GmCML27 gene and biological material containing same in regulating soybean alkali tolerance
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHEAST AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-05-07
- Publication Date
- 2026-06-12
Smart Images

Figure CN122189076A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving GmCML27 Application of genes and biomaterials containing them in regulating soybean alkali tolerance. Background Technology
[0002] Soybeans Glycine max Soybean is an important oilseed and food crop globally, but its growth and development are often limited by soil alkaline stress (such as NaHCO3). Alkaline soils increase rhizosphere pH, damage root structure and function, inhibit nutrient absorption, and induce the accumulation of reactive oxygen species (ROS), leading to leaf chlorosis, wilting, and even death. Therefore, identifying key genes for soybean alkali tolerance and analyzing their regulatory networks is of great significance for breeding alkali-tolerant soybean varieties.
[0003] In recent years, using forward and reverse genetics methods, some genes involved in the regulation of alkali tolerance in soybeans have been identified, such as... GmCHX1, GmSALT3, GmNAC While these genes are not explicitly mentioned, they primarily involve ion transport and transcriptional regulation. Calcium ions (Ca²⁺) serve as the second messenger in plant stress signal transduction, and their downstream calcium-binding proteins (such as calmodulin CaM, calmodulin-like protein CML, and calcium-dependent protein kinase CDPK) play crucial roles in sensing and transmitting stress signals. Among them, members of the CML (Calmodulin-like) family, possessing an EF-hand domain, can bind Ca²⁺ and undergo conformational changes, thereby regulating target protein activity. Existing studies have shown that some CML genes (such as AtCML9 and OsCML4) are involved in plant responses to drought and salt stress, but their function in alkali stress remains unclear, especially regarding whether CML genes in soybean regulate alkali tolerance, which still lacks direct evidence. Therefore, there is an urgent need in this field to identify key genes that can effectively improve soybean alkali tolerance and clarify their application pathways. Summary of the Invention
[0004] Based on the above-mentioned technical problems, the present invention provides... GmCML27 The application of genes in regulating soybean alkali tolerance provides new gene resources and theoretical basis for molecular breeding of alkali-tolerant soybeans.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention provides GmCML27 The application of genes or biological materials containing them in regulating soybean alkali tolerance, the aforementioned GmCML27 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0006] This invention achieves its results through overexpression and CRISPR / Cas9 knockout technology. GmCML27 Transgenic soybean plants. Results showed that overexpression...GmCML27 It can significantly improve the survival rate of soybeans under alkaline stress, enhance the plant's antioxidant capacity, reduce MDA and H2O2 content, and promote root development; while knockout leads to a significant decrease in alkali tolerance. Further analysis shows that... GmCML27 It can upregulate alkali tolerance-related genes GmSOD1 , GmGSH1 , GmCBL1 , GmAOX1 , GmAPX1 The expression.
[0007] Preferably, by overexpressing the GmCML27 Genes are used to improve the alkali resistance of soybeans.
[0008] Preferably, by knocking out the GmCML27 Gene or inhibitor GmCML27 Gene expression is used to reduce soybean alkali tolerance.
[0009] Preferably, knock out the GmCML27 Genes are those containing the aforementioned GmCML27 The gene editing and knockout vector is introduced into soybean plants to achieve the desired result. The recombinant gene editing and knockout vector contains a target gene... GmCML27 The gRNA of the gene, the sequence of which is shown in SEQ ID NO.10.
[0010] Preferably, the biomaterial comprises the GmCML27 Recombinant overexpression vectors of genes or recombinant engineered bacteria.
[0011] Preferably, the recombinant expression vector is used to express the... GmCML27 The gene was obtained by inserting it between the BamHI restriction sites of the pCAMBIA1300-GFP vector.
[0012] Preferably, the recombinant engineered bacteria is obtained by transferring the recombinant overexpression vector into Agrobacterium competent cells K599.
[0013] This invention provides a method for cultivating soybean plants with improved alkali tolerance, comprising the following steps: Constructing the structure described in claim 1 GmCML27 Gene overexpression vectors; The overexpression vector was introduced into Agrobacterium competent cells, cultured, and the infection solution was obtained. Soybean plant tissues were infected with the aforementioned infection solution and cultured to obtain soybean plants with improved alkali tolerance.
[0014] Preferably, the Agrobacterium competent cells are Agrobacterium competent cells K599.
[0015] Preferably, the soybean plant tissue is a soybean seed.
[0016] Preferably, after the overexpression vector is introduced into Agrobacterium competent cells, it is co-cultured at 28°C for 2-3 days.
[0017] The present invention has the following beneficial effects: This invention first cloned and identified GmCML27 This confirms that it can positively regulate the alkali tolerance of soybeans. Overexpression GmCML27 It can significantly enhance soybean root development, increase antioxidant enzyme activity, reduce oxidative damage, and activate the expression of downstream alkali-tolerant genes; gene knockout leads to the opposite phenotype. This invention discloses... GmCML27 As an important component of the soybean alkali tolerance regulatory network, it provides important genetic resources and technical means for the precise creation of new alkali-tolerant soybean germplasm through genetic improvement, and has very important application value. Attached Figure Description
[0018] Figure 1 for GmCML27 Protein structure, sequence characteristics, tissue expression patterns, and subcellular localization. A is... GmCML27 A schematic diagram of the protein's domain structure shows that it consists of four tandem EF-hand domains. B represents... GmCML27 With wild soybeans ( GsCML27 ), lupins ( LaCML27 Multiple sequence alignment analysis of homologous proteins, with the EF-hand domain marked in red, shows that the core domain sequences of the three proteins are highly conserved. C represents... GmCML27 Tissue-specific expression analysis in soybean roots, stems, and leaves (asterisks indicate significant differences) showed that... GmCML27 The highest expression level was observed in leaves. D represents... GmCML27 Subcellular localization analysis revealed the expression of eGFP (control) and eGFP in tobacco leaves, respectively. GmCML27 The -eGFP fusion protein was observed using GFP fluorescence, chloroplast autofluorescence (Chlo), bright field (BF), and merged images (scale bar = 50 μm). The results showed... GmCML27 It is located on the cell membrane, nucleus, and endoplasmic reticulum.
[0019] Figure 2 Wild type GmCML27 -OE1、 GmCML27 -OE2、 GmCML27 -CR1、 GmCML27 - CR2 strain phenotypic and physiological index analysis diagram, where A represents soybean WT under alkaline treatment (200mM, NaHCO3), GmCML27 Phenotypic diagrams of soybean lines with overexpression (OE) and knockout (CR) lines. Scale bar = 5cm. BC represents WT and [other values] before and after alkali stress treatment. GmCML27DAB and NBT staining images of overexpression (OE) and knockout (CR) lines. D represents the results under 50 mM NaHCO3 treatment. GmCML27 Expression levels at 0, 3, 6, and 12 hours. E represents POD activity, F represents MDA content, G represents CAT activity, H represents PRO content, and I represents SOD activity.
[0020] Figure 3 Wild type GmCML27 -OE1、 GmCML27 -OE2、 GmCML27 -CR1、 GmCML27 - Root system scan analysis diagram of CR2 strain. Among them, A is the root system scan diagram of WT, OE and CR, scale bar = 1cm. B is the total root length statistics diagram, C is the root cross number statistics diagram, D is the root surface area statistics diagram, E is the root tip number statistics diagram, F is the root branch number statistics diagram, G is the root volume statistics diagram, and H is the root activity statistics diagram.
[0021] Figure 4 To determine the wild-type and wild-type under 50mM NaHCO3 treatment GmCML27 -OE1、 GmCML27 -OE2、 GmCML27 -CR1、 GmCML27 - Expression levels of alkali tolerance-related genes in CR2 plants at 0, 3, 6, and 12 hours. Where A represents... GmSOD1 The expression level diagram, B is GmGSH1 The expression level diagram, C is GmERF The expression level diagram, D is GmAOX1 The expression level diagram, E is GmAPX1 The expression level plot, F is GmCBL1 The level of expression. Detailed Implementation
[0022] The present invention will now be described in detail with reference to specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.
[0023] Example 1: GmCML27 Gene cloning and cloning sequences Using soybean cDNA library as a template, targeting GmCML27Specific primers were designed for the coding region (CDS, SEQ ID NO.1), with the upstream primer sequence as shown in SEQ ID NO.2 and the downstream primer sequence as shown in SEQ ID NO.3. The target gene fragment was obtained by PCR amplification using SparkJade's Taq PCR Master Mix (with dye) (SparkJade, Shandong, China) and the cloning was completed.
[0024] The PCR reaction system is shown in Table 1: Table 1 PCR reaction system Note: cDNA 1~5μL (not exceeding 1 / 10 of the total PCR reaction volume) Program settings: 95℃ for 3 min; 95℃ for 15 sec, Tm for 15 sec, 72℃ for 15~30 s / kb, 30~35 cycles; 72℃ for 5 min.
[0025] GmCML27 The nucleotide sequence of the CDS region is shown in SEQ ID NO.1: atggcgacgaatccaatcgaagcggggaacggcgacgccgctcctaaccctaacgcgactaccaaaccctccgtctacctccaagacacggaggagctgaagcgagtcttcagccgcttcgacgctaattgcgac ggcaagatctccgtcaccgagttggacaacgtcctccgctccctcggatccggcgtcccgccggaggatatccagcgcgtcatggacgacctcgacaccgaccacgacggattcattaacctctcggagttcgccg ccttctgccgctccgacaccgcggatggcggcgacgccgagctccacgatgctttcaacctgtacgatcatgacaagaacggccatatctccgccacggagctctgccaggtgctgaaccgcctcggaatgaagtg ctccgtcgaggaatgccacaacatgatcaaatccgtggattccgacggcgacggcaacgtcaacttccccgagttcaagcggatgatgagcaacaatcgtgaaaatgctagcaatggcgaagaaaaaaccgattag SEQ ID NO.2: 5'-ATGGCGACGAATCCAATCG-3'; SEQ ID NO. 3: 5'-CTAATCGGTTTTTTCTTCGCCA-3'.
[0026] Example 2: GmCML27 Protein structure, sequence characteristics, tissue expression patterns and subcellular localization one, GmCML27 Protein structure and sequence characteristics GmCML27 Protein domain analysis revealed that the protein contains four tandemly arranged EF-hand domains. Figure 1 (A). The results of multiple sequence alignment further indicate that, GmCML27 with wild soybeans GsCML27 lupins LaCML27 The homologous protein sequences are highly similar, reaching 88.03%. The EF-hand domain (marked in red) shows extremely high sequence conservation across different species. Figure 1 (B)
[0027] two, GmCML27 Organizational expression patterns Soybean root, stem, and leaf tissues were collected, and total RNA was extracted using the TransZol Up Kit (TransGen Biotech, ET111-01-V2). The total RNA was then reverse transcribed into first-strand cDNA using the Spark script II RT Plus kit (SparkJade, Shandong, China). Quantitative polymerase chain reaction (PCR) was performed on a CFX384 real-time system (Bio-Rad) using SYBR Green Master Mix (SparkJade, Shandong, China) to detect the RNA. GmCML27 Expression levels in different soybean tissues. Using 2... -ΔΔCT The method calculates relative expression levels, in order to GmGAPDH This is for internal reference.
[0028] Organizational expression pattern analysis shows that GmCML27 Transcriptional expression was observed in soybean roots, stems, and leaves, with the highest expression level in leaves, followed by stems, and the lowest expression level in roots, exhibiting obvious tissue-specific expression characteristics. Figure 1 (C)
[0029] GmCML27 The qRT-PCR primer sequences are: F: 5'-CGTCTACCTCCAAGACACGG-3', SEQ ID NO.4; R: 5'-GTCCATGACGCGCTGGATA-3', SEQ ID NO.5.
[0030] GmGAPDH The qRT-PCR primer sequences are: F: 5'-CCACCGGAGTTTCACCG-3', SEQ ID NO.6; R: 5'-CATGGGGGCATCCTTACTGG-3', SEQ ID NO.7.
[0031] three, GmCML27 Subcellular localization Amplification was performed using SparkJade's Taq PCR Master Mix (with dye) (SparkJade, Shandong, China) and primers containing homologous arms of the pCAMBIA1300-GFP vector (Miaoling). GmCML27 The CDS sequence of the target fragment (without a stop codon, upstream primer sequence as shown in SEQ ID NO. 8, downstream primer sequence as shown in SEQ ID NO. 9) was used. The target fragment was inserted using a homologous recombinase (Vazyme, Nanjing, China). BamH I single enzyme digestion of the linearized pCAMBIA1300-GFP vector to construct pCAMBIA1300- GmCML27 -GFP fusion vector. The recombinant plasmid pCAMBIA1300- GmCML27 -GFP was co-transformed with the empty vector pCAMBIA1300-GFP into Agrobacterium GV3101 (pSoup-p19) (Weidi, Shanghai, China). The bacterial suspension containing the plasmid (OD) was then... 600 =0.6) The bacteria were collected by centrifugation and resuspended in a bacterial resuspension containing 10 mM MES, MgCl2, and 100 μM acetylsyringone (AS). After standing for 3 hours, the mixture was injected into different parts of the tobacco leaves using a 1 mL syringe and marked accordingly. After incubation overnight in the dark, the infiltrated plants were returned to the greenhouse for 48 hours. Tissue sections from the back of the leaves were prepared and mounted on glass slides. Images were captured using a Leica TCS SP8 confocal laser scanning microscope (Leica, Germany).
[0032] GmCML27 Subcellular results showed GmCML27 Located in the cell membrane, nucleus, and endoplasmic reticulum ( Figure 1 (D).
[0033] The enzyme digestion system is shown in Table 2: Table 2 Enzyme digestion system Reaction conditions: 37℃ for 1 hour.
[0034] SEQ ID NO.8: 5'-GAGCTCGGTACCCGGGGATCCATGGCGACGAATCCAATCG-3'; SEQ ID NO.9: 5'-CATGTCGACTCTAGAGGATCCATCGGTTTTTTCTTCGCCATT-3'.
[0035] Example 3: GmCML27 Construction and transformation of gene overexpression and knockout vectors into soybean I. Construction of overexpression and gene knockout vectors The pCAMBIA1300- will be constructed GmCML27 -GFP fusion vector was used as an overexpression vector for soybean transformation. Using pHK2-Cas9-U6 (Boyuan, Wuhan, China) as the backbone vector, it was targeted... GmCML27 A dual-target gRNA was designed, with the target sequence shown in SEQ ID NO. 10. Dual-target primers with sticky ends were synthesized (primer sequences are SEQ ID NO. 11 for the upstream primer and SEQ ID NO. 12 for the downstream primer), and after annealing, they were... Eco31 I. The restriction enzyme site was inserted into the pHK2-Cas9-U6 vector, and the pHK2-Cas9-U6- vector was successfully constructed. GmCML27 Gene knockout vector. pCAMBIA1300- GmCML27 -GFP overexpression vector and pHK2-Cas9-U6- GmCML27 Gene knockout vector was transformed into Agrobacterium rhizogenes K599 (Weidi, Shanghai, China).
[0036] The dual-target amplification system (20 μL) is shown in Table 3: Table 3. Dual-target amplification system (20 μL) PCR conditions: 98℃ for 3 min; 98℃ for 15 sec, 55℃ for 15 sec, 72℃ for 30 sec, 25 cycles; 72℃ for 5 min.
[0037] Golden Gate (recommended ice setup) is shown in Table 4: Table 4 Golden Gate After the above system is mixed evenly, it is briefly centrifuged and immediately incubated at 37°C for 30-60 min; then the reaction is terminated by heating at 65°C for 20 min, and the mixture is transferred to ice for later use in the subsequent transformation of Escherichia coli DH5α.
[0038] SEQ ID NO.10: atggcgacgaatccaatcgaagcggggaacggcgacgccgctcctaaccctaacgcgactaccaaaccctccgtctacctccaagacacggaggagctgaagcgagtcttcagccgcttcgacgctaattgcgac ggcaagatctccgtcaccgagttggacaacgtcctccgctccctcggatccggcgtcccgccggaggatatccagcgcgtcatggacgacctcgacaccgaccacgacggattcattaacctctcggagttcgccg ccttctgccgctccgacaccgcggatggcggcgacgccgagctccacgatgctttcaacctgtacgatcatgacaagaacggccatatctccgccacggagctctgccaggtgctgaaccgcctcggaatgaagtg ctccgtcgaggaatgccacaacatgatcaaatccgtggattccgacggcgacggcaacgtcaacttccccgagttcaagcggatgatgagcaacaatcgtgaaaatgctagcaatggcgaagaaaaaaccgattag SEQ ID NO.11: 5'-CAGTGGTCTCATGCAACGGCAAGATCTCCGTCACCGTTTTAGAGCTAGAAATAGC-3'; SEQ ID NO.12: 5'-CAGTGGTCTCAAAACAGAGGTTAATGAATCCGTCGTGCACCAGCCGGGAATCGAA-3'.
[0039] II. Construction of soybean overexpression and knockout lines using the K599 rooting transformation system The recombinant vectors were transformed into Agrobacterium competent cells K599 to obtain recombinant engineered bacteria. Seeds of Dongnong 50 with plump grains were selected for germination. The seeds were then transformed into soybean variety Dongnong 50 (DN50) using Agrobacterium-mediated root infection. The transformed plants were incubated at 28℃ for 2-3 days, and then transplanted into soil to continue growth, yielding overexpressing plants. GmCML27 -OE and gene knockout plants GmCML27 -CR. Hairy root complexes obtained by infection with K599 vacuolar fungus were used as wild-type controls (WT).
[0040] Example 4: GmCML27 Functional verification of gene regulation of soybean alkali tolerance I. Alkali Stress Treatment The soybean plants tested included: WT, GmCML27 -OE-1、 GmCML27 -OE-2、 GmCML27 -CR-1、 GmCML27 -CR-2. Select seedlings of uniform growth and irrigate their roots with a 200 mM NaHCO3 solution every 3 days for 10 consecutive days. Plants irrigated with plain water served as a control. Observe and photograph the plant phenotypes before and after treatment.
[0041] The results show that ( Figure 2 Before alkali treatment (A), there were no significant differences in the growth status of the different strains. After alkali treatment, GmCML27 -OE plants retain green leaves and grow vigorously; WT plants show wilting and yellowing leaves. GmCML27 -CR plants are severely damaged, with leaves losing their green color, wilting, or even dying.
[0042] II. Measurement of Physiological Indicators Leaf samples were stained with diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) to detect H2O2 and O2. - The accumulation of these substances was investigated. Simultaneously, root samples were taken from plants before and after alkali treatment, and the contents of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), proline (PRO), and malondialdehyde (MDA) were determined using appropriate kits.
[0043] DAB and NBT staining showed that ( Figure 2 (B~C) OE plant leaves stained the lightest, followed by WT, and CR plant leaves stained the darkest, indicating that OE plant leaves had the least ROS accumulation and the least oxidative damage. Furthermore, regarding... GmCML27 Gene expression levels were analyzed by RT-qPCR at 50 mM treatment for 0, 3, 6, and 12 hours. Results showed that gene expression levels increased within 0–3 hours. GmCML27 The expression level gradually increased, peaked at 3 hours, and then gradually decreased. Figure 2(D), further proof GmCML27 Response to alkaline stress. Physiological index measurements showed that, compared with WT, OE plants exhibited significantly increased SOD, POD, and CAT activities, significantly increased proline content, and significantly decreased MDA content under alkaline treatment; CR plants showed the opposite trend. Figure 2 (E~I). The above results indicate that overexpression GmCML27 It can enhance the antioxidant capacity of soybeans, reduce oxidative damage induced by alkali stress, and thus improve alkali tolerance.
[0044] III. Root System Scan Analysis The root systems of each plant line were scanned and analyzed using a root analysis system before and after alkali treatment. Morphological parameters such as total root length, root volume, number of root tips, number of branches, number of nodes, and number of connections were measured, and root activity was also determined. Figure 3 (A~H).
[0045] The results showed that under normal growth conditions, the root system of OE plants was more developed than that of WT plants, with significantly higher total root length, root volume, number of root tips, and number of branches. In contrast, the root system of CR plants was significantly smaller than that of WT plants. After alkali treatment, OE plants maintained high root activity, with only a smaller decrease in root morphology indicators; however, the root activity of CR plants decreased significantly, and root growth was inhibited. GmCML27 It can positively regulate root development, laying a good foundation for the plant's vegetative growth in response to alkaline stress.
[0046] Example 5: GmCML27 Regulation of the expression of downstream alkali tolerance-related genes.
[0047] Take WT, GmCML27 -OE、 GmCML27 -CR plants were treated with 50 mM NaHCO3 solution for 0, 3, 6, and 12 h. Total RNA was extracted and reverse transcribed into first-strand cDNA. Quantitative polymerase chain reaction (PCR) was performed on a CFX384 real-time system (Bio-Rad) using 2×Universal SYBR Green qPCR Mix (SparkJade, Shandong, China). GmGAPDH qRT-PCR was used to detect alkali tolerance-related genes as internal reference genes. GmSOD1 , GmGSH1 , GmCBL1 , GmAOX1 , GmERF , GmAPX1 The relative expression level.
[0048] The reaction system for qRT-PCR is shown in Table 5: Table 5. qRT-PCR reaction system Program settings: 95℃ for 30 seconds; 95℃ for 10 seconds, 55℃~65℃ for 10 seconds, 72℃ for 10~30 seconds, 40 cycles. The qRT-PCR primer sequences for alkali tolerance-related genes are as follows: GmSOD1 : F: 5'-AGGAAGGGCTGTTGTTGTCC-3', SEQ ID NO.13; R: 5'-CACAAGCTACTCTGCCACCA-3', SEQ ID NO. 14.
[0049] GmGSH1 : F: 5'-TGAGGAACAGGCCGTACAAC-3', SEQ ID NO.15; R: 5'-AAAAACCCGGTCTGGAAGCC-3', SEQ ID NO. 16.
[0050] GmCBL1 : F: 5'-ATGGGCTGCTACTGCTCAA-3', SEQ ID NO.17; R: 5'-AATGACCCCATTGCGCTTGA-3', SEQ ID NO. 18.
[0051] GmAOX1 : F: 5'-TGTTCTACCTCCTCTGCCA-3', SEQ ID NO.19; R: 5'-CATCAGCGCGAATCACAGTG-3', SEQ ID NO. 20.
[0052] GmERF : F: 5'-CACATCGCTACCCAACAACCC-3', SEQ ID NO.21; R: 5'-TCTCAACCTGCTCGCTAACTTTG-3', SEQ ID NO. 22.
[0053] GmAPX1 : F: 5'-AGAAAGGGCTTCTTCGCTCC-3', SEQ ID NO. 23; R: 5'-GATTTTGCGAAGTCCTGGCG-3', SEQ ID NO. 24.
[0054] The results showed that GmSOD1 In overexpressing plants, alkaline treatment for 6 hours upregulated expression ( Figure 4 (A) GmGSH1 Expression was upregulated when processing at 0h and 12h. Figure 4 (B). The expression levels of these two genes did not change significantly at other time points in overexpressing plants and in knockout plants. GmERF ( Figure 4 (C) GmAOX1 ( Figure 4 D), GmAPX1 ( Figure 4 (E) and GmCBL1 ( Figure 4 In the overexpressing plants, the relative expression level of F was significantly higher than that of wild type at 0h, 3h, 6h and 12h under alkali treatment, while the change was not significant in knockout plants compared with wild type.
[0055] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
Claims
1. A kind GmCML27 The application of genes or biological materials containing them in regulating soybean alkali tolerance, characterized in that, The GmCML27 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, By overexpressing the above GmCML27 Genes are used to improve the alkali resistance of soybeans.
3. The application according to claim 1, characterized in that, By knocking GmCML27 Genes are used to reduce the alkali tolerance of soybeans.
4. The application according to claim 1, characterized in that, Knock out the GmCML27 Genes are those containing the aforementioned GmCML27 The gene editing and knockout vector is introduced into soybean plants to achieve the desired result. The recombinant gene editing and knockout vector contains a target gene... GmCML27 The gRNA of the gene, the sequence of which is shown in SEQ ID NO.
10.
5. The application according to claim 1, characterized in that, The biomaterial is comprising the above. GmCML27 Recombinant overexpression vectors for genes.
6. The application according to claim 5, characterized in that, The recombinant expression vector is used to express the... GmCML27 Gene inserted into pCAMBIA1300-GFP vector BamH Obtained at the I restriction site.
7. The application according to claim 1, characterized in that, The biomaterial is comprising the above. GmCML27 Recombinant engineered bacteria.
8. The application according to claim 7, characterized in that, The recombinant engineered bacteria were obtained by transferring the recombinant overexpression vector into Agrobacterium competent cells K599.
9. A method for cultivating soybean plants with improved alkali tolerance, characterized in that, Includes the following steps: Constructing the structure described in claim 1 GmCML27 Gene overexpression vectors; The overexpression vector was introduced into Agrobacterium competent cells, cultured, and the infection solution was obtained. Soybean plant tissues were infected with the aforementioned infection solution and cultured to obtain soybean plants with improved alkali tolerance.