efficacy and systemic safety" provides a fundamental guarantee for the safe clinical application of homoharringtonine. In some embodiments, this disclosure provides an ophthalmic formulation containing homoharringtonine, wherein the excipients used (low-concentration tartaric acid, propylene glycol) are acceptable or already used components in ophthalmic formulations and did not show additional toxicity in this study. Therefore, the ophthalmic formulations disclosed herein can lay a safe foundation for the future development of better clinical formulations (such as preservative-free single-dose formulations and cyclodextrin inclusions).

[0056] This disclosure, through systematic dose exploration, clarifies that 100-400 nM is the effective concentration range of homoharringtonine eye drops in preclinical animal models. Based on well-known dose conversion methods such as interspecies body surface area conversion, an effective animal concentration of 100 nM can be estimated as the equivalent dose range for human eye drops (approximately 0.05-0.2 μg / mL) (Reference: Center for Drug Evaluation (CDE), National Medical Products Administration. "Guidelines for Estimating the Maximum Recommended Starting Dose of Drugs in First Clinical Trials in Healthy Adult Volunteers"; Hugi F, Vollmer J, Renaud L, Machacek M. ASemimechanistic Ocular Pharmacokinetic Model for ADVM-022 Gene Therapy Describing the Dose-Exposure Relationship in Monkeys and the Scaling to Human. Mol Pharm. 2025 Aug 4;22(8):4612-4623. doi: 10.1021 / acs.molpharmaceut.5c00155. Epub 2025 Jul 21. PMID: 40689796.).

[0057] In summary, this disclosure innovatively applies homoharringtonine to the topical treatment of dry eye. Through its unique multi-target, potent, and rapid mechanism of action, it has demonstrated significant advantages in preclinical studies, including faster onset of action, more comprehensive efficacy, and controllable safety. This provides a promising new treatment option for dry eye patients, especially those with moderate to severe or complex dry eye conditions that do not respond well to existing therapies, and has significant clinical application value.

[0058] To make the objectives, technical solutions, and advantages of this disclosure clearer, the following detailed description is provided in conjunction with embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of this disclosure in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in numerous publications.

[0059] definition Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure pertains. For purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0060] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.

[0061] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.

[0062] The terms "dry eye" or "dry eye syndrome" used in this article are interchangeable and refer to a chronic ocular surface disease caused by multiple factors. It is caused by abnormalities in the quality, quantity, and dynamics of tears, leading to tear film instability or an imbalance in the ocular surface microenvironment. It may be accompanied by ocular surface inflammation, tissue damage, and nerve abnormalities, causing various uncomfortable ocular symptoms and / or visual impairment. Based on the causes and risk factors, dry eye can be classified into the following types: 1. Systemic factors: Many systemic diseases, especially immune system diseases and endocrine system imbalances, can lead to dry eye, such as Sjögren's syndrome, Steven-Johnson syndrome, graft-versus-host disease, various connective tissue and collagen vascular diseases, severe liver dysfunction, thyroid dysfunction, diabetes, and gout. It is more common in postmenopausal women. Other diseases such as vitamin A deficiency and androgen deficiency can also easily lead to dry eye. 2. Local factors affecting the eye include local infections and immune-related diseases, such as infectious conjunctivitis, allergic conjunctivitis, abnormal density of the subepithelial nerve fiber plexus under the corneal epithelium and basement membrane, abnormalities in the lacrimal gland, meibomian gland, ocular surface epithelial cells (goblet cells), and corneal nerve function, mite-induced blepharitis, and abnormal eyelid structure; and various causes of tear dynamics abnormalities, such as eyelid skin and conjunctival laxity, lacrimal caruncle hyperplasia, blepharospasm, and ocular acne. 3. Environmental factors: Environmental factors include air pollution, light pollution, radiation, high altitude, low humidity, and strong winds. 4. Lifestyle-related factors: Such as prolonged use of video terminals, lack of outdoor activities, prolonged near-field fixation, insufficient sleep, use of air conditioning, smoking, long-term use of contact lenses, eye makeup, and prolonged driving. 5. Surgery-related factors: These include damage and loss of the lacrimal glands, accessory lacrimal glands, meibomian glands, ocular surface epithelial cells, and corneal epithelial basement membrane subneuroplastic plexus caused by various surgeries; and abnormal tear dynamics caused by various surgeries, such as changes in the smoothness or curvature of the ocular surface, enlargement of the lacrimal duct diameter, abnormal position of the lacrimal punctum, and eyelid margin defects. Laser corneal refractive surgery and cataract extraction surgery have a higher incidence of dry eye. Most patients recover 3-6 months after surgery, but a few patients may experience prolonged dry eye. 6. Drug-related factors: These include systemic and topical medications. Systemic medications include hormone replacement therapy during menopause, antidepressants, antihistamines, anticholinergics, antipsychotics, isotretinoin, diuretics, contraceptives, and systemic chemotherapy drugs; topical medications include eye disinfectants, antiviral drugs, antiglaucoma drugs (receptor blockers, etc.), and eye drops and ointments containing preservatives. 7. Other factors: In addition to the above factors, other factors, such as anxiety and depression, can also lead to dry eye. According to the main components or functional abnormalities of tears: 1. Aqueous teardeficiency: caused by insufficient production of aqueous tears and / or abnormalities in their quality, such as dry eye caused by Sjögren syndrome and many systemic diseases.2. Lipid deficiency-related dry eye: Caused by abnormalities in the quality or quantity of the lipid layer, such as meibomian gland dysfunction, blepharitis, and various factors that increase tear evaporation. 3. Mucin deficiency-related dry eye: Caused by damage to ocular surface epithelial cells (especially goblet cells) due to various factors. Current research uses conjunctival impression cell examination and fern-like tests to assess mucin deficiency, but there is no direct clinical method to detect it. Riesling green and rose bengal staining can indirectly indicate areas lacking mucin coverage. Dry eye caused by ocular surface toxicity from medications, chemical eye trauma, thermal burns, limbal dysfunction, and prolonged contact lens use generally falls into this category. 4. Abnormal tear dynamics-related dry eye: Caused by abnormal tear dynamics, including blinking abnormalities (such as decreased blinking frequency, incomplete blinking, etc.), abnormal tear drainage, conjunctival laxity, and eyelid abnormalities. Some cases of video terminal syndrome and neuroparalytic or exposure-related incomplete eyelid closure due to various causes also belong to this type of dry eye. 5. Mixed dry eye: The most common type of dry eye in clinical practice, caused by two or more of the above reasons. The above classification is only relative. Some clinical dry eye cases, such as video terminal syndrome, have both increased evaporation factors, which can be classified as lipid abnormality dry eye, and decreased blink frequency and incomplete blinking factors, which can be classified as tear dynamics abnormality dry eye. In the later stages, some patients may also have meibomian gland dysfunction. Severe video terminal syndrome is mixed dry eye. According to the severity of signs, dry eye can be divided into the following categories. 1. Mild: No obvious signs of ocular surface damage under slit-lamp microscopy (<5 corneal fluorescein staining spots), tear film breakup time (BUT) of 2 seconds or more. 2. Moderate: Corneal damage under a slit-lamp microscope extends to no more than two quadrants and / or there are ≥5 and <30 fluorescein-stained corneal spots, with a time-to-understand (BUT) of 2 seconds or more. 3. Severe: Corneal damage under a slit-lamp microscope extends to two or more quadrants and / or there are ≥30 fluorescein-stained corneal spots, with a BUT <2 seconds. The fluorescein-stained corneal spots merge into coarse dots, patches, or are accompanied by filamentous structures. Tear secretion is an important indicator for assessing the severity of aqueous humor-deficient dry eye. Due to the poor stability and repeatability of the Schirmer test, its results are not used as an indicator for classifying the severity of dry eye. However, in some cases, it can be used as a reference indicator; for example, a Schirmer test result of 0 can be considered severe dry eye.

[0063] Those skilled in the art will understand that organic compounds can form complexes with solvents, react in the solvent, or precipitate or crystallize out of the solvent. These complexes are called "solvates." When the solvent is water, the complex is called a "hydrate." This disclosure covers all solvates of the compounds disclosed herein.

[0064] Homoharringtonine (HHT) is a natural alkaloid extracted from plants of the Cephalotaxus genus. It is a highly effective antitumor drug. Clinical studies have shown that it has good efficacy against various acute non-lymphocytic leukemias, including acute myeloid leukemia, acute monocytic leukemia, and erythroid leukemia, as well as chronic myeloid leukemia. HHT's CAS number is 26833-87-4, and its molecular formula is C2. 29 H 39 NO9, the structural formula is as follows: .

[0065] "Pharmaceutical-acceptable salts" include, but are not limited to, acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid; or acid addition salts formed with organic acids such as acetic acid, trifluoroacetic acid, propionic acid, hexanoic acid, heptanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, p-chlorobenzenesulfonic acid, p-toluenesulfonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, dodecyl sulfate, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, and stearic acid.

[0066] The term "ophthalmic preparation" as used in this article refers to sterile preparations that are directly applied to the eye to exert a therapeutic effect. Ophthalmic preparations can be divided into ophthalmic liquid preparations (eye drops, eye washes, intraocular injection solutions, etc.), ophthalmic semi-solid preparations (eye ointments, ophthalmic creams, ophthalmic gels, etc.), and ophthalmic solid preparations (ophthalmic films, ophthalmic pills, intraocular inserts, etc.). Ophthalmic liquid preparations can also be packaged in solid form with a separate solvent to prepare a solution or suspension before use. "Eye drops" refers to sterile liquid preparations made from active pharmaceutical ingredients and suitable excipients for instillation into the eye. They can be divided into solutions, suspensions, or emulsions. "Eye washes" refer to sterile, clear aqueous solutions made from active pharmaceutical ingredients, used to rinse away foreign bodies or secretions from the eye and neutralize foreign chemicals. "Intraocular injection solution" refers to a sterile liquid preparation made from a raw material drug and suitable excipients, intended for injection into the periconjunctival tissues (including subconjunctival, subfascial, and retrobulbar regions) or intraocularly (including anterior chamber injection, anterior chamber irrigation, intravitreal injection, and intravitreal infusion). "Ointment" refers to a sterile semi-solid ocular preparation made by uniformly mixing a raw material drug with a suitable matrix to form a solution or suspension. "Ocular cream" refers to a sterile semi-solid ocular preparation made by uniformly mixing a raw material drug with a suitable matrix to form a cream. "Ocular gel" refers to a gel-like sterile semi-solid ocular preparation made from a raw material drug and suitable excipients. "Ocular film" refers to a sterile drug-eluting film made from a raw material drug and a polymer, which can be placed within the conjunctival sac to slowly release the drug. "Ocular pellet" refers to a spherical or near-spherical sterile ocular solid preparation made from a raw material drug and suitable excipients. "Intraocular inserts" refer to sterile ophthalmic solid preparations of appropriate size and shape made from raw materials and suitable excipients, intended for insertion into the conjunctival sac for slow release of the drug.

[0067] As used herein, the terms “individual,” “subject,” “host,” and “patient” are used interchangeably to refer to any mammalian subject, particularly a human, in the presence of a diagnostic, therapeutic, or therapeutic agent. The compositions and methods described herein are suitable for therapeutic and veterinary applications in humans. In some respects, the subject is a mammal; in others, the subject is a human. As used herein, “mammal subject” includes all mammals, including but not limited to humans, domesticated animals (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.).

[0068] As used herein, the term “prevention” means the partial or complete delay of the onset of a disease, condition, and / or disorder; the partial or complete delay of the onset of one or more symptoms, features, or clinical manifestations of a particular disease, condition, and / or disorder; the partial or complete delay of the onset of one or more symptoms, features, or manifestations of a particular disease, condition, and / or disorder; the partial or complete delay of the progression from a particular disease, condition, and / or disorder; and / or the reduction of the risk of developing a pathology associated with a disease, condition, and / or disorder.

[0069] As used herein, the term "treatment" refers to, for example, a reduction in the severity of a disease or ailment; a shortening of the duration of a disease or ailment; an improvement or elimination of one or more symptoms associated with a disease or ailment; or providing a beneficial effect to a subject suffering from a disease or ailment, but not necessarily curing the disease or ailment. The term also includes prevention or treatment of a disease or ailment or its symptoms.

[0070] The term “pharmaceuticalally acceptable carrier” as used in this article refers to a component of a pharmaceutical preparation that is non-toxic to the subject, other than the active ingredient.

[0071] The following embodiments and accompanying drawings are provided to aid in understanding this disclosure. However, it should be understood that these embodiments and drawings are for illustrative purposes only and do not constitute any limitation. The actual scope of protection of this disclosure is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of this disclosure. The reagents and / or kits used in the following examples are commercially available or can be synthesized by known methods.

[0072] It should be noted that, unless specific conditions are specified in the examples, experimental conditions should be performed according to standard conditions, manufacturer recommendations, or publicly reported experimental conditions. Reagents or instruments whose manufacturers are not specified are all commercially available, standard products. For reagents whose manufacturers are specified, similar products from other manufacturers are substitutes.

[0073] Example 1: Preparation of eye drops 1. Materials and Methods 1.1 Compounds and Formulations A. Compounds The active ingredient used in this experiment was homoharringtonine (HHT) (MedChemExpress, USA, catalog number HY-14944), with the molecular formula C 29 H 39NO9, molecular weight 545.63 g / mol. The active pharmaceutical ingredient is a white or off-white powder, stable at room temperature, but easily affected by light. HHT has extremely low solubility in aqueous solution (<0.01 mg / mL). In this example, tartaric acid (2,3-dihydroxybutanedioic acid, molecular formula: C4H6O6, molecular weight: 150.09 g / mol) was used as the solvent to prepare the stock solution.

[0074] B. Formulation Development To meet the basic requirements for drug solubility, stability, and ocular surface tolerance in animal experiments, a preliminary formulation of HHT eye drops suitable for preclinical studies was developed. The formulation design needed to overcome the poor water solubility of HHT and ensure its chemical stability and dosing feasibility under physiological pH conditions.

[0075] 1.2 Prescription Composition and Preparation Process Preparation of stock solution: Accurately weigh HHT raw material and tartaric acid powder, dissolve in ddH2O, and dissolve with ultrasonic assistance to prepare HHT-tartaric acid stock solution with HHT concentration of 20 μM and tartaric acid concentration of 0.1% (w / v). After dispensing, store at -20℃ in the dark.

[0076] Preparation of eye drops: Take the above HHT-tartaric acid stock solution and add it to the 1% (w / v) tartaric acid and 3% (v / v) propylene glycol mixture according to the volumes shown in Table 1. Vortex mix well, and finally adjust the volume to 100 mL using PBS buffer to obtain HHT eye drops of different final concentrations. All preparations were sterilized by filtration through a 0.22 μm microporous membrane in a sterile operating table, aliquoted into sterile light-proof bottles, and stored at 4°C for later use.

[0077] Table 1. HHT Eye Drops Experimental Formulation Formula Table

[0078] The final concentration of HHT has been verified by HPLC.

[0079] Example 2: Characterization and Quality Control of Eye Drops To ensure the reliability and reproducibility of the experimental results, the following quality properties of the eye drops prepared in Example 1 were examined: 1. Content determination: The actual concentration of HHT in the eye drops prepared in Example 1 was verified by high performance liquid chromatography.

[0080] Chromatographic conditions: C18 column (4.6 × 150 mm, 5 μm), mobile phase acetonitrile-phosphate buffer (pH 3.0) (35:65, v / v), flow rate 1.0 mL / min, detection wavelength 240 nm, column temperature 30℃, injection volume 20 μL.

[0081] Sample preparation: Take an appropriate amount of eye drops, dilute it to the linear range with the mobile phase, filter it through a 0.22 μm filter membrane, and then inject the sample.

[0082] Results: The measured HHT concentration in experimental group 1 eye drops was (98.2 ± 2.1) nM, in experimental group 2 it was (202.5 ± 3.7) nM, and in experimental group 3 it was (395.8 ± 5.4) nM. The deviations between the measured and theoretical HHT concentrations in each group were within ±5%, meeting the quality control requirements.

[0083] 2. pH and osmotic pressure: pH measurement: The pH value of the eye drops prepared in Example 1 was directly measured using a calibrated pH meter.

[0084] Results: The pH of eye drops in experimental group 1 was 7.38 ± 0.05, the pH of eye drops in experimental group 2 was 7.42 ± 0.04, and the pH of eye drops in experimental group 3 was 7.35 ± 0.06. All results were stable within the range of 7.2-7.6, which is close to the physiological pH of tears.

[0085] 3. Osmotic pressure measurement: The osmometer was used to measure the osmotic pressure using the freezing point depression method.

[0086] Results: The osmotic pressure of eye drops in experimental group 1 was (295 ± 3) mOsm / kg, that of eye drops in experimental group 2 was (298 ± 4) mOsm / kg, and that of eye drops in experimental group 3 was (292 ± 5) mOsm / kg. The osmotic pressure of the eye drops in each group was within the isotonic range (approximately 280-320 mOsm / kg), which minimizes irritation to the ocular surface.

[0087] 4. Preliminary stability assessment: Each group of eye drops was dispensed into sterile eye drop bottles and stored at 4°C in the dark for 7 days.

[0088] Appearance: Observed daily, it remains clear without any sediment or turbidity.

[0089] Content variation: Samples were taken on days 0, 3, and 7, and the HHT content was determined by the HPLC method described above. After 7 days, the HHT content in each group of eye drops remained above 95% of the initial value (HHT content in experimental group 1 eye drops: 96.8%; HHT content in experimental group 2 eye drops: 97.2%; HHT content in experimental group 3 eye drops: 96.5%), indicating good stability within this experimental period.

[0090] 5. Asepticity test: After sterilization by filtration through a 0.22 μm sterile filter membrane, the eye drops in each group were tested using the membrane filtration method according to the 2020 edition of the Chinese Pharmacopoeia (General Chapter 1101). No sterile growth was observed in any of the eye drop samples, and the results met the requirements.

[0091] In this formulation, a very low proportion of tartaric acid (0.1%, w / v) was used as a co-solvent, successfully solving the solubility problem of HHT in the aqueous phase. Preliminary experiments confirmed that this concentration was non-irritating to the ocular surface of mice. Furthermore, the PBS buffer system maintained physiological pH, and the addition of propylene glycol not only served as a solubilizer to aid dispersion but also improved the ocular spreadability and retention time of the formulation by reducing surface tension, thus enhancing its stability.

[0092] Example 3: Pharmacodynamic Evaluation of Eye Drops 1. Laboratory animals and grouping Animals: Thirty 8-week-old male Balb / c mice were purchased from Beijing Vital River Company. All mice were housed under standard conditions (12-hour light / dark cycle, free access to food and water).

[0093] Grouping: Randomly divided into 5 groups, with 6 animals in each group.

[0094] Control group (also known as PBS group): dry eye model + control group eye drops from Example 1.

[0095] Experimental Group 1: Dry eye model + eye drops from Experimental Group 1 in Example 1.

[0096] Experimental Group 2: Dry eye model + eye drops from Experimental Group 2 in Example 1.

[0097] Experimental Group 3: Dry eye model + eye drops from Experimental Group 3 in Example 1.

[0098] Positive control group: Only a dry eye model was established, and no eye drops were given.

[0099] 2. Establishment of a dry eye model A classic hyoscyamine hydrobromide-induced dry eye model was used. All mice (including the control and experimental groups) were intraperitoneally injected with hyoscyamine hydrobromide solution (0.5 mg / 0.2 mL / time) at 8:00 am daily for 5 consecutive days to systematically inhibit tear secretion and simulate a dry state.

[0100] 3. Administration Regimen: Treatment began simultaneously with modeling. At 8:30, 13:30, and 18:30 daily, one drop of the corresponding eye drops (20 μL) was applied to each eye of mice in each group, sequentially. To ensure sufficient drug contact with the ocular surface, the conjunctival sac was gently opened for approximately 1 minute after instillation. Administration continued for 5 days.

[0101] 4. Pharmacodynamic evaluation indicators All assessments were conducted before the start of the experiment (Day 0, D0) and the day after the end of dosing (Day 6, D6). Assessors blinded the group assignments.

[0102] 4.1 Tear secretion (Schirmer test): After anesthetizing mice, a standard phenol red cotton thread was inserted into the conjunctival sac of the lower eyelid for 1 minute, and the length (mm) of the reddened part infiltrated by tears was measured.

[0103] 4.2 Tear film stability (tear film breakup time, TBUT): 1% sodium fluorescein was dropped onto the corneal surface of mice, and the time (in seconds) from the last blink to the appearance of the first dry spot was observed under cobalt blue light.

[0104] 4.3 Ocular surface damage (corneal fluorescein staining score): After fluorescein staining, the cornea was observed under a slit-lamp microscope. The cornea was divided into 4 quadrants, and each quadrant was scored from 0 to 3 points based on the density of punctate staining and the degree of fusion, for a total score of 0 to 12 points.

[0105] 4.4 Eye rubbing activity caused by painful stimuli Eye rubbing frequency recording: To evaluate the effect of the eye drops in this embodiment on improving ocular surface irritation or itching in dry eye model mice, the number of spontaneous eye rubbings by mice per unit time was recorded using a timed observation method. The specific steps are as follows: Adaptation and environmental setup: Before the formal experiment, mice were placed alone in a transparent observation cage for 10 minutes to adapt. The environment was kept quiet and the lighting was uniform to reduce stress interference.

[0106] Behavioral Recording: Immediately after the adaptation period, timing and observation began. A stopwatch was used to record the number of times mice directly rubbed their eye area (including the periorbital region and cheeks) with their forelimbs (single or both limbs) within 60 seconds. Each clear, complete rubbing motion was counted as one instance. Three consecutive measurements were taken for each mouse within the same time period, with at least 5 minutes between each measurement. The average value was taken as the final eye-rubbing frequency (times / 60 seconds) at that time point. This indicator was measured at the end of treatment (within 24 hours of the last administration) to assess differences between groups.

[0107] 4.5 Inflammatory factors: Detection of corneal inflammatory factor mRNA levels (real-time quantitative PCR) To quantitatively assess the inflammatory status of corneal tissue, the mRNA expression levels of key pro-inflammatory factors (TNF-α, IL-6, IL-1β) were detected. The specific steps are as follows: Sample collection and processing: After the experiments in sections 4.1-4.4, bilateral corneal tissue was aseptically harvested from mice, immediately flash-frozen in liquid nitrogen, and stored at -80°C. For testing, both corneas from the same mouse were combined and homogenized thoroughly with TRIzol reagent under ice bath conditions.

[0108] RNA extraction and reverse transcription: Total RNA was extracted from tissues using the TRIzol method. After the concentration and purity were determined by NanoDrop (A260 / A280 between 1.8 and 2.0 was considered acceptable), 1 μg of total RNA was synthesized into cDNA using a reverse transcription kit (including a gDNA removal step).

[0109] Real-time quantitative PCR: Primer sequences: The primer sequences used are as follows (5'→3'): TNF-α: Upstream primer: CCCTCACACTCAGATCATCTTCT (SEQ ID NO: 1), Downstream primer: GCTACAGGTGGGCTACAG (SEQ ID NO: 2).

[0110] IL-6: Upstream primer: TAGTCCTTCCTACCCCAATTTCC (SEQ ID NO: 3), Downstream primer: TTGGTCCTTAGCCACTCCTTC (SEQ ID NO: 4).

[0111] IL-1β: Upstream primer: GCAACTGTTCCTGAACTCAACT (SEQ ID NO: 5), Downstream primer: ATCTTTTGGGGTCCGTCAACT (SEQ ID NO: 6).

[0112] Internal reference gene (GAPDH): Upstream primer: GGAGCGAGATCCCTCCAAAAT (SEQ ID NO: 7), downstream primer: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 8).

[0113] Reaction system and procedure: Amplification was performed using the SYBR Green method in a 20 μL reaction system. Program settings: pre-denaturation at 95℃ for 30 seconds; followed by 40 cycles (95℃ for 5 seconds, 60℃ for 30 seconds).

[0114] Data analysis: The relative expression levels of each inflammatory factor mRNA were calculated using the 2^-ΔΔCt method and standardized based on the expression level of the model control group for statistical comparison between groups.

[0115] 5. Statistical Analysis Data are expressed as mean ± standard deviation. One-way ANOVA was performed using GraphPad Prism software, followed by Tukey multiple comparison tests. P A value <0.05 is considered statistically significant.

[0116] 6. Experimental Results 6.1 HHT eye drops significantly promote tear secretion in dry-eye mice Compared to the baseline value on Day 0, tear secretion in the positive control group (modeling only, no treatment) mice significantly decreased on Day 6 after hyoscyamine induction. P <0.001, confirming the successful establishment of the dry eye model ( Figure 1 (A). On Day 6, there was no significant difference in tear secretion between the PBS group and the positive control group, indicating that the blank adjuvant had no therapeutic effect. In contrast, on Day 6, all HHT treatment groups (experimental groups 1-3) showed dose-dependent improvement in tear secretion. Figure 1 (B) Among them, the recovery of tear secretion was most significant in experimental group 1, increasing by approximately 75.9% and 106.7% compared to the positive control group and PBS group, respectively. P <0.01)( Figure 1 Groups B and C). Experimental group 2 also showed significant effects ( P <0.01).

[0117] 6.2 HHT eye drops effectively stabilize the tear film and repair ocular surface damage. Tear film breakup time (TBUT): The TBUT time was significantly shorter in the positive control group. Figure 2 (A). HHT treatment significantly prolonged TBUT in a dose-dependent manner. In the experimental group 1, TBUT recovered to near-normal levels, showing a highly significant difference compared to the control groups.P <0.001)( Figure 2 (B)

[0118] Corneal fluorescein staining score (see Figure 3 The positive control group showed numerous punctate staining on the cornea and a significantly higher score. Specific scoring results are as follows (data expressed as mean ± standard deviation): Positive control group: 8.2±0.9; PBS group: 7.8 ± 0.4; Experimental group 1: 3.1±0.6; Experimental group 2: 4.7±0.8; Experimental group 3: 6.5±1.0.

[0119] Statistical analysis showed that, compared with the positive control group, all HHT treatment groups significantly reduced corneal staining scores (all P<0.01), indicating that HHT treatment dose-dependently reduced corneal staining scores. Among them, experimental group 1 had the lowest score and the most significant corneal epithelial damage repair effect (compared with the positive group, P<0.001), suggesting that it has the best corneal epithelial repair activity within the experimental dose range.

[0120] 6.3 HHT improves the frequency of eye rubbing in experimental animals (painful stimulus) The results of the eye-rubbing frequency statistics are as follows: Figure 4 The results showed that the number of times the eyes were wiped in experimental group 1 was lower than that in the PBS group, indicating that the eye drops in experimental group 1 had an ameliorative effect on the ocular surface irritation or itching in dry eye model mice.

[0121] 6.4 HHT inhibits the production of inflammatory factors See results Figure 5 The expression levels of ocular surface inflammatory factors (TNF-α, IL-6, IL-1b) in the HHT treatment group were significantly lower than those in the control group.

[0122] Example 4: Pharmacodynamic evaluation of 100 nM eye drops and comparison with existing dry eye treatments 1. Laboratory animals and grouping Animals: Thirty 8-week-old male Balb / c mice were purchased from Beijing Vital River Company. All mice were housed under standard conditions (12-hour light / dark cycle, free access to food and water).

[0123] Grouping: Randomly divided into 5 groups, with 6 animals in each group.

[0124] Control group (also known as PBS group): dry eye model + control group eye drops from Example 1.

[0125] Experimental Group 1: Dry eye model + eye drops from Experimental Group 1 in Example 1.

[0126] Experimental group 2: Dry eye model + 0.1% sodium hyaluronate eye drops (Zhenshiming).

[0127] Experimental group 3: Dry eye model + 0.05% cyclosporine eye drops (Xingqi Pharmaceutical).

[0128] Positive control group: Only a dry eye model was established, and no eye drops were given.

[0129] 2. Establishment of a dry eye model A classic hyoscyamine hydrobromide-induced dry eye model was used. All mice (including the control and experimental groups) were intraperitoneally injected with hyoscyamine hydrobromide solution (0.5 mg / 0.2 mL / time) at 8:00 am daily for 5 consecutive days to systematically inhibit tear secretion and simulate a dry state.

[0130] 3. Administration Regimen: Treatment began simultaneously with modeling. At 8:30, 13:30, and 18:30 daily, one drop of the corresponding eye drops (20 μL) was applied to each eye of mice in each group, sequentially. To ensure sufficient drug contact with the ocular surface, the conjunctival sac was gently opened for approximately 1 minute after instillation. Administration continued for 5 days.

[0131] 4. Pharmacodynamic evaluation indicators All assessments were conducted on the day following the end of dosing (Day 6). Assessors blinded the group assignments.

[0132] 4.1 Tear secretion (Schirmer test): After anesthetizing mice, a standard phenol red cotton thread was inserted into the conjunctival sac of the lower eyelid for 1 minute, and the length (mm) of the reddened part infiltrated by tears was measured.

[0133] 4.2 Tear film stability (tear film breakup time, TBUT): 1% sodium fluorescein was dropped onto the corneal surface of mice, and the time (in seconds) from the last blink to the appearance of the first dry spot was observed under cobalt blue light.

[0134] 4.3 Ocular surface damage (corneal fluorescein staining score): After fluorescein staining, the cornea was observed under a slit-lamp microscope. The cornea was divided into 4 quadrants, and each quadrant was scored from 0 to 3 points based on the density of punctate staining and the degree of fusion, for a total score of 0 to 12 points.

[0135] 4.4 Eye rubbing activity caused by painful stimuli Eye rubbing frequency recording: To evaluate the effect of the eye drops in this embodiment on improving ocular surface irritation or itching in dry eye model mice, the number of spontaneous eye rubbings by mice per unit time was recorded using a timed observation method. The specific steps are as follows: Adaptation and environmental setup: Before the formal experiment, mice were placed alone in a transparent observation cage for 10 minutes to adapt. The environment was kept quiet and the lighting was uniform to reduce stress interference.

[0136] Behavioral Recording: Immediately after the adaptation period, timing and observation began. A stopwatch was used to record the number of times mice directly rubbed their eye area (including the periorbital region and cheeks) with their forelimbs (single or both limbs) within 60 seconds. Each clear, complete rubbing motion was counted as one instance. Three consecutive measurements were taken for each mouse within the same time period, with at least 5 minutes between each measurement. The average value was taken as the final eye-rubbing frequency (times / 60 seconds) at that time point. This indicator was measured at the end of treatment (within 24 hours of the last administration) to assess differences between groups.

[0137] 5. Statistical Analysis Data are expressed as mean ± standard deviation. One-way ANOVA was performed using GraphPad Prism software, followed by Tukey multiple comparison tests. P A value <0.05 is considered statistically significant.

[0138] 6. Experimental Results The results of the tear secretion test are shown below. Figure 6 The results showed that HHT eye drops significantly promoted tear secretion in dry-eye mice.

[0139] The results of the tear film stability (tear film breakup time, TBUT) test are shown below. Figure 6 The results of the D-type corneal fluorescein sodium staining are shown in the figure. Figure 6 China B and Figure 7 The results showed that HHT eye drops effectively stabilized the tear film and repaired ocular surface damage.

[0140] The results of the eye-rubbing activity test induced by painful stimuli are shown below. Figure 6 The results showed that HHT eye drops could improve the frequency of eye rubbing (painful stimulation) in experimental animals.

[0141] The above results confirm the effectiveness of topical application of homoharringtonine (HHT) eye drops in treating dry eye in an in vivo model. The experimental results clearly demonstrate that: Clear therapeutic efficacy and dose-response: In a hyoscyamine-induced dry eye mouse model, HHT eye drops dose-dependently improved key pathological markers of dry eye—increased tear secretion, prolonged tear film stabilization time, and reduced corneal epithelial damage. A concentration of 100 nM showed optimal efficacy, providing a crucial concentration reference for subsequent formulation development.

[0142] HHT, a known protein synthesis inhibitor, has been found to effectively relieve dry eye symptoms at concentrations far below its antitumor activity (nM levels). This strongly suggests that, at low local doses, HHT may exert its therapeutic effects on dry eye or inflammation repair by inhibiting key signaling pathways in ocular surface inflammation, rather than through cytotoxic effects.

[0143] Compared to current first-line medications such as cyclosporine A or tacrolimus eye drops, the HHT eye drops in this embodiment showed significant functional improvements (tear secretion and TBUT) within a short 5-day treatment course. This suggests that HHT has the potential advantage of faster onset of action.

[0144] The results of this embodiment show that there was no difference in damage scores between the PBS group and the positive control group, indicating that HHT eye drops prepared using PBS solution containing trace amounts of tartaric acid and propylene glycol as a carrier have no obvious irritation to the ocular surface.

[0145] In summary, the data from this embodiment strongly support the novel use of homoharringtonine in the preparation of eye drops for the treatment of dry eye.

[0146] The technical solutions disclosed herein are not limited to the specific embodiments described above. Any technical modifications made based on the technical solutions disclosed herein shall fall within the protection scope of this disclosure.

Claims

1. Use of homoharringtonine, its pharmaceutically acceptable salts, or plant extracts containing it, in the preparation of medicaments for the treatment and / or prevention of dry eye.

2. The use according to claim 1, characterized in that, The medication for treating and / or preventing dry eye may be used in one or more of the following (1) to (6): (1) Used to improve corneal epithelial damage in subjects; (2) Used to improve tear film stability in subjects; (3) Used to promote tear secretion in subjects; (4) Used to improve ocular irritation or itching in subjects; (5) Used to suppress the expression levels of inflammatory factors; (6) Used to suppress the overactivation of the subject’s ocular surface innate immunity.

3. The use according to claim 2, characterized in that, The method for inhibiting the expression levels of inflammatory factors includes inhibiting the expression levels of inflammatory factors on the ocular surface of the subject.

4. The use according to claim 2, characterized in that, The inflammatory factors include one or more of TNF-α, IL-6, and IL-1β.

5. The use according to claim 1, characterized in that, The drug contains a pharmaceutically acceptable carrier. The drug may optionally also contain other pharmaceutically active agents.

6. The use according to claim 1, characterized in that, The drug is an ophthalmic preparation.

7. The use according to claim 1, characterized in that, The pharmaceutically acceptable carriers include pH adjusters, osmotic pressure adjusters, viscosity adjusters, antioxidants, preservatives, buffers, suspending agents, surfactants, solubilizers, wetting agents, emulsifiers, fillers, gel matrix components, or any combination thereof.

8. The use according to claim 1, characterized in that, The concentration of the homoharringtonine alkaloid in the drug, either a pharmaceutically acceptable salt or a plant extract containing it, is 100-400 nM or 0.05-0.2 μg / mL.

9. The use according to claim 1, characterized in that, The drug is an eye drop containing homoharringtonine, tartaric acid, propylene glycol, and PBS buffer.

10. The use according to claim 9, characterized in that, The pH value of the drug is 7.2-7.6; and / or, The osmotic pressure of the drug is 280-320 mOsm / kg.

11. An ophthalmic pharmaceutical composition comprising 100-400 nM or 0.05-0.2 μg / mL of homoharringtonine, a pharmaceutically acceptable salt thereof, or a plant extract comprising thereof.

12. The ophthalmic pharmaceutical composition according to claim 11, characterized in that, The ophthalmic pharmaceutical composition also includes a pharmaceutically acceptable carrier and optional other pharmaceutically active agents.

Images