Use of mdh1 inhibitors in combination with btk inhibitors in the treatment of diffuse large b-cell lymphoma

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to application of MDH1 inhibitor combined with BTK inhibitor in tumor treatment. Specifically, it is found for the first time that MDH1-IN-2 combined with ibritumomab can significantly inhibit DLBCL cell proliferation, and shows a synergistic effect in an ibritumomab-resistant model. Mechanism research shows that MDH1-IN-2 can induce ferroptosis by inhibiting the NF-kappa B signaling pathway, thereby enhancing the killing effect of ibritumomab on drug-resistant cells. The application provides a new drug combination strategy for the treatment of DLBCL, especially for the treatment of patients with ibritumomab resistance, and therefore has good practical application value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of MDH1 inhibitors combined with BTK inhibitors in the treatment of diffuse large B-cell lymphoma. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-Hodgkin lymphoma (NHL), characterized by high heterogeneity and aggressiveness. Although standard treatment regimens, such as R-CHOP, can cure 60-70% of DLBCL patients, a significant proportion still fail to achieve remission. These patients often develop drug resistance, ultimately facing poor clinical outcomes. Therefore, developing new treatment strategies to overcome drug resistance and improve efficacy is an urgent need in the clinical management of DLBCL.

[0004] Ibrutinib, a Bruton's tyrosine kinase (BTK) inhibitor, is an important targeted therapy for DLBCL. Its mechanism of action primarily involves inhibiting BTK protein activity, blocking the B-cell receptor (BCR) signaling pathway, thereby inhibiting tumor cell proliferation and promoting apoptosis. Although ibrutinib provides a direction for targeted therapy of DLBCL, its clinical efficacy as a monotherapy is significantly limited by drug resistance. Current research has found that BTK C481S mutations, activation of downstream alternative signaling pathways (such as NF-κB), and abnormal tumor microenvironment can all lead to ibrutinib resistance. Exploring combination therapy strategies that can overcome ibrutinib resistance and improve efficacy is crucial for improving patient prognosis. Summary of the Invention

[0005] To address the shortcomings of the existing technologies, the inventors, through long-term technical and practical exploration, have developed an application of MDH1 inhibitors combined with BTK inhibitors in the treatment of diffuse large B-cell lymphoma (DLBCL). Specifically, this invention is the first to discover that MDH1-IN-2 has a significant anti-tumor effect in DLBCL and can synergistically inhibit DLBCL cell proliferation when used in combination with ibrutinib, especially demonstrating a reversal of drug resistance in ibrutinib-resistant models. Based on the above research findings, this invention was completed.

[0006] To achieve the above technical objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides the use of an MDH1 inhibitor in combination with a BTK inhibitor in any one or more of the following: a) Inhibiting tumor cell proliferation or preparing products that inhibit tumor cell proliferation; b) Inducing ferroptosis in tumor cells or preparing products that induce ferroptosis in tumor cells; c) Reversing tumor resistance to BTK inhibitors or preparing products that reverse tumor resistance to BTK inhibitors; d) Prepare products for tumor treatment.

[0008] In a second aspect, the present invention provides a composition wherein the active ingredients of the composition include at least the above-mentioned MDH1 inhibitor and BTK inhibitor.

[0009] The composition has any one or more of the following uses: a) Inhibits tumor cell proliferation; b) Induces ferroptosis in tumor cells; c) Reversing tumor resistance to BTK inhibitors; d) Tumor treatment.

[0010] A third aspect of the present invention provides a method for treating a tumor, the method comprising administering to a subject the above-described MDH1 inhibitor in combination with a BTK inhibitor or the above-described composition.

[0011] In a preferred embodiment of the present invention, mechanistic studies have shown that the MDH1 inhibitor MDH1-IN-2 can inhibit the activity of the NF-κB signaling pathway, downregulate the phosphorylation levels of key pathway proteins p65 and IκBα (p-p65, p-IκBα), and thereby downregulate the expression of key proteins related to ferroptosis, SLC7A11 and GPX4, thereby promoting ferroptosis in tumor cells and enhancing the antitumor effect of BTK inhibitors.

[0012] Compared with existing technical solutions, one or more of the above technical solutions have the following beneficial effects: Based on the aforementioned mechanism, this technical solution is the first to discover and verify that MDH1-IN-2 has a significant anti-tumor effect in DLBCL and can synergistically inhibit DLBCL cell proliferation when used in combination with ibrutinib. More importantly, this invention is the first to demonstrate that this combination regimen can reverse drug resistance in an ibrutinib-resistant model and exhibits a strong synergistic effect (synergistic index greater than 10). This study not only provides a novel combination therapy for overcoming the treatment dilemma of DLBCL, especially ibrutinib-resistant DLBCL, but also provides important theoretical basis and experimental support for the development of anti-tumor strategies based on tumor metabolic regulation, and has significant clinical translational prospects. Attached Figure Description

[0013] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0014] Figure 1 The graph shows the results of the synergistic inhibition of DLBCL cell lines OCI-LY1 and OCI-LY19 by MDH1-IN-2 and ibrutinib. A: Effect curve of MDH1-IN-2 on the proliferation of OCI-LY1 and OCI-LY19 cells; B: Effect curve of ibrutinib on the proliferation of OCI-LY1 and OCI-LY19 cells; C: ZIP model synergistic index score of MDH1-IN-2 and ibrutinib in the DLBCL cell line OCI-LY1; D: ZIP model synergistic index score of MDH1-IN-2 and ibrutinib in the DLBCL cell line OCI-LY19.

[0015] Figure 2 The diagram shows the efficacy of MDH1-IN-2 combined with ibrutinib in DLBCL cells. A: Comparison of proliferation inhibition rates between ibrutinib-sensitive and ibrutinib-resistant DLBCL cells after single-drug and combination treatments; B: Validation of the synergistic effect of the combination therapy in ibrutinib-sensitive and ibrutinib-resistant DLBCL cells; C: Changes in lipid ROS levels in ibrutinib-sensitive and ibrutinib-resistant DLBCL cells after single-drug and combination treatments; D: Changes in Fe²⁺ levels in ibrutinib-sensitive and ibrutinib-resistant DLBCL cells after single-drug and combination treatments. + Cumulative content; scale bar is 20 μm.

[0016] Figure 3 This diagram validates the mechanism of changes in NF-κB signaling and ferroptosis-related molecules under MDH1 inhibition. In it, A: Western blot shows changes in NF-κB pathway proteins and ferroptosis proteins after MDH1-IN-2 treatment or MDH1 knockdown; B: Luciferase reporter assay shows the ability of p65 to activate the SLC7A11 promoter transcription in the context of MDH1 knockdown.

[0017] Figure 4 The diagram shows the efficacy of the combination of MDH1-IN-2 and ibrutinib in mice. In this diagram, A: MDH1 knockdown enhances the inhibitory effect of ibrutinib on OCI-LY1 subcutaneous xenografts; B: MDH1 knockdown enhances the inhibitory effect of ibrutinib on OCI-LY19 subcutaneous xenografts. Detailed Implementation

[0018] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0019] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0020] As mentioned earlier, although ibrutinib provides a treatment option for DLBCL, acquired resistance can occur due to various reasons such as site mutations, downstream signal activation, and changes in the microenvironment, resulting in poor efficacy of ibrutinib monotherapy.

[0021] Against this backdrop, our research perspective shifted from traditional signaling pathways to tumor metabolic reprogramming. Through omics analysis, we discovered significant glutamine metabolism abnormalities in DLBCL and further identified malate dehydrogenase 1 (MDH1), a key metabolic enzyme in the tricarboxylic acid cycle, as the core molecule driving this metabolic abnormality. MDH1 not only plays a crucial role in glutamine metabolism reprogramming in lymphoma but also regulates cellular energy metabolism and redox homeostasis. Our study found that targeting MDH1 can induce ferroptosis in DLBCL cells by inhibiting the NF-κB signaling pathway, suggesting that MDH1 inhibitors may be able to intervene in the NF-κB pathway at the metabolic level, reversing key aspects of ibrutinib resistance and improving the efficacy of ibrutinib.

[0022] In view of this, in a typical embodiment of the present invention, the use of an MDH1 inhibitor in combination with a BTK inhibitor in any one or more of the following is provided: a) Inhibiting tumor cell proliferation or preparing products that inhibit tumor cell proliferation; b) Inducing ferroptosis in tumor cells or preparing products that induce ferroptosis in tumor cells; c) Reversing tumor resistance to BTK inhibitors or preparing products that reverse tumor resistance to BTK inhibitors; d) Prepare products for tumor treatment.

[0023] The molar ratio of MDH1 inhibitor to BTK inhibitor is 0-150:0-1.5; further including 0-90:0-0.9 (excluding 0); further, the molar ratio of MDH1 inhibitor to BTK inhibitor is 100:1.

[0024] The MDH1 inhibitors include, but are not limited to, RNA interference molecules or antisense oligonucleotides targeting the MDH1 encoding gene, small molecule inhibitors, shRNA, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against MDH1 itself or its upstream and downstream molecules, such as anti-MDH1 antibodies, and may also include compound inhibitors. In one specific embodiment of the invention, the MDH1 inhibitor includes MDH1-IN-2, which is a highly selective MDH1 inhibitor with the molecular formula C. 25 H 33 NO5, with a molecular weight of 427.53, exhibits significant inhibitory activity against MDH1 enzyme in both in vitro and in vivo models, and can effectively inhibit the proliferation and migration of tumor cells, demonstrating good anti-tumor potential.

[0025] The BTK inhibitors include, but are not limited to, RNA interference molecules or antisense oligonucleotides targeting the BTK encoding gene, small molecule inhibitors, shRNA, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against BTK itself or its upstream and downstream molecules, such as anti-BTK antibodies, and may also include compound inhibitors. In one specific embodiment of the invention, the BTK inhibitor includes ibrutinib, a highly effective BTK inhibitor with the molecular formula C. 25 H 24 N6O2, with a molecular weight of 440.50, is mainly used to treat various B-cell malignancies.

[0026] The product may be a drug or a general experimental reagent for non-medical purposes. The general experimental reagent can be used for basic research to explore the mechanism of tumor development and progression.

[0027] It should be noted that the term "tumor" is used in this invention as is known to those skilled in the art, and includes benign tumors and / or malignant tumors. A benign tumor is defined as the excessive proliferation of cells that cannot form an invasive, metastatic tumor in the body. Conversely, a malignant tumor is defined as cells with various cellular and biochemical abnormalities that can cause systemic disease (e.g., tumor metastasis in distant organs).

[0028] In another specific embodiment of the present invention, the drug of the present invention can be used for hematologic malignancies, especially diffuse large B-cell lymphoma.

[0029] According to the present invention, when the product is a drug, the drug may further include at least one inactive pharmaceutical ingredient.

[0030] The inactive ingredient of the drug may be a pharmaceutically acceptable carrier that can be determined by a person skilled in the art to meet clinical standards. It may be any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption delayers, and the like. Typically, the nature of the carrier depends on the specific route of administration. For example, parenteral preparations often contain an injectable fluid as a vehicle, which may be a pharmaceutically and physiologically acceptable fluid, such as water, saline, balanced salt solution, glucose solution, glycerin, etc. For solid compositions (e.g., in powder, pill, tablet, or capsule form), conventional non-toxic solid carriers may include, for example, pharmaceutical-grade mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical composition to be administered may also contain small amounts of non-toxic excipients, such as wetting agents or emulsifiers, preservatives, and pH buffers, such as sodium acetate or sorbitol monolaurate. No specific limitations are made here.

[0031] In another specific embodiment of the invention, the drug of the invention can be administered into the body by known means, such as intravenous systemic delivery. Alternatively, it can be administered via intravenous, percutaneous, intranasal, mucosal, or other delivery methods. Such administration can be performed via a single dose or multiple doses. Those skilled in the art will understand that the actual dose to be administered in the invention can vary considerably depending on a variety of factors, such as target cells, biological type or tissue, the general condition of the subject to be treated, route of administration, manner of administration, etc.

[0032] In another specific embodiment of the present invention, the drug can be applied to humans and non-human mammals, including mice, rats, guinea pigs, cattle, sheep, cats, dogs, horses, monkeys, orangutans, etc., without being specifically limited here.

[0033] In another specific embodiment of the present invention, a composition is provided, wherein the active ingredients of the composition include at least the above-mentioned MDH1 inhibitor and BTK inhibitor.

[0034] The composition has any one or more of the following uses: a) Inhibits tumor cell proliferation; b) Induces ferroptosis in tumor cells; c) Reversing tumor resistance to BTK inhibitors; d) Tumor treatment.

[0035] Specifically, the definition and scope of tumors in the aforementioned uses are as described above, and therefore will not be repeated here.

[0036] The molar ratio of MDH1 inhibitor to BTK inhibitor is 0-150:0-1.5; further including 0-90:0-0.9 (excluding 0); further, the molar ratio of MDH1 inhibitor to BTK inhibitor is 100:1.

[0037] The composition significantly increased lipid ROS levels in DLBCL cells and promoted Fe 2+ Accumulation; all of the above effects can be reversed by the ferroptosis-specific inhibitor Ferrostatin-1, indicating that ferroptosis induction is an important factor in the synergistic effect of MDH1-IN-2 and ibrutinib and the overcoming of drug resistance.

[0038] Furthermore, the synergistic effect of MDH1-IN-2 and ibrutinib in the drug combination was verified by the Synergy Finder online platform, with a synergy index greater than 10, indicating a strong synergistic effect.

[0039] In the treatment regimen of this invention, MDH1-IN-2 and ibrutinib can be administered simultaneously, separately, or sequentially. Sequential administration refers to administering one drug within a certain time window (e.g., within minutes to hours) after administering the other drug to ensure that the two drugs can exert a synergistic therapeutic effect in the body. The specific dosing interval can be determined based on the pharmacokinetic parameters (e.g., half-life) of the drugs. When sequential administration is used, there are two possible sequences: one is to administer the single-agent formulation containing MDH1-IN-2 first, followed by the single-agent formulation containing ibrutinib; the other is to administer the single-agent formulation containing ibrutinib first, followed by the single-agent formulation containing MDH1-IN-2.

[0040] In the specific implementation plan, the synergistic effect of combining MDH1-IN-2 and ibrutinib was further verified by employing the HSA model, Bliss model, Loewe model, and ZIP model for combination drug use. The HSA model, as a mathematical model for evaluating the effect of drug combinations, determines the existence of a synergistic effect by comparing the actual effect of the combination with the expected value of the optimal effect of each drug used alone: ​​an HSA value greater than zero indicates a synergistic effect; a value less than zero may reflect an antagonistic effect. The Bliss synergistic model is based on the premise that the drugs act independently, estimating the expected value of the combined effect based on probability products, and is suitable for high-throughput screening scenarios, helping to quickly identify potential synergistic combinations. The Loewe additivity model is used to predict the expected effect of multiple drugs used in combination under conditions of no interaction, providing a basis for synergistic effect assessment in drug development and clinical application. The ZIP model, as a zero-interaction reference model, is based on the assumption that the dose-response curves of the two drugs should follow a specific pattern when there is no interaction.

[0041] According to the present invention, the concept of "treatment" refers to any measure applicable to the treatment of tumors and related diseases, including the treatment of tumors, the prevention of tumor recurrence, the removal of residual lesions after treatment, or the relief of tumor-related symptoms, such as inhibiting tumor growth, reducing tumor volume, and prolonging patient survival. In a specific embodiment of the present invention, the disease is preferably DLBCL.

[0042] In another specific embodiment of the present invention, a method for tumor treatment is provided, the method comprising administering to a subject a therapeutically effective amount of the above-mentioned MDH1 inhibitor combined with a BTK inhibitor or the above-mentioned combination.

[0043] In this invention, the term "therapeuticly effective amount" refers to the amount that effectively achieves the desired therapeutic or preventative outcome at the necessary dosage and time period. A therapeutically effective amount of an agent may eliminate, reduce, delay, minimize, or prevent adverse effects of a disease.

[0044] The definition and scope of tumors have been described above, and therefore will not be repeated here.

[0045] The present invention will be further illustrated below with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Any simple modifications, equivalent variations, and alterations made to the embodiments based on the technical essence of the present invention shall fall within the scope of the present invention.

[0046] Example 1: MDH1-IN-2 and ibrutinib synergistically inhibit the growth of DLBCL cell lines OCI-LY1 and OCI-LY19 1. Experimental materials MDH1-IN-2 (MCE, HY-147791), ibrutinib (MCE, HY-10997), CCK8 kit (Japan Dojin, CK04), Synergy Finder online platform.

[0047] 2. Experimental Methods (1) CCK8 cell viability detection OCI-LY1 and OCI-LY19 cells were cultured at a rate of 2 × 10⁻⁶. 4 Cells were seeded at a density of 10 cells / well in 96-well plates and cultured. The cells were then grouped and treated with medication. 1) Control group: MDH1-IN-2 and ibrutinib were not used, i.e., the solvent group without drugs was added, only an equal volume of drug solvent (DMSO) was added; 2) In the MDH1-IN-2 and ibrutinib groups alone, five time points were set at 0, 24, 48, 72, and 96 hours to more fully verify the drug’s cell-killing ability. 3) The combination of MDH1-IN-2 and ibrutinib was used in a 6 x 6 manner for the combined experiment (MDH1-IN-2 drug concentration was 0-150 μM; ibrutinib drug concentration was 0-1.5 μM). Continue culturing for 48 hours, add 10 μl of CCK8 reagent to each well, incubate for two hours, and then take readings at 450 nm. Cell viability = (Experimental group OD value - Blank control OD value) / (Control group OD value - Blank control OD value) × 100%.

[0048] (2) Process CCK8 data, calculate cell viability at different drug concentrations, log in to the Synergy Finder online platform (https: / / synergyfinder.aittokallio.group), upload data, and calculate the synergy index.

[0049] 3. Experimental Results (1) The effect of combined use of MDH1-IN-2 and ibrutinib on the growth of DLBCL cells was detected by the CCK8 assay. The results of cell viability testing are as follows: Figure 1 As shown in AB, MDH1-IN-2 inhibited the proliferation of OCI-LY1 and OCI-LY19 cells in a time-dependent manner; ibrutinib inhibited the proliferation of OCI-LY1 cells in a time-dependent manner, but had no significant inhibitory effect on the proliferation of ibrutinib-resistant OCI-LY19 cells.

[0050] (2) The Synergy Finder online platform was used to calculate and analyze whether MDH1-IN-2 and ibrutinib have a synergistic effect in inhibiting the growth of DLBCL cells. The results are as follows Figure 1 As shown in CD, the synergy index between MDH1-IN-2 and ibrutinib is greater than 10, which indirectly indicates that the two have a strong synergistic effect.

[0051] Example 2: Effect of MDH1-IN-2 combined with ibrutinib in DLBCL cells 1. Experimental Materials MDH1-IN-2 (MCE, HY-147791), Ibrutinib (MCE, HY-10997), Ferrostatin-1 (MCE, HY-100579), TNF-α (proteintech, HZ-1014), CCK8 kit (Dorjin, CK04), C11-BODIPY581 / 591 (Invitrogen, D3861), FerroOrange (Dorjin, F374).

[0052] 2. Experimental Methods (1) CCK8 cell viability detection OCI-LY1 and OCI-LY19 cells were cultured at a rate of 2 × 10⁻⁶. 4 Cells were seeded at a density of 10 cells / well in 96-well plates and cultured. The cells were then grouped and treated with medication. 1) Control group: MDH1-IN-2 and ibrutinib were not used, i.e., the solvent group without drug addition, only an equal volume of drug solvent (DMSO) was added; 2) Use MDH1-IN-2 alone, at a concentration of 60 μM; 3) Ibrutinib monotherapy group, using ibrutinib at a concentration of 0.6 μM; 4) The combination of MDH1-IN-2 and ibrutinib was used at a concentration of 60 μM MDH1-IN-2 and 0.6 μM ibrutinib. 5) MDH1-IN-2 combined with ibrutinib plus Fer-1 group, with Fer-1 concentration of 1 μM, and MDH1-IN-2 and ibrutinib concentrations the same as in the combination group.

[0053] 4) MDH1-IN-2 and ibrutinib monotherapy concentration gradient groups, setting different concentrations of MDH1-IN-2 (30, 60, 90 μM) and ibrutinib (0.3, 0.6, 0.9 μM); Continue culturing for 48 hours, add 10 μl of CCK8 reagent to each well, incubate for two hours, and then take readings at 450 nm. Cell viability = (Experimental group OD value - Blank control OD value) / (Control group OD value - Blank control OD value) × 100%.

[0054] (4) Lipid ROS detection OCI-LY1 and OCI-LY19 cells were fed at a rate of 1×10⁻⁶. 6 Cells were seeded at a density of 100 cells / well in 6-well plates and cultured. The cells were then divided into 5 groups and drug was added. 1) Control group: MDH1-IN-2 and ibrutinib were not used, i.e., the solvent group without drug addition, only an equal volume of drug solvent (DMSO) was added; 2) Use MDH1-IN-2 alone, at a concentration of 60 μM; 3) Ibrutinib monotherapy group, using ibrutinib at a concentration of 0.6 μM; 4) The combination of MDH1-IN-2 and ibrutinib was used at a concentration of 60 μM MDH1-IN-2 and 0.6 μM ibrutinib. 5) MDH1-IN-2 combined with ibrutinib plus Fer-1 group, with Fer-1 concentration of 1 μM, and MDH1-IN-2 and ibrutinib concentrations the same as in the combination group.

[0055] Continue culturing for 48 hours, collect cells, wash three times with pre-cooled PBS, and centrifuge to remove the supernatant. Add 10 μM C11 BODIPY probe working solution according to the cell quantity, and incubate at room temperature for 30 min. After incubation, wash cells with PBS, centrifuge to remove the supernatant, and repeat the washing 2-3 times to terminate the reaction. Observe the intracellular lipid ROS level using flow cytometry.

[0056] (5) Fe² + Detection OCI-LY1 and OCI-LY19 cells were fed at a rate of 1×10⁻⁶. 6 Cells were seeded at a density of 100 cells / well in 6-well plates and cultured. The cells were then divided into 5 groups and drug was added. 1) Control group: MDH1-IN-2 and ibrutinib were not used, i.e., the solvent group without drug addition, only an equal volume of drug solvent (DMSO) was added; 2) Use MDH1-IN-2 alone, at a concentration of 60 μM; 3) Ibrutinib monotherapy group, using ibrutinib at a concentration of 0.6 μM; 4) The combination of MDH1-IN-2 and ibrutinib was used at a concentration of 60 μM MDH1-IN-2 and 0.6 μM ibrutinib. 5) MDH1-IN-2 combined with ibrutinib plus Fer-1 group, with Fer-1 concentration of 1 μM, and MDH1-IN-2 and ibrutinib concentrations the same as in the combination group.

[0057] Cells were cultured for another 48 hours, then collected and washed three times with pre-cooled PBS. The supernatant was then removed by centrifugation. 1 μM FerrOrange was added, and the cells were incubated at 37°C for 20 minutes. Fluorescence intensity was measured using a fluorometer at specific excitation and emission wavelengths, and the relative fluorescence intensity was analyzed.

[0058] 3. Experimental Results (1) Comparison of the inhibitory effects of single and combined drugs on cell proliferation by CCK8 assay CCK8 test results are as follows Figure 2As shown in Figure A, in ibrutinib-sensitive DLBCL cells, both MDH1-IN-2 and ibrutinib monotherapy inhibited cell proliferation; however, in resistant cells, sensitivity to ibrutinib was significantly reduced. Notably, the combination of MDH1-IN-2 and ibrutinib exhibited the strongest inhibitory effect on proliferation in both sensitive and resistant cells. To clarify the necessity of ferroptosis in this process, we co-treated with the ferroptosis inhibitor Ferrostatin-1. The results showed that Ferrostatin-1 significantly reversed the proliferation inhibition effect induced by the combination therapy. This result confirms that ferroptosis induction is a key factor in the synergistic antitumor effect of MDH1-IN-2 and ibrutinib. As shown in our combination therapy experiment 2B, the combined use of MDH1-IN-2 and ibrutinib significantly enhanced the inhibitory effect on DLBCL cells, achieving a synergistic effect.

[0059] (2) Effects of single and combined drug administration on lipid ROS levels detected by flow cytometry Flow cytometry results as follows Figure 2 As shown in Figure C: In ibrutinib-sensitive DLBCL cells, MDH1-IN-2 monotherapy significantly increased lipid ROS levels, while the effect of ibrutinib monotherapy was relatively limited. In resistant cells, ibrutinib monotherapy almost failed to induce lipid ROS accumulation, but MDH1-IN-2 monotherapy still showed a significant induction effect. Notably, the combination of MDH1-IN-2 and ibrutinib induced the strongest increase in lipid ROS levels in both sensitive and resistant cells. To clarify the direct link between this oxidative stress event and ferroptosis, we added the ferroptosis-specific inhibitor Ferrostatin-1 to the combination therapy. The results showed that Ferrostatin-1 could significantly reverse the explosive accumulation of lipid ROS induced by the combination therapy. This result confirms that the effective induction of lipid ROS generation is a key upstream event in the synergistic triggering of ferroptosis by MDH1-IN-2 and ibrutinib.

[0060] (3) Effects of single and combined drug administration on lipid peroxidation levels detected by confocal microscopy Confocal microscopy for detecting intracellular Fe 2+ The results at the level are as follows Figure 2 As shown in Figure D: In ibrutinib-sensitive and ibrutinib-resistant DLBCL cells, MDH1-IN-2 monotherapy significantly enhanced the fluorescence signal of the FerroOrange probe, indicating that it can effectively promote intracellular Fe... 2+The accumulation of [acids] was observed, while the effect of ibrutinib monotherapy was weaker. The strongest fluorescence signal was observed in both cell types after co-treatment with MDH1-IN-2 and ibrutinib. We added the ferroptosis inhibitor Ferrostatin-1 to the co-treatment. Confocal imaging showed that co-treatment with Ferrostatin-1 significantly attenuated the strong fluorescence signal induced by the co-treatment.

[0061] Example 3: Mechanism of NF-κB signaling and changes in ferroptosis-related molecules under MDH1 inhibition 1. Experimental Materials MDH1-IN-2 (MCE, HY-147791), TNF-α (proteintech, HZ-1014), NF-κB p65 monoclonal antibody (proteintech, 66535-1-Ig), phosphorylated NF-κB p65 (Ser468) recombinant monoclonal antibody (proteintech, 82335-1-RR), IkBα polyclonal antibody (proteintech, 10268-1-AP), phosphorylated IkBα (Ser32 / 36) recombinant monoclonal antibody (proteintech, 82349-1-RR), SLC7A11 / xCT polyclonal antibody (proteintech, 26864-1-AP), GPX4 monoclonal antibody (proteintech, 67763-1- Ig), β-actin monoclonal antibody (proteintech, 66009-1-Ig), human RELA overexpression plasmid (Jinan Boshang), pcDNA3.1 empty vector control plasmid (Jinan Boshang), human SLC7A11 promoter reporter plasmid (WT) (Jinan Boshang), human SLC7A11 promoter reporter plasmid (MUT) (Jinan Boshang), pGL3-basic empty vector plasmid (Jinan Boshang), PRL-TK Ren control plasmid (Jinan Boshang), dual luciferase reporter gene assay kit (Beyotime, RG027).

[0062] 2. Experimental Methods (1) Western blot detection OCI-LY1 and OCI-LY19 cells were fed at a rate of 1×10⁻⁶. 6 Cells were seeded at a density of 100 cells / well in 6-well plates and cultured. The cells were then divided into 3 groups and treated with the drug. 1) Control group: MDH1-IN-2 was not used, which is the solvent group without drug addition. Only an equal volume of drug solvent (DMSO) was added. 2) MDH1-IN-2 group alone, cells were treated with MDH1-IN-2 60μM; 3) TNF-α alone group: Cells were treated with TNF-α 20 ng / mL; Cells were collected, washed three times with pre-cooled PBS, and centrifuged to remove the supernatant. Protein lysis buffer (RIPA:PMSF:phosphatase inhibitor volume ratio 100:1:2) was added, and the cells were incubated on ice for 30 min. After centrifugation at 4°C for 12000 rpm for 30 min, the supernatant was collected. Protein concentration was determined using a BCA protein concentration kit. The supernatant was mixed with loading buffer at a 4:1 ratio, denatured in a 100°C metal bath for 5 min, and stored at -80°C. A 10% SDS-PAGE gel was prepared, placed in an electrophoresis tank, and submerged in electrophoresis buffer. The volume required for 20 μg of protein was calculated, and the cells were loaded sequentially, with a protein marker added as a reference. Electrophoresis was performed at 200V for 30 min. A PVDF membrane of the same size as the gel was cut and immersed in methanol for 30 s. Soak transfer paper in transfer buffer, then place the filter paper, gel, PVDF membrane, and filter paper in sequence, and put them into the groove of the Trans-Blot SD semi-dry transfer system. Transfer at 10V for 30 min. Prepare blocking buffer using TBST and skim milk powder, and completely immerse the PVDF membrane in the blocking buffer. Block at room temperature for 1 hour. Add primary antibody diluted 1:1000 and incubate overnight at 4°C with shake. The next day, wash the PVDF membrane three times with TBST, add secondary antibody diluted 1:5000, and incubate at room temperature for 1 hour. After washing the PVDF membrane three times with TBST, add developing solution for development.

[0063] (2) Dual-luciferase reporter assay OCI-LY1 and OCI-LY19 cells were cultured at a rate of 2 × 10⁻⁶. 5 Cells were seeded at a density of 100 cells / well in 24-well plates and cultured. The cells were then grouped and co-transfected with plasmids using Lipofectamine 3000. 1) Verification of direct regulation of the SLC7A11 promoter by p65 ① Blank control group: pGL3-basic + pcDNA3.1 + pRL-TK; ②WT baseline control group: homo-SLC7A11 promoter-WT+ pcDNA3.1+ pRL-TK; ③WT+p65 group: homo-SLC7A11 promoter-WT + pcDNA3.1-p65 + pRL-TK; ④Mut baseline control group: homo-SLC7A11 promoter-mut + pcDNA3.1 + pRL-TK; ⑤ Mut+p65 group: homo-SLC7A11 promoter-mut+ pcDNA3.1-p65 + pRL-TK.

[0064] 2) Verification of the effect of MDH1 knockdown on the transcriptional regulatory relationship of "p65-SLC7A11" Based on the above co-transfection system, MDH1 knockdown treatment and its control treatment were added respectively, and the groups were set as follows: ①WT + empty vector + control group: homo-SLC7A11 promoter - WT + pcDNA3.1 + pRL-TK + sh-Contro; ②WT+p65+ control group: homo-SLC7A11 promoter-WT + pcDNA3.1-p65+ pRL-TK + sh-Control; ③ Mut+p65+ control group: homo-SLC7A11 promoter-mut + pcDNA3.1-p65+ pRL-TK + sh-Control; ④WT+empty+knockdown group: homo-SLC7A11 promoter-WT + pcDNA3.1 + pRL-TK + shMDH1; ⑤WT+p65+ knockdown group: homo-SLC7A11 promoter-WT + pcDNA3.1-p65+ pRL-TK +shMDH1; ⑥ Mut+p65+ knockdown group: homo-SLC7A11 promoter-mut + pcDNA3.1-p65+ pRL-TK +shMDH1.

[0065] The total DNA amount per well was 1 μg, and it was allocated according to the ratio of effect plasmid:reporter plasmid:internal control plasmid = 10:10:1. The transfection complex was prepared according to the Lipofectamine 3000 instructions, with 1 μL of P3000 reagent and 1 μL of Lipofectamine 3000 reagent per well, diluted with Opti-MEM and mixed well. The mixture was incubated at room temperature for 10–15 min to form a DNA-liposome complex. 50 μL of the complex was added to each well, and the cells were cultured for 48 h after transfection. Cells were then collected and lysis buffer was prepared according to the instructions of the dual-luciferase reporter gene assay kit. The activities of firefly luciferase and renal luciferase were measured sequentially on a microplate reader. The relative luciferase activity was calculated as: Relative luciferase activity = (firefly luciferase activity) / (renal luciferase activity).

[0066] 3. Experimental Results (1) Western blot analysis of the effect of MDH1-IN-2 on the expression of key proteins in the NF-κB pathway and ferroptosis-related proteins Western blot results are as follows Figure 3 As shown in Figure B, in both ibrutinib-sensitive and ibrutinib-resistant DLBCL cells, treatment with MDH1-IN-2 alone significantly downregulated the expression of NF-κB pathway proteins (pp65 and p-IκBα) and inhibited the expression of negative regulators of ferroptosis (GPX4 and SLC7A11). To further verify the central role of the NF-κB pathway in this process, we introduced an NF-κB pathway activator. The results showed that the activator effectively reversed the inhibition of the NF-κB pathway by MDH1-IN-2, and subsequently restored the protein expression levels of GPX4 and SLC7A11. This recovery experiment indicates that MDH1-IN-2 likely induces ferroptosis in DLBCL cells by inhibiting the NF-κB pathway, thereby relieving its inhibitory effect on ferroptosis.

[0067] (2) Luciferase reporter assays showed that p65 could activate the transcription of the SLC7A11 promoter in the context of MDH1 knockdown. Dual-luciferase report results as follows Figure 3 As shown in C: In the DLBCL cell lines OCI-LY1 and OCI-LY19, compared with the empty vector control (pcDNA3.1), overexpression of p65 (pcDNA3.1-p65) significantly enhanced the luciferase activity of the wild-type reporter plasmid of the SLC7A11 promoter (SLC7A11-WT); however, when the SLC7A11 promoter binding site was mutated (SLC7A11-MUT), the enhancing effect of p65 on promoter activity was significantly weakened or disappeared, suggesting that the transcriptional activation of the SLC7A11 promoter by p65 depends on this specific binding site, thus proving that p65 can directly bind to and activate the transcriptional activity of the SLC7A11 promoter.

[0068] Furthermore, under MDH1 knockdown conditions, the promoting effect of p65 on SLC7A11-WT promoter activity was significantly reduced compared to the control knockdown group; however, for the SLC7A11-MUT promoter, p65 did not show a significant activation effect under either shCon or shMDH1 conditions. These results indicate that MDH1 reduction can weaken the transcriptional activation ability of p65 on the SLC7A11 promoter, suggesting that MDH1 may affect the "p65-SLC7A11" transcriptional regulatory axis by regulating the transcriptional activity of NF-κB / p65, and ultimately participate in the regulation of SLC7A11 expression and ferroptosis-related processes.

[0069] Example 4: Efficacy verification of the combination of MDH1-IN-2 and ibrutinib in mice. 1. Experimental Materials Ibrutinib (MCE, HY-10997), SBE-β-CD (MCE, HY-17031), D-fluorescein potassium salt (MCE, HY-12591B), ready-to-use tribromoethanol solution (Nanjing Aibei, M2920).

[0070] 2. Experimental Methods (1) Subcutaneous tumor formation Four-week-old female SCID mice were used for subcutaneous tumorigenesis experiments. OCI-LY1 and OCI-LY19 cells stably expressing LucshMDH1 or LucshNC were collected and cell suspensions were prepared. 5 × 10⁵ cells were subcutaneously injected into each mouse. 6 100 cells. Tumor growth in mice was monitored and recorded after inoculation. When the tumor volume reached approximately 100 mm... 3 At that time, cells were randomly divided into groups according to cell type (LucshNC or LucshMDH1, where Luc refers to the luciferase gene, shMDH1: CTTCAGTTGCTTGACTCGTTT, SEQ ID NO.1). Each cell type was randomly divided into 2 groups, with 6 cells in each group, for a total of 4 groups. 1) LucshNC + SBE-β-CD group; 2) LucshNC + ibrutinib group; 3) LucshMDH1 + SBE-β-CD group; 4) LucshMDH1 + ibrutinib group.

[0071] All groups were administered ibrutinib orally by gavage (the oral dose of ibrutinib was 25 mg / kg) once daily for 21 consecutive days.

[0072] (2) Mouse in vivo imaging A small animal in vivo imaging system was used to dynamically monitor the growth of subcutaneously inoculated tumors. Before imaging, mice were intraperitoneally injected with a fluorescein substrate (150 mg / kg). -1 Animals were anesthetized with tribromoethanol solution for 5 minutes and then placed in a small animal in vivo imaging system for detection. Small animal in vivo imaging was performed on Day 0, Day 7, Day 14, and Day 21 after subcutaneous inoculation to record changes in bioluminescent signal intensity at the tumor site, in order to assess tumor growth under different treatment conditions.

[0073] 3. Experimental Results Mouse in vivo imaging results as follows Figure 4As shown in Figure A (OCI-LY1): Over time (Day 0, Day 7, Day 14, Day 21), the bioluminescent signal at the tumor site in the LucshNC + SBE-β-CD group gradually increased, indicating sustained tumor growth. In contrast, the increasing trend of bioluminescent signal in the LucshNC + ibrutinib group was weakened, suggesting that ibrutinib can inhibit tumor growth to some extent. Furthermore, in the LucshMDH1 context, tumor growth in the LucshMDH1 + SBE-β-CD group was reduced compared to the control group, while the LucshMDH1 + ibrutinib group had the lowest bioluminescent signal, indicating the most significant inhibition of tumor growth. These results indicate that MDH1 knockdown can enhance the inhibitory effect of ibrutinib on DLBCL subcutaneous xenografts, suggesting that targeting MDH1 helps improve the in vivo antitumor efficacy of BTK inhibitors.

[0074] Mouse in vivo imaging results as follows Figure 4 As shown in B (OCI-LY19): During the observation period (Day 0, Day 7, Day 14, Day 21), the bioluminescent signal at the tumor site in the LucshNC+SBE-β-CD group gradually increased over time, indicating continuous tumor growth. Since OCI-LY19 cells are ibrutinib-resistant, the overall bioluminescent signal change trends in the LucshNC+ibrutinib group and the LucshNC+SBE-β-CD group were similar, with no significant inhibitory effect observed, suggesting that ibrutinib has limited inhibitory effect on OCI-LY19 subcutaneous xenografts in the LucshNC background. Furthermore, in the LucshMDH1 background, the bioluminescent signal in the LucshMDH1+SBE-β-CD group was weaker than that in the LucshNC+SBE-β-CD group, suggesting that MDH1 knockdown itself can inhibit tumor growth to some extent; while the LucshMDH1+ibrutinib group showed even lower bioluminescent signals at all time points, especially with a more significant inhibitory effect at Day 14 and Day 21. The above results indicate that in the OCI-LY19 resistant subcutaneous xenograft model, MDH1 knockdown can enhance the sensitivity of tumors to ibrutinib and improve the in vivo antitumor effect of ibrutinib.

[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of MDH1 inhibitors in combination with BTK inhibitors in any one or more of the following: a) Inhibiting tumor cell proliferation or preparing products that inhibit tumor cell proliferation; b) Inducing ferroptosis in tumor cells or preparing products that induce ferroptosis in tumor cells; c) Reversing tumor resistance to BTK inhibitors or preparing products that reverse tumor resistance to BTK inhibitors; d) Prepare products for tumor treatment.

2. The application as described in claim 1, characterized in that, The molar ratio of MDH1 inhibitor to BTK inhibitor is 0-150:0-1.5; further including 0-90:0-0.9 (excluding 0); even further, the molar ratio of MDH1 inhibitor to BTK inhibitor is 100:

1.

3. The application as described in claim 1, characterized in that, The MDH1 inhibitors include, but are not limited to, RNA interference molecules or antisense oligonucleotides targeting the MDH1 encoding gene, small molecule inhibitors, shRNA, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against MDH1 itself or its upstream and downstream molecules, including anti-MDH1 antibodies, and also compound inhibitors; furthermore, the MDH1 inhibitors include MDH1-IN-2.

4. The application as described in claim 1, characterized in that, The BTK inhibitors include, but are not limited to, RNA interference molecules or antisense oligonucleotides targeting the BTK encoding gene, small molecule inhibitors, shRNA, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against BTK itself or its upstream and downstream molecules, including anti-BTK antibodies, and also compound inhibitors; furthermore, the BTK inhibitors include ibrutinib.

5. The application as described in claim 1, characterized in that, The product is a pharmaceutical or non-pharmaceutical test reagent intended for use in basic research.

6. The application as described in claim 1, characterized in that, The tumor is a diffuse large B-cell lymphoma.

7. The application as described in claim 1, characterized in that, The MDH1 inhibitor promotes tumor cell ferroptosis and enhances the antitumor effect of BTK inhibitors by inhibiting NF-κB signaling pathway activity and downregulating the expression of GPX4 and SLC7A11; wherein the inhibition of NF-κB signaling pathway activity is manifested by downregulating the phosphorylation levels of p65 and IκBα.

8. A composition, characterized in that, The active ingredients of the composition include at least an MDH1 inhibitor and a BTK inhibitor; Furthermore, the composition has any one or more of the following uses: a) Inhibits tumor cell proliferation; b) Induces ferroptosis in tumor cells; c) Reversing tumor resistance to BTK inhibitors; d) Tumor treatment.

9. The composition according to claim 8, characterized in that, The molar ratio of MDH1 inhibitor to BTK inhibitor is 0-150:0-1.5; further including 0-90:0-0.9 (excluding 0); the tumor is diffuse large B-cell lymphoma.

10. The composition according to claim 8, characterized in that, The MDH1 inhibitors include, but are not limited to, RNA interference molecules or antisense oligonucleotides targeting the MDH1 encoding gene, small molecule inhibitors, shRNA, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against MDH1 itself or its upstream and downstream molecules, including anti-MDH1 antibodies, and also compound inhibitors; further, the MDH1 inhibitors include MDH1-IN-2. The BTK inhibitors include, but are not limited to, RNA interference molecules or antisense oligonucleotides targeting the BTK encoding gene, small molecule inhibitors, shRNA, siRNA, substances for lentiviral infection or gene knockout, and specific antibodies against BTK itself or its upstream and downstream molecules, including anti-BTK antibodies, and also compound inhibitors; furthermore, the BTK inhibitors include ibrutinib.

Images