Microbial agent for alleviating zingiberaceae continuous cropping obstacles and application thereof

The use of compound microbial agents has solved the problem of soil microecological imbalance in continuous cropping obstacles of ginger family plants, improved soil fertility and plant stress resistance, and significantly alleviated the problems of continuous cropping obstacles and frequent diseases.

CN122188805APending Publication Date: 2026-06-12HAINAN INNOV BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-06
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing microbial agents have limitations in alleviating continuous cropping obstacles in ginger family plants, including limited functionality, weak strain combinations, and narrow antagonistic spectrum. They cannot effectively address the multiple causes of continuous cropping obstacles in ginger family plants, leading to soil microecological imbalance and frequent disease outbreaks.

Method used

A compound microbial agent consisting of Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma sp. TS-QF6 was mixed in a certain proportion to improve the microecological environment of soils continuously cropped with ginger plants, thereby enhancing soil fertility and plant stress resistance.

Benefits of technology

It significantly improved the microecology of soils where ginger plants were continuously cropped, increased soil fertility, enhanced plant resistance to stress, effectively alleviated continuous cropping obstacles, improved the emergence rate and growth performance of ginger plants, and reduced the occurrence of soil-borne diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122188805A_ABST
    Figure CN122188805A_ABST
Patent Text Reader

Abstract

The application discloses a microbial agent for relieving continuous cropping obstacles of Zingiberaceae plants and application of the microbial agent. The microbial agent contains Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40 and Trichoderma TS-QF6. The microbial agent can significantly improve the micro-ecological environment of the soil for continuous cropping of Zingiberaceae plants, improve soil fertility, enhance plant stress resistance, effectively relieve the continuous cropping obstacles and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial technology, specifically relating to a microbial agent for alleviating continuous cropping obstacles in ginger plants and its application. Background Technology

[0002] Zingiberaceae plants are an important economic crop in my country, including ginger (Zingiber officinale), turmeric (Curcuma longa), and amomum villosum, among other species that are both food and medicinal, possessing high industrial value in food processing, pharmaceutical extraction, and cosmetics. However, this industry has long been constrained by continuous cropping obstacles, leading to frequent soil-borne diseases such as ginger wilt and root rot, resulting in yield reductions of 30%-50% or even total crop failure, and severely declining quality. Continuous cropping obstacles have become a core bottleneck restricting the sustainable development of the industry.

[0003] The mechanisms of continuous cropping obstacles are complex, mainly including rhizosphere microbial community imbalance, with a decrease in beneficial bacteria and an increase in harmful bacteria; root exudates leading to soil acidification, compaction, and deterioration of physical and chemical properties. Existing technologies to alleviate continuous cropping obstacles include crop rotation, soil fumigation, and chemical pesticide control, but they have significant drawbacks: crop rotation requires a large amount of land resources and is not suitable for large-scale planting; soil fumigation, while killing pathogens, destroys the soil microbial community structure, leading to soil degradation; chemical pesticides not only pollute the environment but also enhance pathogen resistance and cannot fundamentally restore the soil microecology.

[0004] In recent years, microbial inoculants, as a green biological control method, have become a research hotspot by supplementing beneficial microbial communities and regulating the rhizosphere microenvironment to alleviate continuous cropping obstacles. However, the following technical bottlenecks still exist in their application to ginger plants: ① Single function: Existing inoculants are mostly designed for single diseases (ginger wilt), lacking the ability to comprehensively regulate multiple inducing factors of continuous cropping obstacles (microbial community disorder + autotoxin accumulation + nutrient imbalance); ② Lack of targeted strain combinations: Most are simple combinations of common biocontrol bacteria, lacking targeted adaptation to the rhizosphere microecology of ginger plants, and the synergistic mechanism of the microbial community is unclear; ③ Narrow antagonistic spectrum: Insufficient broad-spectrum antagonism against multiple pathogens such as Ralstonia solanacearum and Fusarium wilt, resulting in poor stability of field control efficacy. Therefore, there is an urgent need to develop a compound microbial inoculant that can synergistically enhance efficacy and target multiple obstacles of continuous cropping in ginger plants. Summary of the Invention

[0005] This invention provides a microbial inoculant for alleviating continuous cropping obstacles in ginger family plants, comprising Bacillus subtilis BS-QF2 (accession number: GDMCC NO. 67761, accession date: January 28, 2026, accession institution code: GDMCC-Guangdong Provincial Microbial Culture Collection Center) and Bacillus amyloliquefaciens Y40 (accession number: GDMCC NO. 65314, accession date: October 21, 2024, accession institution code: GDMCC). Guangdong Provincial Center for Microbial Culture Collection) and Trichoderma ( Trichoderma sp.) TS-QF6 (accession number: GDMCC NO.67760, accession date: January 28, 2026, accession institution code: GDMCC) This microbial agent is formulated by the Guangdong Provincial Center for Microbial Culture Collection in a specific ratio. Furthermore, this invention also provides applications of this microbial agent. This agent can significantly improve the micro-ecological environment of soils continuously cropped with ginger plants, enhance soil fertility, strengthen plant resistance to stress, and effectively alleviate continuous cropping obstacles, thus possessing broad application prospects.

[0006] The first objective of this invention is to provide Trichoderma ( Trichoderma sp.)TS-QF6, with accession number GDMCC NO.67760.

[0007] The second objective of this invention is to provide a complex microbial community containing Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6.

[0008] The third objective of this invention is to provide a compound microbial agent containing Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6, as well as microbial agent excipients, wherein the cell count ratio of Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6 is 5:5:1.

[0009] The present invention relates to a compound microbial agent for effectively improving continuous cropping obstacles in ginger plants. This agent is composed of Bacillus subtilis BS-QF2 liquid microbial agent, Bacillus amyloliquefaciens Y40 liquid microbial agent, and Trichoderma TS-QF6 liquid microbial agent mixed in a 1:1:1 ratio. The total bacterial count of the Bacillus subtilis BS-QF2 liquid microbial agent is ≥1 billion / mL, the total bacterial count of the Bacillus amyloliquefaciens Y40 liquid microbial agent is ≥1 billion / mL, and the effective viable count of the Trichoderma TS-QF6 liquid microbial agent is ≥200 million / mL.

[0010] A fourth objective of this invention is to provide a bio-fertilizer containing the aforementioned compound microbial flora or compound microbial agent, as well as fertilizer.

[0011] The fifth object of the present invention is to provide the application of the aforementioned compound microbial community, compound microbial agent or bio-fertilizer in at least one of the following (1)-(4): (1) Improve the soil; (2) Increase the abundance of beneficial microorganisms in the rhizosphere of ginger plants; (3) Antagonizes soil-borne diseases of ginger family plants; (4) Alleviate the obstacle of continuous cropping of ginger family plants.

[0012] Preferably, the ginger family plant is ginger lily (Zingiber officinale). Zingiber officinale var. amarum), black ginger ( Kaempferia parviflora ), ginger ( Zingiber officinale ),turmeric( Curcuma longa L.), intellectually stimulating ( Alpinia oxyphylla Miq.) and Yangchunsha ( Amomum villosum Lour.).

[0013] Preferably, the beneficial microorganisms in the rhizosphere of ginger plants are beneficial microorganisms of Firmicutes and Actinobacteria.

[0014] Preferably, the soil-borne diseases of ginger family plants are caused by Fusarium solani (…). Fusarium solani Fusarium moniliforme ( ) Fusarium proliferatum ) and / or Ralstonia solanacearum ( Ralstonia solanacearum Diseases caused by ).

[0015] Preferably, the soil-borne diseases of ginger plants are ginger wilt and root rot.

[0016] Preferably, the application methods are soil basal application, trench application during the planting period, and root irrigation during the growing season. The specific application methods are as follows: (1) Soil basal application: When planting ginger plants, the compound microbial agent is evenly wrapped around the ginger rhizomes before sowing. This can improve the germination rate and inhibit soil-borne diseases during the seedling stage. (2) Root irrigation during the growing season: Root irrigation is performed once during the seedling stage and once during the vigorous growth stage of ginger plants, with an application rate of 4 L / mu of liquid microbial agent. This can sustainably repair the rhizosphere microecology and alleviate the obstacles of continuous cropping during the growing season.

[0017] The Trichoderma TS-QF6 of this invention is an endophytic fungus of the ginger family tuber, ensuring its colonization in ginger family plants.

[0018] Based on the specific causes of continuous cropping obstacles in ginger family plants, this invention screened three functional strains: Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6, and scientifically formulated them into a specialized microbial agent. This agent, through the synergistic effect of multiple strains, comprehensively improves the soil microecology and alleviates acidification and nutrient imbalance; further optimization of formulation and process ensures stable and reliable effects. This invention can provide important technical support for the development of the ginger family industry and has significant economic, social, and ecological benefits.

[0019] Preservation Instructions The Trichoderma of this invention ( Trichoderma sp.)TS-QF6 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 28, 2026, with accession number GDMCC NO.67760, depository code GDMCC-Guangdong Provincial Center for Microbial Culture Collection, and address of depository: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0020] The Bacillus subtilis of the present invention ( Bacillus subtilis BS-QF2 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 28, 2026, with accession number GDMCC NO.67761, depository code GDMCC-Guangdong Provincial Center for Microbial Culture Collection, and address of depository: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. Attached Figure Description

[0021] Figure 1 It is a phylogenetic tree constructed based on the ITS sequence gene of strain QF6.

[0022] Figure 2 This shows the colony morphology of strain QF6 on PDA medium.

[0023] Figure 3 This test assesses the ability of strain QF6 to secrete extracellular polysaccharides, decompose inorganic phosphorus, and produce siderophores.

[0024] Figure 4 This is the result of strain QF6 antagonizing different physiological races of Fusarium.

[0025] Figure 5 The effects of different treatments on the aboveground fresh weight, tuber fresh weight, plant height, and disease incidence of potted ginger seedlings.

[0026] Figure 6 This study examines the effects of different treatments on the growth of continuously cropped black ginger.

[0027] Figure 7 The effects of different treatments on the rhizosphere soil nutrients (available phosphorus, nitrate nitrogen, and humic acid) of continuously cropped black ginger.

[0028] Figure 8 This study examines the effects of different treatments on the diversity of rhizosphere soil microorganisms in continuously cropped black ginger. Detailed Implementation

[0029] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0030] In the example, Trichoderma ( Trichoderma The TS-QF6 strain (sp.) is abbreviated as QF6.

[0031] The strains QF2 and Y40 in the examples are described below: Bacillus subtilis ( Bacillus subtilis The BS-QF2 strain is abbreviated as QF2. After 3 days of incubation at 28°C on YMB plates, strain QF2 colonies are transparent, slightly whitish, with smooth, raised edges. When mannitol is used as the sole carbon source, its metabolites are alkaline. It exhibits motility, weak biofilm formation, and the ability to solubilize inorganic phosphorus, but not organic phosphorus or potassium. It possesses nitrogen fixation ability, but this ability is weak. It has the ability to produce siderophores and can produce IAA. It can tolerate up to 8% NaCl and can grow normally in an environment with a pH range of 5-11. The genomic DNA of strain QF2 was amplified by PCR using 16S rDNA primers (F: AGAGTTTGATCCTGGCTCAG; R: TACGGCTACCTTGTTACGACTT). The amplified fragment sequence was homology-matched in the NCBI gene bank (https: / / blast.ncbi.nlm.nih.gov / ). Bacillus subtilis The 16S rDNA sequence of strain MK736113.1 showed 100% homology. Strain QF2 was identified as belonging to... Bacillus The genus was named Bacillus subtilis (QF2 strain). Bacillus subtilis BS-QF2. This bacterium is disclosed in the patent application entitled: A compound Bacillus agent for improving saline-alkali land and promoting broad-spectrum growth and its application (application number: 2026102662023, application date: March 5, 2026).

[0032] Strain Y40 has been disclosed in the patent titled "A Compound Microbial Agent for Alleviating Continuous Crop Obstacles in Chinese Medicinal Herbs and Its Application" (Application No.: CN202510436566.7, Application Date: April 9, 2025, Publication No.: CN119955685B, Publication Date: July 22, 2025). The corresponding strain name is Bacillus amyloliquefaciens Y40, accession number: GDMCC NO. 65314, accession date: October 21, 2024, accession institution code: GDMCC. Guangdong Provincial Center for the Preservation of Microbial Cultures

[0033] Example 1 1. Isolation and acquisition of strain QF6 Strain QF6 was derived from the rhizomes of Rucheng ginger. The ginger rhizomes were disinfected with 75% ethanol aqueous solution for 30 seconds, then with 2% NaClO aqueous solution for 5 minutes, rinsed 5-6 times with sterile water, crushed, and placed on PDA medium. They were incubated at 28℃ for 3-4 days. Once *Trichoderma viride* appeared, single spores were selected from the *Trichoderma viride* plates and placed on PDA medium for further cultivation. After spore growth, single spores from the outermost layer were selected for a second purification culture, and the spore solution was sequenced.

[0034] 2. Analysis of the basic biological characteristics of strain QF6 2.1 Phosphorus solubilization capacity Prepare culture plates for testing the activity of organic phosphorus (lecithin), inorganic phosphorus (tricalcium phosphate), and potassium solubilizing agents of Monkina. Take 5 μL of bacterial suspension and spot it in the center of each plate (ensure accurate sampling and do not allow the bacterial suspension to flow). Incubate at 28℃ for 3 days and observe whether the strain grows and whether it forms phosphorus- and potassium-solubilizing zones.

[0035] The culture medium formula is as follows: ① Monkina organophosphate (lecithin) bacterial culture medium (1 L): glucose 10.0 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, KCl 0.3 g, CaCO3 1.0 g, lecithin 0.3 g, agar 20 g, pH 7.0. The lecithin was dissolved in 75% ethanol aqueous solution by heating, sterilized separately, and then mixed with the sterilized culture medium solution cooled to 60℃ before being poured into plates.

[0036] ②Montagna Inorganic Phosphorus (Tricalcium Phosphate) Bacterial Culture Medium (1 L): Glucose 10 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, CaCO3 5.0 g, KCl 0.3 g, Ca3(PO4)2 5.0 g, Agar 20 g, pH 7.0.

[0037] ③ Potassium solubilization activity assay medium (1 L): glucose 5.0 g, anhydrous magnesium sulfate 0.5 g, ferric chloride 0.005 g, calcium carbonate 0.1 g, calcium phosphate 2.0 g, potassium-containing minerals 2.0 g, bromothymol blue 100 mg, agar 15 g, pH 7.2.

[0038] 2.2 Iron-producing carrier test Aspirate 5 μL of the strain onto a CAS medium plate (Crazin S (CAS) 60.5 mg, hexadecyltrimethylammonium bromide (ITIA) 72.9 mg, ferric chloride hexahydrate 2.645 mg, sodium dihydrogen phosphate dihydrate 295.25 mg, disodium hydrogen phosphate dodecahydrate 1213.5 mg, ammonium chloride 125 mg, potassium dihydrogen phosphate 37.5 mg, sodium chloride 62.5 mg, agar 9.0 g, distilled water 1 L, pH 6.8) and incubate at 28°C for 3 days. If a yellow ring appears on the colony, it indicates the presence of an iron carrier.

[0039] 2.3 Qualitative observation of QF6's ability to produce extracellular polysaccharides Culture medium preparation. Prepare 100 mL of TSB medium (TSB medium formula contains 17.0 g tryptone, 3.0 g soybean peptone, 5.0 g sodium chloride, 2.5 g dipotassium hydrogen phosphate, and 2.5 g glucose per liter, final pH 7.3±0.2), supplement with 0.05 g glucose, 0.067 g yeast extract, 6 mg aniline blue, and 400 mg kelp polysaccharide, adjust pH to 6.8, then add 1.2 g agar, sterilize at 121°C for 15 min, and prepare plates. Inoculate with QF6 mycelial discs, incubate for 3 days, and observe for the presence of a transparent zone around the mycelial discs.

[0040] 3. Molecular biological identification of strain QF6 Genomic DNA of strain QF6 was amplified using ITS primers (F: 5'-TCCGTAGGTGAACCTGCGG-3'; R: 5'-TCCTCCGCTTATTGATA TGC-3') for molecular biological identification. A fragment of approximately 597 bp was amplified, and its ITS nucleotide sequence is shown in SEQ ID NO.1. The amplified sequence was aligned using DNAMAN software, assembled using SNAPGENE software, and homology was compared in the NCBI gene bank (https: / / blast.ncbi.nlm.nih.gov / ). A phylogenetic tree was constructed using the neighbor-joining method with MEGA 11.0 software for phylogenetic analysis.

[0041] The results show that: After being cultured in PDA medium at 28°C for 3 days, the mature spores of strain QF6 were green. Figure 2 It has the ability to produce extracellular polysaccharides, and the ability to hydrolyze inorganic phosphates and produce siderophores. Figure 3 ).

[0042] Based on the morphological characteristics, physiological and biochemical properties, and phylogenetic tree analysis using ITS gene sequences, strain QF6 was identified as belonging to [a specific group / family]. Trichoderma genus, whose ITS sequence is similar to Trichoderma sp The ITS sequence of isolateSDAS203237 has 99.93% homology. Its position in the Trichoderma genus phylogenetic tree constructed using the ITS sequence is as follows: Figure 1 As shown. Therefore, strain QF6 was named Trichoderma ( Trichoderma sp.)TS-QF6.

[0043] Example 2 1. Bacterial fermentation Bacterial strain activation: Strain QF2 and strain Y40 were selected and inoculated into LB medium (10 g peptone, 5 g yeast extract, 10 g NaCl, 1000 mL water, pH 7.0) and cultured at 37℃ and 200 r / min for 20 h to obtain activated bacterial solutions.

[0044] Seed culture: Activated bacterial solutions were inoculated into seed culture medium (15 g peptone, 8 g yeast extract, 10 g glucose, 15 g NaCl, 1000 mL water, pH 7.2) and cultured at 35℃ with shaking at 200 r / min for 30 h. The bacterial concentration was measured to be 10⁻⁶. 9 CFU / mL was used to obtain the seed culture.

[0045] Bacterial fermentation culture: Seed culture of strain QF2 and strain Y40 was inoculated into fermentation medium (mannitol 10 g / L, yeast extract 0.5 g / L, K2HPO4 4) at an inoculation rate of 6%. 3H₂O 0.33 g / L, MgSO₄ Fermentation was carried out at 28℃ and 200 r / min for 60 h in a solution of 0.2 g / L H₂O, 0.1 g / L NaCl, 0.025 g / L CaCl₂ (pH 7.0). During fermentation, the pH was maintained at 6.5-7.5 by adding 0.1 mol / L NaOH and HCl. After fermentation, a protective agent (2% KCl, 0.01% alanine, 0.05% potassium sorbate, 2% trehalose, 0.3% Tween 80, pH 7.0) was added to the fermentation broth. The viable cell count was found to be 1 billion CFU / mL, which met the set standard. Thus, QF2 liquid inoculant and Y40 liquid inoculant were obtained for later use.

[0046] 2. Fungal fermentation QF6 strain activation: Active, contamination-free QF6 strains were activated and cultured on PDA slant medium (28℃, 3-4 days). Spores were scraped from the PDA slant medium using a sterile inoculation loop and inoculated into the fermentation substrate of an Erlenmeyer flask, gently shaken to mix. The Erlenmeyer flask was placed in a 28℃ incubator for 5 days of fermentation. When the flask was covered with white mycelium and a large number of green spores were produced, 50 mL of sterile physiological saline was added to rinse the spores and mycelium on the substrate surface. The solution was filtered through sterile gauze (2 layers), the filtrate was collected, and the seed culture concentration was adjusted to 1.0 × 10⁻⁶. 7 The concentration of 1000 cells / mL is the QF6 seed culture.

[0047] Fermentation with QF6 strain: Weigh wheat ash and medicinal herb residue at a mass ratio of 1:2, and add nutrient solution (ammonium sulfate 5 g / L, calcium chloride 0.25 g / L, potassium dihydrogen phosphate 1.5 g / L, magnesium sulfate 0.5 g / L, pH 6.5) at a ratio of 1.7 L / kg. Mix well and sterilize to use as the fermentation substrate. Pour the QF6 seed liquid into a sterile sprayer and spray evenly onto the surface of the fermentation substrate (inoculation amount controlled at 10 mL QF6 seed liquid per 1 kg of substrate), ensuring uniform inoculation. Maintain an ambient humidity of 85%-90% and a temperature of 28±1℃. After 7-10 days, wash away the spores with sterile water, ensuring an effective viable cell count ≥200 million / mL, thus obtaining QF6 liquid inoculum for later use.

[0048] Example 3 The QF6 liquid bacterial agent prepared in Example 2 was used to determine the susceptibility of the QF6 strain to two physiological races of the pathogen Fusarium solani (Fusarium solani) using the plate confrontation method. Fusarium solani China Industrial Microbial Culture Collection Center, strain number: CICC 2603) and Fusarium moniliforme strain ( Fusarium proliferatum The antibacterial ability of Fusarium strains. Fusarium proliferatumThe pathogens were isolated from ginger rhizomes of Rucheng small yellow ginger, which were severely affected by soft rot. *Fusarium solani* and *Fusarium solani* strains were inoculated into the center of PDA agar plates, respectively. 10 μL of diluted QF6 liquid bacterial agent was added around the pathogens, while 10 μL of sterile water was added around the pathogens in the control group. The plates were incubated at 28℃ for 7 days.

[0049] The results showed that strain QF6 significantly inhibited the growth of *Fusarium solani* and *Fusarium moniliforme* strains derived from ginger. Figure 4 The plate confrontation method showed that after the addition of strain QF6, the growth area of ​​Fusarium effusum increased from 11.673 cm². 2 Decreased to 2.502 cm 2 The growth area of ​​Fusarium solani increased from 14.828 cm². 2 It dropped to 1.724 cm. 2 (Table 1). The results show that strain QF6 can significantly inhibit the growth of Fusarium.

[0050] Table 1. Inhibitory effect of QF6 strain against different Fusarium species as determined by plate confrontation method. Example 4 Select potted ginger seedlings that are growing uniformly, vigorous, and free from obvious diseases, and use a concentration of 1×10⁻⁶. 8 cfu / mL Ralstonia solanacearum Ralstonia solanacearum Bacterial suspension and 1 × 10 6 A mixture of equal volumes of *Fusarium* strains (same as in Example 3) at a concentration of 10 mL per plant was used for root drenching as a control (treatment A). After 24 hours, different microbial inoculants were applied to the roots, with 100 mL per plant (treatment B consisted of a mixture of 50 mL of QF2 liquid inoculant prepared in Example 2 and 50 mL of Y40 liquid inoculant prepared in Example 2; treatment C consisted of 100 mL of QF6 liquid inoculant prepared in Example 2; and treatment D consisted of a mixture of 33.33 mL of QF2 liquid inoculant prepared in Example 2, 33.33 mL of Y40 liquid inoculant prepared in Example 2, and 33.33 mL of QF6 liquid inoculant prepared in Example 2). A total of four treatments were set up, as shown in Table 2. Each treatment consisted of 10 pots, with 5 seedlings per pot, and 3 biological replicates per treatment. Disease incidence was observed and recorded after 21 days. The effects of antagonistic bacterial strains on the growth of ginger were mainly assessed by measuring the aboveground fresh weight, root fresh weight, plant height, stem diameter, and disease incidence of ginger.

[0051] Table 2 Different treatment combinations The results showed that the exogenous addition of antagonistic strains significantly increased the aboveground fresh weight and plant height of *Zingiber officinale* (P < 0.01). The aboveground fresh weight of *Zingiber officinale* in treatment D was 22.41 g, while that in treatment A was 8.21 g. Although treatments B and C effectively increased the aboveground fresh weight of *Zingiber officinale*, their effects were not as significant as those in treatment D. Figure 5 The antagonistic strain treatment also increased the tuber weight and plant height of ginger, but treatment D was more effective than treatments B and C. Figure 5 Furthermore, the incidence of disease in ginger treated with treatment D was significantly reduced. While almost all ginger in treatment A developed the disease, the incidence rate in treatment D was only 12.53%, indicating that treatment D was extremely effective in suppressing the occurrence of diseases such as ginger wilt and root rot in ginger. Figure 5 ).

[0052] Example 5: Field trial of the liquid bacterial agent prepared in Example 2 The experiment was conducted on April 10, 2025, in Zhaoqing, in soil prone to disease where black ginger had been continuously planted for three years. Uniformly sized black ginger pieces were evenly dipped in the microbial agent and transplanted. Two weeks after transplanting, a second root drenching with the microbial agent was performed at a rate of 4 L / mu (approximately 0.067 hectares). The field trial was set up as follows: Treatment A (CK) was a blank control group (using tap water left to stand for one day instead of the microbial agent); Treatment B was a QF2+Y40+QF6 compound microbial agent (a mixture of QF2 liquid microbial agent, Y40 liquid microbial agent, and QF6 liquid microbial agent prepared in Example 2 at a volume ratio of 1:1:1); Treatment C was a QF2+Y40 mixed microbial agent (QF2 liquid microbial agent and Y40 liquid microbial agent prepared in Example 2 at a volume ratio of 1:1). Each group had three parallel plots, with 30 black ginger plants planted in each plot, and the same weeding, thinning, and water and fertilizer management measures were applied.

[0053] Data on disease incidence, survival rate, and leaf area were collected 60 days after planting.

[0054] The results showed that treatment B, which included the addition of three bacterial strains (QF2, Y40, and QF6), had a more significant effect on the growth of black ginger and reduced disease incidence. Figure 6 Among the 90 black ginger plants planted, the survival rate of treatment B reached 91.1%, significantly higher than that of treatment C and extremely significantly higher than that of control treatment A; at the same time, the leaf area and number of leaves of plants in treatment B were also significantly higher than those of other treatments (Table 3). Therefore, the combined treatment of the three strains QF2, Y40 and QF6 can significantly alleviate the continuous cropping obstacle of black ginger.

[0055] Table 3. Effects of microbial communities on the germination rate of black ginger seeds. Ninety days after planting, soils from different treatments and rhizosphere soils of black ginger were collected for soil nutrient composition determination and rhizosphere soil microbial diversity sequencing and analysis.

[0056] The results showed that, compared with control treatment A, the available phosphorus, nitrate nitrogen, and humic acid contents of the soil treated with microbial community B increased significantly by 42.86%, 37.02%, and 7.40%, respectively. Figure 7 Soil microbial analysis also showed that, compared with control treatment A and treatment C which lacked QF6, the relative abundance of Firmicutes and Actinobacteria in soil treated by treatment B was significantly increased. Figure 8 The results indicate that the QF2+Y40+QF6 microbial community can effectively alleviate the problems of microbial community and nutrient imbalance caused by continuous cropping.

Claims

1. Trichoderma ( Trichoderma sp.) TS-QF6, characterized in that, The accession number is GDMCC NO.67760.

2. A complex microbial community, characterized in that, It contains Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6 as described in claim 1.

3. A compound microbial agent, characterized in that, The product contains Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6 as described in claim 1, as well as excipients for the inoculum. The cell count ratio of Bacillus subtilis BS-QF2, Bacillus amyloliquefaciens Y40, and Trichoderma TS-QF6 is 5:5:

1.

4. A bio-fertilizer, characterized in that, It contains the compound microbial community as described in claim 2 or the compound microbial agent as described in claim 3, and fertilizer.

5. The application of the compound microbial community of claim 2, the compound microbial agent of claim 3, or the bio-fertilizer of claim 4 in at least one of the following (1)-(4): (1) Improve the soil; (2) Increase the abundance of beneficial microorganisms in the rhizosphere of ginger plants; (3) Antagonizes soil-borne diseases of ginger family plants; (4) Alleviate the obstacle of continuous cropping of ginger family plants.

6. The application according to claim 5, characterized in that, The ginger family plant mentioned is ginger lily (Zingiber officinale). Zingiber officinale var. amarum), black ginger ( Kaempferia parviflora ), ginger ( Zingiber officinale ),turmeric( Curcuma longa L.), intellectually stimulating ( Alpinia oxyphylla Miq.) and Yangchunsha ( Amomum villosum Lour.).

7. The application according to claim 5, characterized in that, The beneficial microorganisms in the rhizosphere of ginger plants are beneficial microorganisms of Firmicutes and Actinobacteria.

8. The application according to claim 5, characterized in that, The soil-borne diseases of ginger family plants mentioned above are caused by Fusarium solani (… Fusarium solani Fusarium moniliforme ( ) Fusarium proliferatum ) and / or Ralstonia solanacearum ( Ralstonia solanacearum Diseases caused by ).

9. The application according to claim 5, characterized in that, The soil-borne diseases of ginger family plants mentioned are ginger wilt and root rot.

10. The application according to claim 5, characterized in that, The application methods are soil basal application, trench application during the planting period, and root irrigation during the growing season.

Citation Information

Patent Citations

  • A composite microbial agent for alleviating continuous cropping obstacles of traditional Chinese medicine crops and its application

    CN119955685B