Conjugates and uses thereof
A GD2-targeting antigen binding protein conjugate addresses the limitations of current osteosarcoma treatments by enhancing treatment efficacy and survival rates through targeted cytotoxicity against osteosarcoma cells.
Patent Information
- Application Number
- PCT/AU2025/051422
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-12-13
- Filing Date
- 2025-12-12
- Publication Date
- 2026-06-18
Smart Images

Figure IMGF000022_0001 
Figure IMGF000023_0001 
Figure IMGF000023_0002
Abstract
Description
Conjugates and uses thereofField of the invention
[0001] The present invention relates to novel drug conjugates and their use in the treatment of osteosarcoma and other cancers.Related application
[0002] This application claims priority from PCT application PCT / CN2024 / 139073, the entire contents of which are hereby incorporated by reference.Background of the invention
[0003] Osteosarcoma is the most common type of malignant primary bone tumour, especially in children and young adults. It is characterised by a high metastatic potential, mainly to the lungs, which contributes to its poor prognosis.
[0004] Current treatment includes surgery, chemotherapy, and radiotherapy, but the 5- year survival rate remains around 60-70% for localised osteosarcoma and falls to 20% for patients with metastatic disease at diagnosis.
[0005] There is a need for new medications and / or new approaches for the treatment of osteosarcoma.
[0006] Reference to any prior art in the specification is not an acknowledgment or suggestion that this prior art forms part of the common general knowledge in any jurisdiction or that this prior art could reasonably be expected to be understood, regarded as relevant, and / or combined with other pieces of prior art by a skilled person in the art.Summary of the invention
[0007] In a first aspect, the invention provides a conjugate comprising:- an antigen binding protein comprising an antigen binding domain for binding to GD2 antigen, conjugated to a cytotoxic agent.1006294735
[0008] As used herein, GD2 refers to a disialoganglioside antigen expressed on tumour cells. It is also referred to by the term Ganglioside G2.
[0009] Preferably, the antigen binding protein comprises an HCDR1 , an HCDR2 and / or an HCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 14 or 41. Preferably, the antigen binding protein also comprises an LCDR1, an LCDR2 and / or an LCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 27 or 54.
[0010] The antigen binding protein may comprise an HCDR1, an HCDR2 and / or an HCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 14. Preferably, the antigen binding protein also comprises an LCDR1, an LCDR2 and / or an LCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 27.
[0011] The antigen binding protein may comprise an HCDR1, an HCDR2 and / or an HCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 41. Preferably the antigen binding protein also comprises an LCDR1 , an LCDR2 and / or an LCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 54.
[0012] In a preferred embodiment, the antigen binding domain comprises an HCDR1 comprising the sequence as set forth in SEQ ID NO: 1 , an HCDR2 comprising the sequence as set forth in SEQ ID NO: 2, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 3; or an HCDR1 comprising the sequence as set forth in SEQ ID NO: 4, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 5, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 6.
[0013] Preferably the antigen binding domain further comprises an LCDR1 comprising the sequence as set forth in SEQ ID NO: 15, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 16, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 17; or comprises an LCDR1 comprising the sequence as set forth in SEQ ID NO: 18, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 19, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 17.1006294735
[0014] In a preferred embodiment, the antigen binding domain comprises: an HCDR1 comprising the sequence as set forth in SEQ ID NO: 1, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 2, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 3; or an HCDR1 comprising the sequence as set forth in SEQ ID NO: 4, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 5, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 6; and an LCDR1 comprising the sequence as set forth in SEQ ID NO: 15, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 16, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 17; or an LCDR1 comprising the sequence as set forth in SEQ ID NO: 18, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 19, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 17.
[0015] When the CDRs are defined according to IMGT, the antigen binding protein preferably comprises: a VH comprising a framework region (FR) 1 comprising an amino acid sequence of SEQ ID NO: 7, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 8, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 9, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 10, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and / or a VL comprising a FR1 comprising an amino acid sequence of SEQ ID NO: 20, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO:100629473521 , or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 22, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 23, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.
[0016] When the CDRs are defined according to Kabat, the antigen binding protein preferably comprises: a VH comprising a framework region (FR) 1 comprising an amino acid sequence of SEQ ID NO: 11 , or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 12, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 13, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 10, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and / or a VL comprising a FR1 comprising an amino acid sequence of SEQ ID NO: 24, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 25, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID1006294735NO: 26, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 23, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.
[0017] In a particularly preferred embodiment, the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 14, and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 27.
[0018] In a preferred embodiment, the antigen binding domain comprises an HCDR1 comprising the sequence as set forth in SEQ ID NO: 28, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 29, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 30; or an HCDR1 comprising the sequence as set forth in SEQ ID NO: 31, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 32, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 33.
[0019] Preferably the antigen binding domain further comprises an LCDR1 comprising the sequence as set forth in SEQ ID NO: 42, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 43, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 44; or comprises an LCDR1 comprising the sequence as set forth in SEQ ID NO: 45, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 46, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 44.
[0020] In a preferred embodiment, the antigen binding domain comprises: an HCDR1 comprising the sequence as set forth in SEQ ID NO: 28, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 29, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 30; or an HCDR1 comprising the sequence as set forth in SEQ ID NO: 31, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 32, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 33; and an LCDR1 comprising the sequence as set forth in SEQ ID NO: 42, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 43, and an LCDR3 comprising the1006294735sequence as set forth in SEQ ID NO: 44; or an LCDR1 comprising the sequence as set forth in SEQ ID NO: 45, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 46, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 44.
[0021] When the CDRs are defined according to IMGT, the antigen binding protein preferably comprises: a VH comprising a framework region (FR) 1 comprising an amino acid sequence of SEQ ID NO: 34, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 35, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 36, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 37, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and / or a VL comprising a FR1 comprising an amino acid sequence of SEQ ID NO: 47, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 48, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 49, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 50, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.1006294735
[0022] When the CDRs are defined according to Kabat, the antigen binding protein preferably comprises: a VH comprising a framework region (FR) 1 comprising an amino acid sequence of SEQ ID NO: 38, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 39, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 40, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 37, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and / or a VL comprising a FR1 comprising an amino acid sequence of SEQ ID NO: 51 , or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 52, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 53, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 50, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.
[0023] In a particularly preferred embodiment, the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID1006294735NO: 41 , and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 54.
[0024] Preferably, an antigen binding protein as described herein is an antibody or antigen binding fragment thereof. Typically, the antigen binding protein is an antibody, for example, a monoclonal antibody. The antigen binding protein may be in the form of a recombinant or modified antibody (eg, chimeric antibody, humanised antibody, human antibody, CDR-grafted antibody, primatised antibody, de-immunised antibody, synhumanised antibody, half-antibody, bispecific antibody, trispecific antibody or multispecific antibody). The antibody may further comprise a chemical modification, such as conjugation to an active agent or radiolabel, or an agent for improving solubility or other modification described herein.
[0025] As used herein the antigen binding protein may be a variable domain.
[0026] As used herein, the complementarity determining region sequences (CDRs) of an antigen binding protein of the invention may be defined according to the IMGT, Chothia or Kabat numbering systems, or any other CDR numbering system known to the skilled person.
[0027] In any example, an antigen binding protein as described herein comprises a constant region of an I gGi antibody or a stabilised constant region of an I gGi antibody.
[0028] In any example, an antigen binding protein as described herein comprises a constant region of an lgG2A antibody or a stabilised constant region of an lgG2A antibody.
[0029] In any example, an antigen binding protein as described herein comprises a constant region of an lgG2c antibody or a stabilised constant region of an IgGc antibody.
[0030] In any example, an antigen binding protein as described herein comprises a constant region of a kappa chain or a stabilised constant region of a kappa chain.
[0031] In any example, an antigen binding protein as described herein or a composition of an antigen binding protein as described herein, comprises a heavy chain constant region, comprising a stabilised heavy chain constant region, comprising a mixture of sequences fully or partially with or without the C-terminal lysine residue.1006294735
[0032] In any example, an antigen binding protein comprises a VH disclosed herein linked or fused to an IgGi constant region or stabilised IgGi constant region, an lgG2A constant region or stabilised lgG2A constant region, or an lgG2c constant region or stabilised lgG2c constant region (eg, as discussed above), and the VL is linked to or fused to a kappa light chain constant region.
[0033] In another embodiment, the antigen binding protein comprises an Fc region that is engineered to:- increase the in vitro or in vivo half-life;- have an increased capacity to induce antibody-dependent cell mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP) or complement-dependent cytotoxicity- reduce effector function; or- increase co-engagement of the antigen binding protein.
[0034] Mutations, deletions or modifications of amino acids in the Fc region which affect half-life, ADCC, ADCP or complement-dependent cytotoxicity, effector function are known to the skilled person and further described herein.
[0035] The functional characteristics of an antigen binding protein of the invention will be taken to apply mutatis mutandis to an antibody of the invention.
[0036] In any aspect of the invention and in any antigen binding protein described herein, there further includes an Fc region that is engineered to have reduced capacity to induce antibody-dependent cell-mediated cytotoxicity (ADCC). Preferably, the reduced capacity to induce ADCC is conferred by mutation, deletion or modification of amino acids in the Fc region which interact with an Fc receptor.
[0037] The invention also provides a pharmaceutical composition comprising a conjugate as described herein, and a pharmaceutically acceptable carrier, diluent or excipient.1006294735
[0038] The present invention further contemplates therapeutic uses for the conjugate of the invention. The conjugates of the invention are preferably used to treat a cancer, particularly osteosarcoma.
[0039] In a further aspect, the invention provides a method of treating osteosarcoma in a subject in need thereof, the method comprising administering to the subject an antigen binding protein for binding to GD2.
[0040] Further, the invention provides a method of treating osteosarcoma in a subject in need thereof, the method comprising administering to the subject a conjugate comprising an antigen binding protein for binding to GD2, conjugated to a cytotoxic agent.
[0041] Preferably the antigen binding protein comprises an antigen binding domain as described herein.
[0042] In a preferred embodiment, the method comprises administering a conjugate as described herein.
[0043] In any embodiment, the method may further comprise administering to the subject, an agent for increasing expression of GD2 antigen by the osteosarcoma cells of the subject. The agent may directly or indirectly increase GD2 antigen expression.
[0044] In certain embodiments, the agent for increasing GD2 expression is an epigenetic modulator.
[0045] In certain embodiments, the agent for increasing expression of GD2 is selected from: an EZH2 inhibitor, a PRC2 inhibitor, an agent that activates intracellular signalling pathways leading to increased GD2 synthesis or that is a precursor to a substrate for GD2 synthase (B4GALNT1) and agents that increase the expression of ST8SIA1 (GD3 synthase).
[0046] As used herein, EZH2 refers to the catalytic subunit of the epigenetic regulator polycomb repressive complex 2 (PRC2) and acts primarily as a gene transcription silencer by trimethylating lysine 27 of histone H3 (H3K27me3). An example of an EZH2 inhibitor is tazemetostat.1006294735
[0047] An example of an agent that activates intracellular signalling pathways leading to increased GD2 synthesis or that is a precursor to a substrate for GD2 synthase (B4GALNT1) is ceramide. Ceramide is believed to increase GD2 expression primarily through its role as a precursor in the ganglioside biosynthesis pathway, providing substrates for enzymes like GD2 synthase (B4GALNT1). It also influences lipid raft dynamics, enhancing the trafficking and surface localization of GD2. Additionally, ceramide activates intracellular signalling pathways. These combined effects are believed to contribute to increased GD2 expression in cells.
[0048] Ceramide levels may also be increased by administration of doxorubicin.
[0049] Preferably, the agent for increasing expression of GD2 is tazemetostat, ceramide (ceramide-C16), or a combination of tazemetostat and ceramide-C16.
[0050] In certain embodiments, the methods described herein may comprise administration of doxorubicin and tazemetostat. The doxorubicin and tazemetostat may be administered concomitantly (either in the same or different dosage forms) or sequentially. In one example, the doxorubicin is administered prior to the tazemetostat. The administration of either or both doxorubicin and / or tazemetostat may be concomitant or sequential in relation to administration of the antigen binding domain or conjugate described herein.
[0051] In one example, the method of treatment comprises prior administration of doxorubicin (which the inventors believe - without wishing to be bound by theory - to be responsible for increasing ceramide levels) - followed by administration of tazemetostat and followed by administration of the antigen binding domain or conjugate for binding to GD2.
[0052] In a preferred embodiment, the GD2-expressing cancer is not a neuroblastoma. In another preferred embodiment, the GD2-expressing cancer is not Ewing’s sarcoma.
[0053] In some embodiments, the GD2-expressing cancer is neuroblastoma or Ewing’s sarcoma. In these embodiments, preferably the method comprises administering doxorubicin.1006294735
[0054] Further, the present invention provides for the use of an antigen binding protein for binding to antigen GD2, in the manufacture of a medicament for the treatment of osteosarcoma. Optionally, the antigen binding protein may be conjugated to a cytotoxic agent.
[0055] Further, the present invention provides for the use of a conjugate as described herein, in the manufacture of a medicament for the treatment of a cancer expressing GD2 antigen, preferably wherein the cancer is osteosarcoma.
[0056] The present invention also provides an antigen binding protein for binding to GD2, for use in the treatment of a cancer expressing GD2 antigen, preferably wherein the cancer is osteosarcoma. Optionally, the antigen binding protein may be conjugated to a cytotoxic agent.
[0057] The present invention also provides a conjugate or pharmaceutical composition as described herein, for use in the treatment of a cancer expressing GD2 antigen, preferably wherein the cancer is osteosarcoma.
[0058] In any embodiment or aspect of the invention, and in the context of a conjugate for binding to GD2, the antigen binding protein and the cytotoxic agent may be directly linked via amino acid side chains of the antigen binding protein. For example, the cytotoxic agent may be linked via lysine or cysteine residues of the protein.
[0059] In any embodiment or aspect of the invention, and in the context of a conjugate for binding to GD2, the antigen binding protein and the cytotoxic agent are joined via a linker. Suitable linkers are known to the skilled person and include:- cleavable linkers such as: o acid-cleavable linkers, including hydrazone linkers, CL2A linkers, carbonate linkers, diisopropyl silyl ether-based linkers, and 4-(4- acetylphenoxy) butanoic acid (ActBut or AcBut) linkers; o enzyme-cleavable peptide linkers, including valine-citrulline linkers, glutamic acid-glycine-citrulline (Glu-Val-Cit) linkers, serine-Val-Cit (Ser- Val-Cit) linkers, cyclobutane- 1 ,1 -dicarboxamide moiety (cBu-Cit) linkers, legumain cleavable linkers, P -galactosidase cleavable linkers, -1006294735glucuronide linkers, sulfatase cleavable linkers, lysosomal proteasesensitive linkers (eg Val-Cit linkers, Val-alanine (Val-Ala) linkers, phenylalanine-lysine (Phe-Lys) linkers, L-Alanyl-L-alanine (Ala-Ala) linkers), and matrix metalloproteinase 2 (MMP-2) sensitive linkers; o disulfide linkers, including glutathione-sensitive disulfide linkers (eg N-Succinimidyl 4-(2-pyridyldithio) butanoate (SPDB) linkers and N-succinimidyl-4-(2-pyridyldithio) pentanoate (SPP) linkers); and o self-immolative linkers; and- non-cleavable linkers, including thioether linkers (eg, maleimidocaproyl linkers), oxime linkers, triazole linkers, 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) linkers, N-hydroxysuccinimide (NHS) linkers, sulfosuccinimidyl-4-(N- maleimidomethyl)cyclohexane-1-carboxylate (SMCC or sulfo-SMCC) linkers, maleimidomethyl cyclohexane- 1 -carboxylate (MCC) linkers, and maleimidocaproyl (MC) linkers.
[0060] In a preferred embodiment, the linker is a non-cleavable linker.
[0061] In a preferred embodiment, the linker further comprises branched polyethylene (PEG) chains, pyrophosphate diester groups and / or negatively charged sulfonate groups.
[0062] In a preferred embodiment, the antigen binding protein and a cytotoxic agent are linked via the linker succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylaten (SMCC).
[0063] In any embodiment or aspect of the invention, the conjugate may comprise more than one cytotoxic agent. Methods for the dual conjugation of different cytotoxic agents to antigen binding proteins are described in Mckertish and Kayser (2023) Pharmaceutics, the contents of which are incorporated herein by reference. It will be appreciated that when more than one cytotoxic agents are conjugated to an antigen binding protein, that the class of linker used may be the same or different for each agent. For example, a first cytotoxic agent may be conjugated to the antigen binding protein via a cleavable linker and a second cytotoxic agent may be conjugated via a1006294735non-cleavable linker. Alternatively, each cytotoxic agent is linked via the same class of linker (eg each linked via non-cleavable linkers or each linked via cleavable linkers). Of course, even when the same class of linker is used, the skilled person will appreciate that depending on the chemistry required, identical linkers are not necessarily required for conjugation of each cytotoxic agent. The more than one cytotoxic agents may be conjugated to different parts of the antigen binding protein, such as different amino acids (e.g., Lys, Cys, non-native amino acids, N-terminal, C-terminal, and glycans). The skilled person would be able to select suitable linkers and chemistry for the conjugation, e.g., in view of the present disclosure, Mckertish and Kayser (2021) Biomedicines, and Mckertish and Kayser (2023) Discov Med.
[0064] In any embodiment or aspect of the invention, the cytotoxic agent may be any agent suitable for generating cytolysis upon binding of the antigen binding protein conjugate to its target. In certain embodiments, the cytotoxic agent is in the form of a radionuclide.
[0065] The cytotoxic agent may be selected from any suitable chemotherapeutic molecule capable of being linked to an antigen binding protein. In certain embodiments, the (one or more) cytotoxic agents is selected from: cytotoxic agents such as microtubule inhibitors including auristatins (eg, MMAE and MMAF) and maytansinoids (eg, DM1 and DM4), DNA-damaging agents including but not limited to calicheamicins and pyrrolobenzodiazepines (PBDs), topoisomerase I inhibitors including camptothecin derivatives (eg, SN-38) and topoisomerase 2 inhibitors including doxorubicin.
[0066] In a preferred embodiment, the cytotoxic agent is the cytotoxin emtansine (DM1).
[0067] In a further preferred embodiment, the cytotoxic agent is doxorubicin. In further embodiments, the conjugate may comprise both doxorubicin and another cytotoxic agent.
[0068] In certain embodiments, the conjugate comprises both DM1 and doxorubicin.
[0069] Accordingly, in a preferred embodiment, the present invention provides a conjugate, or the use thereof, the conjugate comprising an antigen binding protein for binding to GD2 antigen, the protein conjugated to DM1 via an SMCC linker, wherein the1006294735antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 14, and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 27.
[0070] Accordingly, in a preferred embodiment, the present invention provides a conjugate, or the use thereof, the conjugate comprising an antigen binding protein for binding to GD2 antigen, the protein conjugated to DM1 via an SMCC linker, wherein the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 41 , and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 54.
[0071] In still a further embodiment, the present invention provides a conjugate, or the use thereof, the conjugate comprising an antigen binding protein for binding to GD2 antigen, the protein conjugated to Doxorubicin via an SMCC linker, wherein the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 14, and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 27.
[0072] Accordingly, in a preferred embodiment, the present invention provides a conjugate, or the use thereof, the conjugate comprising an antigen binding protein for binding to GD2 antigen, the protein conjugated to Doxorubicin via an SMCC linker, wherein the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 41 , and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 54.
[0073] As used herein, except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additives, components, integers or steps. The terms “comprising’ and “including” are used interchangeably.
[0074] Further aspects of the present invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example and with reference to the accompanying drawings.1006294735Brief description of the drawings
[0075] Figure 1. Characterization of synthesised anti-GD2 antibody-drug conjugate (ADC). A, FTIR spectra of naxitamab, SMCC-DM1, and the resulting ADC, showing characteristic absorption peaks. Upper line: ADC; lower line: naxitamab.B, ultraviolet-visible (UV-Vis) absorption spectra of Naxitamab, DM1 , and the ADC, illustrating the presence of conjugated components. Lines at approximately 280 nm, from upper to lower: naxitamab (blue), ADC (red) and DM1 (green).
[0076] Figure 2. In vitro cytotoxicity and apoptosis induction by anti-GD2 ADC. A-C, Cell Counting Kit-8 (CCK-8) assay results showing the cytotoxic effects of free DM1, Naxitamab, and ADC in U2OS cell lines; the IC50 of naxitamab: 4244nM; the IC50 of free DM1: 0.072nM; the IC50 of ADC: 13.5nM. D, flow cytometry analysis of apoptosis in U2OS cells treated with ADC showed a significant increase in apoptotic cells compared to control groups in total, early and late apoptosis. E-G, flow cytometry analysis of apoptosis in U2OS cells treated with ADC, showing total (E), early (F) and late apoptosis (G). H, real-time PCR analysis of apoptosis-related genes in U2OS cells treated with ADC, showing an upregulation of the apo ptosis- related gene Bax. Bars in each group: left = ADC; right = NC. I-K, similar CCK-8 assay results for 143B cells; the IC50 of naxitamab: NA; the IC50 of free DM1 : 0.07nM; the IC50 of ADC: 37.38nM. L, flow cytometry analysis of 143B cells treated with ADC showed a significant increase in apoptotic cells compared to control groups in total and early apoptosis, but no significant increase was observed. M-O, flow cytometry analysis of apoptosis in U2OS cells treated with ADC, showing total (M), early (N) and late apoptosis (O). P, real-time PCR analysis of apoptosis-related genes in 143B cells treated with ADC, showing an upregulation of the apoptosis-related gene Bad. Bars in each group: left = ADC; right = NC.
[0077] Figure 3. Effect of tazemetostat on GD2 expression. A-B, western blot analysis of EZH2 and H3K27me3 levels in U2OS cells treated with tazemetostat, showing a substantial reduction in both proteins, indicating effective EZH2 inhibition. Bars in each group of panel B: left = U2OS Tazemetostat; right = NC. C-D, western blot analysis confirming the reduction in H3K27me3 levels in 143B cells, showing a substantial reduction in both proteins, indicating effective EZH2 inhibition. Bars in each group of panel D: left = 143B Tazemetostat; right = NC. E-F, flow cytometry analysis of1006294735GD2 expression in LI2OS cells, showing a significant increase in GD2 levels compared to control. Bars in each group of panel F: left = LI2OS Tazemetostat; right = LI2OS NC. G-H, similar flow cytometry analysis for 143B cells, showing a significant increase in GD2 levels compared to control. Bars in each group of panel H: left = 143B Tazemetostat; right = 143B NC.
[0078] Figure 4. Effect of tazemetostat on sensitization to anti-GD2 ADC. A, flow cytometry analysis of apoptosis in LI2OS cells co-treated with tazemetostat and ADC, showing an enhanced significant increase in apoptotic cells compared to control. B-D, flow cytometry analysis of apoptosis in LI2OS cells treated with tazemetostat and ADC, showing total (B), early (C) and late apoptosis (D). E, real-time PCR analysis of apoptosis-related genes in LI2OS cells co-treated with tazemetostat and ADC, showing upregulation of apoptosis-related genes, including P53, Bad, Bax, Bcl-2, and Caspase-3. Bars from left to right in each group: ADC, Tazemetostat and NC. F, flow cytometry analysis of apoptosis in 143B cells co-treated with tazemetostat and ADC, showing an enhanced significant increase in apoptotic cells compared to control. G-l, enhanced apoptosis in 143B cells co-treated with tazemetostat and ADC, showing total (G), early (H) and late apoptosis (I). J, real-time PCR analysis of apoptosis-related genes in 143B cells co-treated with tazemetostat and ADC, showing upregulation of apoptosis-related genes, including P53, Bad, Bax, Bcl-2, and Caspase-3. Bars from left to right in each group: ADC, Tazemetostat and NC.
[0079] Figure 5. In vivo anti-tumour activity of anti-GD2 ADC. A, tumour volume measurements of 143B xenografts in mice treated with anti-GD2 ADC compared to control (saline, NC), showing significant inhibition in the ADC-treated group. B, images of 143B tumour-bearing mice at end point. C, images of 143B tumours at end point. D, images of the lungs recovered from 143B tumour-bearing mice at end point. E, haematoxylin and eosin (H.E) staining of mouse lung tissues. The mouse lung tissues showed no obvious signs of metastasis in the ADC-treated group, while the negative control group exhibited classic signs of metastasis with metastatic nodules observed in three lungs. F, body weight changes in mice treated with anti-GD2 ADC and control, showing significant weight loss in the control group on day 21 post-therapy initiation. Bars in each group: left = ADC; right = NC.1006294735
[0080] Figure 6. Early-period therapy with anti-GD2 ADC and tazemetostat in vivo. A, tumour volume measurements of 143B xenografts in mice treated with anti- GD2 ADC, tazemetostat, and combination therapy, showing enhanced inhibition in the combination therapy group. B, live image of mice. Colour scale: min =6.40e7 p / sec / cm2 / sr; max = 6.21e8 p / sec / cm2 / sr. C-D, flux data demonstrating the antitumour (C, tumour flux) and anti-metastasis (D, pulmonary flux) effect of combination therapy, with the combination therapy group showing the most effective results. E-F, H.E staining confirming reduced metastasis in the combination therapy group. G, body weight changes in different treatment groups, showing significant weight loss in the negative control and tazemetostat groups. Bars from left to right in each group: ADC + Tazemetostat; NC; ADC; Tazemetostat; and Naxitamab. H-l, immunohistochemistry (IHC) staining showing upregulation of GD2 expression in vivo, with significantly enhanced GD2 expression in the ADC with tazemetostat and tazemetostat groups.
[0081] Figure 7. Late-period therapy with anti-GD2 ADC and tazemetostat in vivo. A, tumour volume comparison showing robust inhibition in combination therapy and pretreatment groups, showing robust inhibition in the groups treated with anti-GD2 ADC combined with tazemetostat and in the tazemetostat pretreatment group, while moderate inhibition was observed in the anti-GD2 ADC alone group. B, live image of mice. Colour scale: min = 6.40e7 p / sec / cm2 / sr; max = 6.21e8 p / sec / cm2 / sr. C-D, flux data indicating reduced tumour growth (C, tumour flux) and anti-metastasis (D, pulmonary flux) effect of combination therapy and pretreatment groups, indicating reduced tumour growth and metastasis in the combination therapy and pretreatment groups compared to the tazemetostat and negative control groups. E-F, H.E staining showing minimal metastasis in these groups. G, body weight changes in different treatment groups, showing no significant weight loss in any group. Bars from left to right in each group: ADC + Tazemetostat; PreTazemetostat + ADC; NC; TA; and ADC. H-l, IHC staining highlighting GD2 expression in different treatment regimens, with the highest levels observed in the anti-GD2 ADC combined with tazemetostat, anti-GD2 ADC with tazemetostat pretreatment, and tazemetostat groups.
[0082] Figure 8. Effect of ceramide-C16 on GD2 expression in U2OS and 143B cells. A, flow cytometry analysis of GD2 expression in U2OS cells treated with Tazemetostat (TA) + ceramide-C16 or control (TA alone). B, flow cytometry analysis of1006294735GD2 expression in LI2OS cells treated with TA + ceramide-C16 or control (TA alone). C- D, flow cytometry analysis of GD2 expression in 143B cells treated with TA + ceramide- C16 or control (TA alone).
[0083] Figure 9. Prognostic value of ST8SIA1 (A) or B4GALT1 (B) expression on the survival outcomes of osteosarcoma patients. Lines from upper to lower at approximately 4000 days in panel A: B4GALT 1 low and B4GALT 1 high. Lines from upper to lower at approximately 4000 days in panel B: B4GALT 1 high and B4GALT 1 low.
[0084] Figure 10. IHC analysis of GD2 in metastatic osteosarcoma and non- metastatic osteosarcoma tumours.
[0085] Figure 11. Staining index of GD2 in cells treated with different therapies.A, late stage; B, early stage.
[0086] Figure 12. Staining index of GD2 in metastatic or non-metastatic osteosarcoma samples.
[0087] Figure 13. Ultraviolet-visible (UV-Vis) absorption spectra of Naxitamab, doxorubicin (DOX), and the ADC, illustrating the presence of conjugated components. Lines at approximately 280 nm, from upper to lower: ADC (black), Naxitamab (blue) and doxorubicin (“DOX”; red).
[0088] Figure 14 Doxorubicin-induced ceramide biosynthesis and GD2 upregulation in U2OS osteosarcoma cells. (A-E) LC-MS / MS sphingolipidomic analysis of U2OS cells exposed to sub-IC50 DOX for 10 h versus vehicle, showing absolute levels and fold changes of individual ceramide species (C16:0, C18:0, C20:0, C22:0, C24:0); among these, C16:0 displays the most robust DOX-induced increase.(F) RT-qPCR analysis of ceramide-metabolism genes in U2OS following DOX treatment, showing significant upregulation of CERS5 (de novo synthesis) with no change in SMPD1 (acid sphingomyelinase) relative to vehicle controls. (G- H) Immunoblot analysis of CERS5 protein expression in U2OS after DOX exposure; panel G shows representative Western blots for CERS5 and the loading control, and panel H shows densitometric quantification (normalised to loading control), confirming a significant DOX-induced increase in CERS5 protein levels. Data are presented as mean1006294735± SEM from at least three independent experiments; *p < 0.05, **p < 0.01 , ***p < 0.001 versus vehicle or as indicated. Left bar in each group: LI2OS DOX; right bar in each group: NC.
[0089] Figure 15. Doxorubicin-induced ceramide biosynthesis and GD2 upregulation in 143B osteosarcoma cells. (A-E) LC-MS / MS sphingolipidomic analysis of 143B cells exposed to sub-IC50 DOX for 10 h versus vehicle, showing absolute levels and fold changes of individual ceramide species (C16:0, C18:0, C20:0, C22:0, C24:0); among these, C16:0 and C18:0 display the most prominent DOX- induced increases. (F) RT-qPCR analysis of ceramide-metabolism genes in 143B following DOX treatment, showing significant upregulation of CERS5 (de novo synthesis) with no change in SMPD1 (acid sphingomyelinase) relative to vehicle controls. (G-H) Immunoblot analysis of CERS5 protein expression in 143B after DOX exposure; panel G shows representative Western blots for CERS5 and the loading control, and panel H shows densitometric quantification (normalized to loading control), confirming a significant DOX-induced increase in CERS5 protein levels. Data are presented as mean ± SEM from at least three independent experiments; *p < 0.05, **p < 0.01, ***p < 0.001 versus vehicle or as indicated. Left bar in each group: 143B DOX; right bar in each group: NC.
[0090] Figure 16. In vivo antitumour efficacy and safety evaluation of DOX, TA, and anti-GD2 ADC in orthotopic 143B-Luc osteosarcoma xenografts.(A) Treatment schedule showing the timing and dosing frequency of each agent: doxorubicin (DOX, intraperitoneal, weekly), tazemetostat (TA, oral, daily from day 7), anti-GD2-DM1 antibody-drug conjugate (ADC, intravenous, every three days from day 7), and saline for the negative control (NC). (B) Representative gross images of excised tibial tumours at the experimental endpoint from each treatment group: NC, DOX, DOX+TA (D+T), DOX+ADC (D+A), and DOX+TA+ADC(D+A+T). (C) Tumour volume at three time points over four weeks, demonstrating significantly smaller tumour volumes in combination groups, with the greatest suppression in DOX+TA+ADC. Bars from left to right in each group: DOX+TA+ADC; DOX+ADC; DOX+TA; DOX; and NC.(D) Longitudinal body-weight measurements for each group showing stable weight maintenance during treatment and no additional weight loss in the DOX+TA+ADC group compared with DOX alone, indicating good systemic tolerability. Bars from left to right in1006294735each group: DOX+TA+ADC; DOX+ADC; DOX+TA; DOX; and NC. Data represent mean ± SEM from 5^3 independent measurements; *p < 0.05, **p < 0.01 , ***p < 0.001 versus NC or as indicated.
[0091] Figure 17. In vivo bioluminescence, metastatic burden, GD2 expression, and cardiac apoptosis in orthotopic 143B-Luc osteosarcoma xenografts.(A) Representative whole-body bioluminescence images at endpoint for each treatment group: negative control (NC), doxorubicin alone (DOX), DOX plus tazemetostat (DOX+TA), DOX plus anti-GD2-DM1 antibody-drug conjugate (DOX+ADC), and the triple combination (DOX+TA+ADC). Colour scale: min = 4.07e7 p / sec / cm2 / sr; max = 3.28e9 p / sec / cm2 / sr. (B) Quantification of lung photon flux (photons / sec) from thoracic regions of interest, showing reduced metastatic signal in all combination groups and the lowest values in DOX+TA+ADC. (C) Quantification of primary tibial tumour photon flux, demonstrating greatest suppression of local tumour signal in the DOX+TA+ADC group compared with NC, DOX, and dual combinations. (D) Representative haematoxylin and eosin (H&E) stained lung sections illustrating extensive metastatic nodules in NC and DOX, fewer and smaller lesions in DOX+TA and DOX+ADC, and minimal metastatic involvement in DOX+TA+ADC. (E) GD2 immunohistochemistry of primary tibial tumours showing low or patchy GD2 expression in NC, with stronger and more homogeneous membrane staining in TA-containing groups, particularly DOX+TA+ADC. (F-G) Representative cardiac sections stained for cleaved caspase-3, indicating DOX- associated cardiomyocyte apoptosis without obvious exacerbation by addition of TA and ADC; the red is positive, the bule is negative. (H) TLINEL staining of ventricular myocardium showing a similar pattern of scattered apoptotic nuclei, with no widespread increase in apoptosis in the DOX+TA+ADC group relative to DOX alone; the red is positive, the bule is negative. Scale bars as indicated. Data in B and C are mean ± SEM; *p < 0.05, **p < 0.01 , ***p < 0.001 versus NC or as indicated. Bars from left to right in panel B-C: DOX+TA+ADC; DOX+ADC; DOX+TA; DOX; and NC.Sequence informationTable 1. VH CDR sequences1006294735Table 2. VH framework regions1006294735Table 3. VH full sequencesTable 4. VL CDR sequencesTable 5. VL framework regions1006294735Table 6. VL full sequencesDetailed description of the embodiments
[0092] Osteosarcoma is the most common and highly aggressive form of bone cancer with limited therapeutic options. Generally, it affects children and young adults 30 years of age or younger, although it is possible to observe at any age. The prognosis of1006294735osteosarcoma remains particularly poor, especially for individuals with metastatic or recurring cases. Often, the treatment options include a combination of chemotherapy, surgery, or radiotherapy, which are extremely invasive and associated with severe side effects. Partial or complete amputation of the inflicted limb is a common practice in those severe or recurring instances. Various immunotherapies are being investigated as a therapy option for osteosarcoma; however, their usage remains mainly experimental. Therefore, there is an urgent need for more effective and targeted therapies for osteosarcoma.
[0093] The present invention is based on a number of surprising findings by the inventors.
[0094] Firstly, the inventors identified that an anti-GD2 antibody, conjugated to a cytotoxic agent was capable of killing osteosarcoma cells, whereas no such killing effect was observed for unconjugated antibody. Thus, the inventors have identified a new use for anti-GD2 antibodies for targeting osteosarcomas.
[0095] The inventors also found that the efficacy of a conjugate for binding to GD2 can be further enhanced by upregulating GD2 expression, for example by epigenetic modulation.
[0096] Together, the inventors’ findings offer a new approach to osteosarcoma treatment that is expected to significantly improve patient outcomes.
[0097] Further aspects of the present invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example and with reference to the accompanying drawings.
[0098] Reference will now be made in detail to certain embodiments of the invention. While the invention will be described in conjunction with the embodiments, it will be understood that the intention is not to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the present invention as defined by the claims.1006294735General and definitions
[0099] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter. Thus, as used herein, the singular forms “a”, “an” and “the” include plural aspects, and vice versa, unless the context clearly dictates otherwise. For example, reference to “a” includes a single as well as two or more; reference to “an” includes a single as well as two or more; reference to “the” includes a single as well as two or more and so forth.
[0100] Those skilled in the art will appreciate that the present invention is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.
[0101] One skilled in the art will recognise many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described.
[0102] All of the patents and publications referred to herein are incorporated by reference in their entirety.
[0103] The present invention is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally- equivalent products, compositions and methods are clearly within the scope of the present invention.
[0104] For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth conflicts with any document incorporated herein by reference, the definition set forth below shall prevail.1006294735
[0105] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (for example, in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).
[0106] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilised in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-lnterscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
[0107] The description and definitions of variable regions and parts thereof, immunoglobulins, antibodies and fragments thereof herein may be further clarified by the discussion in Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., 1987 and 1991 , Bork et al., J Mol. Biol. 242, 309-320, 1994, Chothia and Lesk J. Mol Biol. 196:901 -917, 1987, Chothia et al. Nature 342, 877-883, 1989, Martin (“enhanced Chothia”; Mol Immunol. (2008) 45:3832-9; and / or or Al-Lazikani et al., J Mol Biol 273, 927-948, 1997.
[0108] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.
[0109] The term “protein” shall be taken to include a single polypeptide chain, i.e., a series of contiguous amino acids linked by peptide bonds or a series of polypeptide chains covalently or non-covalently linked to one another (i.e., a polypeptide complex). For example, the series of polypeptide chains can be covalently linked using a suitable1006294735chemical or a disulphide bond. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, Van der Waals forces, and hydrophobic interactions. The protein may include one or more non-natural amino acids.
[0110] The term “polypeptide” or “polypeptide chain” will be understood from the foregoing paragraph to mean a series of contiguous amino acids linked by peptide bonds.
[0111] As used herein, the term “antigen binding domain” and shall be taken to mean a region of an antibody that is capable of specifically binding to an antigen, i.e. , a H or a L or an Fv comprising both a VH and a VL. The antigen binding domain need not be in the context of an entire antibody, e.g., it can be in isolation (e.g., a domain antibody) or in another form, e.g., as described herein, such as a scFv.
[0112] For the purposes for the present disclosure, the term “antibody” includes a protein capable of specifically binding to one or a few closely related antigens by virtue of an antigen binding domain contained within a Fv. This term includes four chain antibodies (e.g., two light chains and two heavy chains), recombinant or modified antibodies (e.g., chimeric antibodies, humanised antibodies, human antibodies, CDR-grafted antibodies, primatised antibodies, de-immunised antibodies, synhumanised antibodies, halfantibodies, bispecific antibodies).
[0113] An antibody generally comprises constant domains, which can be arranged into a constant region or constant fragment or fragment crystallisable (Fc). Exemplary forms of antibodies comprise a four-chain structure as their basic unit. Full-length antibodies comprise two heavy chains (~50 to 70 kD) covalently linked and two light chains (~23 kDa each). A light chain generally comprises a variable region (if present) and a constant domain and in mammals is either a K light chain or a A light chain. A heavy chain generally comprises a variable region and one or two constant domain(s) linked by a hinge region to additional constant domain(s). Heavy chains of mammals are of one of the following types a, 5, E, y, or p. Each light chain is also covalently linked to one of the heavy chains. For example, the two heavy chains and the heavy and light chains are held together by inter-chain disulfide bonds and by non-covalent interactions. The number of inter-chain disulfide bonds can vary among different types of antibodies. Each chain has an N- terminal variable region (VH or VL wherein each are -110 amino acids in length) and one or more constant domains at the C- terminus. The constant domain of the light chain (CL1006294735which is -110 amino acids in length) is aligned with and disulfide bonded to the first constant domain of the heavy chain (CHI which is 330 to 440 amino acids in length). The light chain variable region is aligned with the variable region of the heavy chain. The antibody heavy chain can comprise 2 or more additional CH domains (such as, CH2, CH3 and the like) and can comprise a hinge region between the CHI and CH2 constant domains. Antibodies can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgGi, lgG2, IgGs, lgG4, IgAi and lgA2) or subclass. In one example, the antibody is a murine (mouse or rat) antibody or a primate (such as, human) antibody. In one example the antibody heavy chain is missing a C-terminal lysine residue. In one example, the antibody is humanised, synhumanised, chimeric, CDR-grafted or deimmunised.
[0114] The terms "full-length antibody", "intact antibody" or "whole antibody" are used interchangeably to refer to an antibody in its substantially intact form, as opposed to an antigen binding fragment of an antibody. Specifically, whole antibodies include those with heavy and light chains including an Fc region. The constant domains may be wild-type sequence constant domains (e.g., human wild-type sequence constant domains) or amino acid sequence variants thereof.
[0115] As used herein, “variable region” refers to the portions of the light and / or heavy chains of an antibody as defined herein that is capable of specifically binding to an antigen and, includes amino acid sequences of complementarity determining regions (CDRs); i.e., CDRi, CDR2, and CDR3, and framework regions (FRs). For example, the variable region comprises three or four FRs (e.g., FR1, FR2, FR3 and optionally FR4) together with three CDRs. VH refers to the variable region of the heavy chain. VL refers to the variable region of the light chain.
[0116] As used herein, the term “complementarity determining regions” (syn. CDRs; i.e., CDR1, CDR2, and CDR3) refers to the amino acid residues of an antibody variable region the presence of which are major contributors to specific antigen binding. Each variable region domain (VH or L) typically has three CDRs identified as CDR1 , CDR2 and CDR3. The CDRs of VH are also referred to herein as CDR Hi , CDR H2 and CDR H3, respectively, wherein CDR Hi corresponds to CDR 1 of VH, CDR H2 corresponds to CDR 2 of VH and CDR H3 corresponds to CDR 3 of VH. Likewise, the CDRs of VL are referred to herein as CDR Li , CDR L2 and CDR L3, respectively, wherein CDR Li corresponds to CDR 1 of VL, CDR L2 corresponds to CDR 2 of VL and CDR L3 corresponds to CDR 3 of1006294735VL. In one example, the amino acid positions assigned to CDRs and FRs are defined according to Kabat Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md., 1987 and 1991 (also referred to herein as “the Kabat numbering system”). In another example, the amino acid positions assigned to CDRs and FRs are defined according to the Enhanced Chothia Numbering Scheme (http: / / www.bioinfo.org.uk / mdex.html). The present invention is not limited to FRs and CDRs as defined by the Kabat numbering system, but includes all numbering systems, including the canonical numbering system or of Chothia and Lesk J. Mol. Biol. 196: 901- 917, 1987; Chothia et al., Nature 342: 877-883, 1989; and / or Al-Lazikani et al., J. Mol. Biol. 273: 927-948, 1997; the numbering system of Honnegher and Plukthun J. Mol. Biol. 309: 657-670, 2001 ; or the IMGT system discussed in Giudicelli et al., Nucleic Acids Res. 25: 206-211 1997.
[0117] In one example, the CDRs are defined according to the Kabat numbering system. Optionally, heavy chain CDR2 according to the Kabat numbering system does not comprise the five C-terminal amino acids listed herein or any one or more of those amino acids are substituted with another naturally-occurring amino acid. In this regard, Padlan et al., FASEB J., 9: 133-139, 1995 established that the five C-terminal amino acids of heavy chain CDR2 are not generally involved in antigen binding.
[0118] "Framework regions" (FRs) are those variable region residues other than the CDR residues. The FRs of VH are also referred to herein as FR Hi , FR H2, FR H3 and FR H4, respectively, wherein FR Hi corresponds to FR 1 of VH, FR H2 corresponds to FR 2 of VH, FR H3 corresponds to FR 3 of H and FR H4 corresponds to FR 4 of VH. Likewise, the FRs of VL are referred to herein as FR Li, FR L2, FR L3 and FR L4, respectively, wherein FR Li corresponds to FR 1 of VL, FR L2 corresponds to FR 2 of VL, FR L3 corresponds to FR 3 of VL and FR L4 corresponds to FR 4 of VL.
[0119] As used herein, the term “Fv” shall be taken to mean any protein, whether comprised of multiple polypeptides or a single polypeptide, in which a VL and a VH associate and form a complex having an antigen binding domain, i.e., capable of specifically binding to an antigen. The VH and the VL that form the antigen binding domain can be in a single polypeptide chain or in different polypeptide chains. Furthermore, an Fv of the invention (as well as any protein of the invention) may have multiple antigen binding domains that may or may not bind the same antigen. This term shall be1006294735understood to encompass fragments directly derived from an antibody as well as proteins corresponding to such a fragment produced using recombinant means. In some examples, the VH is not linked to a heavy chain constant domain (CH) 1 and / or the VL is not linked to a light chain constant domain (CL). Exemplary Fv containing polypeptides or proteins include a Fab fragment, a Fab’ fragment, a F(ab’) fragment, a scFv, a diabody, a triabody, a tetrabody or higher order complex, or any of the foregoing linked to a constant region or domain thereof, e.g., CH2 or CH3 domain, e.g., a minibody.
[0120] A "Fab fragment" consists of a monovalent antigen-binding fragment of an immunoglobulin and can be produced by digestion of a whole antibody with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain or can be produced using recombinant means. A "Fab1fragment" of an antibody can be obtained by treating a whole antibody with pepsin, followed by reduction, to yield a molecule consisting of an intact light chain and a portion of a heavy chain comprising a VH and a single constant domain. Two Fab' fragments are obtained per antibody treated in this manner. A Fab’ fragment can also be produced by recombinant means. A "F(ab')2 fragment” of an antibody consists of a dimer of two Fab' fragments held together by two disulfide bonds, and is obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction. A “Fab2” fragment is a recombinant fragment comprising two Fab fragments linked using, for example a leucine zipper or a CH3 domain. A “single chain Fv” or “scFv” is a recombinant molecule containing the variable region fragment (Fv) of an antibody in which the variable region of the light chain and the variable region of the heavy chain are covalently linked by a suitable, flexible polypeptide linker.
[0121] As used herein, the term “binds” in reference to the interaction of an antigen binding protein or an antigen binding domain thereof with an antigen means that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the antigen. For example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody binds to epitope "A", the presence of a molecule containing epitope “A” (or free, unlabelled “A”), in a reaction containing labelled “A” and the protein, will reduce the amount of labelled “A” bound to the antibody.
[0122] As used herein, the term “specifically binds” or “binds specifically” shall be taken to mean that an antigen binding protein of the invention reacts or associates more1006294735frequently, more rapidly, with greater duration and / or with greater affinity with a particular antigen or cell expressing same than it does with alternative antigens or cells. For example, an antigen binding protein binds to GD2 with materially greater affinity (e.g., 1.5 fold or 2 fold or 5 fold or 10 fold or 20 fold or 40 fold or 60 fold or 80 fold to 100 fold or 150 fold or 200 fold) than it does to other related molecules (such as other cytokine binding proteins).
[0123] As used herein, the terms “preventing”, “prevent” or “prevention” include administering an antigen binding protein of the invention to thereby stop or hinder the development of at least one symptom of a condition. This term also encompasses treatment of a subject in remission to prevent or hinder relapse.
[0124] As used herein, the terms “treating”, “treat” or “treatment” include administering an antigen binding protein described herein to thereby reduce or eliminate at least one symptom of a specified disease or condition.
[0125] As used herein, the term “subject” shall be taken to mean any animal including humans, for example a mammal. Exemplary subjects include but are not limited to humans and non-human primates. For example, the subject is a human.
[0126] The terms "engineered cell" and "genetically modified cell" as used herein can be used interchangeably. The terms mean containing and / or expressing a foreign gene or nucleic acid sequence that in turn modifies the genotype or phenotype of the cell or its progeny.GD2
[0127] “GD2” is a disialoganglioside expressed on tumors of neuroectodermal origin, including human neuroblastoma and melanoma, with highly restricted expression on normal tissues, principally to the central and peripheral nervous system in humans. GD2 is defined by the IIIPAC name:(2R,4R,5S,6S)-2-[3-[(2S,3S,4R,6S)-6-[(2S,3R,4R,5S,6R)-5-[(2S,3R,4R,5R,6R)-3- acetamido- 4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-[(2R,3S,4R,5R,6R)-4,5- dihydroxy-2- (hydroxymethyl)-6-[(E)-3-hydroxy-2-(octadecanoylamino)octadec-4- enoxy]oxan-3-yl]oxy-3-hydroxy-6-(hydroxymethyl)oxan-4-yl]oxy-3-amino-6-carboxy-4-1006294735hydroxyoxan-2-yl]-2,3-dihydroxypropoxy]-5-amino-4-hydroxy-6-(1 ,2,3- trihydroxypropyl)oxane-2-carboxylic acid.Antibodies
[0128] In one example, an antigen binding protein as described herein according to any example is an antibody.
[0129] An “antibody-drug conjugate”, or “ADC” is an antibody that is conjugated to one or more cytotoxins, each through a linker. The antibody is typically a monoclonal antibody specific to an antigen. In certain preferred embodiments of the present invention, ADCs are designed as a targeted therapy for treating cancer.
[0130] Unlike chemotherapy alone, these preferred embodiments combine the targeting capabilities of monoclonal antibodies with the cancer-killing ability of cytotoxic drugs and may discriminate between healthy and malignant tissue.
[0131] Methods for generating antibodies are known in the art and / or described in Harlow and Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988). Generally, in such methods GD2 or a region thereof (e.g., an extracellular region) or immunogenic fragment or epitope thereof or a cell expressing and displaying same (i.e. , an immunogen), optionally formulated with any suitable or desired carrier, adjuvant, or pharmaceutically acceptable excipient, is administered to a nonhuman animal, for example, a mouse, chicken, rat, rabbit, guinea pig, dog, horse, cow, goat or pig. The immunogen may be administered intranasally, intramuscularly, subcutaneously, intravenously, intradermally, intraperitoneally, or by other known route.
[0132] The production of polyclonal antibodies may be monitored by sampling blood of the immunised animal at various points following immunisation. One or more further immunisations may be given, if required to achieve a desired antibody titre. The process of boosting and titreing is repeated until a suitable titre is achieved. When a desired level of immunogenicity is obtained, the immunised animal is bled and the serum isolated and stored, and / or the animal is used to generate monoclonal antibodies (mAbs).
[0133] Monoclonal antibodies are one exemplary form of antibody contemplated by the present invention. The term “monoclonal antibody" or “mAb” refers to a homogeneous1006294735antibody population capable of binding to the same antigen(s), for example, to the same epitope within the antigen. This term is not intended to be limited with regard to the source of the antibody or the manner in which it is made.
[0134] For the production of mAbs any one of a number of known techniques may be used, such as, for example, the procedure exemplified in LIS4196265 or Harlow and Lane (1988), supra.
[0135] For example, a suitable animal is immunised with an immunogen under conditions sufficient to stimulate antibody producing cells. Rodents such as rabbits, mice and rats are exemplary animals. Mice genetically-engineered to express human antibodies, for example, which do not express murine antibodies, can also be used to generate an antibody of the present invention (e.g., as described in W02002 / 066630).
[0136] Following immunisation, somatic cells with the potential for producing antibodies, specifically B lymphocytes (B cells), are selected for use in the mAb generating protocol. These cells may be obtained from biopsies of spleens, tonsils or lymph nodes, or from a peripheral blood sample. The B cells from the immunised animal are then fused with cells of an immortal myeloma cell, generally derived from the same species as the animal that was immunised with the immunogen.
[0137] Hybrids are amplified by culture in a selective medium comprising an agent that blocks the de novo synthesis of nucleotides in the tissue culture media. Exemplary agents are aminopterin, methotrexate and azaserine.
[0138] The amplified hybridomas are subjected to a functional selection for antibody specificity and / or titre, such as, for example, by flow cytometry and / or immunohistochemistry and / or immunoassay (e.g. radioimmunoassay, enzyme immunoassay, cytotoxicity assay, plaque assay, dot immunoassay, and the like).
[0139] Alternatively, ABL-MYC technology (NeoClone, Madison Wl 53713, USA) is used to produce cell lines secreting MAbs (e.g., as described in Largaespada et al, J. Immunol. Methods. 197: 85-95, 1996).
[0140] Antibodies can also be produced or isolated by screening a display library, e.g., a phage display library, e.g., as described in US6300064 and / or US5885793. For1006294735example, the present inventors have isolated fully human antibodies from a phage display library.
[0141] The antibody of the present invention may be a synthetic antibody. For example, the antibody is a chimeric antibody, a humanised antibody, a human antibody synhumanised antibody, primatised antibody or a de-immunised antibody.
[0142] Antigen binding proteins (eg antibodies) for binding to GD2 are known in the art. Examples of such antibodies include naxitamab and dinutuximab, the sequences of which are provided herein. Further antibodies for binding GD2, and for use in accordance with the invention, include antibody 14.18 and hu14.18, disclosed in WO2023172968 which is incorporated herein by reference.Mutations to proteins
[0143] The present invention also provides an antigen binding protein or a nucleic acid encoding same having at least 80% identity to a sequence disclosed herein. In one example, an antigen binding protein or nucleic acid of the invention comprises sequence at least about 85% or 90% or 95% or 97% or 98% or 99% identical to a sequence disclosed herein.
[0144] Alternatively, or additionally, the antigen binding protein comprises a CDR (e.g., three CDRs) at least about 80% or 85% or 90% or 95% or 97% or 98% or 99% identical to CDR(s) of a VH or VL as described herein according to any example.
[0145] In another example, a nucleic acid of the invention comprises a sequence at least about 80% or 85% or 90% or 95% or 97% or 98% or 99% identical to a sequence encoding an antigen binding protein having a function as described herein according to any example. The present invention also encompasses nucleic acids encoding an antigen binding protein of the invention, which differs from a sequence exemplified herein as a result of degeneracy of the genetic code.
[0146] The % identity of a nucleic acid or polypeptide is determined by GAP (Needleman and Wunsch. Mol. Biol. 48, 443-453, 1970) analysis (GOG program) with a gap creation penalty=5, and a gap extension penalty=0.3. The query sequence is at least 50 residues in length, and the GAP analysis aligns the two sequences over a region of at1006294735least 50 residues. For example, the query sequence is at least 100 residues in length and the GAP analysis aligns the two sequences over a region of at least 100 residues. For example, the two sequences are aligned over their entire length.
[0147] The present invention also contemplates a nucleic acid that hybridises under stringent hybridisation conditions to a nucleic acid encoding an antigen binding site described herein. A “moderate stringency” is defined herein as being a hybridisation and / or washing carried out in 2 x SSC buffer, 0.1 % (w / v) SDS at a temperature in the range 45°C to 65°C, or equivalent conditions. A “high stringency” is defined herein as being a hybridisation and / or wash carried out in 0.1 x SSC buffer, 0.1% (w / v) SDS, or lower salt concentration, and at a temperature of at least 65°C, or equivalent conditions. Reference herein to a particular level of stringency encompasses equivalent conditions using wash / hybridisation solutions other than SSC known to those skilled in the art. For example, methods for calculating the temperature at which the strands of a double stranded nucleic acid will dissociate (also known as melting temperature, or Tm) are known in the art. A temperature that is similar to (e.g., within 5°C or within 10°C) or equal to the Tm of a nucleic acid is considered to be high stringency. Medium stringency is to be considered to be within 10°C to 20°C or 10°C to 15°C of the calculated Tm of the nucleic acid.
[0148] The present invention also contemplates mutant forms of an antigen binding protein of the invention comprising one or more conservative amino acid substitutions compared to a sequence set forth herein. In some examples, the antigen binding protein comprises 10 or fewer, e.g., 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1 conservative amino acid substitutions. A “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain and / or hydropathicity and / or hydrophilicity.
[0149] Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), p-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Hydropathic indices are described, for example in1006294735Kyte and Doolittle J. Mol. Biol., 157: 105-132, 1982 and hydrophylic indices are described in, e.g., US4554101.
[0150] The present invention also contemplates non-conservative amino acid changes. For example, of particular interest are substitutions of charged amino acids with another charged amino acid and with neutral or positively charged amino acids. In some examples, the antigen binding protein comprises 10 or fewer, e.g., 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1 non-conservative amino acid substitutions.
[0151] In one example, the mutation(s) occur within a FR of an antigen binding domain of an antigen binding protein of the invention. In another example, the mutation(s) occur within a CDR of an antigen binding protein of the invention.
[0152] Exemplary methods for producing mutant forms of an antigen binding protein include:• mutagenesis of DNA (Thie et al., Methods Mol. Biol. 525: 309-322, 2009) or RNA (Kopsidas et al., Immunol. Lett. 107:163-168, 2006; Kopsidas et al. BMC Biotechnology, 7: 18, 2007; and W01999 / 058661);• introducing a nucleic acid encoding the polypeptide into a mutator cell, e.g., XL- 1 Red, XL-mutS and XL-mutS-Kanr bacterial cells (Stratagene);• DNA shuffling, e.g., as disclosed in Stemmer, Nature 370: 389-91 , 1994; and• site directed mutagenesis, e.g., as described in Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995).
[0153] Exemplary methods for determining biological activity of the mutant antigen binding proteins of the invention will be apparent to the skilled artisan and / or described herein, e.g., antigen binding. For example, methods for determining antigen binding, competitive inhibition of binding, affinity, association, dissociation and therapeutic efficacy are described herein.1006294735Constant Regions
[0154] The present invention encompasses antigen binding proteins and / or antibodies described herein comprising a constant region of an antibody. This includes antigen binding fragments of an antibody fused to an Fc.
[0155] Sequences of constant regions useful for producing the proteins of the present invention may be obtained from a number of different sources. In some examples, the constant region or portion thereof of the protein is derived from a human antibody. The constant region or portion thereof may be derived from any antibody class, including IgM, IgG, IgD, IgA and IgE, and any antibody isotype, including IgGi, lgG2, IgGs and lgG4. In one example, the constant region is human isotype lgG4 or a stabilised lgG4 constant region.
[0156] In one example, the Fc region of the constant region has a reduced ability to induce effector function, e.g., compared to a native or wild-type human IgGi or IgGs Fc region. In one example, the effector function is antibody-dependent cell-mediated cytotoxicity (ADCC) and / or antibody-dependent cell-mediated phagocytosis (ADCP) and / or complement-dependent cytotoxicity (CDC). Methods for assessing the level of effector function of an Fc region containing protein are known in the art and / or described herein.
[0157] In another example, the Fc region is a region modified to have reduced effector function, i.e., a “non-immunostimulatory Fc region”. For example, the Fc region is an I gGi Fc region comprising a substitution at one or more positions selected from the group consisting of 268, 309, 330 and 331. In another example, the Fc region is an IgGi Fc region comprising one or more of the following changes E233P, L234V, L235A and deletion of G236 and / or one or more of the following changes A327G, A330S and P331S (Armour et al., Eur J Immunol. 29:2613-2624, 1999; Shields et al., J Biol Chem. 276(9):6591-604, 2001). Additional examples of non-immunostimulatory Fc regions are described, for example, in Dall'Acqua et al., J Immunol. 177: 1129-1138 2006; and / or Hezareh J Virol ;75: 12161-12168, 2001).
[0158] In another example, the Fc region is a chimeric Fc region, e.g., comprising at least one CH2 domain from an lgG4 antibody and at least one CH3 domain from an IgGi antibody, wherein the Fc region comprises a substitution at one or more amino acid1006294735positions selected from the group consisting of 240, 262, 264, 266, 297, 299, 307, 309, 323, 399, 409 and 427 (Ell numbering) (e.g., as described in WO2010 / 085682). Exemplary substitutions include 240F, 262L, 264T, 266F, 297Q, 299A, 299K, 307P, 309K, 309M, 309P, 323F, 399S, and 427F.Additional Modifications
[0159] The present invention also contemplates additional modifications to an antibody or antigen binding protein comprising an Fc region or constant region.
[0160] For example, the antibody comprises one or more amino acid substitutions that increase the half-life of the protein. For example, the antibody comprises a Fc region comprising one or more amino acid substitutions that increase the affinity of the Fc region for the neonatal Fc region (FcRn). For example, the Fc region has increased affinity for FcRn at lower pH, e.g., about pH 6.0, to facilitate Fc / FcRn binding in an endosome. In one example, the Fc region has increased affinity for FcRn at about pH 6 compared to its affinity at about pH 7.4, which facilitates the re-release of Fc into blood following cellular recycling. These amino acid substitutions are useful for extending the half-life of a protein, by reducing clearance from the blood.
[0161] Exemplary amino acid substitutions include T250Q and / or M428L or T252A, T254S and T266F or M252Y, S254T and T256E or H433K and N434F according to the Ell numbering system. Additional or alternative amino acid substitutions are described, for example, in US20070135620 or US7083784.Protein production
[0162] In one example, an antigen binding protein described herein according to any example is produced by culturing a hybridoma under conditions sufficient to produce the protein, e.g., as described herein and / or as is known in the art.Recombinant expression
[0163] In another example an antigen binding protein described herein according to any example is recombinant.1006294735
[0164] In the case of a recombinant protein, nucleic acid encoding same can be cloned into expression constructs or vectors, which are then transfected into host cells, such as E. coli cells, yeast cells, insect cells, or mammalian cells, such as simian COS cells, Chinese Hamster Ovary (CHO) cells, human embryonic kidney (HEK) cells, or myeloma cells that do not otherwise produce the protein. Exemplary cells used for expressing a protein are CHO cells, myeloma cells or HEK cells. Molecular cloning techniques to achieve these ends are known in the art and described, for example in Ausubel et al., (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present) or Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989). A wide variety of cloning and in vitro amplification methods are suitable for the construction of recombinant nucleic acids. Methods of producing recombinant antibodies are also known in the art, see, e.g., US4816567 or US5530101.
[0165] Following isolation, the nucleic acid is inserted operably linked to a promoter in an expression construct or expression vector for further cloning (amplification of the DNA) or for expression in a cell-free system or in cells.
[0166] As used herein, the term “promoter” is to be taken in its broadest context and includes the transcriptional regulatory sequences of a genomic gene, including the TATA box or initiator element, which is required for accurate transcription initiation, with or without additional regulatory elements (e.g., upstream activating sequences, transcription factor binding sites, enhancers and silencers) that alter expression of a nucleic acid, e.g., in response to a developmental and / or external stimulus, or in a tissue specific manner. In the present context, the term “promoter” is also used to describe a recombinant, synthetic or fusion nucleic acid, or derivative which confers, activates or enhances the expression of a nucleic acid to which it is operably linked. Exemplary promoters can contain additional copies of one or more specific regulatory elements to further enhance expression and / or alter the spatial expression and / or temporal expression of said nucleic acid.
[0167] As used herein, the term “operably linked to" means positioning a promoter relative to a nucleic acid such that expression of the nucleic acid is controlled by the promoter.1006294735
[0168] Many vectors for expression in cells are available. The vector components generally include, but are not limited to, one or more of the following: a signal sequence, a sequence encoding a protein (e.g., derived from the information provided herein), an enhancer element, a promoter, and a transcription termination sequence. The skilled artisan will be aware of suitable sequences for expression of a protein. Exemplary signal sequences include prokaryotic secretion signals (e.g., pelB, alkaline phosphatase, penicillinase, Ipp, or heat-stable enterotoxin II), yeast secretion signals (e.g., invertase leader, a factor leader, or acid phosphatase leader) or mammalian secretion signals (e.g., herpes simplex gD signal).
[0169] Exemplary promoters active in mammalian cells include cytomegalovirus immediate early promoter (CMV-IE), human elongation factor 1-a promoter (EF1), small nuclear RNA promoters (U1a and U 1 b), a-myosin heavy chain promoter, Simian virus 40 promoter (SV40), Rous sarcoma virus promoter (RSV), Adenovirus major late promoter, P-actin promoter; hybrid regulatory element comprising a CMV enhancer / p-actin promoter or an immunoglobulin promoter or active fragment thereof. Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture; baby hamster kidney cells (BHK, ATCC CCL 10); or Chinese hamster ovary cells (CHO).
[0170] Typical promoters suitable for expression in yeast cells such as for example a yeast cell selected from the group comprising Pichia pastoris, Saccharomyces cerevisiae and S. pombe, include, but are not limited to, the ADH1 promoter, the GAL1 promoter, the GAL4 promoter, the CLIP1 promoter, the PHO5 promoter, the nmt promoter, the RPR1 promoter, or the TEFI promoter.
[0171] Means for introducing the isolated nucleic acid or expression construct comprising same into a cell for expression are known to those skilled in the art. The technique used for a given cell depends on the known successful techniques. Means for introducing recombinant DNA into cells include microinjection, transfection mediated by DEAE-dextran, transfection mediated by liposomes such as by using lipofectamine (Gibco, MD, USA) and / or cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agracetus Inc., Wl, USA) amongst others.1006294735
[0172] The host cells used to produce the protein may be cultured in a variety of media, depending on the cell type used. Commercially available media such as Ham's FIO (Sigma), Minimal Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma) are suitable for culturing mammalian cells. Media for culturing other cell types discussed herein are known in the art.Isolation of Proteins
[0173] Methods for isolating a protein are known in the art and / or described herein.
[0174] Where an antigen binding protein is secreted into culture medium, supernatants from such expression systems can be first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis and antibiotics may be included to prevent the growth of adventitious contaminants. Alternatively, or additionally, supernatants can be filtered and / or separated from cells expressing the protein, e.g., using continuous centrifugation.
[0175] The antigen binding protein prepared from the cells can be purified using, for example, ion exchange, hydroxyapatite chromatography, hydrophobic interaction chromatography, gel electrophoresis, dialysis, affinity chromatography (e.g., protein A affinity chromatography or protein G chromatography), or any combination of the foregoing. These methods are known in the art and described, for example in WO99 / 57134 or Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988).
[0176] The skilled artisan will also be aware that a protein can be modified to include a tag to facilitate purification or detection, e.g., a poly-histidine tag, e.g., a hexa-histidine tag, or an influenza virus hemagglutinin (HA) tag, or a Simian Virus 5 (V5) tag, or a FLAG tag, or a glutathione S-transferase (GST) tag. The resulting protein is then purified using methods known in the art, such as, affinity purification. For example, a protein comprising a hexa-his tag is purified by contacting a sample comprising the protein with nickelnitrilotriacetic acid (Ni-NTA) that specifically binds a hexa-his tag immobilised on a solid or semi-solid support, washing the sample to remove unbound protein, and subsequently1006294735eluting the bound protein. Alternatively, or in addition a ligand or antibody that binds to a tag is used in an affinity purification method.Assaying binding of antigen binding proteins
[0177] It will be apparent to the skilled artisan that antigen binding protein of the present invention bind to GD2. Methods for assessing binding to a protein are known in the art, e.g., as described in Scopes (In: Protein purification: principles and practice, Third Edition, Springer Verlag, 1994). Such a method generally involves immobilising the antigen binding protein and contacting it with labelled antigen (GD2). Following washing to remove non-specific bound protein, the amount of label and, as a consequence, bound antigen is detected. Of course, the antigen binding protein can be labelled and the antigen immobilised. Panning-type assays can also be used. Alternatively, or additionally, surface plasmon resonance assays can be used.
[0178] Optionally, the dissociation constant (Kd), association constant (Ka) and / or affinity constant (KD) of an immobilised antigen binding protein for binding to GD2 or an epitope thereof is determined. The "Kd" or "Ka" or “KD” for a GD2 binding protein is in one example measured by a radiolabelled or fluorescently-labelled GD2 ligand binding assay. In the case of a “Kd”, this assay equilibrates the antigen binding protein with a minimal concentration of labelled GD2 or epitope thereof in the presence of a titration series of unlabelled GD2. Following washing to remove unbound GD2 or epitope thereof, the amount of label is determined, which is indicative of the Kd of the protein.
[0179] According to another example the Kd, Ka or KD is measured by using surface plasmon resonance assays, e.g., using BIAcore surface plasmon resonance (BIAcore, Inc., Piscataway, NJ) with immobilised GD2 or a region thereof or immobilised antigen binding protein.
[0180] In some embodiments, the function of GD2 may be decreased by at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 99% upon binding by an antigen-binding protein of the present invention.1006294735Conditions to be treated
[0181] The cancers which may be treated according to the methods of the present invention preferably express GD2 antigen.
[0182] In particularly preferred embodiments, the methods of the present invention are for the treatment of osteosarcoma.
[0183] Osteosarcomas are malignant osseous neoplasms and are typically aggressive.
[0184] Osteosarcomas arise from primitive transformed cells of mesenchymal origin (and thus a sarcoma) and that exhibits osteoblastic differentiation and produces malignant osteoid.
[0185] Osteosarcoma is the most common histological form of primary bone sarcoma. It is most prevalent in teenagers and young adult.
[0186] The skilled person will be familiar with standard methods for identifying subjects with osteosarcoma and therefore requiring treatment according to the methods of the present invention. Typically, osteosarcomas are diagnosed by X-rays. Some characteristics of osteosarcoma on X-rays are sunburst appearance and Codman triangle (elevation of bony cortex by the tumour that caused new bone formation). CT scan is helpful in defining the bony anatomy, the integrity of the bony cortex, detecting pathologic fracture, and assessing ossification (laying of new bone materials) and calcification of the cartilage. On the other hand, soft tissue and medullary cavity is better imaged by MRI scan.
[0187] Often, early signs of osteosarcoma are caught on X-rays taken during routine dental check-ups. Osteosarcoma frequently develops in the mandible (lower jaw). Even though radiographic findings for this cancer vary greatly, one usually sees a symmetrical widening of the periodontal ligament space. A dentist who has reason to suspect osteosarcoma or another underlying disorder would then refer the patient to an Oral & Maxillofacial surgeon for biopsy. A biopsy of suspected osteosarcoma outside of the facial region is typically performed by a qualified orthopedic oncologist.1006294735Conjugation of cytotoxins to antigen binding proteins
[0188] The skilled person will be familiar with various techniques for conjugating cytotoxins to antigen binding proteins. Exemplary methods for antibody-drug conjugation are described in Ducry and Stump (2010) Bioconjug Chem, 21 (1):5-13, Mckertish and Kayser (2023) Pharmaceutics, 15:1-17, and Mckertish and Kayser (2023) Discovery Medicine, 35(178):697-714, incorporated herein by reference.
[0189] In certain embodiments, conjugation may be via surface lysines on the antigen binding protein, using standard procedures known to the skilled person.
[0190] Various linkers for conjugating cytotoxins to antibodies are described elsewhere herein.Cytotoxic agents
[0191] In any embodiment or aspect of the invention, the conjugate of the invention, or the conjugate that is used in a method of treatment described herein, is an antigen binding protein conjugated to any cytotoxic agent suitable for generating cytolysis upon binding of the antigen binding protein conjugate to its target. In certain embodiments, the cytotoxic agent is in the form of a radionuclide.
[0192] The cytotoxic agent may be any suitable chemotherapeutic molecule capable of being linked to an antigen binding protein.
[0193] The term "cytotoxic agent" as used herein refers to a substance that directly or indirectly inhibits or prevents the function of cells and / or causes destruction of the cells. The term "cytotoxic agent" includes e.g. chemotherapeutic agents, enzymes, antibiotics, toxins such as small molecule toxins or enzymatically active toxins, toxoids, vincas, taxanes, maytansinoids or maytansinoid analogs, tomaymycin or pyrrolobenzodiazepine derivatives, cryptophycin derivatives, leptomycin derivatives, auristatin or dolastatin analogs, prodrugs, topoisomerase I inhibitors, topoisomerase II inhibitors, DNA alkylating agents, anti-tubulin agents, CC-1065 and CC-1065 analogs.
[0194] Topoisomerase I inhibitors are molecules or compounds that inhibit the human enzyme topoisomerase I which is involved in altering the topology of DNA by catalyzing the transient breaking and rejoining of a single strand of DNA. Topoisomerase I1006294735inhibitors are highly toxic to dividing cells e.g. of a mammal. Examples of suitable topoisomerase I inhibitors include camptothecin (CPT) and analogs thereof such as topotecan, irinotecan, silatecan, cositecan, Exatecan, lurtotecan, gimatecan, belotecan and rubitecan.
[0195] In some embodiments, the conjugates of the invention comprise the cytotoxic drug Exatecan as the growth inhibitory agent. Exatecan has the IIIPAC chemical name:
[0078] (1S,9S)-1-Amino-9-ethyl-5-fluoro-9-hydroxy-4-methyl-1 ,2,3,9, 12, 15-hexahydro- 10H,13H-benzo[de]pyrano[3',4':6,7]indolizino[1 ,2-b]q ui nol ine- 10, 13-dione.
[0196] Exatecan is a modified derivative of camptothecin, with an additional alicyclic ring fused to rings A and B that bears a solubilizing primary amine (equivalent to a 7- CH2NH2 substituent on camptothecin). There are also lipophilic substituents at positions 10 and 1 1 on ring A that enhance membrane permeability.
[0197] In further embodiments of the invention, other CPT analogs and other cytotoxic drugs may be used, e.g. as listed above. Examples of some cytotoxic agents and of methods of conjugation are further given in the application W02008 / 010101 which is incorporated by reference.
[0198] In certain embodiments, the cytotoxic agent is selected from: cytotoxic agents such as microtubule inhibitors including auristatins (eg, MMAE and MMAF) and maytansinoids (eg, DM1 and DM4), DNA-damaging agents including calicheamicins and pyrrolobenzodiazepines (PBDs), and topoisomerase I inhibitors including camptothecin derivatives (eg, SN-38).
[0199] In a preferred embodiment, the cytotoxic agent is the cytotoxin emtansine (DM1).
[0200] Accordingly, in a preferred embodiment, the present invention provides a conjugate, or the use thereof, the conjugate comprising an antigen binding protein for binding to GD2 antigen, the protein conjugated to DM1 via an SMCC linker, wherein the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 14, and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 27.1006294735
[0201] Accordingly, in a preferred embodiment, the present invention provides a conjugate, or the use thereof, the conjugate comprising an antigen binding protein for binding to GD2 antigen, the protein conjugated to DM1 via an SMCC linker, wherein the antigen binding protein comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 41, and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 54.
[0202] A conjugate of the present invention, may be covalently linked via a linker to the at least one cytotoxic agent. "Linker", as used herein, means a chemical moiety comprising a covalent bond and / or any chain of atoms that covalently attaches the growth inhibitory agent to the antibody. Linkers are well known in the art and include e.g. disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups. Conjugation of an antibody of the invention with cytotoxic drugs or other growth inhibitory agents may be performed e.g. using a variety of bifunctional protein coupling agents including but not limited to N-succinimidyl pyridyldithiobutyrate (SPDB), butanoic acid 4-[(5-nitro-2-pyridinyl)dithio]-2,5-dioxo-1 - pyrrolidinyl ester (nitro-SPDB), 4-(Pyridin-2-yldisulfanyl)-2-sulfo-butyric acid (sulfo- SPDB), N-succinimidyl (2-pyridyldithio) propionate (SPDP), succinimidyl (N- maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl)-hexanediamine), bis-diazonium derivatives (such as bis- (p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6- diisocyanate), and bis-active fluorine compounds (such as 1 ,5-difluoro-2,4- dinitrobenzene). For example, a ricin immunotoxin can be prepared as described in Vitetta et al (1987). Carbon labeled 1-isothiocyanatobenzyl methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to an antibody (WO 94 / 11026).
[0203] In embodiments of the present invention, the linker may be a "cleavable linker", which may facilitate release of the cytotoxic drug or other growth inhibitory agent inside of or in the vicinity of a cell, e.g. a tumor cell. In some embodiments, the linker is a linker cleavable in an endosome of a mammalian cell. For example, an acid-labile linker, a1006294735peptidase-sensitive linker, an esterase labile linker, a photolabile linker or a disulfide- containing linker (see e.g. U.S. Patent No. 5,208,020) may be used.
[0204] In some specific embodiments of the present invention, the linker is a linker cleavable by the human enzyme glucuronidase.
[0205] In other embodiments of the present invention, the linker may be a "non- cleavable linker" (for example an SMCC linker). Release of the growth inhibitory agent from the antibody can occur upon lysosomal degradation of the antibody.
[0206] In other embodiments of the invention, the immunoconjugate may be a fusion protein comprising an antibody of the invention and a cytotoxic or growth inhibitory polypeptide (as the growth inhibitory agent); such fusion proteins may be made by recombinant techniques or by peptide synthesis, i.e. methods well known in the art. A molecule of encoding DNA may comprise respective regions encoding the two portions of the conjugate (antibody and cytotoxic or growth inhibitory polypeptide, respectively) either adjacent to one another or separated by a region encoding a linker peptide.Compositions
[0207] In some examples, an antigen binding protein as described herein can be administered orally, parenterally, by inhalation spray, adsorption, absorption, topically, rectally, nasally, bucally, vaginally, intraventricularly, via an implanted reservoir in dosage formulations containing conventional non-toxic pharmaceutically acceptable carriers, or by any other convenient dosage form. The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, and intracranial injection or infusion techniques.
[0208] Methods for preparing an antigen binding protein into a suitable form for administration to a subject (e.g. a pharmaceutical composition) are known in the art and include, for example, methods as described in Remington's Pharmaceutical Sciences (18th ed., Mack Publishing Co., Easton, Pa., 1990) and U.S. Pharmacopeia: National Formulary (Mack Publishing Company, Easton, Pa., 1984).
[0209] The pharmaceutical compositions of this invention are particularly useful for parenteral administration, such as intravenous administration or administration into a1006294735body cavity or lumen of an organ or joint. The compositions for administration will commonly comprise a solution of an antigen binding protein dissolved in a pharmaceutically acceptable carrier, for example an aqueous carrier. A variety of aqueous carriers can be used, e.g., buffered saline and the like. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of an antigen binding protein of the present invention in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the patient's needs. Exemplary carriers include water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles such as mixed oils and ethyl oleate may also be used. Liposomes may also be used as carriers. The vehicles may contain minor amounts of additives that enhance isotonicity and chemical stability, e.g., buffers and preservatives.
[0210] The antigen binding proteins of the present invention may be formulated for local or topical administration, such as for topical application to the skin or tissue requiring treatment. Formulations for topical administration typically comprise a topical vehicle combined with active agent(s), with or without additional optional components. The pharmaceutical compositions of the invention may be in the form of a spray, cream, gel, lotion or the like for topical administration.
[0211] Suitable topical vehicles and additional components are well known in the art, and it will be apparent that the choice of a vehicle will depend on the particular physical form and mode of delivery. Topical vehicles include organic solvents such as alcohols (for example, ethanol, iso-propyl alcohol or glycerine), glycols such as butylene, isoprene or propylene glycol, aliphatic alcohols such as lanolin, mixtures of water and organic solvents and mixtures of organic solvents such as alcohol and glycerine, lipid-based materials such as fatty acids, acylglycerols including oils such as mineral oil, and fats of natural or synthetic origin, phosphoglycerides, sphingolipids and waxes, protein-based materials such as collagen and gelatine, silicone-based materials (both nonvolatile and volatile), and hydrocarbon-based materials such as microsponges and polymer matrices.1006294735
[0212] A composition may further include one or more components adapted to improve the stability or effectiveness of the applied formulation, such as stabilising agents, suspending agents, emulsifying agents, viscosity adjusters, gelling agents, preservatives, antioxidants, skin penetration enhancers, moisturisers and sustained release materials. Examples of such components are described in Martindale - The Extra Pharmacopoeia (Pharmaceutical Press, London 1993) and Martin (ed.), Remington's Pharmaceutical Sciences. Formulations may comprise microcapsules, such as hydroxymethylcellulose or gelatine-microcapsules, liposomes, albumin microspheres, microemulsions, nanoparticles or nanocapsules.
[0213] A topical formulation may be prepared in a variety of physical forms including, for example, solids, pastes, creams, foams, lotions, gels, powders, aqueous liquids, emulsions, sprays and skin patches. The physical appearance and viscosity of such forms can be governed by the presence and amount of emulsifier(s) and viscosity adjuster(s) present in the formulation. Solids are generally firm and non-pourable and commonly are formulated as bars or sticks, or in particulate form. Solids can be opaque or transparent, and optionally can contain solvents, emulsifiers, moisturisers, emollients, fragrances, dyes / colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Creams and lotions are often similar to one another, differing mainly in their viscosity. Both lotions and creams may be opaque, translucent or clear and often contain emulsifiers, solvents, and viscosity adjusting agents, as well as moisturisers, emollients, fragrances, dyes / colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product.
[0214] Gels can be prepared with a range of viscosities, from thick or high viscosity to thin or low viscosity. These formulations, like those of lotions and creams, may also contain solvents, emulsifiers, moisturisers, emollients, fragrances, dyes / colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Liquids are thinner than creams, lotions, or gels, and often do not contain emulsifiers. Liquid topical products often contain solvents, emulsifiers, moisturisers, emollients, fragrances, dyes / colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product.
[0215] Emulsifiers for use in topical formulations include, but are not limited to, ionic emulsifiers, cetearyl alcohol, non-ionic emulsifiers like polyoxyethylene oleyl ether, PEG-100629473540 stearate, ceteareth-12, ceteareth-20, ceteareth-30, ceteareth alcohol, PEG- 100 stearate and glyceryl stearate. Suitable viscosity adjusting agents include, but are not limited to, protective colloids or nonionic gums such as hydroxyethylcellulose, xanthan gum, magnesium aluminium silicate, silica, microcrystalline wax, beeswax, paraffin, and cetyl palmitate. A gel composition may be formed by the addition of a gelling agent such as chitosan, methyl cellulose, ethyl cellulose, polyvinyl alcohol, polyquaterniums, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, carbomer or ammoniated glycyrrhizinate. Suitable surfactants include, but are not limited to, nonionic, amphoteric, ionic and anionic surfactants. For example, one or more of dimethicone copolyol, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, lauramide DEA, cocamide DEA, and cocamide MEA, oleyl betaine, cocamidopropyl phosphatidyl PG-dimonium chloride, and ammonium laureth sulfate may be used within topical formulations.
[0216] Preservatives include, but are not limited to, antimicrobials such as methylparaben, propylparaben, sorbic acid, benzoic acid, and formaldehyde, as well as physical stabilisers and antioxidants such as vitamin E, sodium ascorbate / ascorbic acid and propyl gallate. Suitable moisturisers include, but are not limited to, lactic acid and other hydroxy acids and their salts, glycerine, propylene glycol, and butylene glycol. Suitable emollients include lanolin alcohol, lanolin, lanolin derivatives, cholesterol, petrolatum, isostearyl neopentanoate and mineral oils. Suitable fragrances and colours include, but are not limited to, FD&C Red No. 40 and FD&C Yellow No. 5. Other suitable additional ingredients that may be included in a topical formulation include, but are not limited to, abrasives, absorbents, anticaking agents, antifoaming agents, antistatic agents, astringents (such as witch hazel), alcohol and herbal extracts such as chamomile extract, binders / excipients, buffering agents, chelating agents, film forming agents, conditioning agents, propellants, opacifying agents, pH adjusters and protectants.
[0217] Typical modes of delivery for topical compositions include application using the fingers, application using a physical applicator such as a cloth, tissue, swab, stick or brush, spraying including mist, aerosol or foam spraying, dropper application, sprinkling, soaking, and rinsing. Controlled release vehicles can also be used, and compositions may be formulated for transdermal administration (for example, as a transdermal patch).1006294735
[0218] Upon formulation, an antigen binding protein of the present invention will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically / prophylactically effective. Formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but other pharmaceutically acceptable forms are also contemplated, e.g., tablets, pills, capsules or other solids for oral administration, suppositories, pessaries, nasal solutions or sprays, aerosols, inhalants, liposomal forms and the like. Pharmaceutical "slow release" capsules or compositions may also be used. Slow release formulations are generally designed to give a constant drug level over an extended period and may be used to deliver an antigen binding protein of the present invention.
[0219] W02002 / 080967 describes compositions and methods for administering aerosolized compositions comprising antibodies for the treatment of, e.g., asthma, which are also suitable for administration of an antigen binding protein of the present invention.Dosage and timing of administration
[0220] Suitable dosages of an antigen binding protein of the present invention will vary depending on the specific an antigen binding protein, the condition to be treated and / or the subject being treated. It is within the ability of a skilled physician to determine a suitable dosage, e.g., by commencing with a sub-optimal dosage and incrementally modifying the dosage to determine an optimal or useful dosage. Alternatively, to determine an appropriate dosage for treatment / prophylaxis, data from the cell culture assays or animal studies are used, wherein a suitable dose is within a range of circulating concentrations that include the EDso of the active compound with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. A therapeutical ly / prophylactically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the ICso (i.e., the concentration or amount of the compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma maybe measured, for example, by high performance liquid chromatography.1006294735
[0221] In some examples, a method of the present invention comprises administering a prophylactically or therapeutically effective amount of a protein described herein.
[0222] The term “therapeutically effective amount” is the quantity which, when administered to a subject in need of treatment, improves the prognosis and / or state of the subject and / or that reduces or inhibits one or more symptoms of a clinical condition described herein to a level that is below that observed and accepted as clinically diagnostic or clinically characteristic of that condition. The amount to be administered to a subject will depend on the particular characteristics of the condition to be treated, the type and stage of condition being treated, the mode of administration, and the characteristics of the subject, such as general health, other diseases, age, sex, genotype, and body weight. A person skilled in the art will be able to determine appropriate dosages depending on these and other factors. Accordingly, this term is not to be construed to limit the present invention to a specific quantity, e.g., weight or amount of protein(s), rather the present invention encompasses any amount of the antigen binding protein(s) sufficient to achieve the stated result in a subject.
[0223] As used herein, the term “prophylactically effective amount” shall be taken to mean a sufficient quantity of a protein to prevent or inhibit or delay the onset of one or more detectable symptoms of a clinical condition. The skilled artisan will be aware that such an amount will vary depending on, for example, the specific antigen binding protein(s) administered and / or the particular subject and / or the type or severity or level of condition and / or predisposition (genetic or otherwise) to the condition. Accordingly, this term is not to be construed to limit the present invention to a specific quantity, e.g., weight or amount of antigen binding protein(s), rather the present invention encompasses any amount of the antigen binding protein(s) sufficient to achieve the stated result in a subject.Kits
[0224] The present invention additionally comprises a kit comprising one or more of the following:(i) an antigen binding protein of the invention or expression construct(s) encoding same; or(ii) a pharmaceutical composition of the invention.1006294735
[0225] In the case of a kit for therapeutic use, the kit can additionally comprise a pharmaceutically acceptable carrier.
[0226] Optionally a kit of the invention is packaged with instructions for use in a method described herein according to any example.
[0227] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.ExamplesExample 1 - materials and methodsCell culture
[0228] LI2OS cells were obtained from the American Type Culture Collection (ATCC), and the 143B cells were gifted by a collaborator. LI2OS cells and 143B cells were cultured in Corning ultra-low attachment U-flasks with vent caps canted neck T75 cm2cell culture flasks. LI2OS cells were grown in McCoy’s 5A medium, and 143B cells were cultured in DMEM with high glucose, both supplemented with 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) penicillin / streptomycin (100 U / rnL). All cultures were incubated in a humidified atmosphere at 37°C with 5% CO2.Anti-GD2 antibody-drug conjugate (ADC) synthesis and characterisation
[0229] Naxitamab was buffer exchanged with PBS (0.01 M, 30mM sodium bicarbonate at pH 8) to obtain a final concentration of 3 mg / mL. SMCC-DM1 was dissolved in DMSO to a concentration of 1mM. This solution was added into Naxitamab at a ratio of 8:1 (SMCC-DM1 : Naxitamab) and allowed to react for 4 hours at 4°C. Unreacted SMCC- DM1 was removed using 50kDa cut-off filters and the final product was stored in PBS at pH 7.4. Fourier Transform infrared spectroscopy (FTIR) was performed to confirm the successful synthesis of ADC by observing the functional groups.1006294735Drug-antibody-ratio (PAR) and UV-Vis spectroscopy
[0230] UV-Vis absorbance spectra were measured over a wavelength range of 200- 400 nm using a UV-Vis spectrophotometer. The data were normalised and plotted. Concentrations and DAR were determined and calculated using the Beer-Lambert law.In vitro cell cytotoxic assay
[0231] U2OS and 143B cells were seeded at 5*10A3 cells per well in 96-well plates and incubated at 37°C for 24 hours in McCoy’s 5A / DMEM media with 10% FBS, respectively. Fresh McCoy’s 5A / DMEM media containing 1% penicillin / streptomycin, along with free DM1 , ADC, or Naxitamab at the appropriate concentrations, were then added to the wells in triplicates. McCoy’s 5A / DMEM media alone was used for negative control samples. Cell cytotoxicity was assessed at 72 hours using a cell counting kit-8 (CCK-8) assay, measured with a microplate reader at a wavelength of 450 nm, following the manufacturer’s instructions. The half-maximal inhibitory concentration (IC50) was determinedIn vitro cell apoptosis detection
[0232] Cells at a density of 100,000 per well were treated with ADC or ADC combined with tazemetostat (TA) in 6-well plates. McCoy’s 5A / DMEM media with 10% FBS was used for negative control samples. After 12 hours, the cells were harvested and stained with Annexin V-FITC. Cell apoptosis was then detected by flow cytometry.Real-time quantitative polymerase chain reaction (RT-qPCR)
[0233] Real-time quantitative polymerase chain reaction (RT-qPCR) was conducted to assess the expression of apoptosis-related genes, including P53, Bad, Bax, Bcl-2, and Caspase-3. After 12 hours of co-culturing with ADC, ADC combined with tazemetostat, or tazemetostat alone, total RNA was extracted from the cells from which cDNA was synthesised. Amplification of target genes was performed with the SYBR Green RT- PCR kit using appropriate RT-qPCR primers and a real-time PCR machine. All procedures were carried out according to the manufacturer’s instructions. Each experiment was repeated three times.1006294735In vitro GD2 expression analysis
[0234] Cell lines were trypsinised into suspension and washed twice with PBS + 2% FBS before staining with PE anti-human Ganglioside GD2. GD2 expression was then detected by flow cytometry.Western blot
[0235] U2OS and 143B cells were treated with tazemetostat for 28 days. Subsequently, the cells were lysed. Proteins in the lysate were separated using SDS- PAGE Gel and transferred onto a polyvinylidene difluoride (PVDF) membrane, followed by staining with anti-EZH2, anti-H3K27me3, and anti- -actin antibodies. The membranes were then incubated with appropriate secondary antibodies. Band signals were detected using a chemiluminescence imaging system. The intensity of the protein bands was measured and analysed.Cell-derived xenograft tumour model experiments
[0236] Following anaesthesia, 1 X 10A6 143B cells suspended in 50 pL PBS were orthotopically injected into the proximal tibial region of BALB / c nude mice (female, 4 weeks old, 20g). The ADC / Naxitamab was given every three days at 5mg / kg or 10mg / kg via intraperitoneal injection, respectively, and tazemetostat was administrated via oral gavage at 500mg / kg twice daily. Tumour volume was monitored every three to four days using callipers and calculated using the formula: volume = 1 x length x widthA2. For in vivo imaging, 143B-luc cells, which stably express luciferase, were used. The luciferase substrate D-Luciferin was administered intraperitoneally prior to imaging at week four.’Immunohistochemistry (IHC) staining
[0237] Tumour samples were fixed in 4% polyoxymethylene for a minimum of 48 hours. After fixation, samples underwent gradient ethanol dehydration, were embedded in paraffin, and sectioned into 4-pm-thick slices. IHC staining was conducted to localise the expression of target GD2, using a Ganglioside GD2 antibody. Detection was performed with the GTVision™ III Detection System / Mo&Rb kit (GENE, GK500710), adhering to the manufacturer’s instructions.1006294735Haematoxylin and eosin (H.E) staining
[0238] Osteosarcoma tumour tissues were processed as follows: paraffin-embedded sections were deparaffinised and rehydrated through a graded series of ethanol concentrations (100%, 90%, 75%) before rinsing in tap water. Frozen sections were equilibrated to room temperature and fixed if needed before rinsing. Sections were stained with hematoxylin and differentiated in hematoxylin differentiation solution. Bluing was performed using hematoxylin bluing solution, followed by eosin staining.IHC staining semi-quantitation
[0239] Immunohistochemistry staining was semi-quantitatively evaluated based on the staining index (SI) method, with positive cell proportion (PP) divided into five groups: no positive cells recorded as 0 points; <10% positive cells recorded as 1 point; 10-35% positive cells recorded as 2 points; 35-75% positive cells recorded as 3 points; >75% positive cells recorded as 4 points. The staining intensity (SI) was also divided into four groups: no staining recorded as 1 point; weak staining recorded as 2 points; moderate staining recorded as 3 points; strong staining recorded as 4 points.Survival analysis
[0240] Data were sourced from the Therapeutically Applicable Research to Generate Effective Treatments (TARGET) database. The transcriptome and corresponding clinical data for osteosarcoma were downloaded. Expression levels of the target gene were extracted and merged with survival data and survival status information. Survival analysis was conducted using R software version 4.1.3, utilising the “survival” and “survminer” packages to perform Kaplan-Meier (KM) survival analysis and plot the KM curves.Statistical analysis
[0241] All data were summarised and presented as mean ± standard deviation (SD). Multiple comparisons were analysed using one-way ANOVA followed by Tukey’s post- hoc test. The significance levels were established at *p < 0.05, **p < 0.01, and ***p < 0.001, representing progressively increasing levels of statistical significance.1006294735Example 2 - spectroscopic validation of anti-GD2 Naxitamab-DM1 conjugation and determination of drug-antibody-ratios (DAR)
[0242] The ADC consisted of Naxitamab conjugated to DM1 via SMCC linker. A Fourier transform infrared spectroscopy (FTIR) test was performed to confirm the conjugation. The FTIR spectrum revealed absorption peaks at 3457 and 3310 cm1, attributed to the stretching vibrations of N-H and O-H, respectively. The peak at 2960 cm1corresponded to the stretching vibration of C-H, and the peak at 1634 cm1(amide I band) was due to the stretching vibration of C=O. Compared to the absorption peak of Naxitamab, the intensity was significantly reduced, indicating that the linker drug complex was successfully conjugated to the surface lysine groups of Naxitamab (Figure 1A). Subsequently, ultraviolet-visible spectroscopy (UV-Vis) further confirmed the conjugation (Figure 1B), with the two absorbance peaks at around 280 nm indicating the presence of the ADC and Naxitamab, and a peak at around 260 nm denoting DM1.UV-Vis was also employed to analyse DAR. The absorbance spectrum of DM1 contributed to the overall absorbance of ADC, enabling the determination of the DAR using the Beer-Lambert law and the applied formula: DAR = ( e Ab260 - H E Ab280) / (H E D280 - E D260). Following conjugation with DM1 , DAR was calculated to be 3.7, based on the absorption and extinction coefficients of both Naxitamab and the linkerdrug complex (Table 7). These data not only demonstrated the successful conjugation of this ADC, but also illustrated its distinctive characteristics.Table 7. Structural representation of the ADC with the confirmed DAR valueExample 3 - anti-GD2 ADC exhibits significant anti-osteosarcoma effect in vitro
[0243] To evaluate the cytotoxic effect of our ADC, a Cell Counting Kit-8 (CCK-8) assay was performed. The assay included three groups: ADC, Naxitamab, and free DM1 , tested on both U2OS and 143B cell lines. The half-maximal inhibitory1006294735concentration (IC50) for each group was calculated to compare the IC50 values between the groups (Figure 2A-C, l-K). The in vitro cytotoxic activity of free DM1 was higher in both cell lines compared to ADC and Naxitamab, with subnanomolar IC50 values for both cell lines. LI2OS displayed slightly higher sensitivity to ADC (IC50 = 13.5nM) than 143B cells (IC50 = 37.38nM). The IC50 for Naxitamab in LI2OS cells was 4244nM. This mAb also showed a dramatically decreased potency in 143B relative to DM1-containing formats; hence, the IC50 value was not determined for this cell line due to the high concentration of mAb required to obtain an appropriate dose-response curve.
[0244] To determine the apoptosis induction function of ADC, flow cytometry analysis was employed. After 12 hours of co-cultures with anti-GD2 ADC, both LI2OS or 143B cell lines demonstrated significant increases in apoptosis compared to the control groups. In LI2OS cells, the data showed that late apoptosis was induced more frequently than early apoptosis (Figure 2D-G). In contrast, 143B cells exhibited a higher occurrence of early apoptosis (Figure 2I-K).
[0245] Subsequently, a polymerase chain reaction (PCR) test was performed to assess the status of apoptosis-related genes, including P53, Bad, Bax, Bcl-2, and Caspase-3, within 12 hours of ADC treatment. The results indicated that ADC activated the mitochondrial apoptotic pathway in both cell lines. In LI2OS cells, the apoptosis gene Bax was elevated, while in 143B cells, the gene Bad was increased (Figure 2H, P). These data suggest that the ADC induces the mitochondrial apoptosis in osteosarcoma cell lines.Example 4 - EZH2 inhibitor tazemetostat (TA) upregulates the GD2 expression in U2OS and 143B cells
[0246] The inventors used tazemetostat, an FDA-approved EZH2 inhibitor, to treat LI2OS and 143B cell lines, aiming to decrease H2K27me3 levels and subsequently upregulate GD2 expression. Tazemetostat concentration was set at 10pM over incubation period of 28 days. Histone trimethylation was evaluated via western blot analysis targeting EZH2 and H3K27me3. GD2 expression levels were measured using flow cytometry.1006294735
[0247] I western blot results showed that the levels of EZH2 and H3K27me3 proteins were nearly undetectable in both cell lines (Figure 3A-D). Obvious changes were observed compared to each control group. Additionally, the GD2 expression was significantly increased in both cell lines (Figure 3E-H). These findings proved that EZH2 inhibition can also upregulate GD2 in osteosarcoma cell lines.Example 5 - GD2 upregulation sensitises U2OS and 143B cells to anti-GD2 ADC, enhancing apoptosis in vitro
[0248] To determine whether upregulation of GD2 enhances sensitivity to anti-GD2 ADC in LI2OS and 143B cells, flow cytometry and qPCR assays for apoptosis-related genes were conducted.
[0249] In the flow cytometry test, two groups, one with the anti-GD2 ADC treatment and another as a negative control group were established, and the apoptosis levels between these two groups were compared. Afterwards, cells were incubated for 28 days with tazemetostat, and then they were co-cultured with anti-GD2 ADC for 12 hours. In the LI2OS cells, both early and late apoptosis rates were significantly higher in the treated group compared to that of the negative control (Figure 4A-D). A similar trend was observed with the 143B cells, where the apoptosis was significantly higher in the treated group, particularly late apoptosis, compared to the control group (Figure 4F-I).
[0250] In the PCR analysis, three groups were included: the anti-GD2 ADC with tazemetostat group, the tazemetostat group, and the negative control group. In the U2OS cell line, the results indicated that the apoptotic genes, P53, Bax, Bcl-2, and Caspase-3, were upregulated following the induction of ADC (Figure 4E). The data from tazemetostat group revealed a slight increase in P53 and Bax levels compared to the anti-GD2 ADC with tazemetostat group. For the 143B cells, the P53, Bax, and Bad were significantly upregulated in the anti-GD2 ADC with tazemetostat group, whereas only slight increase was observed in the tazemetostat alone group (Figure 4J). Additionally, the Caspase-3 levels were also modestly elevated in the anti-GD2 ADC with tazemetostat group. These findings suggest that tazemetostat may enhance the sensitivity of osteosarcoma cells to anti-GD2 ADC.1006294735Example 6 - antitumour activity of anti-GD2 ADC in vivo
[0251] To assess the anti-tumour effect of anti-GD2 ADC in vivo, mice bearing 143B xenografts were used. Eight mice were randomly assigned one week post-model establishment (injection) to receive either anti-GD2 ADC or a negative control (saline), with four in each group. The anti-GD2 ADC or saline was administrated via abdominal injection twice or thrice weekly. Tumour volumes and mouse body weight were measured and recorded biweekly. The therapy lasted three weeks, and mice were euthanised due to high tumour burden (length or width >2.5cm) within this period.
[0252] From the fifth day of treatment initiation, the tumour volume in the negative control group was consistently higher than that in the anti-GD2 ADC group (Figure 5A). Ultimately, the tumour volume in the negative control was approximately 6.75 times larger than that in the anti-GD2 ADC group (Figure 5A-C).
[0253] Metastatic nodules were visible on the lungs of 143B tumour-bearing mice receiving negative control treatments, whereas the lungs of mice treated with the anti-GD2 ADC did not show signs of metastasis (Figure 5D). H.E staining was performed on the mouse pulmonary slices. Three sections from the anti-GD2 ADC group showed no obvious signs of metastasis. In contrast, three sections from the negative control group exhibited classical sings of metastasis. Metastasis nodules observed in the three lungs (Figure 5E). Significant weight lost were observed in the negative control group on day 21 post-therapy initiation (Figure 5F).Example 7 - anti-tumour activity of anti-GD2 ADC with tazemetostat (TA) for early-period therapy in vivo
[0254] To mimic early-stage therapy, mice bearing 143B xenografts were treated starting from the 4thday after model establishment (injection), continuing for a three- week therapy period. The administration method followed the previous protocol. Five groups were included: anti- GD2 ADC with tazemetostat, anti-GD2 ADC, Naxitamab, tazemetostat, and a negative control, with four mice in each group. Tumour volume, body weight changes, and H.E staining for pulmonary metastasis were assessed as before. Additionally, tumour volume and pulmonary metastasis were quantified by flux values.1006294735
[0255] The results indicated that anti-GD2 ADC significantly inhibited tumour growth compared to Naxitamab, tazemetostat, and the negative control, respectively (Figure 6A-C). The flux data showed that anti-GD2 ADC with tazemetostat had the most effective anti-metastasis effect among the groups (Figure 6D). This finding was further confirmed by H.E staining (Figure 6E-F). Significant weight loss was observed in the negative control and tazemetostat groups (Figure 6G).
[0256] Furthermore, immunohistochemistry (IHC) of tumour tissue was used to evaluate whether tazemetostat could upregulate GD2 expression in vivo. The results showed significantly enhanced GD2 expression in the ADC with tazemetostat and tazemetostat groups, demonstrating that TA could upregulate GD2 expression for early treatment in vivo (Figure 6H-I).Example 8 - anti-GD2 ADC with tazemetostat (TA) for late-period therapy in vivo
[0257] To simulate a late-stage therapy, the mice were treated starting from the third week, and the same analyses were performed as in the early-stage therapy.Additionally, a tazemetostat pretreatment group was included to determine the optimal tazemetostat administration strategy (from pre-treatment to concurrent administration with anti-GD2 ADC). In this group, the mice received tazemetostat alone for one week, followed by the addition of anti-GD2 ADC to the combination therapy. The total treatment duration was three weeks. The other groups were anti-GD2 with tazemetostat, tazemetostat, Naxitamab, and negative control.
[0258] According to the tumour volumes and flux values, robust tumour growth inhibition was observed in the groups treated with anti-GD2 ADC combined with tazemetostat and in the group pretreated with tazemetostat before receiving anti-GD2 ADC (Figure 7A-C). Moderate inhibition was observed in the group treated with anti- GD2 ADC alone. In contrast, no significant growth inhibition was noted in the tazemetostat group compared to the negative control group (Figure 7A-C).
[0259] The pulmonary flux values in the groups treated with anti-GD2 ADC, anti-GD2 ADC combined with tazemetostat, and anti-GD2 ADC with tazemetostat pretreatment were lower than those in the tazemetostat and negative control groups (Figure 7D) The histopathological examination (H.E staining) showed the lowest level of metastasis in1006294735these three groups (Figure 7E-F). No significant weight loss was observed in any of the groups (Figure 7G).
[0260] Furthermore, the IHC results indicated the highest GD2 expression in the anti- GD2 ADC combined with tazemetostat, anti-GD2 ADC with tazemetostat pretreatment, and tazemetostat groups (Figure 7H-I). These findings suggest that the anti-tumour effect of anti-GD2 ADC can be enhanced with tazemetostat, even in late-stage therapy, and these two regimens can be coadministered.Discussion
[0261] The examples demonstrate that an anti-GD2 antibody-drug conjugate (ADC) therapy, especially when combined with the EZH2 inhibitor tazemetostat, was effective in treating osteosarcoma and metastasis therefrom. In particular, the examples demonstrated that tazemetostat upregulated GD2 expression in osteosarcoma cells, and this upregulation led to enhanced sensitivity to anti-GD2 ADC, as evidenced by increased apoptosis in the treated cells compared to control groups. This synergistic relationship is particularly evident in the increased expression of apoptotic genes such as P53, Bax, Bad, Bcl-2, and Caspase-3 in the combinational treatment groups. The elevated expression of these genes indicated a more robust activation of the apoptotic pathways, enhancing the overall therapeutic efficacy against osteosarcoma.Example 9 - ceramide upregulates GD2 expression in osteosarcoma cells
[0262] Ceramide is a substrate in the GD2 expression process. The effect of ceramide on GD2 expression was investigated.
[0263] In 143B and LI2OS osteosarcoma cell lines, 30-day co-incubation with C16:0 and TA were evaluated by flow cytometry for GD2 surface expression. Readouts included the percentage of GD2-positive events and the mean fluorescence intensity (MFI) distribution within the GD2-positive gate (Figure 8A-D).
[0264] Relative to pre-treatment baselines, both cell lines showed an increased GD2- positive fraction accompanied by a rightward shift in GD2 intensity profiles (Figure 8 and Table 8). Compared with TA alone, the C16:0+TA condition produced a greater proportion of events above the GD2 positivity threshold in both lines, with consistent1006294735axis scaling and labelling to allow direct, side-by-side comparison of the magnitude of change at the 30-day endpoint. Quantitatively, GD2 expression was significantly higher in the C16:0+TA groups than in the corresponding TA groups in both 143B and LI2OS.
[0265] Table 8. Mean fluorescence intensity (MFI) of LI2OS and 143B cells as shown in Figure 8B&D.Example 10 - enhancement of GD2 expression on osteosarcoma cancer cells would not result in worse clinical outcomes of osteosarcoma patients
[0266] Survival analysis was completed using the method as described in Example 1. Totally, 85 osteosarcoma cases were identified. As shown in Figure 9A, high GD2 synthase (B4GALNT1) expression correlated with a poor survival of osteosarcoma patients (Figure 9A); in contrast, the expression of GD3 synthase (ST8SIA1) did not have a significant impact on patient survival (Figure 9B). These results demonstrate that the modulation of ST8SIA1 would not worsen the outcome of osteosarcoma patients, and it would be safe to upregulate ST8SIA1 in order to enhance GD2 expression on osteosarcoma cancer cells.1006294735Example 11 - IHC staining of GD2 in human osteosarcoma samples
[0267] Human osteosarcoma samples were analysed. The average age of patients in these two groups were 12.3 and 11.6 years, respectively. The samples from the group of patients having pulmonary metastasis had higher levels of GD2 expression than the those in the non-metastasis group (Figure 10).Example 12 - staining index of GD2 expression in vivo
[0268] Immunohistochemistry staining was semi-quantitatively evaluated based on the SI method in Example 1. The total score was obtained by multiplying PP and SI, where SI >6 points indicated high expression, and SI <6 points indicated low expression.
[0269] The quantitation showed that tazemetostat upregulated GD2 expression in early-therapy stage or late-therapy stage in combination with anti-GD2 ADC(Figure 11). Furthermore, metastatic osteosarcoma samples had a significantly higher staining index as compared to the non-metastatic osteosarcoma samples (Figure 12).
[0270] These results demonstrate that GD2 is an important target for osteosarcoma treatments and for anti-metastasis treatments.Example 13 - spectroscopic validation of anti-GD2 Naxitamab-doxorubicin conjugation and determination of drug-antibody-ratios (DAR)
[0271] An ADC comprising an antigen binding domain for binding to GD2 (eg naxitamab), the linker SMCC and payload doxorubicin (“DOX”) was prepared similarly to the procedures outlined in the previous Examples.
[0272] As shown in Figure 13, the conjugation was successful. In view of the results outlined in the previous Examples, the inventors anticipate that the Naxitamab-SMCC- DOX ADC will perform similarly to Naxitamab-SMCC-DM1 (e.g., with respect to the induction of apoptosis, cytotoxicity, and in vivo anti-tumour and anti-metastatic effects).1006294735Example 14 - combination of Naxitamab-SMCC-DM1 and doxorubicin (“DOX”)Materials and methodsMaterials
[0273] Doxorubicin hydrochloride (Cat. No. HY-15142) and ethylenediaminetetraacetic acid (EDTA; Cat. No. HY-Y0682) were purchased from MedChemExpress (Monmouth Junction, NJ, USA). The fetal bovine serum (FBS; Cat. No. F8318) was purchased from Sigma (St. Louis, MO, USA). Hieff qPCR SYBR Green Master Mix (No Rox; Cat. No. 11201 ES08) was purchased from Yeasen (Shanghai, China). The 5* SDS-PAGE loading buffer (odorless, reducing; Cat. No. G2075) and antibody elution buffer (membrane regeneration, enhanced; Cat. No. G2079) were purchased from Servicebio (Wuhan, China). Lass5 (CERS5) Polyclonal Antibody (Cat. No. PA5-98731) was purchased from Thermo (Waltham, MA, USA). Ficoll-Paque PREMIUM (Cat. No. 17544602) was purchased from Cytiva (Chicago, IL, USA). The Omni Easy one-step PAGE gel rapid preparation kit (Cat. Nos. PG212 and PG211) was purchased from Epizyme Biotech (Shanghai, China). Cryopreserved human PBMCs (Cry hPBMC; Cat. No. CZPB050M) were purchased from Yayubio (Shanghai, China). 7-AAD (Cat. No. 559925) and the following flow antibodies were purchased from BD Biosciences (New Jersey, USA): PE-Cy7 Rat Anti-Mouse CD45 (30-F11 ; Cat. No. 552848), BV510 Mouse Anti-Human CD45 (HI30; Cat. No. 563204), BV650 Mouse Anti-Human CD3 (SP34-2; Cat. No. 563916), Human CD19 BV711 (HIB19; Cat. No. 740774), Human CD25 BV605 (2A3; Cat. No. 562660), BV421 Mouse Anti-Human PD-1 (CD279, EH12.1 ; Cat. No. 562516), and APC-Cy7 Mouse Anti-Human CD16 (3G8; Cat. No. 561726). The CD56 (NCAM) Monoclonal Antibody (TULY56), APC (Cat. No. 17-0566-41) was purchased from Thermo (Waltham, MA, USA). RBC lysis buffer (Cat. No. B541001) was purchased from Sangon Biotech (Shanghai, China). BSA, Fraction V (Cat. No. ST023) was purchased from Beyotime (Shanghai, China). All other materials may be obtained as outlined in the previous Examples.Cell Culture
[0274] Human osteosarcoma lines 143B and U2OS were maintained under standard conditions. For in vivo experiments, luciferase-tagged variants were used to enable1006294735longitudinal bioluminescent imaging. Culture media and supplements followed standard OS protocols as before.Ceramide quantity measurement via LS-MS
[0275] Ceramide species quantity measurement was performed on an ACQUITY UPLC™. Premier system coupled to a Xevo® TQ-Absolute triple quadrupole mass spectrometer (Waters, Milford, MA, USA). Chromatographic separation used an ACQUITY UPLC BEH C18 column (100 x 2.1 mm, 1.7 pm) at 45 °C with water (A) and acetonitrile (B), both containing 0.1% formic acid; a linear gradient from 1% to 100% B was run at 0.40 mL min-1with 1 pL injections. The TQ-Absolute operated in MRM mode (0.01 s dwell / scan) with a capillary voltage of 1 kV (positive / negative as required), source temperature 150 °C, desolvation temperature 450 °C, desolvation gas flow 900 L h-1, and cone gas flow 50 L h-1. Nitrogen was used as desolvation and cone gas, and argon served as the collision gas. Data were acquired using MassLynx™ v4.2 software. Cell pellets or tissues were extracted by a modified Bligh-Dyer procedure with internalstandard normalization, and species-resolved ceramides were quantified by MRM following short, sub-IC50doxorubicin pulses central to the study
[0030] ,In vitro GD2 expression analysis
[0276] GD2 expression was quantified by flow cytometry. Cells were detached with trypsin to generate single-cell suspensions, washed twice in PBS containing 2% FBS, and stained with a PE-conjugated anti-human GD2 (ganglioside) antibody for 15-30 min at room temperature. After staining, samples were passed through a 40-pm cell strainer and acquired immediately on a Fortessa flow cytometer. Data were analysed and graphed using FlowJo v10.1.8.Reverse Transcription Quantitative PCR (RT-qPCR) for Ceramide-Pathway Genes
[0277] RT-qPCR was conducted to assess the expression of ceramide-pathway genes CERS5, and SMPD1 in human osteosarcoma 143B and U2OS cells following brief, sub-cytotoxic DOX exposure. Cells were seeded at -60-70% confluency and exposed to a sub-IC50 DOX pulse (-10-25% of each line’s 72-h IC50) for 2-6 h, washed twice with warm PBS, returned to drug-free medium, and harvested at 0, 2, 6, and 24 h after washout; 0.1% DMSO time-matched vehicle controls were included. Total RNA was1006294735extracted using a silica-membrane spin-column kit with on-column DNase, and RNA quality was confirmed (A260 / A280 1.8-2.1 ; RIN > 7). cDNA was synthesised using a reverse-transcription kit with mixed oligo(dT) / random hexamers, and amplification was performed with a SYBR Green qPCR master mix on a real-time PCR machine (CFX Connect™ Optics Module, Bio-Rad, USA). All procedures were carried out according to the manufacturers’ instructions. Primers were designed to span exon-exon junctions:- CERS5 forward primer: GGTCACCATTGGGCTTATCTCC (SEQ ID NO: 55)- CERS5 reverse primer: GTGTCACAGAGCCGCTGATACT (SEQ ID NO: 56)- SMPD1 forward primer: CTCCCGCTGGCTCTATGAAG (SEQ ID NO: 57)- SMPD1 reverse primer: GCCAGAAGTTCTCACGGGAA (SEQ ID NO: 58).Each experiment was repeated three times.Western Blotting (WB) for ceramide enzyme
[0278] U2OS and 143B cells were treated with DOX as indicated. Subsequently, the cells were lysed on ice for 30 min in 200 pL of RIPA lysis buffer. The lysates were centrifuged at 14,000 x g at 4 °C for 15 min. Supernatants were collected, and protein concentrations were determined using a BCA protein assay kit (Beyotime, China). Proteins were separated using SDS-PAGE Gel and transferred onto a polyvinylidene difluoride (PVDF) membrane. The membranes were blocked in tris-buffered saline with Tween-20 (TBST) containing 5% BSA, followed by overnight incubation with primary antibodies against targeted enzyme and p-actin (loading control) at the recommended dilutions. The membranes were then incubated with appropriate secondary antibodies. Band signals were detected using a chemiluminescence imaging system (Tanon, China). The intensity of the protein bands was measured and analysed using Imaged 1.54g software.Orthotopic Xenograft and Treatment Regimens
[0279] BALB / c nude mice (female, 4 weeks old, 20g) were obtained from the Shanghai Jiaotong University Animal Research Centre (Shanghai, China) and housed under specific pathogen-free (SPF) conditions. Following anaesthesia, 143B-Luc cells 1006294735suspended in PBS were orthotopically injected into the proximal tibia of each mouse. Experimental arms comprised NC, DOX (weekly intraperitoneal dose), DOX+TA (tazemtostat), DOX+ADC, and DOX+TA+ADC, using the representative dose ranges provided: DOX 2.5-5 mg / kg i.p. once weekly; TA 100-150 mg / kg p.o. daily; ADC 3- 5 mg / kg i.v. 2-3x / week. Tumour burden and body weight were recorded every 3-4 days using callipers, with bioluminescent imaging (BLI) performed at the indicated timepoints. Tumour volume was calculated as % x length x width2. Mice were removed from study if they exhibited markedly reduced activity, >20% body-weight loss, severe cachexia, or if either tumour length or width exceeded 25 mm. At the study endpoint, mice were euthanized; lungs and primary tumours were harvested, fixed in formaldehyde, and embedded in paraffin. Hematoxylin and eosin (H&E) staining was performed on lung sections to assess metastasis. GD2 expression in primary tumours was analysed by immunohistochemistry (IHC) with semiquantitative scoring. For in vivo imaging, D-luciferin was administered intraperitoneally prior to BLI acquisition.Immunofluorescence
[0280] Formalin-fixed, paraffin-embedded (FFPE) tissue sections (4 pm) were deparaffinized, rehydrated, and subjected to heat-induced antigen retrieval in ethylenediaminetetraacetic acid (EDTA) buffer (pH 9.0, DTA9.0) using microwave heating, following the instructions of a tyramide signal amplification (TSA) multiplex immunofluorescence kit (Shanghai Lianlan Biotechnology). After blocking endogenous peroxidase with 3% hydrogen peroxide (H2O2) and nonspecific binding with blocking buffer, sections were incubated with anti-cleaved caspase-3 primary antibody (cat. no. 68773-1-lg, Proteintech; 1:500) at 4 °C overnight, followed by horseradish peroxidase (HRP)-conjugated secondary antibody and development with tyramide-conjugated fluorophore. Nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI)-containing mounting medium, and images were acquired using a fluorescence microscope.Apoptosis assays
[0281] Apoptotic cells were detected by terminal deoxynucleotidyl transferase deoxyuridine 5'-triphosphate (dllTP) nick-end labelling (TLINEL) using a Cyanine 3 (Cy3)-labelled TLINEL kit (LLT-100R, Shanghai Lianlanbio Biological Technology,1006294735Shanghai, China). Formalin-fixed, paraffin-embedded sections were deparaffinized, rehydrated, permeabilized with proteinase K, and incubated with TLINEL working solution (terminal deoxynucleotidyl transferase enzyme mixed 1:50 with Cy3-labeled reaction buffer) at 37 °C for about 1 h in the dark, followed by phosphate-buffered saline washes, nuclear counterstaining with DAPI, and mounting with anti-fade medium. Fluorescent images were acquired using a fluorescence microscope with appropriate filter sets for DAPI and Cy3, and TUNEL-positive apoptotic nuclei were identified as red fluorescent signals.Statistics
[0282] Data are presented as mean ± SD. Multiple comparisons used one-way ANOVA with Tukey’s post hoc test; significance thresholds were *p*<0.05, **p*<0.01, ***p*<0.001. Effect sizes and confidence intervals were calculated where appropriate.ResultsShort DOX Exposure Elevates Ceramides
[0283] LI2OS and 143B were treated with sub-IC50 DOX for 10 h, and ceramide species were quantified by LC-MS. The long-chain ceramides — C16:0, C18:0, C20:0, C22:0, and C24:0 were monitored (Figures 14A-E and 15A-E). In LI2OS, DOX selectively increased 016:0 without significant changes in 018:0-024:0. In contrast, 143B exhibited elevations in both C16:0 and C18:0, while 020:0-024:0 had no significant increase. Thus, across models, 016:0 emerges as the shared, responsive species after short DOX treatment, with an additional 018:0 component evident in 143B. Given its consistent DOX-induced upregulation across both osteosarcoma cell lines, 016:0 ceramide was selected as the principal species for subsequent experiments.DOX induces a ceramide-biosynthetic gene signature
[0284] To determine whether DOX modulates ceramide metabolism, the inventors quantified transcripts representative of de novo synthesis (CERS5) and sphingomyelin turnover (SMPD1 , acid sphingomyelinase) by RT-qPCR in osteosarcoma cell lines 143B and LI20S. Across three biological replicates, DOX exposure significantly1006294735upregulated CERS5 mRNA in both cell lines, while SMPD1 mRNA remained unchanged relative to vehicle controls (Figure 14F and 15F). Consistent with the transcriptional data, immunoblotting demonstrated a DOX-induced increase in CERS5 protein in 143B and LI2OS, and densitometric quantification (normalised to loading controls) confirmed a statistically significant elevation in CERS5 band intensity compared with vehicle- treated cells (Figure 14G-H and 15G-H).In vivo combination with DOX
[0285] To test whether the co-treatment strategy translated into improved antitumour activity in vivo, the inventors established orthotopic 143B-Luc xenografts by injecting luciferase-tagged 143B cells into the proximal tibia of female BALB / c nude mice. Once tumours were palpable, animals were randomised into five treatment arms: negative control (NC; saline), DOX alone, DOX+TA, DOX+ADC, and the triple-combination DOX+TA+ADC. As summarised in the treatment schematic (Figure 16A), DOX was administered intraperitoneally once weekly, TA was given orally once daily from day 7, and the anti-GD2-DM1 ADC was delivered intravenously every three days over the same period, using dose ranges specified in the Methods. This design allowed TA- and DOX-induced ceramide and GD2 upregulation to overlap with ADC exposure, while the NC group received volume-matched saline on an identical schedule.
[0286] Tumour burden was monitored longitudinally by calliper measurement and bioluminescent imaging, with calliper-derived volumes plotted at three time points over the four-week treatment course (Figure 16C). Across the cohort, a clear rank order of efficacy emerged: DOX+TA+ADC produced the greatest inhibition of tumour growth, followed by DOX+ADC and DOX+TA, with DOX alone conferring only modest slowing relative to NC. By the second and third measurement points, tumour volumes in the triple-combination group were significantly lower than in all other arms, whereas DOX+ADC and DOX+TA showed intermediate suppression compared with DOX alone and NC, consistent with additive or synergistic benefit from combining biochemical and / or epigenetic modulation with targeted payload delivery.
[0287] At necropsy, macroscopic inspection of excised tibial tumours mirrored these trends (Figure 16B). Tumours from NC and DOX-only mice were large, irregular, and often showed surface haemorrhage, whereas masses from the DOX+TA and1006294735DOX+ADC groups were visibly smaller. The DOX+TA+ADC group exhibited the most pronounced reduction in tumour size, with several specimens approaching minimal residual disease by gross appearance. These qualitative observations corroborate the quantitative volume data and support the conclusion that DOX and / or TA co-treatment augments the antitumour effect of anti-GD2 ADC in this orthotopic model.
[0288] Treatment tolerability was assessed primarily by serial body-weight measurements (Figure 16D). Across the four-week period, mean body weight remained relatively stable in all drug-treated groups, with only minor fluctuations and no abrupt declines indicative of acute systemic toxicity. In contrast, NC animals tended to lose weight as tumour burden advanced, consistent with disease-related cachexia. Notably, mice receiving the triple combination did not show additional weight loss compared with DOX alone, suggesting that the enhanced antitumour activity of DOX+TA+ADC was achieved without obvious exacerbation of systemic toxicity within the dose ranges tested.In vivo bioluminescence and histopathological assessment of antitumour efficacy and cardiac safety
[0289] To further characterise treatment effects on metastatic dissemination and systemic safety, the inventors performed terminal in vivo imaging and histopathological analyses (Figure 17). Whole-body bioluminescence imaging at the study endpoint revealed marked differences in luciferase signal among groups (Figure 17A). Mice in the NC and DOX monotherapy arms exhibited intense thoracic and tibial signals consistent with heavy lung and primary tumour burden, whereas signals were visibly attenuated in the DOX+TA and DOX+ADC groups. The DOX+TA+ADC combination produced the greatest suppression of bioluminescence, with several animals demonstrating only faint residual tibial signal and minimal detectable thoracic flux. Quantification of region-of-interest flux confirmed these impressions: lung bioluminescence was significantly reduced in all combination groups compared with NC and DOX alone, with the lowest values observed in the DOX+TA+ADC cohort(Figure 17B). A similar pattern was seen for primary tibial tumours, where total photon flux in the triple-combination group was significantly lower than in NC, DOX, and either dual combination (Figure 17C).1006294735
[0290] Histological examination of the lungs by H&E staining corroborated the imaging findings (Figure 17D). NC and DOX-treated mice showed numerous, often coalescent metastatic nodules occupying large areas of lung parenchyma, with effacement of normal alveolar architecture. In contrast, lungs from DOX+TA and DOX+ADC animals contained fewer and smaller tumour foci, frequently confined to perivascular or subpleural regions. In the DOX+TA+ADC group, no histologically detectable metastatic deposits were observed, and the alveolar architecture was largely preserved.
[0291] To confirm that the co-treatment strategy enhanced target antigen density in vivo, the inventors performed GD2 immunohistochemistry on sections from the primary tibial tumours (Figure 16E). NC tumours showed low to patchy GD2 membrane staining, consistent with the modest baseline GD2 expression observed in vitro. Tumours from TA-containing groups (DOX+TA and DOX+TA+ADC) displayed stronger and more homogeneous GD2 staining across viable tumour regions, indicating effective pharmacodynamic upregulation of the target antigen in vivo. In the DOX+TA+ADC cohort, intense GD2 positivity was frequently juxtaposed with areas of necrosis and regressive change, consistent with efficient engagement of GD2 by the anti-GD2-DM1 ADC.
[0292] Finally, to explore potential cardiotoxicity, cardiac sections were stained for cleaved caspase-3 and TLINEL to assess apoptosis in ventricular myocardium (Figure 17F-H). As expected, DOX-treated hearts exhibited detectable apoptotic signals compared with NC, reflecting the known propensity of anthracyclines to induce cardiomyocyte injury. Importantly, the addition of TA and anti-GD2 ADC did not visibly exacerbate this pattern: DOX+TA and DOX+TA+ADC treated hearts showed apoptotic labelling that was comparable to, or slightly less prominent than, DOX alone, with apoptotic nuclei largely confined to scattered foci rather than diffuse involvement. No widespread myocyte loss or architectural disruption was observed in any treated group at the doses used.Discussion
[0293] These results demonstrate that brief, sub-ICso exposure to DOX selectively elevates the pro-apoptotic ceramide species C16:0 in both LI2OS and 143B osteosarcoma cells, with an additional rise in C18:0 in 143B. DOX treatment was1006294735accompanied by transcriptional and protein-level upregulation of the de novo ceramide synthase CERS5, implicating the synthetic ceramide metabolism. Functionally, exogenous C16:0 cooperated with the EZH2 inhibitor TA to drive more robust and sustained GD2 surface upregulation than TA alone in both cell lines. In an orthotopic 143B-Luc model, the triple combination of DOX+TA+anti-GD2-DM1 ADC produced the greatest suppression of primary tibial tumour growth and pulmonary metastasis, the highest intratumoral GD2 staining, and no clear exacerbation of DOX-related body-weight loss or cardiac apoptosis compared with DOX alone, supporting the robust anti-tumour and anti-metastatic effects of the co-treatment strategy.
[0294] Mechanistically, the inventors consider that further to their effects on GD2 expression, C16-family ceramides could facilitate mitochondrial outer-membrane permeabilisation and cooperate with BAX / BAK to lower the apoptotic threshold. The selective increase of C16:0 across both cell lines, together with DOX-driven CERS5 induction, suggest that even a brief DOX pulse may re-programme the ceramide biosynthetic axis in tumour cells, creating a treatment window without immediate cytotoxic collapse. In parallel, TA may reduce H3K27me3 and upregulate GD2 through ST8SIA1 -dependent ganglioside synthesis, a behaviour mirrored here by stronger and more homogeneous GD2 expression in TA-containing in vitro and in vivo conditions.
[0295] Within this context, the non-cleavable anti-GD2-DM1 ADC provides immune-independent cytotoxicity, converting enhanced antigen density and lowered mitochondrial thresholds into efficient mitotic arrest and caspase activation.
[0296] The superior tumour control observed with DOX+TA+ADC relative to the dual combinations indicates that convergent modulation of both antigen biology and apoptotic readiness has a further synergistic effect compared to addressing either barrier alone.
[0297] These results also help to rationalise the choice of an ADC rather than naked anti-GD2 antibody for treatment of osteosarcoma. Clinical experience with anti-GD2 monoclonal antibodies in neuroblastoma demonstrates that responses are critically dependent on intact antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity, which may be muted in the myeloid-rich, immunosuppressive OS microenvironment and in immunodeficient murine hosts. By1006294735contrast, a maytansinoid-based ADC can kill GD2-positive cells largely independently of immune effector function while retaining selectivity through antigen recognition. The present in vivo data further suggest that relatively low-intensity DOX pulses can be repurposed as a co-treatment rather than as a bulk cytotoxic agent, achieving enhanced antitumour activity when combined with TA and ADC without obvious additional cardiotoxicity beyond that attributable to DOX alone. This raises the possibility that, in the clinic, DOX exposure could be deliberately reframed — from maximal-tolerated-dose cytotoxicity toward transient ceramide-mediated sensitisation — particularly in patients for whom cumulative cardiotoxicity is a major concern.
[0298] In view of the results outlined in the Examples, the inventors further anticipate that the combination therapy comprising doxorubicin and the DM1 -conjugated anti-GD2 antibody may also be administered in the form of an ADC with dual payloads, the dual payloads being doxorubicin and DM1 respectively. For example, the inventors have already established methods for conjugating dual payloads to an antibody - see Mckertish and Kayser (2020) Pharmaceutics, incorporated herein by reference. Such methods may be used for the preparation of the ADC conjugated with both doxorubicin and DM1.1006294735
Claims
CLAIMS1. A conjugate comprising an antigen binding protein for binding to GD2 antigen conjugated to a cytotoxic agent.
2. The conjugate of claim 1 , wherein the antigen binding protein comprises an HCDR1 , an HCDR2 and / or an HCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 14 or 41.
3. The conjugate of claim 1 or 2, wherein the antigen binding protein also comprises an LCDR1 , an LCDR2 and / or an LCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 27 or 54.
4. The conjugate of any one of claims 1 to 3, wherein the antigen binding protein comprises an HCDR1 , an HCDR2 and an HCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 14 and / or an LCDR1 , an LCDR2 and an LCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 27.
5. The conjugate of claim 4, wherein the antigen binding domain comprises: an HCDR1 comprising the sequence as set forth in SEQ ID NO: 4, an HCDR2 comprising the sequence as set forth in SEQ ID NO: 5, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 6; and / or an LCDR1 comprising the sequence as set forth in SEQ ID NO: 18, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 19, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 17; (according to Kabat numbering); wherein optionally the antigen binding protein comprises: a VH comprising a framework region (FR) 1 comprising an amino acid sequence of SEQ ID NO: 11 , or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 12, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least100629473596%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 13, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 10, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and / or a VL comprising a FR1 comprising an amino acid sequence of SEQ ID NO: 24, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 25, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 26, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 23, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; wherein preferably, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 14, and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 27.
6. The conjugate of any one of claims 1 to 3, wherein the antigen binding protein comprises an HCDR1 , an HCDR2 and an HCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 41 and / or an LCDR1, an LCDR2 and an LCDR3 of an antigen binding domain with a variable heavy chain as defined in SEQ ID NO: 54.10062947357. The conjugate of claim 6, wherein the antigen binding domain comprises: an HCDR1 comprising the sequence as set forth in SEQ ID NO: 31 , an HCDR2 comprising the sequence as set forth in SEQ ID NO: 32, and an HCDR3 comprising the sequence as set forth in SEQ ID NO: 33; and / or an LCDR1 comprising the sequence as set forth in SEQ ID NO: 45, an LCDR2 comprising the sequence as set forth in SEQ ID NO: 46, and an LCDR3 comprising the sequence as set forth in SEQ ID NO: 44; (Kabat numbering) wherein optionally the antigen binding protein comprises: a VH comprising a framework region (FR) 1 comprising an amino acid sequence of SEQ ID NO: 38, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 39, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 40, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 37, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; and / or a VL comprising a FR1 comprising an amino acid sequence of SEQ ID NO: 51 , or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR2 comprising an amino acid sequence of SEQ ID NO: 52, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; a FR3 comprising an amino acid sequence of SEQ ID NO: 53, or a sequence at least about 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%,1006294735at least 97%, at least 98%, or at least 99% identical thereto; and a FR4 comprising an amino acid sequence of SEQ ID NO: 50, or a sequence at least about 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto; wherein preferably, the antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 41 , and a light chain variable region comprising the amino acid sequence as set forth in SEQ ID NO: 54.
8. The conjugate of any one of claims 1 to 7, wherein the antigen binding protein is an antibody or antigen binding fragment thereof, including a variable domain.
9. The conjugate of any one of claims 1 to 8, wherein the conjugate comprises more than one cytotoxic agent.
10. The conjugate of any one of the preceding claims wherein the antigen binding protein and the cytotoxic agent are joined via a linker.
11. The conjugate of claim 10, wherein the linker is a non-cleavable linker.
12. The conjugate of claim 10, wherein the antigen binding protein and the cytotoxic agent are linked via the linker succinimidyl 4-(N- maleimidomethyl)cyclohexane-1-carboxylaten (SMCC).
13. The conjugate of any one of the preceding claims, wherein the cytotoxic agent is a chemotherapeutic molecule, optionally selected from: a microtubule inhibitors including auristatin (eg, MMAE and MMAF) and a maytansinoid (eg, DM1 and DM4), a DNA-damaging agent including calicheamicins and pyrrolobenzodiazepines (PBDs), a topoisomerase I inhibitor including camptothecin derivatives (eg, SN-38), a topoisomerase 2 inhibitor such as doxorubicin.
14. The conjugate of any one of the preceding claims wherein the cytotoxic agent is emtansine (DM1) and / or doxorubicin.
15. A pharmaceutical composition comprising a conjugate of any one of the preceding claims and a pharmaceutically acceptable carrier, diluent or excipient.100629473516. A method of treating osteosarcoma in a subject, the method comprising administering to a subject in need thereof, a conjugate or pharmaceutical composition of any one of the preceding clams, thereby treating osteosarcoma in the subject.
17. Use of a conjugate of any one of claims 1 to 14, in the manufacture of a medicament for the treatment of osteosarcoma.
18. A method of treating osteosarcoma in a subject in need thereof, the method comprising administering to the subject an antigen binding protein for binding to GD2, preferably wherein the method further comprises administering to the subject an agent for increasing expression of GD2 antigen by the osteosarcoma cells of the subject.
19. The method of claim 18, wherein the antigen binding protein for binding to GD2 is conjugated to a cytotoxic agent.
20. The method of claim 18 or 19, wherein the conjugate is as described in any one of claims 1 to 14.
21. The method of claim 18, wherein the agent for increasing GD2 expression is an epigenetic modulator.
22. The method of claim 21 , wherein the agent for increasing expression of GD2 is selected from: an EZH2 inhibitor, a PRC2 inhibitor, an agent that activates intracellular signalling pathways leading to increased GD2 synthesis or that is a precursor to a substrate for GD2 synthase (B4GALNT1) and an agent that increases the expression of ST8SIA1 (GD3 synthase).
23. The method of claim 21 or 22, wherein the agent for increasing expression of GD2 is tazemetostat, ceramide-016, or a combination of tazemetostat and ceramide- C16.
24. The method of claims 18 to 23 wherein the method comprises administering an agent for indirectly increasing ceramide or GD2 synthesis.
25. The method of claim 24 wherein the method comprises administering doxorubicin.100629473526. The method of any one of claims 16, or 18 to 25 wherein the GD2-expressing cancer is not a neuroblastoma or is not Ewing’s sarcoma.1006294735