Compositions and methods for treating GJB2-related hearing loss

Nucleic acid vectors with regulatory elements for targeted GJB2 protein expression in GJB2-expressing cells address off-target issues in gene therapy, effectively treating GJB2-related hearing loss.

JP2026518994APending Publication Date: 2026-06-11DECIBEL THERAPEUTICS INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025567632
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-18
Filing Date
2024-05-17
Publication Date
2026-06-11

AI Technical Summary

Technical Problem

Existing gene therapy approaches for GJB2-related hearing loss face challenges due to off-target effects and toxicity, as GJB2 is endogenously expressed in diverse inner ear cell types, necessitating targeted gene expression therapies with minimal off-target effects.

Method used

Development of nucleic acid vectors containing regulatory elements that induce wild-type GJB2 protein expression in GJB2-expressing cells, with reduced CG dinucleotide content and high sequence identity, to promote targeted gene expression with minimal off-target effects.

Benefits of technology

The nucleic acid vectors effectively induce wild-type GJB2 protein expression in GJB2-expressing cells, potentially treating or preventing hearing loss with reduced off-target effects and improved safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026518994000001_ABST
    Figure 2026518994000001_ABST
Patent Text Reader

Abstract

This disclosure provides polynucleotides and nucleic acid vectors containing gap junction protein beta-2 (GJB2) regulatory constructs operably linked to polynucleotides encoding the Gjb2 protein (e.g., wild-type human Gjb2 protein). These polynucleotides and vectors can be used to express Gjb2 in GJB2-expressing cells, including cochlear support cells, and can therefore be used to treat subjects who have or are at risk of developing GJB2-related hearing loss.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence List This application includes a sequence listing submitted electronically in XML file format, the entirety of which is incorporated herein by reference. The XML copy, created on 8 May 2024, is named 51471-015WO2_Sequence_Listing_5_8_24.xml and has a size of 128,752 bytes. [Background technology]

[0002] Hearing loss is a major public health problem, estimated to affect nearly 15% of school-aged children and one in three people up to age 65. The most common type of hearing loss is sensorineural hearing loss, which is a type of hearing loss caused by a defect in inner ear cells, such as cochlear hair cells and cochlear supporting cells, or in the nerve pathways that project from the inner ear to the brain. Sensorineural hearing loss is often acquired, but can also be caused by genetic mutations. Mutations in the GJB2 gene, which encodes the gap junction protein beta-2 (Gjb2, also known as Connexin 26), are the most common cause of genetically modified sensorineural hearing loss.

[0003] In recent years, efforts to treat hearing loss have increasingly focused on gene therapy as a possible solution, but GJB2 is endogenously expressed in a diverse range of inner ear cell types, which has proven difficult to specifically target. Gene therapy approaches to hearing loss that induce the expression of exogenous genes in all inner ear cells are a cause for concern because they may have off-target effects or be toxic. Therefore, new therapies are needed for the treatment of GJB2-related hearing loss. [Overview of the project]

[0004] The present invention provides compositions and methods for promoting the expression of genes encoding wild-type gap junction protein beta-2 (Gjb2) protein, such as a CpG-depleted GJB2 gene, a codon-optimized GJB2 gene, or a CpG-depleted and codon-optimized GJB2 gene, in GJB2-expressing cells (e.g., GJB2-expressing ear cells). The compositions described herein comprise a nucleic acid vector containing a regulatory element capable of inducing the expression of a transgene encoding wild-type Gjb2 protein in GJB2-expressing cells with minimal off-target expression in non-GJB2-expressing cells. Accordingly, the compositions described herein can be administered to subjects such as human subjects to induce the expression of wild-type Gjb2 protein in GJB2-expressing cells (e.g., GJB2-expressing ear cells, e.g., subjects with mutations in GJB2), and / or to treat or prevent hearing loss (e.g., sensorineural hearing loss such as GJB2-associated hearing loss).

[0005] In a first aspect, the present invention relates to a GJB2 regulatory construct having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2, operably linked in the order of 5' to 3' in (a) and (b), and a GJB2 regulatory construct having at least 90% sequence identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, SEQ ID NO: 3, operably linked in (b) and (c), The present invention provides a nucleic acid vector comprising (c) a human GJB2 coding sequence selected from the group including a sequence having sequence identity (c) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less CG dinucleotides) and a sequence having at least 90% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity), and (c) a polyadenylated (polyA) signal sequence.

[0006] In another embodiment, the present invention provides a polynucleotide comprising a human GJB2 coding sequence selected from the group comprising sequences having at least 90% sequence identity to SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, and SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less CG dinucleotides), and sequences having at least 90% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or less sequence identity). In some embodiments, a GJB2 promoter is operably linked to the GJB2 coding sequence. In some embodiments, the GJB2 promoter is located at 5' of the GJB2 coding sequence. In some embodiments, the GJB2 promoter is contained within the GJB2 regulatory construct. In some embodiments, the GJB2 coding sequence is operably coupled to a poly(A) signal sequence. In some embodiments, the poly(A) signal sequence is located at 3' of the GJB2 coding sequence.

[0007] In another embodiment, the present invention provides a nucleic acid vector containing the polynucleotide described above.

[0008] In some embodiments of the aforementioned aspects, the GJB2 regulatory construct has at least 90% sequence identity with respect to the sequence of sequence number 1 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of the aforementioned aspects, the GJB2 regulatory construct has the sequence of sequence number 1.

[0009] In some embodiments of the aforementioned aspects, the GJB2 regulatory construct has at least 90% sequence identity with respect to the sequence of sequence number 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of the aforementioned aspects, the GJB2 regulatory construct has the sequence of sequence number 2.

[0010] In some embodiments of the aforementioned aspects, the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides). In some embodiments of the aforementioned aspects, the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and does not contain CG dinucleotides. In some of the embodiments described above, the human GJB2 code sequence has the sequence of sequence number 3.

[0011] In some embodiments of the aforementioned aspects, the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of sequence number 4 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of the aforementioned aspects, the human GJB2 coding sequence has the sequence of sequence number 4.

[0012] In some embodiments of the aforementioned aspects, the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of sequence number 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments of the aforementioned aspects, the human GJB2 coding sequence has the sequence of sequence number 28.

[0013] In some of the embodiments described above, the stop codon is located at 3' in the GJB2 code sequence (for example, the stop codon is directly concatenated to the 3' end of the GJB2 code sequence).

[0014] In some of the embodiments described above, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3. In some of the embodiments described above, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4. In some of the embodiments described above, the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28. In some of the embodiments described above, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3. In some of the embodiments described above, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4. In some of the embodiments described above, the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0015] In some embodiments of the aforementioned aspects, the polyA signal sequence has at least 90% sequence identity with respect to the sequence of sequence number 6 or sequence number 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, the polyA signal sequence has at least 90% sequence identity with respect to the sequence of sequence number 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, the polyA signal sequence has the sequence of sequence number 6. In some embodiments, the polyA signal sequence has at least 90% sequence identity with respect to the sequence of sequence number 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, the poly-A signal sequence has the sequence of sequence number 7.

[0016] In some embodiments of the aforementioned aspects, the nucleic acid vector or polynucleotide further comprises a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), which contains a first member of an inverted terminal repeat (ITR) pair and is located at 5' of the GJB2 regulatory construct sequence or the GJB2 promoter sequence; and a second polynucleotide having at least 90% sequence identity to SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), which contains a second member of the ITR pair and is located at 3' of the poly-A signal sequence. In some embodiments, the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0017] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide further comprises: a first polynucleotide containing a first member of an ITR pair and positioned at 5' of the GJB2 regulatory construct sequence or GJB2 promoter sequence, having at least 90% sequence identity to SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity); and a second polynucleotide containing a second member of an ITR pair and positioned at 3' of the poly-A signal sequence, having at least 90% sequence identity to SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0018] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157-2383 of SEQ ID NO: 12. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1-2531 of SEQ ID NO: 12.

[0019] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157-2383 of SEQ ID NO: 13. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1-2531 of SEQ ID NO: 13.

[0020] In some embodiments of the aforementioned aspects, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157 to 3459 of SEQ ID NO: 14. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 3607 of SEQ ID NO: 14.

[0021] In some embodiments of the aforementioned aspects, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157 to 3459 of SEQ ID NO: 15. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 3607 of SEQ ID NO: 15.

[0022] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157-2462 of SEQ ID NO: 16. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1-2610 of SEQ ID NO: 16.

[0023] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157 to 2462 of SEQ ID NO: 17. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 2610 of SEQ ID NO: 17.

[0024] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157-3538 of SEQ ID NO: 18. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1-3686 of SEQ ID NO: 18.

[0025] In some embodiments of the aforementioned aspects, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 157-3538 of SEQ ID NO: 19. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1-3686 of SEQ ID NO: 19.

[0026] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 2438 of SEQ ID NO: 20. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 2650 of SEQ ID NO: 20.

[0027] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 2438 of SEQ ID NO: 21. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 2650 of SEQ ID NO: 21.

[0028] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 3514 of SEQ ID NO: 22. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 3726 of SEQ ID NO: 22.

[0029] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 3514 of SEQ ID NO: 23. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 3726 of SEQ ID NO: 23.

[0030] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 2517 of SEQ ID NO: 24. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 2729 of SEQ ID NO: 24.

[0031] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 2517 of SEQ ID NO: 25. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 2729 of SEQ ID NO: 25.

[0032] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 3593 of SEQ ID NO: 26. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 3805 of SEQ ID NO: 26.

[0033] In some embodiments of the aforementioned models, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 212 to 3593 of SEQ ID NO: 27. In some embodiments, the nucleic acid vector or polynucleotide contains a polynucleotide sequence comprising nucleotides 1 to 3805 of SEQ ID NO: 27.

[0034] In some embodiments of the aforementioned aspects, the nucleic acid vector is a viral vector, plasmid, cosmid, or artificial chromosome. In some embodiments, the nucleic acid vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentiviral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S capsid. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has a PHP.S capsid. In some embodiments, the AAV vector has an AAV-DJ capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has an Anc80L65 capsid. In some embodiments, the AAV vector has an AAV2 capsid. In some embodiments, the AAV vector has an AAV2quad(YF) capsid. In some embodiments, the AAV vector has a PHP.eB capsid. In some embodiments, the AAV vector has an AAV3 capsid. In some embodiments, the AAV vector has an AAV4 capsid. In some embodiments, the AAV vector has an AAV5 capsid. In some embodiments, the AAV vector has an AAV6 capsid. In some embodiments, the AAV vector has an AAV7 capsid. In some embodiments, the AAV vector has an AAV8 capsid. In some embodiments, the AAV vector has a PHP.B capsid.

[0035] In another embodiment, the present invention provides a composition containing a nucleic acid vector from any of the embodiments and models described above. In some embodiments, the composition further includes a pharmaceutically acceptable carrier, diluent, or excipient.

[0036] In another embodiment, the present invention provides cells containing any of the polynucleotides or vectors described above. In some embodiments, the cells are GJB2-expressing cells. In some embodiments, the cells are GJB2-expressing inner ear cells. In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the cells are cochlear support cells.

[0037] In another embodiment, the present invention provides a method for expressing human GJB2 in GJB2-expressing cells by contacting the GJB2-expressing cells with a nucleic acid vector or composition of any of the embodiments and models described above. In some embodiments, the GJB2-expressing cells are GJB2-expressing ear cells (e.g., cochlear support cells). In some embodiments, the contact is performed inside the subject (e.g., in vivo).

[0038] In another embodiment, the present invention provides a method for treating a subject who has or is at risk of developing GJB2-associated hearing loss by administering a therapeutically effective amount of any nucleic acid vector composition from the aforementioned embodiments and models to the inner ear of the subject. In some embodiments, the GJB2-associated hearing loss is hearing loss associated with DFNB1, DFNA3, or Bart-Pumphrey syndrome, porcupine-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratosis with deafness, or Vohwinkel syndrome. In some embodiments, the GJB2-associated hearing loss is DFNB1 or DFNA3. In some embodiments, the subject has a mutation in GJB2, a mutation in GJB6, or a mutation in both GJB2 and GJB6.

[0039] In another embodiment, the present invention provides a method for improving the function or survival of cochlear support cells by contacting the cochlear support cells with a nucleic acid vector or composition of any of the embodiments or models described above. In some embodiments, the contact is performed inside the subject.

[0040] In another aspect, the present invention provides a method for improving the function or survival of cochlear supporting cells in subjects who require improvement of the function or survival of cochlear supporting cells by administering a therapeutically effective amount of any nucleic acid vector or composition from any of the above-described aspects and embodiments to the inner ear of the subject.

[0041] In some embodiments of the aforementioned models, the subjects have or are at risk of developing GJB2-related hearing loss. In some embodiments, the GJB2-related hearing loss is hearing loss associated with DFNB1, DFNA3, or Bart-Pumphrey syndrome, porcupine-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratosis with deafness, or Vohwinkel syndrome. In some embodiments, the hearing loss is DFNB1 or DFNA3.

[0042] In some embodiments of the aforementioned models, the cochlear supporting cells are mammalian cochlear supporting cells. In some embodiments, the mammalian cochlear supporting cells are human cochlear supporting cells.

[0043] In some embodiments of the aforementioned aspects, the method further includes evaluating the subject's hearing before administering the nucleic acid vector or composition.

[0044] In some embodiments of the aforementioned aspects, the method further includes evaluating the hearing of the subject after administering a nucleic acid vector or composition.

[0045] In some embodiments of the aforementioned models, the nucleic acid vector or composition is administered topically. In some embodiments, the nucleic acid vector or composition is administered into the inner ear. In some embodiments, the nucleic acid vector or composition is administered into the middle ear. In some embodiments, the nucleic acid vector or composition is administered transtympanically or intratympanically. In some embodiments, the nucleic acid vector or composition is administered into the perilymph. In some embodiments, the nucleic acid vector or composition is administered into the endolymph. In some embodiments, the nucleic acid vector or composition is administered into or via the oval window. In some embodiments, the nucleic acid vector or composition is administered into or via the round window.

[0046] In some embodiments of the aforementioned models, the nucleic acid vector or composition is administered in an amount sufficient to prevent or reduce hearing loss, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing, increase or induce human GJB2 expression in GJB2-expressing cells, promote or increase cochlear supporting cell survival, or improve cochlear supporting cell function.

[0047] In some of the embodiments described above, the subject is a human subject.

[0048] In another aspect, the present invention provides a kit comprising a polynucleotide, nucleic acid vector, or composition from any of the above-described aspects and embodiments.

[0049] definition As used herein, the term “approximately” refers to a value that is 10% above or below the stated value.

[0050] As used herein, “administration” means providing or giving a therapeutic agent (e.g., a nucleic acid vector containing a GJB2 regulatory construct operably ligated to a polynucleotide encoding the wild-type GJB2 protein) to a subject by any effective route. Exemplary routes of administration are described herein below.

[0051] As used herein, the expression “administering to the inner ear” means providing or administering the therapeutic agent described herein to a subject by any route that enables transduction into inner ear cells. Exemplary routes of administration to the inner ear include administration into or via the perilymph or endolymph, e.g., the oval window, round window, or semicircular canals (e.g., the horizontal semicircular canal), or administration by transtympanic or intratympanic injection, e.g., administration to GJB2-expressing inner ear cells.

[0052] As used herein, the term “cell type” refers to a group of cells that share a phenotype that is statistically separable based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of a common cell type may include those isolated from a common tissue (e.g., epithelial tissue, nerve tissue, connective tissue, or muscle tissue), and / or those isolated from a common organ, tissue system, blood vessel, or other structure and / or region in an organism.

[0053] As used herein, the terms “conservative mutation,” “conservative substitution,” and “conservative amino acid substitution” refer to the substitution of one or more amino acids with one or more different amino acids that exhibit similar physicochemical properties, such as polarity, static charge, and stereovolume. These properties are summarized in Table 1 for each of the 20 naturally occurring amino acids. [Table 1]

[0054] From this table, it can be understood that the conserved amino acid families include (i) G, A, V, L, and I, (ii) D and E, (iii) C, S, and T, (iv) H, K, and R, (v) N and Q, and (vi) F, Y, and W. Therefore, a conserved mutation or substitution is one in which one amino acid is replaced with a member of the same amino acid family (for example, replacing Ser with Thr or Lys with Arg).

[0055] Where used herein, the terms “effective dose,” “therapeutic effective dose,” and “sufficient dose” of a composition, vector construct, or viral vector described herein refer to an amount sufficient to achieve a beneficial or desired outcome, including a clinical outcome, when administered to a subject, including a mammal, e.g., a human. Therefore, “effective dose” or its synonyms depends on the context in which it is applied. For example, in the context of treating sensorineural hearing loss, it is the amount of a composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to a response obtained without administration of the composition, vector construct, or viral vector. The amount of a given composition described herein that corresponds to such a dose will vary depending on various factors, e.g., a given drug, pharmaceutical formulation, route of administration, type of disease or disorder, characteristics of the subject or host being treated (e.g., age, sex, weight), but nevertheless, it can be routinely determined by a person skilled in the art. Where used herein, the “therapeutic effective dose” of a composition, vector construct, or viral vector disclosed herein is the amount that produces a beneficial or desired outcome in a subject compared to a control. As defined herein, the therapeutically effective dose of any composition, vector construct, or viral vector of this disclosure can be readily determined by routine methods known in the art to those skilled in the art. The administration regimen may be adjusted to provide an optimal therapeutic response.

[0056] As used herein, the term “endogenous” refers to a molecule (e.g., polypeptide, nucleic acid, or cofactor) that is found naturally in a particular organism (e.g., human) or in a particular location within an organism (e.g., an organ, tissue, or human cell, such as a human cochlear support cell).

[0057] As used herein, the term “expression” refers to one or more of the following events: (1) the generation of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) the translation of RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein. The term “expression product” refers to a protein or RNA molecule produced by any of these events.

[0058] As used herein, the term “exogenous” refers to molecules (e.g., polypeptides, nucleic acids, or cofactors) that are not found naturally in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or human cell, such as a human cochlear support cell). Exogenous substances include substances supplied from an external source to an organism or a culture extracted therefrom.

[0059] As used herein, the terms “Gjb2” and “GJB2” (also known as connexin 26 and CX26) refer to the protein encoded by the GJB2 gene and the gene encoding this protein, respectively. GJB2 is a member of the connexin gene family. Nearly half of all hearing loss cases are due to mutations in one of the four members of the connexin gene family, with GJB2 mutations being the most common. More than 100 different mutations in GJB2 have been identified that cause asymptomatic hearing loss, which is hearing loss not associated with other signs and symptoms. The term "Gjb2" refers to wild-type Gjb2 proteins, such as the wild-type human Gjb2 protein (e.g., the protein having the amino acid sequence of SEQ ID NO: 29), while the term "GJB2" also refers to codon-optimized and / or CpG-depleted polynucleotides relative to the sequence of the wild-type GJB2 gene (e.g., SEQ ID NO: 5), provided that they encode the wild-type Gjb2 protein and have at least 90% sequence identity to one of SEQ ID NOs: 3, 4, and 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% sequence identity, or higher).

[0060] As used herein, the term “GJB2-expressing cells” refers to cell types in the body known to endogenously express GJB2 (for example, in subjects expressing a wild-type copy of GJB2). Examples of GJB2-expressing cells include esophageal epithelial cells, cervical cells (cervical cervix), cells of minor salivary glands, cutaneous epithelial cells, vaginal epithelial cells, respiratory epithelial cells, hepatocytes, renal epithelial cells, testicular cells, mammary luminal epithelial cells, pancreatic acinar cells, bladder urothelial cells, intestinal epithelial cells, and GJB2-expressing inner ear cells. The term “GJB2-expressing cells” encompasses the same cell types in subjects with mutations in GJB2.

[0061] As used herein, the term “GJB2-expressing inner ear cells” refers to cells in the inner ear that endogenously express GJB2 (for example, in subjects expressing a wild-type copy of GJB2). Inner ear GJB2-expressing cells are found in both the cochlea and the vestibule. Cochlear GJB2-expressing cells include internal phalangeal cells, internal border cells, internal column cells, external column cells, Deiter cells, Hensen's cells, Claudius cells, interdental cells, internal groove cells, external groove cells, spiral rim cells, spiral ridge cells, root cells, striae basal cells, striae vascularis intermediate cells, spiral rim and spiral ligament fibrous cells, and mesenchymal cells lining the vestibular scala. Vestibular GJB2-expressing cells include supporting cells, dark cells, fibrous cells, and mesenchymal cells. The term “GJB2-expressing inner ear cells” encompasses the same cell types in subjects with mutations in GJB2.

[0062] As used herein, the term “GJB2 regulatory construct” means a polynucleotide or a variant thereof that can specifically express a transgene in GJB2-expressing cells, such as a polynucleotide having at least 85% sequence identity to the GJB2 regulatory constructs described herein (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). The GJB2 regulatory constructs of this disclosure comprise one or more regulatory elements, such as a GJB2 promoter and a GJB2 enhancer, and have at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0063] As used herein, the term “GJB2-associated hearing loss” refers to diseases and conditions characterized by hearing loss associated with mutations in GJB2, including DFNB1, characterized by moderate to profound pre-acquisition hearing loss and inherited in an autosomal recessive pattern, and DFNA3, characterized by moderate to severe pre-acquisition or post-acquisition hearing loss that worsens over time and inherited in an autosomal dominant pattern. GJB2-associated hearing loss also occurs in Bart-Pumphrey syndrome, porcupine-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, and Vohwinkel syndrome, all of which are characterized by hearing loss and skin abnormalities and are associated with mutations in GJB2. The two types of GJB2-associated hearing loss, DFNB1 and DFNA3, may also be associated with mutations in GJB6, either alone or in combination with mutations in GJB2. For example, a subject possessing DFNB1 may have mutations in GJB2, GJB6, or both genes.

[0064] As used herein, the term “heterogeneic” refers to a combination of elements that do not exist in nature. For example, a heterogeneic transgene refers to a transgene that is not expressed in nature by a promoter to which it is activatably linked.

[0065] As used herein, the terms “increase” and “decrease” refer to adjusting to a greater or lesser amount of the function, expression, or activity of an indicator relative to a reference. For example, after administration of a composition by the method described herein, the amount of an indicator marker as described herein (e.g., transgene expression, ABR, or DPOAE) may increase or decrease in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% or more relative to the amount of the marker before administration. Generally, the indicator is measured post-administration when the administration has had the enumerated effect, for example, at least one week, one month, three months, or six months after the start of the treatment regimen.

[0066] As used herein, “topically” or “topically administered” means administration to a specific site of the body where a local effect, rather than a systemic effect, is intended. Examples of topical administration include administration to the epithelium, by inhalation, intra-articular, subarachnoid, vagina, intravitreal, intrauterine, lesion, lymph node, tumor, inner ear, and mucous membrane of the subject, where the administration is intended to have a local effect, rather than a systemic effect.

[0067] As used herein, the term “operably linked” refers to a first molecule linked to a second molecule such that the first molecule influences the function of the second molecule. The two molecules may or may not be part of a single contiguous molecule, and may or may not be adjacent. For example, a promoter is operably linked to a transcribed polynucleotide molecule if the promoter regulates the transcription of a desired transcribed polynucleotide molecule within a cell. In addition, two parts of a transcriptional regulatory element are operably linked to each other if they are linked in such a way that the transcriptional activation functionality of one part is not adversely affected by the presence of the other part. The two transcriptional regulatory elements may be operably linked to each other by a linker polynucleotide (e.g., an intervening non-coding polynucleotide) or operably linked to each other without an intervening nucleotide.

[0068] As used herein, the term “plasmid” refers to an extrachromosomal circular double-stranded DNA molecule into which additional DNA segments may be ligated. A plasmid is a type of vector, a nucleic acid molecule that can transport another nucleic acid to which it is ligated. Certain plasmids are capable of autonomous replication in the host cell into which they are introduced (e.g., bacterial plasmids with bacterial origins of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be incorporated into the host cell's genome upon introduction into the host cell, thereby replicating with the host genome. Certain plasmids can direct the expression of genes to which they are operably ligated.

[0069] As used herein, the terms “nucleic acid” and “polynucleotide” as used synonymously herein refer to polymeric forms of nucleosides of any length. Typically, polynucleotides consist of nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) that are naturally found in DNA or RNA joined by phosphodiester bonds. However, the term also encompasses molecules containing nucleosides or nucleoside analogs that include chemically or biologically modified bases, modified skeletons, etc., whether or not they are found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. When this application refers to polynucleotides, it is understood that both DNA and RNA, and in each case, both single-stranded and double-stranded forms (as well as complementary strands of each single-stranded molecule) are provided. As used herein, “polynucleotide sequence” may refer to the polynucleotide material itself and / or sequence information (i.e., a series of letters used as abbreviations for bases) that biochemically characterize a particular nucleic acid. Unless otherwise indicated, the polynucleotide sequences presented herein are presented in the 5′ to 3′ direction.

[0070] As used herein, the term “promoter” refers to a recognition site on DNA to which RNA polymerase is bound. Polymerase drives the transcription of the transgene.

[0071] The “sequence identity percentage (%)” with respect to a reference polynucleotide or reference polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or reference polypeptide sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum sequence identity percentage. Alignment for the purpose of determining nucleic acid or amino acid sequence identity percentage can be achieved in various ways within the capabilities of a person skilled in the art, for example, using readily available computer software such as BLAST, BLAST-2, or Megalign software. A person skilled in the art can determine appropriate parameters for aligning sequences, including any algorithm necessary to achieve the maximum alignment over the entire length of the sequences being compared. For example, a sequence identity percentage value can be generated using the sequence comparison computer program BLAST. As an example, the sequence identity percentage of a given nucleic acid or amino acid sequence A to, with, or against a given nucleic acid or amino acid sequence B (alternatively, it can be expressed as a given nucleic acid or amino acid sequence A having a specific sequence identity percentage to, with, or against a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(fraction X / Y) In the formula, X is the number of nucleotides or amino acids scored as identical by a sequence alignment program (e.g., BLAST) in the program alignment of A and B, and Y is the total number of nucleic acids in B. It will be understood that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the sequence identity percentage of A to B will not be equal to the sequence identity percentage of B to A.

[0072] As used herein, the term “pharmaceutical composition” means a mixture containing, optionally, one or more pharmaceutically acceptable excipients, diluents, and / or carriers, a therapeutic agent administered to a subject such as a mammal, e.g., a human, for the purpose of preventing, treating, or controlling a particular disease or condition that affects or may affect the subject.

[0073] As used herein, the term “pharmaceutically acceptable” means a compound, material, composition and / or dosage form that is suitable for contact with the tissues of a subject, such as mammals (e.g., humans), without complications of excessive toxicity, irritation, allergic response and other problems commensurate with a reasonable benefit / risk ratio. Preferably, the term “pharmaceutically acceptable” means that it is approved by a federal or state regulatory agency or is listed in the United States Pharmacopeia or other generally accepted pharmacopoeias for use in mammals, more specifically in humans.

[0074] As used herein, the term “sample” refers to a specimen isolated from a subject (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villi specimens, and cells).

[0075] As used herein, the terms “subject” and “patient” refer to animals (e.g., mammals such as humans). Subjects treated according to the methods described herein may be subjects diagnosed with sensorineural hearing loss (e.g., GJB2-associated hearing loss) or subjects at risk of developing this condition (e.g., due to genetic mutation). Diagnosis may be performed by any method or technique known in the art. Those skilled in the art will understand that subjects treated according to this disclosure may have undergone standard testing or may have been identified as subjects at risk due to the presence of one or more risk factors associated with the disease or condition, even if they have not been tested.

[0076] As used herein, the terms “transcriptional regulatory element” and “regulatory sequence” refer to polynucleotides that, at least in part, regulate the transcription of a gene of interest. Transcriptional regulatory elements may include promoters, enhancers, and other polynucleotides (e.g., polyadenylation signals) that regulate or assist in the regulation of gene transcription. Examples of transcriptional regulatory elements are described, for example, in Lorence, Recombinant Gene Expression: Reviews and Protocols (Humana Press, New York, NY, 2012).

[0077] As used herein, the term “transfection” refers to any of the many techniques commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, nucleofection, squeeze-poration, acoustic perforation, optical transfection, magnetofection, and impalefection.

[0078] As used herein, the terms “transduction” and “transduce” refer to a method of introducing a vector construct or a portion thereof into a cell. When the vector construct is contained in a viral vector, such as an AAV vector, transduction refers to the viral infection of the cell, as well as the subsequent transfer and integration of the vector construct or a portion thereof into the cell genome.

[0079] As used herein, “treatment” and “treating” with respect to a disease or condition mean an approach to obtain a beneficial or desired outcome, such as a clinical outcome. Beneficial or desired outcomes may include, but are not limited to, alleviation or improvement of one or more symptoms or conditions, whether detectable or undetectable; reduction of the severity of the disease or condition; a stable (i.e., non-worsening) state of the disease, disorder, or condition; prevention of the progression of the disease or condition; delay or slowing of the progression of the disease or condition; improvement or alleviation of the disease or condition; and remission (whether partial or complete). To “improve” or “alleviate” a disease or condition means that the severity and / or undesirable clinical signs of the disease, disorder, or condition are reduced and / or the time course of progression is slowed or prolonged compared to the degree or time course without treatment. “Treatment” may also mean extending survival compared to the expected survival time without treatment. Those who require treatment include those who already have the condition or disorder, as well as those who are susceptible to the condition or disorder, or those for whom prevention of the condition or disorder is desirable.

[0080] As used herein, the term “vector” refers to nucleic acid vectors, such as DNA vectors like plasmids, cosmids, or artificial chromosomes, RNA vectors, viruses, or any other suitable replicons (e.g., viral vectors). A variety of vectors have been developed for delivering polynucleotides encoding exogenous proteins to prokaryotic or eukaryotic cells. Examples of such expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). Expression vectors suitable for use in the compositions and methods described herein contain polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Certain vectors that can be used for the expression of transgenes described herein include vectors containing regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other useful vectors for transgene expression contain polynucleotide sequences that increase the translation rate of the transgene or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5′ and 3′ untranslated regions and polyadenylation signaling sites to direct the efficient transcription of the gene supported on the expression vector. Expression vectors suitable for use with the compositions and methods described herein may contain polynucleotides encoding markers for the selection of cells containing such vectors. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or norseoslysin.

[0081] As used herein, the term “wild type” refers to the most frequently occurring genotype for a particular gene in a given organism. [Brief explanation of the drawing]

[0082] [Figure 1] This is the plasmid map of plasmid P1588. [Figure 2] This is the plasmid map of plasmid P1589. [Figure 3] This is the plasmid map of plasmid P1590. [Figure 4] This is the plasmid map of plasmid P1592. [Figure 5] This is the plasmid map of plasmid P1593. [Figure 6] This is the plasmid map of plasmid P1595. [Figure 7] This is the plasmid map of plasmid P1596. [Figure 8] This is the plasmid map of plasmid P1598. [Figure 9] This is the plasmid map of plasmid P1599. [Figure 10] This is the plasmid map of plasmid P1601. [Figure 11] This is the plasmid map of plasmid P1602. [Figure 12] This is the plasmid map of plasmid P1604. [Figure 13] This is the plasmid map of plasmid P1605. [Figure 14] This is the plasmid map of plasmid P1607. [Figure 15] This is the plasmid map of plasmid P1608. [Figure 16] This is the plasmid map of plasmid P1610. [Figure 17] This is the plasmid map of plasmid P1611. [Figure 18]These images and graphs show Gjb2 expression levels in HeLa cells transfected with different plasmids containing various FLAG-tagged versions of the human GJB2 coding sequence under the control of a CMV promoter. Panel A shows a Western blot showing the level of Gjb2 expressed from each plasmid as detected by an anti-FLAG antibody. An anti-actin antibody was also used for normalization. Panel B shows the relative intensity of the anti-FLAG signal detected for each plasmid compared to a plasmid with a wild-type GJB2 sequence arbitrarily set to 1. "No GJB2" and "No Flag" are negative control plasmids lacking the FLAG-tagged GJB2 coding sequence. "Wild-type" is a plasmid with the wild-type GJB2 sequence (SEQ ID NO: 5). "CpG-depleted" is a plasmid with a CpG-depleted GJB2 coding sequence (SEQ ID NO: 3) and a FLAG tag. "CodOpt" is a plasmid with a codon-optimized GJB2 coding sequence (SEQ ID NO: 28) and a FLAG tag. "CO-CpGdep" is a plasmid that has codon optimization and a CpG-depleted GJB2 coding sequence (SEQ ID NO: 4) and a FLAG tag. [Figure 19] This is a series of graphs showing the ability of HeLa cells transfected with different plasmids containing various versions of the human GJB2 coding sequence under the control of the CMV promoter to take up propidium iodide ("PI") in both the presence and absence of Ca2+. Panel A shows the percentage of cells that took up PI in both the presence and absence of Ca2+ for each transfection. Panel B shows the percentage of cells that took up PI in the presence of Ca2+ for transfections with either the wild-type GJB2 coding sequence (SEQ ID NO: 5) or the CpG-depleted GJB2 coding sequence (SEQ ID NO: 3). [Figure 20]This is a series of graphs showing the effects of AAV1 vectors containing either the wild-type (SEQ ID NO: 5) or the CpG-depleted GJB2 coding sequence (SEQ ID NO: 3) on hearing restoration in a GJB2-deficient mouse model, under the control of a GJB2 regulatory construct (SEQ ID NO: 1). Each AAV1 vector was injected into the right ear of the mouse, with the left ear serving as a negative control. The upper panel shows the effect on the auditory brainstem response (ABR) of the mouse at various time points (weeks) after injection at various frequencies. The lower panel shows the effect on the strained component otoacoustic emissions (DPOAE) of the mouse at various time points (weeks) after injection at various frequencies. The upper line in each of the four graphs represents the result in the untreated left ear of the mouse. [Figure 21] This is a series of graphs showing the dose-response effect of AAV1 vectors containing a CpG-depleted GJB2 coding sequence (SEQ ID NO: 3) under the control of a GJB2 regulatory construct (SEQ ID NO: 1) on hearing recovery in a GJB2-deficient mouse model. Each AAV1 vector was injected into the right ear of mice, and measurements were taken 4 weeks after vector administration. "Untreated" mice were GJB2-deficient mice that were not treated with the vector. "Naive WT" mice were non-GJB2-deficient BL6 mice that were not treated with the vector. Panel A shows the effect of various concentrations of the CpG-depleted GJB2 coding sequence on the mean auditory brainstem response (ABR) threshold of mice compared to untreated and naive WT mice. Panel B shows the effect of various concentrations of the CpG-depleted GJB2 coding sequence on the mean DPOAE threshold of mice compared to untreated and naive WT mice. [Figure 22] This graph shows the effect of the bovine growth hormone (bGH) polyadenylation signal sequence (SEQ ID NO: 6) compared to the simian virus 40 polyadenylation (SV40) polyadenylation signal sequence (SEQ ID NO: 7) on the mean expression level of nuclear target green fluorescent protein driven by the CMV promoter (CMV.H2B-EGFP) in HEK293T cells. [Figure 23]This graph shows the effect of the pAAVdB backbone (3,038 nucleotides spanning nucleotides 2399-5301 and 1-135 of SEQ ID NO: 12) compared to the pAAVKan backbone (3,157 nucleotides spanning nucleotides 2454-5420 and 1-190 of SEQ ID NO: 20) on the mean expression level of H2B-EGFP driven by the CMV promoter (CMV.H2B-EGFP) and containing a bGH polyadenylation site (bGH_pA) in HEK293T cells. "Cassette 1" and "Cassette 2" represent two different CMV.H2B-EGFP.bGH_pA gene cassettes (sequences not shown) that have different restriction enzyme cloning sites in the intragene region but possess the same pAAVKan or pAAVdB sequence. [Modes for carrying out the invention]

[0083] Compositions and methods for specifically inducing the expression of a polynucleotide encoding the Gjb2 protein in GJB2-expressing cells (e.g., GJB2-expressing inner ear cells such as cochlear support cells) are described herein. The present invention features a GJB2 regulatory construct (a construct containing a promoter and an enhancer element) capable of inducing the expression of a polynucleotide encoding the Gjb2 protein (e.g., wild-type Gjb2 protein such as wild-type human Gjb2) in GJB2-expressing cells (e.g., cochlear support cells), with minimal or no expression in cochlear hair cells. The polynucleotide encoding the Gjb2 protein may be CpG-depleted and / or codon-optimized. The present invention also features a nucleic acid vector containing the GJB2 regulatory construct described herein, operably ligated to a polynucleotide encoding the Gjb2 protein. The compositions and methods described herein can be used to specifically express the Gjb2 protein in GJB2-expressing cells, and therefore the compositions described herein can be administered to subjects (mammalian subjects, e.g., humans) to treat GJB2-related hearing loss (e.g., hearing loss associated with DFNB1, DFNA3, or Bart-Pumphrey syndrome, porcupine-like ichthyosis with hearing loss, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with hearing loss, or Vohwinkel syndrome).

[0084] supporting cells The sensory epithelium of the inner ear contains two main cell types: hair cells and supporting cells. Hair cells are the sensory cells of the auditory and vestibular systems present in the inner ear. Cochlear hair cells are the sensory cells of the auditory system and consist of two main cell types: inner hair cells, which are responsible for sensing sound, and outer hair cells, which are thought to amplify low-level sounds. Vestibular hair cells are located in the terminal organs of the semicircular canals and otolith organs of the inner ear and are involved in motor sensation, contributing to balance and spatial awareness. The development, function, and maintenance of the inner ear sensory epithelium depend heavily on supporting cells, which are non-sensory cells located between the hair cells. Cochlear supporting cells include Hensen cells, Dyter cells, inner and outer column cells, Claudius cells, inner phalangeal cells, and border cells. Supporting cells are connected to each other and to hair cells by tight junctions and adhesive junctions, and communicate directly with other supporting cells by gap junctions. The gap junction is composed of connexins encoded by connexin genes such as CX26 (also known as GJB2) and CX30 (also known as GJB6). These connexin channels play a crucial role in intracellular K+ recycling and regulation, as well as pH homeostasis mechanisms, and may also provide pathways for the rapid removal of ions from the area of ​​sensory cells during sound conduction to maintain sensitivity. Supporting cells have a rigid cytoskeleton that maintains the structural integrity of sensory organs during auditory stimuli and head movements, and after trauma or toxicity, can expel damaged hair cells from the epithelium, phagocytose hair cell fragments, and, in some cases, generate new hair cells.

[0085] Gene therapy has recently emerged as an intriguing therapeutic approach for treating hearing loss, particularly that caused by mutations in genes expressed in the inner ear. Mutations in a wide variety of genes, including those expressed in cochlear support cells, have been found to cause hearing loss. For example, mutations in GJB2 are the most common cause of recessive hearing loss. However, using gene therapy to treat hearing loss associated with mutations in cochlear support cell genes (e.g., genes expressed in cochlear support cells) requires methods to induce gene expression in cochlear support cells rather than cochlear hair cells, and these methods are currently very limited.

[0086] GJB2 Gap junction protein beta-2 (Gjb2, also known as connexin 26) is a protein encoded by the GJB2 gene and is a member of the connexin gene family. Connexin oligomerization results in a hexameric arrangement called a connexon or hemichannel, which often docks with hemichannels from contact cells to form a gap junction. Nearly half of all hearing loss is due to mutations in one of the four members of the connexin gene family, with GJB2 mutations being the most common. More than 100 different mutations in GJB2 have been identified that cause asymptomatic hearing loss, which is hearing loss not associated with other signs and symptoms. One form of asymptomatic hearing loss associated with mutations in GJB2 is DFNB1, which is characterized by moderate to severe pre-speech acquisition hearing loss and is inherited in an autosomal recessive pattern. DFNA3 is another form of non-symptomatic hearing loss associated with mutations in GJB2, characterized by moderate to severe pre- or post-language acquisition hearing loss that worsens over time and is inherited in an autosomal dominant pattern. Other health conditions associated with mutations in GJB2 include Bart-Pumphrey syndrome, porcupine-like ichthyosis with hearing loss, keratitis-ichthyosis-hearing loss syndrome, palmoplantar keratosis with hearing loss, and Vohwinkel syndrome, all of which are characterized by hearing loss and skin abnormalities.

[0087] The present invention is partly based on the discovery of an upstream region of the GJB2 coding sequence, which can be used to specifically promote the expression of polynucleotides encoding the Gjb2 protein in GJB2-expressing cells (e.g., cochlear support cells). The inventors have also identified CpG-depleted and / or codon-optimized polynucleotide sequences encoding wild-type human Gjb2 that can be used to reduce immune activation induced by gene therapy and / or to modulate GJB2 expression levels. Thus, the compositions and methods described herein can be used to express polynucleotides encoding the Gjb2 protein (e.g., wild-type human Gjb2 protein) in GJB2-expressing cells (e.g., GJB2-expressing inner ear cells such as cochlear support cells) to treat subjects who have or are at risk of developing sensorineural hearing loss (e.g., GJB2-associated hearing loss). The discovery of GJB2 regulatory constructs that induce GJB2 expression in GJB2-expressing cells while minimizing or eliminating off-target expression in cells that do not endogenously express GJB2 (e.g., cochlear hair cells) can improve the safety and efficacy of gene therapy by reducing toxicity associated with off-target expression.

[0088] The polynucleotides of the compositions and methods described herein include nucleic acid sequences containing a GJB2 regulatory element that can specifically express a transgene in GJB2-expressing cells, or variants thereof such as nucleic acid sequences having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) to a nucleic acid sequence containing a GJB2 regulatory element that can specifically express a transgene in GJB2-expressing cells. A nucleic acid sequence containing a GJB2 regulatory element that can specifically express a transgene in GJB2-expressing cells is referred to herein as a GJB2 regulatory construct. In some embodiments, the GJB2 regulatory construct has at least 85% sequence identity with respect to sequence number 1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, the GJB2 regulatory construct has the sequence of sequence number 1. In some embodiments, the GJB2 regulatory construct has at least 85% sequence identity with respect to sequence number 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, the GJB2 regulatory construct has the sequence of sequence number 2.

[0089] The nucleic acid sequences mentioned above are provided in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3]

[0090] The aforementioned GJB2 regulatory construct sequences can be contained in a nucleic acid vector and operably ligated to a polynucleotide encoding the Gjb2 protein. In some embodiments, the polynucleotide operably ligated to the GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)) is a transgene encoding the wild-type form of the Gjb2 protein (e.g., wild-type human Gjb2 protein). In some embodiments, the polynucleotide operably ligated to the GJB2 regulatory construct described herein is a polynucleotide encoding wild-type human Gjb2 (e.g., a polynucleotide encoding the amino acid sequence of SEQ ID NO: 29). In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is modified relative to the wild-type GJB2 sequence (SEQ ID NO: 5). In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is CpG depleted. An exemplary CpG depleted polynucleotide sequence encoding wild-type human Gjb2 is the sequence of Sequence ID No. 3. In some embodiments, the CpG depleted polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity to the sequence of Sequence ID No. 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) and contains fewer CG dinucleotides than the wild-type GJB2 nucleic acid sequence. In some embodiments, the CpG-depleted polynucleotide has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (i.e., compared to SEQ ID NO: 5) (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides).In some embodiments, the CpG-depleted polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and does not contain CG dinucleotides. In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is codon-optimized. An exemplary codon-optimized polynucleotide sequence encoding wild-type human Gjb2 is the sequence of SEQ ID NO: 28. In some embodiments, the polynucleotide sequence encoding wild-type human Gjb2 is CpG-depleted and codon-optimized. An exemplary CpG-depleted and codon-optimized polynucleotide sequence encoding wild-type human Gjb2 is the sequence of SEQ ID NO: 4. In some embodiments, the polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). In some embodiments, a polynucleotide encoding wild-type human Gjb2 has at least 90% sequence identity to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less) or has at least 90% sequence identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more), which encodes the sequence of SEQ ID NO: 29 (e.g., due to genetic coding redundancy). Exemplary Gjb2 amino acid and polynucleotide sequences are listed in Table 3 below.A nucleic acid vector (e.g., an AAV vector) containing the GJB2 regulatory construct described herein, operably linked to a polynucleotide encoding wild-type human GJB2 (e.g., SEQ ID NO: 29, e.g., a polynucleotide encoding any one of SEQ ID NOs: 3, 4, and 28), can be administered to subjects to treat, reduce, or prevent GJB2-related hearing loss, such as hearing loss in subjects with DFNB1, DFNA3, Bart-Pumphrey syndrome, porcupine-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Vohwinkel syndrome. [Table 3-1] [Table 3-2] [Table 3-3]

[0091] This disclosure also relates to codon-optimized and / or CpG-depleted sequences encoding wild-type human GJB2 as shown above in Table 3 (e.g., sequences of SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 28), and their variants, e.g., sequences of SEQ ID NO: 3, having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) and less than wild-type GJB2. The present invention provides polynucleotides containing sequences that each contain 50% fewer CG dinucleotides (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less CG dinucleotides), and sequences that have at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28. Codon-optimized sequences and / or CpG-depleted sequences encoding wild-type human Gjb2, or variants thereof, can be operably linked to the GJB2 promoter. GJB2 promoters that can be operably ligated to codon-optimized and / or CpG-depleted sequences encoding wild-type human GJB2, or variants thereof, as described herein include the GJB2 promoters described in U.S. Publication US2021 / 0095313A1, International Publication WO2021 / 231808A2 and WO2022 / 056444A1, and International Application PCT / US2023 / 061953, which are related to GJB2 promoter sequences and are therefore incorporated herein by reference.A polynucleotide containing a GJB2 promoter operably linked to a codon-optimized and / or CpG-depleted sequence encoding wild-type human GJB2 (e.g., SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 28) as described herein may be incorporated into a nucleic acid vector (e.g., an AAV vector) and administered to subjects to treat, alleviate, or prevent GJB2-related hearing loss, such as hearing loss in subjects with DFNB1, DFNA3, Bart-Pumphrey syndrome, porcupine-like ichthyosis with deafness, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with deafness, or Vohwinkel syndrome.

[0092] Gjb2 expression in mammalian cells Mutations in GJB2 are associated with sensorineural hearing loss. Using the compositions and methods described herein, a polynucleotide may be obtained that has at least 90% sequence identity to the sequence of the GJB2 protein (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less) or has at least 90% sequence identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, By administering a nucleic acid vector containing a GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)) operably linked to a polynucleotide having 97%, 98%, 99%, or higher sequence identity), the expression of a polynucleotide encoding Gjb2 (e.g., wild-type human Gjb2) can be specifically induced or increased in GJB2-expressing cells (e.g., GJB2-expressing ear cells, e.g., cochlear support cells). A wide range of methods have been established for protein delivery to mammalian cells and for the stable expression of protein-encoding polynucleotides in mammalian cells.

[0093] Polynucleotide encoding Gjb2 One platform that can be used to achieve therapeutically effective intracellular concentrations of Gjb2 in mammalian cells is the stable expression of the gene encoding Gjb2 (e.g., by integration into the nucleus or mitochondrial genome of mammalian cells, or by episomal concatemer formation in the nucleus of mammalian cells). The gene is a polynucleotide that encodes the primary amino acid sequence of the corresponding protein. To introduce an exogenous gene into mammalian cells, the gene can be incorporated into a vector. The vector can be introduced into cells by a variety of methods, including transformation, transfection, transduction, direct uptake, incident particle impact, and encapsulation of the vector in liposomes. Examples of preferred methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in more detail, for example, Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014), and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of which are incorporated herein by reference.

[0094] Gjb2 can also be introduced into mammalian cells by targeting cell membrane phospholipids with a vector containing the gene encoding Gjb2. For example, the vector can target phospholipids on the extracellular surface of the cell membrane by linking the vector molecule to the VSV-G protein, a viral protein that has affinity for all cell membrane phospholipids. Such constructs can be produced using methods well known to those skilled in the art.

[0095] The recognition and binding of the polynucleotide encoding Gjb2 by mammalian RNA polymerase is crucial for gene expression. Therefore, the polynucleotide may contain sequence elements that exhibit high affinity for transcription factors that recruit RNA polymerase and facilitate the assembly of the transcription complex at the transcription start site. Such sequence elements include, for example, mammalian promoters, whose sequences can be recognized and bound by specific transcription start factors and ultimately by RNA polymerase. An example of a mammalian promoter is described in Smith, et al., Mol. Sys. Biol., 3:73, published online, and its disclosure is incorporated herein by reference. The promoters used in the methods and compositions described herein are GJB2 promoters contained within a GJB2 regulatory construct described herein (for example, a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)).

[0096] Once the polynucleotide encoding Gjb2 is incorporated into a mammalian cell or stabilized with an episomal monomer or concatemer, transcription of this polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing mammalian cells to external chemical reagents, such as agents that modulate the binding of transcription factors and / or RNA polymerase to the mammalian promoter, and thus regulate gene expression. The chemical reagents may function to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter, for example, by removing a repressor protein bound to the promoter. Alternatively, the chemical reagents may function to improve the affinity of the mammalian promoter to RNA polymerase and / or transcription factors, such as increasing the transcription rate of genes located downstream of the promoter in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available and can be administered to mammalian cells to promote gene expression according to established protocols.

[0097] Other DNA sequence elements that may be included in nucleic acid vectors for use in the compositions and methods described herein include enhancer sequences. Enhancers represent another class of regulatory elements that induce conformational changes in polynucleotides containing the gene of interest so that the DNA adopts a three-dimensional orientation favorable for the binding of transcription factors and RNA polymerase at the transcription start site. Thus, polynucleotides for use in the compositions and methods described herein include those encoding the Gjb2 protein and further include mammalian enhancer sequences. Many enhancer sequences are currently known from mammalian genes, examples of which include enhancers from genes encoding mammalian globin, elastase, albumin, α-fetoprotein, and insulin. Enhancers for use in the compositions and methods described herein also include those derived from the genetic material of viruses that can infect eukaryotic cells. Examples include the SV40 enhancer on the late side of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the origin of replication, and the adenovirus enhancer. Further enhancer sequences that induce activation of eukaryotic gene transcription include CMV enhancers and RSV enhancers. The GJB2 regulatory constructs described herein (e.g., polynucleotides having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)) include one or more GJB2 enhancer sequences. The enhancer may be spliced ​​into a vector containing a polynucleotide encoding the Gjb2 protein, for example, at a 5′ or 3′ position relative to this gene. In a preferred orientation, the enhancer is positioned 5′ to the promoter, and the promoter is positioned 5′ relative to the polynucleotide encoding the Gjb2 protein.

[0098] Nucleic acid vectors containing a GJB2 regulatory construct operably ligated to a polynucleotide encoding the Gjb2 protein described herein may contain a Woodchuck post-transcriptional regulatory element (WPRE). WPREs act at the mRNA level by promoting nuclear export of transcripts and / or increasing the polyadenylation efficiency of nascent transcripts, thereby increasing the total amount of mRNA in the cell. Addition of WPREs to vectors can result in substantial improvements in the level of transgene expression from several different promoters, both in vitro and in vivo.

[0099] The nucleic acid vectors described herein also contain polyadenylation (polyA) signal sequences. A polyA signal sequence is a sequence that induces endonuclease cleavage of mRNA and the addition of a series of adenosines to the 3' end of the cleaved mRNA. PolyA signal sequences that may be included in the nucleic acid vectors described herein include polyA signal sequences from bovine growth hormone (bGH), mouse β-globin, mouse α-globin, human collagen, polyomavirus, herpes simplex virus thymidine kinase gene, human growth hormone (hGH), SV40, synthetic polyA, HIV-1 upstream polyA enhancer, adenovirus (L3) upstream polyA enhancer, hTHGB upstream polyA enhancer, and hC2 upstream polyA enhancer. In some embodiments, the nucleic acid vector contains a bGH polyA signal sequence having the following sequence: CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGA (SEQ ID NO: 6).

[0100] In some embodiments, the nucleic acid vector contains a bGH polyA signal sequence having at least 90% sequence identity with respect to the sequence of SEQ ID NO: 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0101] In some embodiments, the nucleic acid vector contains an SV40 poly(A) signal sequence having the following sequence: GATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCAAAACTAGAATGCAGTGAAAAAAATGCCTTATTTGTGAAATTTGTGATGCTATTGCCTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT (SEQ ID NO: 7).

[0102] In some embodiments, the nucleic acid vector contains an SV40 polyA signal sequence having at least 90% sequence identity with respect to the sequence of SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0103] In some embodiments, nucleic acid vectors containing a GJB2 regulatory construct operably ligated to a polynucleotide encoding the GJB2 protein described herein include a reporter sequence that can be useful for verifying the expression of the gene operably ligated to the GJB2 regulatory construct in cells and tissues (e.g., GJB2-expressing cells such as cochlear support cells). Reporter sequences that may be provided by the transgene include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art. When relating to regulatory elements that drive their expression, such as GJB2 regulatory constructs, the reporter sequence provides a signal detectable by conventional means, including enzymatic, radioactive, colorimetric, fluorescence or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of a signaling vector can be detected by an assay for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the signaling vector can be visually measured by color or light generation using a luminometer.

[0104] In some embodiments, the nucleic acid vector described herein is an AAV transfer plasmid. Such a plasmid contains a promoter inverted terminal repeat (ITR) 5' (i.e., 5' of the GJB2 regulatory construct described herein) and a poly(A) signaling sequence 3'. The DNA sequence between the ITRs is packaged into the AAV molecule, but the sequence outside the ITRs is not. In some embodiments, the sequence located at 5' of the GJB2 regulatory construct described herein in the AAV transfer plasmid is the following sequence: CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGGAAGATCGGAATTCTGGTACCTTGCTAGC (SEQ ID NO: 8).

[0105] In other embodiments, the sequence located at 5' of the GJB2 regulatory construct described herein in the AAV transfer plasmid is the following sequence: CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGAGCAGAATTCTGGTACCTTGCTAGC (SEQ ID NO: 10).

[0106] In both Sequence ID No. 8 and Sequence ID No. 10 shown above, nucleotides 1-130 correspond to the 5'ITR.

[0107] In some embodiments, the sequence located at 3' of the poly(A) signal sequence in the AAV transfer plasmid is the following sequence: TCTAGAACTGAATTCCCGATAAGGATCTTCCTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCCCTAGTGATGGAGTTGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 9).

[0108] In Sequence ID 9 shown above, nucleotides 83-212 correspond to the 3'ITR. In other embodiments, the sequence located at 3' of the poly(A) signal sequence in the AAV transfer plasmid is the following sequence: TCTAGAACTGAATTCACAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG (SEQ ID NO: 11).

[0109] In SEQ ID NO: 11 shown above, nucleotides 19-148 correspond to the 3' ITR. In some embodiments, the AAV transfer plasmid contains the 5' sequence of SEQ ID NO: 8 and the 3' sequence of SEQ ID NO: 9. In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), and a 3' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), provided that the ITR sequence in the 5' sequence has the sequence of nucleotides 1-130 of SEQ ID NO: 8, and the ITR sequence in the 3' sequence has the sequence of nucleotides 83-212 of SEQ ID NO: 9. In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), and a 3' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), provided that the ITR sequence in the 3' is the reverse complement of the ITR sequence in the 5'. In some embodiments, the AAV transfer plasmid contains the 5' sequence of SEQ ID NO: 10 and the 3' sequence of SEQ ID NO: 11.In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), and a 3' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), provided that the ITR sequence in the 5' sequence has the sequence of nucleotides 1-130 of SEQ ID NO: 10, and the ITR sequence in the 3' sequence has the sequence of nucleotides 19-148 of SEQ ID NO: 11. In some embodiments, the AAV transfer plasmid contains a 5' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), and a 3' sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher), provided that the ITR sequence in the 3' is the reverse complement of the ITR sequence in the 5'.

[0110] In some embodiments, the 5' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 1-130 of SEQ ID NO: 8 or SEQ ID NO: 10, or a sequence having at least 90% sequence identity thereto (at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), and the 3' adjacent inverted terminal repeat has a sequence corresponding to nucleotides 83-212 of SEQ ID NO: 9 or nucleotides 19-148 of SEQ ID NO: 11, or a sequence having at least 90% sequence identity thereto (at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). Those skilled in the art will understand that, in any given pair of inverted terminal repeats in a transfer plasmid used to construct a viral vector (typically by transfecting the transfer plasmid with other plasmids containing the necessary AAV genes for viral vector formation), the corresponding sequence in the viral vector may be altered during recombination to cause the ITR to adopt a “flip” or “flop” orientation. Therefore, the sequence of the ITR in the transfer plasmid is not necessarily the same as the sequence found in the viral vector prepared from it.

[0111] The GJB2 regulatory constructs described herein (e.g., polynucleotides having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)) are polynucleotide sequences encoding the wild-type GJB2 protein described herein (e.g., having at least 90% sequence identity to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides) The GJB2 regulatory sequence and the polyA signal sequence can be operably ligated to a polynucleotide having at least 90% sequence identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), which can be operably ligated to a polyA signal sequence described herein (e.g., a polynucleotide having at least 90% sequence identity to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)), and can be incorporated into a transfer plasmid that can be used to produce a nucleic acid vector (e.g., an AAV vector) for use in the compositions and methods described herein. The GJB2 regulatory sequence and the polyA signal sequence can be flanked in the transfer plasmid by the and 5' and 3' ITR-containing sequences described herein. Table 4 below provides combinations of these elements that can be incorporated into such transfer plasmids, with each row representing a combination of elements in a single transfer plasmid. [Table 4]

[0112] Table 5 provides transfer plasmid sequences that can be used to produce nucleic acid vectors (e.g., AAV vectors) for use in the compositions and methods described herein. A transfer plasmid (e.g., a plasmid containing a DNA sequence delivered by a nucleic acid vector, e.g., an AAV vector) may be co-delivered to a progenitor cell together with a helper plasmid (e.g., a plasmid providing proteins necessary for AAV production) and a rep / cap plasmid (e.g., a plasmid providing the AAV capsid protein and a protein for inserting the transfer plasmid DNA sequence into the capsid shell) to produce a nucleic acid vector (e.g., an AAV vector) for administration. The following transfer plasmids are designed to produce nucleic acid vectors (e.g., AAV vectors) containing a GJB2 regulatory construct (e.g., a polynucleotide having the sequence of SEQ ID NO: 1 or SEQ ID NO: 2) operably ligated to a polynucleotide encoding the GJB2 protein (e.g., the polynucleotide of SEQ ID NO: 3 or SEQ ID NO: 4). The sequence spanning from 5'ITR to 3'ITR (including the intervening GJB2 regulatory construct, GJB2 coding sequence, and poly(A) signaling sequence) is packaged into an AAV vector. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] Table 5-7 Table 5-8 Table 5-9 Table 5-10 Table 5-11 Table 5-12 Table 5-13 Table 5-14 Table 5-15 Table 5-16 Table 5-17 Table 5-18 Table 5-19 Table 5-20 Table 5-21 Table 5-22 Table 5-23 Table 5-24 Table 5-25 Table 5-26 Table 5-27 Table 5-28 Table 5-29 Table 5-30 Table 5-31 Table 5-32 Table 5-33 Table 5-34 Table 5-35 Table 5-36 Table 5-37 Table 5-38 Table 5-39 Table 5-40 Table 5-41 Table 5-42 Table 5-43 Table 5-44 Table 5-45 Table 5-46 Table 5-47 Table 5-48 Table 5-49 Table 5-50 Table 5-51 Table 5-52 Table 5-53 Table 5-54 Table 5-55 Table 5-56 Table 5-57 Table 5-58 Table 5-59 Table 5-60 Table 5-61 [Table 5-62] [Table 5-63] [Table 5-64] [Table 5-65] [Table 5-66] [Table 5-67] [Table 5-68] [Table 5-69] [Table 5-70] [Table 5-71] [Table 5-72]

[0113] Method for delivering polynucleotides encoding Gjb2 to target cells Techniques are well known in the art for introducing polynucleotides encoding Gjb2 (e.g., wild-type human Gjb2), operably linked to the GJB2 regulatory constructs described herein (e.g., polynucleotides having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)), into target cells (e.g., mammalian cells). For example, mammalian cells (e.g., human target cells) can be permeated by applying an electrostatic potential to the cells of interest using electroporation. Mammalian cells, such as human cells, exposed to an external electric field in this manner are then more readily able to take up exogenous polynucleotides. Electroporation of mammalian cells is described in detail, for example, Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference. To stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells, a similar technique, Nucleofection®, utilizes an applied electric field. Nucleofection® and useful protocols for carrying out this technique are described, for example, Distler et al., Experimental Dermatology 14:315 (2005), and US2010 / 0317114, the disclosures of which are incorporated herein by reference.

[0114] Additional techniques useful for transfection of target cells include the squeeze-poration method. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through pores formed in response to an applied stress. This technique is advantageous in that no vector is required for delivery of polynucleotides into cells such as human target cells. Squeeze-poration is described in detail, for example, in Sharei et al., Journal of Visualized Experiments 81:e50980 (2013), the disclosure of which is incorporated herein by reference.

[0115] Lipofection represents another technique useful for transfection of target cells. This method involves loading polynucleotides into liposomes that often present cationic functional groups, such as quaternary amines or protonated amines, toward the outer surface of the liposomes. This facilitates electrostatic interactions between the liposomes and cells due to the anionic nature of the cell membrane, ultimately leading to the uptake of exogenous polynucleotides, for example, by direct fusion of the liposomes and the cell membrane, or by endocytosis of the complex. Lipofection is described in detail, for example, U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. Similar techniques that utilize ionic interactions with the cell membrane to induce the uptake of exogenous polynucleotides include contacting cells with cationic polymer-polynucleotide complexes. Exemplary cationic molecules that associate with polynucleotides to confer a positive charge favorable to interaction with the cell membrane include activated dendrimers (e.g., described in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference), polyethyleneimines, and diethylaminoethyl (DEAE)-dextran. The use of these as transfection agents is described in detail, e.g., in Gulick et al., Current Protocols in Molecular Biology 40:I:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner, as this method utilizes an applied magnetic field to guide the uptake of polynucleotides. This technique is described in detail, e.g., in US2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0116] Another useful tool for inducing the uptake of exogenous polynucleotides by target cells is laser transmission, also known as optical transfection. This technique involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeate them, allowing polynucleotides to penetrate the cell membrane. The biological activity of this technique is similar to, and in some cases superior to, electroporation.

[0117] Impalefection is another technique that can be used to deliver genetic material to target cells. It relies on the use of nanomaterials such as carbon nanofibers, carbon nanotubes, and nanowires. Needle-shaped nanostructures are synthesized perpendicular to the surface of a substrate. DNA containing the gene intended for intracellular delivery is attached to the surface of the nanostructure. A chip equipped with these needle arrays is then pressed onto cells or tissue. Cells impaled by the nanostructure can express the delivered gene(s). An example of this technique is described in Shalek et al., PNAS 107:1870 (2010), the disclosure of which is incorporated herein by reference.

[0118] Magnetofection can also be used to deliver polynucleotides to target cells. The principle of magnetofection is to bind polynucleotides to cationic magnetic nanoparticles. The magnetic nanoparticles are made of fully biodegradable iron oxide and are coated with specific cationic molecules that vary depending on the application. Their association with gene vectors (DNA, siRNA, viral vectors, etc.) is achieved by salt-inducible colloidal aggregation and electrostatic interactions. The magnetic particles are then concentrated into the target cells by the influence of an external magnetic field generated by a magnet. This technique is described in detail in Scherer et al., Gene Therapy 9:102 (2002), the disclosure of which is incorporated herein by reference.

[0119] Another useful tool for inducing the uptake of exogenous polynucleotides by target cells is acoustic permeation, a technique that involves using sound waves (typically ultrasonic frequencies) to modify the permeability of the cell plasma membrane in order to make the cell permeable and allow polynucleotides to penetrate the cell membrane. This technique is described in detail, for example, in Rhodes et al., Methods in Cell Biology 82:309 (2007), the disclosure of which is incorporated herein by reference.

[0120] Microvesicles represent another potential vehicle that can be used to modify the genome of target cells according to the methods described herein. For example, microvesicles induced by the co-overexpression of glycoprotein VSV-G with genome-modifying proteins such as nucleases can be used to efficiently deliver proteins to cells that subsequently catalyze site-specific cleavage of endogenous polynucleotide sequences, thereby preparing the cell's genome for covalent incorporation of polynucleotides of interest, such as genes or regulatory sequences. The use of such vesicles, also called Gesicles, for genetic modification of eukaryotic cells is described in detail, for example, in Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [abstract] and Methylation changes in early embryonic genes in cancer [abstract], Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; 2015 May 13, Abstract No. 122. This is described in detail in "Methylation changes in early embryonic genes in cancer" [abstract], in "Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy"; May 13, 2015, Abstract No. 122.

[0121] Vector for GJB2 expression In addition to achieving high transcription and translation rates, stable expression of exogenous polynucleotides in mammalian cells can be achieved by incorporating the polynucleotides into the nuclear genome of mammalian cells. Various vectors have been developed for the delivery and integration of polynucleotides encoding exogenous proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). Expression vectors for use in the compositions and methods described herein are polynucleotides encoding the Gjb2 protein (e.g., polynucleotides having at least 90% sequence identity to wild-type human Gjb2, e.g., sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides), or polynucleotides having at least 90% sequence identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28. The GJB2 regulatory construct described herein (e.g., polynucleotides having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)) is operably linked to a polynucleotide (e.g., polynucleotides having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)), and includes additional sequence elements used, for example, for the expression of these activators and / or the incorporation of these polynucleotide sequences into the genome of mammalian cells.Vectors that may contain a GJB2 regulatory construct operably linked to a polynucleotide encoding Gjb2 include plasmids (e.g., circular DNA molecules capable of autonomous replication within cells), cosmids (e.g., pWE or sCos vectors), artificial chromosomes (e.g., human artificial chromosomes (HAC), yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC)), and viral vectors. Certain vectors that can be used for the expression of polynucleotides encoding the Gjb2 protein include plasmids containing regulatory sequences, such as enhancer regions that direct gene transcription. Other useful vectors for the expression of polynucleotides encoding the Gjb2 protein contain polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5′ and 3′ untranslated regions and polyadenylation signaling sites to direct efficient transcription of the gene supported on the expression vector. Expression vectors suitable for use with the compositions and methods described herein may contain polynucleotides encoding markers for the selection of cells containing such vectors. Suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or norseoslysin.

[0122] Viral vectors for polynucleotide delivery Viral genomes are a rich source of vectors that can be used for the efficient delivery of target genes into the genomes of target cells (e.g., mammalian cells such as human cells). Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of mammalian cells through generalized or specialized transduction. These processes occur as part of the natural viral replication cycle and do not require additional proteins or reagents to induce gene integration. Examples of viral vectors include negative-strand RNA viruses such as retroviruses (e.g., retrovirus family viral vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, orthomyxoviruses (e.g., influenza virus), rhabdoviruses (e.g., rabies and vesicular stomatitis viruses), and paramyxoviruses (e.g., measles and Sendai virus), as well as positive-strand RNA viruses such as picornaviruses and alphaviruses, and double-strand DNA viruses including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, modified vaccinia ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foam virus, and hepatitis viruses. Examples of retroviruses include avian leukemia / sarcoma, avian type C virus, mammalian type C virus, mammalian type B virus, mammalian type D virus, onchoretrovirus, HTLV-BLV group, lentivirus, alpha-retrovirus, gamma-retrovirus, and spumavirus (Coffin, JM, Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, 1996)).Other examples include mouse leukemia virus, mouse sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon leukemia virus, Mason-Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentivirus. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure relating to viral vectors for use in gene therapy and is incorporated herein by reference.

[0123] AAV vectors for polynucleotide delivery In some embodiments, the polynucleotides of the compositions and methods described herein are incorporated into rAAV vectors and / or virions to facilitate their introduction into cells. In some embodiments, the rAAV vector useful for the compositions and methods described herein is (1) a GJB2 regulatory construct described herein (e.g., a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)), (2) a sequence to be expressed (e.g., a polynucleotide encoding Gjb2, e.g., having at least 90% sequence identity to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and having at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., A recombinant polynucleotide construct comprising (3) a polynucleotide containing 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less CG dinucleotides, or a polynucleotide having at least 90% sequence identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity), and (3) a viral sequence that promotes the incorporation and expression of the sequence to be expressed. The viral sequence may include the AAV sequence required in cis for DNA replication and packaging to virions (e.g., functional ITR). Such an rAAV vector may also contain a marker gene or a reporter gene. Useful rAAV vectors include AAV One or more of the WT genes are deleted, either whole or partially, but the functional adjacent ITR sequences are retained. The AAV ITR can be any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITR may be an AAV2 ITR.Methods for using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000) and Monahan and Samulski, Gene Delivery 7:24 (2000), and the disclosures of each of these, relating to AAV vectors for gene delivery, are incorporated herein by reference.

[0124] The polynucleotides and vectors described herein (e.g., a GJB2 regulatory construct operably linked to a polynucleotide encoding Gjb2) can be incorporated into rAAV virions to facilitate the introduction of the polynucleotide or vector into the cell. The AAV capsid protein constitutes the non-nucleic acid portion outside the viral particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, which are necessary for virion assembly. Constructions of rAAV virions are described, for example, in US5,173,414, US5,139,941, US5,863,541, US5,869,305, US6,057,152, and US6,376,237, as well as in Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), each of which disclosures relating to AAV vectors for gene delivery are incorporated herein by reference.

[0125] rAAV virions useful in conjunction with the compositions and methods described herein include those derived from various AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eb, and PHP.S. AAV1, AAV2, AAV2quad(YF), AAV6, AAV8, AAV9, Anc80, Anc80L65, AAV-DJ, AAV-DJ / 9, 7m8, and PHP.B may be particularly useful for targeting GJB2-expressing cells. Serotypes evolved for retinal transduction may also be used in the methods and compositions described herein. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol.Ther.2:619 (2000), Davidson et al., Proc.Natl.Acad.Sci.USA 97:3428 (2000), Xiao et al., J.Virol.72:2224 (1998), Harlbert et al., J.Virol.74:1524 (2000), Harlbert et al., J.Virol.75:6615 (2001), and Auricchio et al., Hum.Molec.Genet.10:3075 (2001), and each of these disclosures is incorporated herein by reference as it relates to AAV vectors for gene delivery.

[0126] Pseudotyped rAAV vectors are also useful in combination with the compositions and methods described herein. Pseudotyped vectors include pseudotypes in which an AAV vector of a given serotype (e.g., AAV9) has a capsid gene derived from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for example, in Duan et al., J.Virol.75:7662 (2001), Halbert et al., J.Virol.74:1524 (2000), Zolotukhin et al., Methods, 28:158 (2002), and Auricchio et al., Hum.Molec.Genet.10:3075 (2001).

[0127] AAV virions with mutations within the virion capsid can be used to infect specific cell types more effectively than non-mutant capsid virions. For example, a suitable AAV variant may have ligand insertion mutations to facilitate AAV targeting of specific cell types. The construction and characterization of AAV capsid variants, including insertion variants, alanine screening variants, and epitope tag variants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV virions that can be used in the methods described herein include capsid hybrids produced by molecular breeding of the virus and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0128] Pharmaceutical composition The nucleic acid vectors described herein (for example, polynucleotides having at least 90% sequence identity to the sequence of wild-type human Gjb2 (for example, wild-type human Gjb2, for example, sequence number 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides) or having at least 90% sequence identity to the sequence of sequence number 4 or sequence number 28 (e.g., A vector containing a GJB2 modulating construct as described herein (for example, a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher)) operably linked to a polynucleotide having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) can be incorporated into a vehicle for administration to a patient, such as a human patient suffering from sensorineural hearing loss (e.g., GJB2-associated hearing loss). A pharmaceutical composition containing a vector, such as a viral vector, containing a GJB2 modulating construct as described herein operably linked to a polynucleotide encoding GJB2 can be prepared using methods known in the art. For example, such compositions can be prepared in a desired form, such as a lyophilized formulation or an aqueous solution, using, for example, a physiologically acceptable carrier, excipient, or stabilizer (Remington: The Science and Practice of Pharmacology 22nd edition, Allen, L. Ed. (2013), incorporated herein by reference).

[0129] A mixture of nucleic acid vectors (e.g., viral vectors) containing the GJB2 modulating construct described herein, operably linked to a polynucleotide encoding Gjb2, may be prepared in water suitably mixed with one or more excipients, carriers, or diluents. Dispersions may also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, and in oil. Under normal storage and use conditions, these preparations may contain preservatives to prevent microbial growth. Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions, and sterile powders for immediate preparation of sterile injectable solutions or dispersions (described in US5,466,468, the disclosure of which is incorporated herein by reference). In any case, the formulations may be sterile and may be fluid to the extent that syringability is present. The formulations may be stable under manufacturing and storage conditions and may be protected against contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Appropriate fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antimicrobial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. In many cases, it is preferable to include isotonic agents, such as sugars or sodium chloride. Long-term absorption of the injectable composition can be achieved by the use of absorption-delaying agents, such as aluminum monostearate and gelatin, in the composition.

[0130] For example, solutions containing the pharmaceutical compositions described herein are preferably buffered as needed, and the liquid diluent isotonicized first with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that can be used are known to those skilled in the art in light of this disclosure. For example, a single dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution, or injected at the proposed injection site. Some dose variation will inevitably occur depending on the condition of the subject being treated. For local administration to the inner ear, the composition may be formulated to contain synthetic perilymphatic fluid. A typical synthetic perilymphatic fluid contains 20–200 mM NaCl, 1–5 mM KCl, 0.1–10 mM CaCl2, 1–10 mM glucose, and 2–50 mM HEPE, with a pH of approximately 6–9 and an osmotic pressure of approximately 300 mOsm / kg. The administering officer will, in any case, determine the appropriate dose for each individual subject. Furthermore, for human administration, the preparation may meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biologics.

[0131] Treatment method The compositions described herein may be administered to subjects with or at risk of developing sensorineural hearing loss (e.g., GJB2-associated hearing loss) by a wide variety of routes, including local administration to the middle or inner ear (e.g., administration into the perilymph or endolymph, e.g., the oval window, round window, or semicircular canals (e.g., the horizontal semicircular canal), or administration via these, or by transtympanic or intratympanic injection, e.g., administration to GJB2-expressing inner ear cells), intravenous, parenteral, intradermal, transcutaneous, intramuscular, intranasal, subcutaneous, transcutaneous, intratracheal, intraperitoneal, intra-arterial, intravascular, inhalation, perfusion, lavage, and oral administration. The most preferred route of administration in any given case depends on the specific composition being administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., time of administration and route of administration), the patient's age, weight, sex, the severity of the disease being treated, the patient's diet, and the patient's excretion rate. The composition may be administered once or multiple times (for example, once a year, twice a year, three times a year, every other month, once a month, or every other week).

[0132] Subjects who may be treated as described herein are subjects who have or are at risk of developing sensorineural hearing loss. In some embodiments, the compositions described herein are used to treat GJB2-related hearing loss (e.g., hearing loss associated with DFNB1, DFNA3, or Bart-Pumphrey syndrome, porcupine-like ichthyosis with hearing loss, keratitis-ichthyosis-deafness syndrome, palmoplantar keratosis with hearing loss, or Vohwinkel syndrome). GJB2-related hearing loss such as DFNB1 or DFNA3 is caused by polynucleotides encoding GJB2 (e.g., polynucleotides encoding wild-type human GJB2, e.g., polynucleotides having at least 90% sequence identity to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides), or SEQ ID NO: 4 or The patient can be treated by administering a nucleic acid vector containing a GJB2 modulating construct described herein (for example, a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (for example, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity)) which is operably linked to a polynucleotide having at least 90% sequence identity to the sequence of sequence number 28 (for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity). Subjects may have, or may be identified as having, mutations in GJB2 and / or GJB6 (e.g., mutations associated with GJB2-related hearing loss, such as mutations that disrupt GJB2 expression or GJB2 function), and may have severe, moderate, or mild hearing loss at the time treatment is initiated, or may be treated before the onset of symptoms (e.g., prophylactic treatment).

[0133] The methods described herein may include a step of screening a subject for one or more mutations in genes known to be associated with GJB2-related hearing loss (e.g., one or more mutations in GJB2 and / or GJB6) prior to treatment or administration with the compositions described herein. The subject may be screened for gene mutations using standard methods known to those skilled in the art (e.g., genetic testing). The methods described herein may also include a step of evaluating the hearing of the subject prior to treatment with or administration of the compositions described herein. Hearing may be evaluated using standard tests such as audiometry, auditory brainstem response (ABR), electrocochleography (ECOG), and otoacoustic emissions (DPOAE). These tests may also be used to evaluate the hearing of the subject after treatment with or administration with the compositions described herein.

[0134] Therapy may involve the administration of a composition containing a nucleic acid vector (e.g., an AAV vector) containing a GJB2 regulatory construct operably linked to a polynucleotide encoding Gjb2 as described herein, at various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount administered, as well as specific routes of administration and formulations, are within the scope of the art of the art. The unit dose does not need to be administered as a single injection, but may involve continuous infusion over a predetermined period. Administration may be carried out using a syringe pump to control the infusion rate in order to minimize damage to the inner ear (e.g., the cochlea and / or vestibular system). If the nucleic acid vector is an AAV vector (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / also / 8, DJ / 9, 7m8, PHP.B, PHP.eb, or PHP.S vector), the viral vector will deliver, for example, approximately 1 × 10⁶ doses to the patient. 9 Vector genome (VG) / mL ~ approximately 1 × 10⁻⁶ 16 VG / mL (e.g., 1 × 10) 9 VG / mL, 2 x 10 9 VG / mL, 3 x 109 VG / mL、4×10 9 VG / mL、5×10 9 VG / mL、6×10 9 VG / mL、7×10 9 VG / mL、8×10 9 VG / mL、9×10 9 VG / mL、1×10 10 VG / mL、2×10 10 VG / mL、3×10 10 VG / mL、4×10 10 VG / mL、5×10 10 VG / mL、6×10 10 VG / mL、7×10 10 VG / mL、8×10 10 VG / mL、9×10 10 VG / mL、1×10 11 VG / mL、2×10 11 VG / mL、3×10 11 VG / mL、4×10 11 VG / mL、5×10 11 VG / mL、6×10 11 VG / mL、7×10 11 VG / mL、8×10 11 VG / mL、9×10 11 VG / mL、1×10 12 VG / mL、2×10 12 VG / mL、3×10 12 VG / mL、4×10 12 VG / mL、5×10 12 VG / mL、6×10 12 VG / mL、7×10 12 VG / mL、8×10 12 VG / mL、9×10 12 VG / mL、1×10 13 VG / mL、2×10 13 VG / mL、3×10 13 VG / mL、4×10 13 VG / mL、5×10 13 VG / mL、6×10 13 VG / mL、7×10 13 VG / mL、8×10 13 VG / mL、9×10 13 VG / mL、1×10 14VG / mL, 2 x 10 14 VG / mL, 3 x 10 14 VG / mL, 4 x 10 14 VG / mL, 5 x 10 14 VG / mL, 6 x 10 14 VG / mL, 7×10 14 VG / mL, 8 x 10 14 VG / mL, 9×10 14 VG / mL, 1 x 10 15 VG / mL, 2 x 10 15 VG / mL, 3 x 10 15 VG / mL, 4 x 10 15 VG / mL, 5 x 10 15 VG / mL, 6 x 10 15 VG / mL, 7×10 15 VG / mL, 8 x 10 15 VG / mL, 9×10 15 VG / mL, or 1 × 10 16 The VG / mL can be administered in volumes of 1 μL to 200 μL (e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μL). The AAV vector is approximately 1 × 10⁶ 7 VG / ear ~ approx. 2 x 10 15 VG / ear (for example, 1 x 10) 7 VG / ear, 2×10 7 VG / ear, 3×10 7 VG / ear, 4×10 7 VG / ear, 5×10 7 VG / ear, 6×10 7 VG / ear, 7×10 7 VG / ear, 8×10 7 VG / ear, 9×10 7 VG / ear, 1×10 8 VG / ear, 2×10 8 VG / ear, 3×10 8 VG / ear, 4×10 8 VG / ear, 5×10 8 VG / ear, 6×10 8 VG / ear, 7×10 8 VG / ear, 8×10 8VG / ear, 9×10 8 VG / ear, 1×10 9 VG / ear, 2×10 9 VG / ear, 3×10 9 VG / ear, 4×10 9 VG / ear, 5×10 9 VG / ear, 6×10 9 VG / ear, 7×10 9 VG / ear, 8×10 9 VG / ear, 9×10 9 VG / ear, 1×10 10 VG / ear, 2×10 10 VG / ear, 3×10 10 VG / ear, 4×10 10 VG / ear, 5×10 10 VG / ear, 6×10 10 VG / ear, 7×10 10 VG / ear, 8×10 10 VG / ear, 9×10 10 VG / ear, 1×10 11 VG / ear, 2×10 11 VG / ear, 3×10 11 VG / ear, 4×10 11 VG / ear, 5×10 11 VG / ear, 6×10 11 VG / ear, 7×10 11 VG / ear, 8×10 11 VG / ear, 9×10 11 VG / ear, 1×10 12 VG / ear, 2×10 12 VG / ear, 3×10 12 VG / ear, 4×10 12 VG / ear, 5×10 12 VG / ear, 6×10 12 VG / ear, 7×10 12 VG / ear, 8×10 12 VG / ear, 9×10 12 VG / ear, 1×10 13 VG / ear, 2×10 13 VG / ear, 3×10 13 VG / ear, 4×10 13 VG / ear, 5×10 13 VG / ear, 6×10 13 VG / ear, 7×10 13 VG / ear, 8×10 13 VG / ear, 9×1013 VG / ear, 1×10 14 VG / ear, 2×10 14 VG / ear, 3×10 14 VG / ear, 4×10 14 VG / ear, 5×10 14 VG / ear, 6×10 14 VG / ear, 7×10 14 VG / ear, 8×10 14 VG / ear, 9×10 14 VG / ear, 1×10 15 VG / ear, or 2×10 15 It can be administered to the target at a dose of VG / ear.

[0135] The compositions described herein are administered in amounts sufficient to improve hearing, increase or induce wild-type Gjb2 expression in GJB2-expressing cells (e.g., cochlear support cells), increase or improve Gjb2 function, promote or increase cochlear support cell survival, or improve the function and / or structure of cochlear support cells. Hearing may be assessed using standard audiometry (e.g., audiometrics, ABR, electrocochleography (ECOG), and otoacoustic emissions) and may be improved by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more) compared to a hearing measurement obtained before treatment. In some embodiments, the compositions are administered in amounts sufficient to improve the subject's ability to understand speech. The compositions described herein may also be administered in amounts sufficient to slow or prevent the onset or progression of sensorineural hearing loss (for example, in subjects who have a gene mutation associated with GJB2-related hearing loss but do not exhibit hearing impairment, or in subjects who exhibit only mild to moderate hearing loss at the start of treatment). GJB2 expression may be evaluated using immunohistochemistry, Western blotting, quantitative real-time PCR, or other methods known in the art for detection of proteins or mRNA, and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more) compared to expression before administration of the compositions described herein. Cochlear support cell function and / or Gjb2 function can be indirectly assessed based on hearing tests and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200%, or more) compared to cochlear support cell function and / or Gjb2 function before administration of the compositions described herein. The compositions and methods described herein may also reduce the toxicity associated with the administration of nucleic acid vectors compared to the toxicity observed after administration of nucleic acid vectors that do not contain the GJB2 regulatory constructs described herein (e.g., administration of nucleic acid vectors in which polynucleotides encoding Gjb2 are expressed using a ubiquitous promoter).These effects may occur, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 weeks or longer after administration of the composition described herein. Patients may be evaluated 1, 2, 3, 4, 5, 6 months or longer after administration of the composition, depending on the dose and route of administration used for treatment. Depending on the evaluation results, patients may receive additional treatment.

[0136] kit The compositions described herein can be provided in kits for use in treating sensorineural hearing loss (e.g., GJB2-related hearing loss). The compositions include polynucleotides encoding Gjb2 (e.g., polynucleotides encoding wild-type human Gjb2, e.g., polynucleotides encoding wild-type human Gjb2, e.g., polynucleotides having at least 90% sequence identity to the sequence of SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides), or SEQ ID NO: 4 or SEQ ID NO: 28 The polynucleotides may include a polynucleotide containing the GJB2 regulatory construct described herein, operably linked to a polynucleotide having at least 90% sequence identity with respect to the sequence (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity). Nucleic acid vectors may be packaged in AAV virus capsids (e.g., AAV1, AAV2, AAV2quad(YF), AAV6, AAV8, AAV9, Anc80, Anc80L65, AAV-DJ, DJ / 9, 7m8, or PHP.B). The kit may further include instructions for the kit user, such as a physician, to carry out the methods described herein. The kit may optionally include a syringe or other device for administering the composition. [Examples]

[0137] The following examples are provided to those skilled in the art to explain how the compositions and methods described herein may be used, prepared, and evaluated, and are intended to be merely illustrative of the present invention and not intended to limit the scope of what the inventors consider to be their invention.

[0138] Example 1. Western blot of Flag-tagged hGJB2 codon variants Code sequence variants of human GJB2 (hGJB2), including wild-type (SEQ ID NO: 5), CpG-depleted (CpG-dep, SEQ ID NO: 3), codon-optimized (CodOpt, SEQ ID NO: 28), and CpG-depleted codon-optimized (CO-CpG-dep, SEQ ID NO: 4), were cloned into plasmids having the same C-terminal 3×FLAG tag sequence under the control of the CMV promoter. Each 1 microgram plasmid was subjected to 6×10⁶ filtration using Lipofectamine 3000 (Invitrogen L3000-015). 5 HeLa cells were transfected into different wells of a 6-well plate. Transfected cells were incubated at 37°C for 72 hours. Cells were then harvested and cell lysates were performed on Western blot. The hGJB2-3×Flag protein was detected using an anti-Flag antibody, with an anti-actin antibody used as an internal control (Figure 18, Panel A). The band intensity of hGJB2-3×Flag was measured and normalized to actin band intensity (Figure 18, Panel B). These results demonstrated a moderate reduction in hGJB2 levels with CpG depletion in vitro, both in wild-type and codon-optimized contexts.

[0139] Example 2. In vitro uptake of propidium iodide by cells expressing wild-type or codon variant hGJB2. In vitro functional assays were performed to compare Gjb2 function from proteins produced by different hGJB2 coding sequences. Human Gjb2, when expressed in HeLa cells, forms hemichannels. These channels remain closed in the presence of calcium ions but open in the absence of calcium. The functional activity of Gjb2 can be measured in vitro using the uptake of propidium iodide (PI) via the opened hemichannels.

[0140] Code sequence variants of hGJB2, including wild-type (SEQ ID NO: 5), CpG-depleted (CpG-dep, SEQ ID NO: 3), codon-optimized (CodOpt, SEQ ID NO: 28), and CpG-depleted codon-optimized (CO-CpG-dep, SEQ ID NO: 4), were cloned into plasmids under the control of the CMV promoter. 200 nanograms of each plasmid were sampled using Lipofectamine 3000 (Invitrogen L3000-015) at a rate of 1 × 10⁶. 5 HeLa cells were transfected into different wells of a 24-well plate. The transfected cells were incubated at 37°C for 72 hours. The culture medium was then aspirated, and Ca was removed. 2+ Whether or not it was present, it was replaced with buffered PI in Hanks equilibrium salt solution (HBSS). The final solution was prepared as follows: Ca 2+ Buffer solution containing: 1 × HBSS (Thermo 14065056) and 0.1 mg / mL PI (Sigma P4864); Ca 2+Buffer solution without calcium: 1× calcium-free HBSS (Thermo 14185052), 200 mM MgCl2 (VWR 97062-850), 10 mM EGTA (Fisher 50-255-956), and 0.1 mg / mL PI. Cells were incubated in the PI buffer at room temperature for 40 minutes. The buffer was then aspirated, and cells were collected using TrypLE Express (Gibco 12605-010) and analyzed on a Sony SH800 flow cytometer in analyzer mode using a 561 nm laser and PE (600 / 60) filter. The percentage of cells that took up PI was graphed for each coding sequence variant (Figure 19, Panel A). All variants resulted in higher PI uptake than the "no GJB2" condition. The two CpG-depleted versions were functionally similar to the wild-type hGJB2, but the codon-optimized version without CpG depletion resulted in increased PI uptake.

[0141] The wild-type (SEQ ID NO: 5) and CpG-depleted (SEQ ID NO: 3) hGJB2 genes, driven by CMV, were packaged in an AAV1 vector. HeLa cells were fed 1 × 10⁶ cells per cell. 4 , 1 x 10 5 , and 1 × 10 6 Using these vectors at different infection ratios (MOI) of the viral genome (vg), a total of 2.5 × 10⁶ 5 The cells were transduced. After incubating the transduced cells at 37°C for 72 hours, the culture medium was changed to Ca as described above. 2+ The PI buffer was replaced with one that did not contain [specific component]. Cells were incubated at room temperature for 40 minutes, then harvested and run on an SH800 flow cytometer as described above. The percentage of PI-positive cells was graphed at each MOI (Figure 19, Panel B). Both wild-type and CpG-dep vectors showed increased PI uptake at higher MOIs, with MOI = 1 × 10⁻⁶. 6 The CpG-dep version shows higher uptake in vg / cells.

[0142] Example 3. Hearing recovery driven by CpG depletion and wild-type hGJB2 transgene in a GJB2-deficient mouse model. Neonatal GJB6-LacZ mice were injected unilaterally via fenestration in the posterior semicircular canal 1–3 days after birth with either transgene plasmid P1595 (Figure 6, SEQ ID NO: 16) containing CpG-dep hGJB2 driven by a GJB2 regulatory construct, or a corresponding transgene plasmid containing wild-type hGJB2 driven by the same GJB2 regulatory construct, injecting either the vector into the posterior semicircular canal. To test for hearing recovery, animals were anesthetized with ketamine and xylazine, and auditory brainstem response (ABR) and distortion component otoacoustic emissions (DPOAE) were measured in both ears (injected and uninjected). Hearing recovery was tested at multiple time points from 4 to 24 weeks post-treatment. The level and durability of hearing recovery were comparable between both treatment groups (Figure 20), indicating comparable efficacy driven by wild-type and CpG-depleted transcripts.

[0143] Example 4. Hearing restoration using a CpG-depleted hGJB2 transgene follows a clear dose-response pattern. Neonatal GJB6-LacZ mice were injected unilaterally with 1 microliter of 1x, 0.25x, or 0.1x doses of AAV1 vector prepared from the transgene plasmid P1595 (Figure 6, SEQ ID NO: 16). The surgical injection route and timing were as described in Example 3. Auditory brainstem responses and distortion component otoacoustic emissions were measured 4 weeks after treatment, as in Example 3. The results showed a clear dose-response, with the number of respondents and the magnitude of hearing recovery increasing with dose level (Figure 21).

[0144] Example 5. The bGH polyA signal sequence yielded higher gene expression in vitro than the SV40 polyA signal sequence. Either the bovine growth hormone polyadenylation (bGH_pA) signal (SEQ ID NO: 6) or the simian virus 40 polyadenylation (SV40_pA) signal (SEQ ID NO: 7) was inserted into a plasmid downstream of an H2B-EGFP sequence driven by the CMV promoter (CMV.H2B-EGFP). 500 nanograms of each plasmid were used to extract 1 × 10⁶ samples using Lipofectamine 3000 (Invitrogen L3000-015). 5 HEK293T cells were transfected into different wells of a 24-well plate. Transfected cells were incubated at 37°C for 48 hours. Cells were then harvested using TrypLE Express (Gibco 12605-010) and analyzed on a Sony SH800 flow cytometer in analyzer mode using a 488 nm laser and a FITC (525 / 50) filter. Geometric mean fluorescence in EGFP-positive cells was measured and graphed (Figure 22). Using the bGH_pA signaling sequence resulted in higher mean expression of CMV-driven EGFP than using the SV40_pA signaling sequence in vitro.

[0145] Example 6. The pAAVdB skeleton functions similarly to pAAVKan in vitro. Two different CMV.H2B-EGFP.bGH_pA gene cassettes (sequences not shown), each having different restriction enzyme cloning sites within the gene region, were separately cloned into either the pAAVKan (3,157 nucleotides spanning nucleotides 2454-5420 and 1-190 of SEQ ID NO: 20) or pAAVdB (3,038 nucleotides spanning nucleotides 2399-5301 and 1-135 of SEQ ID NO: 12) ITR-containing plasmid backbone. 500 nanograms of each plasmid were extracted using Lipofectamine 3000 (Invitrogen L3000-015) at a rate of 1 × 10⁶ 5HEK293T cells were transfected into different wells of a 24-well plate. The transfected cells were incubated at 37°C for 48 hours. Cells were then harvested using TrypLE Express (Gibco 12605-010) and analyzed on a Sony SH800 flow cytometer in analyzer mode using a 488 nm laser and a FITC (525 / 50) filter. The geometric mean of fluorescence in EGFP-positive cells was measured and graphed (Figure 23). There was some variability between GFP cassettes, but expression did not differ significantly between the two plasmid backbones.

[0146] Example 7. Administration of a composition containing the nucleic acid vector described herein to a subject having GJB2-related hearing loss. A person skilled in the art can treat a patient, such as a human patient with GJB2-related hearing loss, in accordance with the methods disclosed herein, to improve or restore hearing, or to slow or halt the progression of hearing loss. For this purpose, a person skilled in the art could provide a human patient with a polynucleotide that has at least 90% sequence identity to the sequence of SEQ ID NO: 38 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less) or at least 90% sequence identity to the sequence of SEQ ID NO: 4 or SEQ ID NO: 2 A composition containing an AAV vector (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S vector) containing a GJB2 modulating construct described herein (e.g., a polynucleotide having at least 85% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity)) operably linked to a polynucleotide having the above sequence identity can be administered. Compositions containing AAV vectors can be administered to patients to treat sensorineural hearing loss, for example, by local administration to the inner ear (e.g., injection into the perilymph or through the round window membrane).

[0147] After administering the composition to a patient, physicians in the art can monitor the patient's improvement in response to the treatment in a variety of ways. For example, a physician can monitor the patient's hearing by performing standard tests such as audiometry, ABR, electrocochleography (ECOG), and otoacoustic emissions (DPOAE) after administering the composition. Findings that the patient shows improvement in hearing in one or more of the tests after administration of the composition compared to the audiometry results before administration of the composition indicate that the patient is responding favorably to the treatment. Subsequent doses can be determined and administered as needed.

[0148] Exemplary embodiments of the present invention are described in the following paragraphs.

[0149] In the order of E1.5' to 3', A GJB2 modulating construct operably linked to (a)(b) having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher) with respect to the sequence of sequence number 1 or sequence number 2, (b)(c) operably linked to a human GJB2 coding sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 28; a sequence having at least 90% sequence identity with SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or less); and a sequence having at least 90% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more); (c) A nucleic acid vector containing a polyadenylated (poly-A) signal sequence.

[0150] E2. The nucleic acid vector according to E1, wherein the GJB2 regulatory construct has at least 90% sequence identity with respect to the sequence of Sequence ID No. 1 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0151] E3. The nucleic acid vector according to E2, wherein the GJB2 regulatory construct has the sequence of Sequence ID No. 1.

[0152] E4. The nucleic acid vector according to E1, wherein the GJB2 regulatory construct has at least 90% sequence identity with respect to the sequence of Sequence ID No. 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0153] E5. The nucleic acid vector according to E4, wherein the GJB2 regulatory construct has the sequence of Sequence ID No. 2.

[0154] E6. A nucleic acid vector according to any one of E1 to E5, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of Sequence ID No. 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides).

[0155] E7. The nucleic acid vector according to E6, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of Sequence ID No. 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), and does not contain CG dinucleotides.

[0156] E8. The nucleic acid vector according to E6 or E7, wherein the human GJB2 coding sequence has the sequence of sequence number 3.

[0157] E9. A nucleic acid vector according to any one of E1 to E5, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of sequence number 4 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0158] E10. The nucleic acid vector according to E9, wherein the human GJB2 coding sequence has the sequence of sequence number 4.

[0159] E11. A nucleic acid vector according to any one of E1 to E5, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of sequence number 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0160] E12. The nucleic acid vector according to E11, wherein the human GJB2 coding sequence has the sequence of sequence number 28.

[0161] E13. A nucleic acid vector according to any one of E1-E3 and E6-E8, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0162] E14. A nucleic acid vector according to any one of E1 to E3, E9, and E10, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0163] E15. A nucleic acid vector according to any one of E1 to E3, E11, and E12, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0164] E16. A nucleic acid vector according to any one of E1 and E4 to E8, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0165] E17. A nucleic acid vector according to any one of E1, E4, E5, E9, and E10, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0166] E18. A nucleic acid vector according to any one of E1, E4, E5, E11, and E12, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0167] E19. A nucleic acid vector according to any one of E1 to E18, wherein the poly(A) signal sequence has at least 90% sequence identity with respect to the sequence of sequence number 6 or sequence number 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0168] E20. The nucleic acid vector according to E19, wherein the poly(A) signal sequence has at least 90% sequence identity with respect to the sequence of sequence number 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0169] E21. The nucleic acid vector according to E20, wherein the poly(A) signal sequence has the sequence of sequence number 6.

[0170] E22. The nucleic acid vector according to E19, wherein the poly(A) signal sequence has at least 90% sequence identity with respect to the sequence of sequence number 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0171] E23. The nucleic acid vector according to E22, wherein the poly(A) signal sequence has the sequence of sequence number 7.

[0172] E24. A nucleic acid vector according to any one of E1 to E23, further comprising: a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity); and a second polynucleotide having at least 90% sequence identity to SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity); and

[0173] E25. The nucleic acid vector according to E24, wherein the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0174] E26. A nucleic acid vector according to any one of E1 to E23, further comprising: a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity); and a second polynucleotide having at least 90% sequence identity to SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity); and

[0175] E27. The nucleic acid vector according to E26, wherein the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0176] E28. A nucleic acid vector according to any one of E1 to E27, wherein the stop codon is located at 3' of the GJB2 coding sequence (for example, the stop codon is directly ligated to the 3' end of the GJB2 coding sequence).

[0177] E29. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-2383 of sequence number 12.

[0178] E30. The nucleic acid vector according to E1 or E29, wherein the vector comprises a polynucleotide sequence including nucleotides 1 to 2531 of sequence number 12.

[0179] E31. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-2383 of sequence number 13.

[0180] E32. The nucleic acid vector according to E1 or E31, wherein the vector comprises a polynucleotide sequence including nucleotides 1 to 2531 of sequence number 13.

[0181] E33. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-3459 of sequence number 14.

[0182] E34. The nucleic acid vector according to E1 or E33, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 3607 of sequence number 14.

[0183] E35. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-3459 of sequence number 15.

[0184] E36. The nucleic acid vector according to E1 or E35, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 3607 of SEQ ID NO: 15.

[0185] E37. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-2462 of sequence number 16.

[0186] E38. The nucleic acid vector according to E1 or E37, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2610 of sequence number 16.

[0187] E39. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-2462 of sequence number 17.

[0188] E40. The nucleic acid vector according to E1 or E39, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2610 of sequence number 17.

[0189] E41. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-3538 of sequence number 18.

[0190] E42. The nucleic acid vector according to E1 or E41, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 3686 of sequence number 18.

[0191] E43. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 157-3538 of sequence number 19.

[0192] E44. The nucleic acid vector according to E1 or E43, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 3686 of sequence number 19.

[0193] E45. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-2438 of sequence number 20.

[0194] E46. The nucleic acid vector according to E1 or E45, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2650 of sequence number 20.

[0195] E47. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-2438 of sequence number 21.

[0196] E48. The nucleic acid vector according to E1 or E47, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 2650 of sequence number 21.

[0197] E49. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-3514 of sequence number 22.

[0198] E50. The nucleic acid vector according to E1 or E49, wherein the vector comprises a polynucleotide sequence including nucleotides 1 to 3726 of sequence number 22.

[0199] E51. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-3514 of sequence number 23.

[0200] E52. The nucleic acid vector according to E1 or E51, wherein the vector comprises a polynucleotide sequence including nucleotides 1 to 3726 of sequence number 23.

[0201] E53. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-2517 of sequence number 24.

[0202] E54. The nucleic acid vector according to E1 or E53, wherein the vector comprises a polynucleotide sequence including nucleotides 1 to 2729 of sequence number 24.

[0203] E55. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-2517 of sequence number 25.

[0204] E56. The nucleic acid vector according to E1 or E55, wherein the vector comprises a polynucleotide sequence including nucleotides 1 to 2729 of SEQ ID NO: 25.

[0205] E57. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-3593 of sequence number 26.

[0206] E58. The nucleic acid vector according to E1 or E57, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 3805 of sequence number 26.

[0207] E59. The nucleic acid vector according to E1, wherein the vector comprises a polynucleotide sequence including nucleotides 212-3593 of sequence number 27.

[0208] E60. The nucleic acid vector according to E1 or E59, wherein the vector comprises a polynucleotide sequence containing nucleotides 1 to 3805 of sequence number 27.

[0209] E61. A polynucleotide comprising a human GJB2 coding sequence selected from the group consisting of sequences having at least 90% sequence identity with SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, and SEQ ID NO: 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity) and containing at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides), and sequences having at least 90% sequence identity with SEQ ID NO: 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0210] E62. The polynucleotide according to E61, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of Sequence ID No. 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), and contains at least 50% fewer CG dinucleotides than wild-type GJB2 (e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or lower CG dinucleotides).

[0211] E63. The polynucleotide according to E62, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of Sequence ID No. 3 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), and does not contain a CG dinucleotide.

[0212] E64. The polynucleotide according to E62 or E63, wherein the human GJB2 coding sequence has the sequence of Sequence ID No. 3.

[0213] E65. The polynucleotide according to E61, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of Sequence ID No. 4 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0214] E66. The polynucleotide according to E65, wherein the human GJB2 coding sequence has the sequence of Sequence ID No. 4.

[0215] E67. The polynucleotide according to E61, wherein the human GJB2 coding sequence has at least 90% sequence identity with respect to the sequence of Sequence ID No. 28 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0216] E68. The polynucleotide according to E67, wherein the human GJB2 coding sequence has the sequence of sequence number 28.

[0217] E69. A polynucleotide according to any one of E61 to E68, wherein the stop codon is located at 3' of the GJB2 coding sequence (for example, the stop codon is directly ligated to the 3' end of the GJB2 coding sequence).

[0218] A polynucleotide according to any one of E61 to E69, wherein the E70.GJB2 promoter is operably ligated to the GJB2 coding sequence.

[0219] E71. The polynucleotide according to E70, wherein the GJB2 promoter is located at 5' of the GJB2 coding sequence.

[0220] E72. The polynucleotide according to E70 or E71, wherein the GJB2 promoter is contained in the GJB2 regulatory construct.

[0221] E73. The polynucleotide according to E72, wherein the GJB2 regulatory construct has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0222] E74. The polynucleotide according to 73, wherein the GJB2 modulating construct has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 1 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0223] E75. The polynucleotide according to E74, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1.

[0224] E76. The polynucleotide according to E75, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0225] E77. The polynucleotide according to E75, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0226] E78. The polynucleotide according to E75, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0227] E79. The polynucleotide according to E73, wherein the GJB2 regulatory construct has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0228] E80. The polynucleotide according to E79, wherein the GJB2 regulatory construct has the sequence of Sequence ID No. 2.

[0229] E81. The polynucleotide according to E80, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 3.

[0230] E82. The polynucleotide according to E80, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 4.

[0231] E83. The polynucleotide according to E80, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO: 28.

[0232] E84. A polynucleotide according to any one of E61 to E83, wherein the GJB2 coding sequence is operably linked to a poly-A signal sequence.

[0233] E85. The polynucleotide according to E84, wherein the poly(A) signal sequence is located at 3' of the GJB2 coding sequence.

[0234] E86. The polynucleotide according to E84 or E85, wherein the polyA signal sequence has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 6 or SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0235] E87. The polynucleotide according to E86, wherein the polyA signal sequence has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 6 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0236] E88. The polynucleotide according to E87, wherein the polyA signal sequence has the sequence of SEQ ID NO: 6.

[0237] E89. The polynucleotide according to E86, wherein the polyA signal sequence has at least 90% sequence identity with respect to the sequence of SEQ ID NO: 7 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity).

[0238] E90. The polynucleotide according to E89, wherein the polyA signal sequence has the sequence of SEQ ID NO: 7.

[0239] E91. A polynucleotide according to any one of E71 to E90, further comprising: a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 8 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), comprising a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 9 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), comprising a second).

[0240] E92. The polynucleotide according to E91, wherein the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0241] E93. A polynucleotide according to any one of E71 to E90, further comprising: a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 10 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), comprising a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 11 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity), comprising a second).

[0242] E94. The polynucleotide according to E93, wherein the first polynucleotide has the sequence of SEQ ID NO: 8, and the second polynucleotide has the sequence of SEQ ID NO: 9.

[0243] E95. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157-2383 of SEQ ID NO: 12.

[0244] E96. The polynucleotide according to E61, E73, or E95, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2531 of SEQ ID NO: 12.

[0245] E97. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157-2383 of SEQ ID NO: 13.

[0246] E98. The polynucleotide according to E61, E73, or E97, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2531 of SEQ ID NO: 13.

[0247] E99. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 3459 of SEQ ID NO: 14.

[0248] E100. The polynucleotide according to E61, E73, or E99, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3607 of SEQ ID NO: 14.

[0249] E101. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 3459 of SEQ ID NO: 15.

[0250] E102. The polynucleotide according to E61, E73, or E101, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3607 of SEQ ID NO: 15.

[0251] E103. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 2462 of SEQ ID NO: 16.

[0252] E104. The polynucleotide according to E61, E73, or E103, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2610 of SEQ ID NO: 16.

[0253] E105. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157 to 2462 of SEQ ID NO: 17.

[0254] E106. The polynucleotide according to E61, E73, or E104, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2610 of SEQ ID NO: 17.

[0255] E107. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 157-3538 of SEQ ID NO: 18.

[0256] E108. The polynucleotide according to E61, E73, or E107, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3686 of SEQ ID NO: 18.

[0257] E109. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence including nucleotides 157-3538 of SEQ ID NO: 19.

[0258] E110. The polynucleotide according to E61, E73, or E109, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3686 of SEQ ID NO: 19.

[0259] E111. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212-2438 of SEQ ID NO: 20.

[0260] E112. The polynucleotide according to E61, E73, or E111, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2650 of SEQ ID NO: 20.

[0261] E113. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 2438 of SEQ ID NO: 21.

[0262] E114. The polynucleotide according to E61, E73, or E113, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2650 of SEQ ID NO: 21.

[0263] E115. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 3514 of SEQ ID NO: 22.

[0264] E116. The polynucleotide according to E61, E73, or E115, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3726 of SEQ ID NO: 22.

[0265] E117. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 3514 of SEQ ID NO: 23.

[0266] E118. The polynucleotide according to E61, E73, or E117, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3726 of SEQ ID NO: 23.

[0267] E119. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence including nucleotides 212-2517 of SEQ ID NO: 24.

[0268] E120. The polynucleotide according to E61, E73, or E119, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2729 of SEQ ID NO: 24.

[0269] E121. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 212 to 2517 of SEQ ID NO: 25.

[0270] E122. The polynucleotide according to E61, E73, or E121, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 2729 of SEQ ID NO: 25.

[0271] E123. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence including nucleotides 212 to 3593 of SEQ ID NO: 26.

[0272] E124. The polynucleotide according to E61, E73, or E123, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3805 of SEQ ID NO: 26.

[0273] E125. The polynucleotide according to E61 or E73, wherein the polynucleotide comprises a polynucleotide sequence including nucleotides 212 to 3593 of SEQ ID NO: 27.

[0274] E126. The polynucleotide according to E61, E73, or E125, wherein the polynucleotide comprises a polynucleotide sequence containing nucleotides 1 to 3805 of SEQ ID NO: 27.

[0275] A nucleic acid vector containing one of the polynucleotides listed in E127.E61~E126.

[0276] E128. The nucleic acid vector according to any one of E1 to E60 and E127, wherein the nucleic acid vector is a viral vector, plasmid, cosmid, or artificial chromosome.

[0277] E129. The nucleic acid vector according to any one of E1 to E60, E127, and E122, wherein the nucleic acid vector is a viral vector.

[0278] E130. The nucleic acid vector according to E129, wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus.

[0279] E131. The nucleic acid vector described in E130, wherein the viral vector is an AAV vector.

[0280] E132. The nucleic acid vector according to E131, wherein the AAV vector has a capsid of AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S.

[0281] E133. The nucleic acid vector according to E132, wherein the AAV vector has an AAV1 capsid.

[0282] E134. The nucleic acid vector according to E132, wherein the AAV vector has an AAV-DJ capsid.

[0283] E135. The nucleic acid vector according to E132, wherein the AAV vector has an AAV9 capsid.

[0284] E136. The nucleic acid vector according to E132, wherein the AAV vector has a 7m8 capsid.

[0285] E137. The nucleic acid vector according to E132, wherein the AAV vector has an Anc80 capsid.

[0286] E138. The nucleic acid vector according to E132, wherein the AAV vector has an AAV2 capsid.

[0287] E139. The nucleic acid vector according to E132, wherein the AAV vector has an AAV2quad(YF) capsid.

[0288] E140. The nucleic acid vector according to E132, wherein the AAV vector has an AAV8 capsid.

[0289] E141. The nucleic acid vector according to E132, wherein the AAV vector is a DJ / 9 capsid.

[0290] E142. The nucleic acid vector described in E132, wherein the AAV vector is a PHP.B capsid.

[0291] E143. The nucleic acid vector according to E132, wherein the AAV vector has an AAV6 capsid.

[0292] E144. The nucleic acid vector described in E132, wherein the AAV vector is a PHP.S capsid.

[0293] A composition comprising a nucleic acid vector described in any one of E145, E1-E60, and E127-E144, and a pharmaceutically acceptable carrier, diluent, or excipient.

[0294] Cells containing a polynucleotide described in any one of E146.E61-E126, or a nucleic acid vector described in any one of E1-E60 and E127-E144.

[0295] E147. The cells described in E146, wherein the cells are GJB2-expressing cells.

[0296] E148. The cells described in E147, wherein the GJB2-expressing cells are GJB2-expressing inner ear cells.

[0297] E149. The cell described in any one of E146 to E148, wherein the cell is a mammalian cell.

[0298] E150. The cell described in E149, wherein the mammalian cell is a human cell.

[0299] E151. The cell described in any one of E146 to E150, wherein the cell is a cochlear supporting cell.

[0300] E152. A method for expressing human GJB2 in GJB2-expressing cells, comprising contacting the GJB2-expressing cells with a nucleic acid vector described in any one of E1 to E60 and E127 to E144 or a composition described in E145.

[0301] E153. The method according to E152, wherein the GJB2-expressing cells are GJB2-expressing inner ear cells.

[0302] E154. The method according to E153, wherein the GJB2-expressing inner ear cells are cochlear supporting cells.

[0303] E155. The method according to any one of E152 to E154, wherein the contact is made inside the object (for example, in vivo).

[0304] E156. A method for treating a subject having or at risk of developing GJB2-related hearing loss, comprising administering to the inner ear of the subject a therapeutically effective amount of a nucleic acid vector according to any one of E1-E60 and E127-E144 or a composition according to E145.

[0305] E157. The method according to E156, wherein the GJB2-related hearing loss is DFNB1, DFNA3, or hearing loss associated with Bart-Pumphrey syndrome, porcupine-like ichthyosis with hearing loss, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with hearing loss, or Vohwinkel syndrome.

[0306] E158. The method according to E156, wherein the hearing loss is DFNB1 or DFNA3.

[0307] E159. The method according to E158, wherein the subject has a mutation in GJB2, a mutation in GJB6, or a mutation in both GJB2 and GJB6.

[0308] E160. A method for improving the function or survival of cochlear supporting cells, comprising contacting the cochlear supporting cells with a nucleic acid vector according to any one of E1 to E60 and E127 to E144 or a composition according to E145.

[0309] E161. The method according to E160, wherein the contact is made inside the object (for example, in vivo).

[0310] E162. A method for improving the function or survival of cochlear supporting cells in a subject requiring improvement, comprising administering to the inner ear of the subject a therapeutically effective amount of a nucleic acid vector according to any one of E1-E60 and E127-E144 or a composition according to E145.

[0311] E163. The method according to E161 or E162, wherein the subject has or is at risk of developing GJB2-related hearing loss.

[0312] E164. The method according to E163, wherein the GJB2-related hearing loss is DFNB1, DFNA3, or hearing loss associated with Bart-Pumphrey syndrome, porcupine-like ichthyosis with hearing loss, keratitis-ichthyosis-deafness syndrome, palmoplantar keratoderma with hearing loss, or Vohwinkel syndrome.

[0313] E165. The method according to E163, wherein the hearing loss is DFNB1 or DFNA3.

[0314] E166. The method according to any one of E160 to E165, wherein the cochlear supporting cells are mammalian cochlear supporting cells.

[0315] E167. The method according to E166, wherein the mammalian cochlear supporting cells are human cochlear supporting cells.

[0316] E168. The method according to any one of E155-E159 and E161-E167, further comprising evaluating the hearing of the subject before administering the nucleic acid vector or the composition.

[0317] E169. The method according to any one of E155-E159 and E161-E168, further comprising evaluating the hearing of the subject after administering the nucleic acid vector or the composition.

[0318] E170. The method according to any one of E155 to E169, wherein the nucleic acid vector or the composition is administered topically.

[0319] E171. The method according to E170, wherein the nucleic acid vector or the composition is administered to the inner ear.

[0320] E172. The method according to E170, wherein the nucleic acid vector or the composition is administered to the middle ear.

[0321] E173. The method according to E170, wherein the nucleic acid vector or the composition is administered transtympanically or intratympanically.

[0322] E174. The method according to E170, wherein the nucleic acid vector or the composition is administered into the perilymph.

[0323] E175. The method according to E170, wherein the nucleic acid vector or the composition is administered into the endolymph.

[0324] E176. The method according to E170, wherein the nucleic acid vector or the composition is administered into or through the oval window.

[0325] E177. The method according to E170, wherein the nucleic acid vector or the composition is administered into or through a circular window.

[0326] E178. The method according to any one of E155 to E177, wherein the nucleic acid vector or composition is administered in an amount sufficient to prevent or reduce hearing loss, delay the onset of hearing loss, slow the progression of hearing loss, improve hearing, increase or induce the expression of human GJB2 in GJB2-expressing cells, promote or increase the survival of cochlear supporting cells, or improve the function of cochlear supporting cells.

[0327] E179. The method according to any one of E155-E159 and E161-E178, wherein the subject is a human subject.

[0328] A kit comprising any one of E180.E61-E126, a nucleic acid vector any one of E1-E50 and E127-E144, or the composition described in E145.

[0329] Other Embodiments Various modifications and variations of the invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in relation to specific embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. In fact, various modifications of the described modes for carrying out the invention, which will be apparent to those skilled in the art, are intended to be within the scope of the invention. Other embodiments are included in the claims.

Claims

1. In the order from 5' to 3', A GJB2 regulatory construct operably linked to (a) and (b), having sequences selected from the group consisting of sequence number 1, sequence number 2, and sequences having at least 90% sequence identity with sequence number 1 or sequence number 2, (b) A human GJB2 coding sequence selected from the group consisting of a sequence operably linked to (c) that has at least 90% sequence identity with SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 28, and SEQ ID NO: 3 and contains at least 50% fewer CG dinucleotides than wild-type GJB2, and a sequence that has at least 90% sequence identity with SEQ ID NO: 4 or SEQ ID NO: 28, (c) A nucleic acid vector containing a polyadenylated (poly-A) signal sequence.

2. The nucleic acid vector according to claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

3.

3. The nucleic acid vector according to claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

4.

4. The nucleic acid vector according to claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 1, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

28.

5. The nucleic acid vector according to claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

3.

6. The nucleic acid vector according to claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

4.

7. The nucleic acid vector according to claim 1, wherein the GJB2 regulatory construct has the sequence of SEQ ID NO: 2, and the human GJB2 coding sequence has the sequence of SEQ ID NO:

28.

8. The nucleic acid vector according to any one of claims 1 to 7, wherein the polyA signal sequence has at least 90% sequence identity with respect to sequence number 6 or sequence number 7.

9. The nucleic acid vector according to claim 8, wherein the poly(A) signal sequence has the sequence of sequence number 6.

10. The nucleic acid vector according to claim 8, wherein the poly(A) signal sequence has the sequence of sequence number 7.

11. The nucleic acid vector according to any one of claims 1 to 10, wherein the vector includes a stop codon located at the 3' end of the GJB2 coding sequence.

12. The nucleic acid vector according to any one of claims 1 to 11, further comprising: a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 8, comprising a first member of an ITR pair and positioned at 5' of the GJB2 regulatory construct sequence; and a second polynucleotide having at least 90% sequence identity to SEQ ID NO: 9, comprising a second member of an ITR pair and positioned at 3' of the poly-A signal sequence.

13. The nucleic acid vector according to any one of claims 1 to 11, further comprising: a first polynucleotide having at least 90% sequence identity to SEQ ID NO: 10, comprising a first member of an ITR pair and positioned at 5' of the GJB2 regulatory construct sequence; and a second polynucleotide having at least 90% sequence identity to SEQ ID NO: 11, comprising a second member of an ITR pair and positioned at 3' of the poly-A signal sequence.

14. The nucleic acid vector according to any one of claims 1 to 13, wherein the nucleic acid vector is a viral vector.

15. The nucleic acid vector according to claim 14, wherein the viral vector is an adeno-associated virus (AAV) vector.

16. A composition comprising a nucleic acid vector according to any one of claims 1 to 15 and a pharmaceutically acceptable carrier, diluent, or excipient.

17. A method for treating a subject having or being at risk of developing GJB2-related hearing loss, comprising administering to the inner ear of the subject a therapeutically effective amount of a nucleic acid vector according to any one of claims 1 to 15 or a composition according to claim 16.

18. The method according to claim 17, wherein the GJB2-related hearing loss is DFNB1 or DFNA3.

19. The method according to claim 18, wherein the subject has a mutation in GJB2, a mutation in GJB6, or a mutation in both GJB2 and GJB6.