Igfbp5 gene associated with proliferation of sheep ovarian granulosa cells and application thereof

By regulating the expression of the IGFBP5 gene, the proliferation of sheep ovarian granulosa cells was promoted or inhibited, which solved the problem of insufficient research on the expression characteristics and regulatory function of IGFBP5 in sheep ovarian granulosa cells and achieved the effect of improving sheep reproductive performance.

CN122235154APending Publication Date: 2026-06-19YANGZHOU UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2026-03-20
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

There is a lack of research on the expression characteristics, regulatory functions and molecular mechanisms of IGFBP5 in sheep ovarian granulosa cells in the current technology, which affects the improvement of sheep reproductive performance.

Method used

By regulating the expression level of the IGFBP5 gene, overexpression of the IGFBP5 gene promotes the proliferation of sheep ovarian granulosa cells, while inhibition of IGFBP5 gene expression inhibits cell proliferation. IGFBP5 gene or recombinant vectors and siRNA are used to interfere with IGFBP5 expression, thereby regulating the proliferation and apoptosis of sheep ovarian granulosa cells.

Benefits of technology

The IGFBP5 gene can serve as a regulatory element for sheep ovarian granulosa cells, improving sheep reproductive performance through positive regulation, promoting follicle development and ovulation rate, and cultivating sheep breeds with high reproductive performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122235154A_ABST
    Figure CN122235154A_ABST
Patent Text Reader

Abstract

This invention discloses an IGFBP5 gene associated with the proliferation of sheep ovarian granulosa cells, the nucleotide sequence of which is shown in SEQ ID NO.1. The IGFBP5 gene regulates the proliferation of sheep ovarian cells. This invention investigated the effects of IGFBP5 gene overexpression and inhibition on the proliferation of sheep ovarian granulosa cells. The results showed that IGFBP5 gene overexpression significantly promoted the proliferation of sheep ovarian granulosa cells, while significant inhibition of IGFBP5 gene expression inhibited their proliferation. Therefore, the IGFBP5 gene can serve as a regulatory element for sheep myoblasts, providing a new approach for sheep molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of functional gene technology, specifically relating to an IGFBP5 gene related to the proliferation of sheep ovarian granulosa cells and its application. Background Technology

[0002] In modern sheep farming, reproductive efficiency is a core factor restricting the industry's large-scale and intensive development. Improving ovulation rate and lambing numbers in ewes plays a crucial role in enhancing overall economic benefits and promoting high-quality development of the industry. As the basic functional unit of the ovary, the follicle's development involves continuous and precise stages, including primordial follicle activation, growth follicle proliferation and differentiation, and maturation and ovulation. Ovarian granulosa cells are the most abundant somatic cells within the follicle and are the core functional cells maintaining normal follicle development. Their proliferative activity not only directly regulates the growth and differentiation process of follicles but also determines whether follicles successfully mature and complete ovulation, thus being highly correlated with ewe reproductive performance. Therefore, elucidating the molecular regulatory mechanism of ovarian granulosa cell proliferation in sheep and screening and identifying key functional genes involved in this biological process is not only a core step in clarifying the molecular mechanisms of sheep reproductive traits but also an important prerequisite for breaking through traditional breeding technology bottlenecks and conducting molecular marker-assisted selection and precision breeding.

[0003] The insulin-like growth factor (IGF) signaling pathway is one of the core signaling pathways regulating mammalian reproductive development, widely participating in various physiological processes such as cell proliferation, differentiation, and apoptosis, and playing a key regulatory role in maintaining the normal function of the reproductive system. Insulin-like growth factor binding proteins (IGFBPs), as important regulators of this pathway, can precisely regulate the biological activity, in vivo half-life, and binding efficiency of IGF ligands by specifically binding to them, thereby regulating the physiological functions of target cells and participating in multiple stages of reproductive development. IGFBPs are important members of the IGFBP family, and their regulatory mechanism has a dual nature: they can mediate downstream signal transduction in an IGF-dependent manner to indirectly regulate cell function, and they can also participate in the regulation of cellular physiological functions independently by directly binding to extracellular matrix or cell membrane surface receptors through an IGF-independent pathway. Experiments have shown that IGFBP5 exhibits a distinct stage-specific expression pattern in the ovarian tissues of mammals such as mice, pigs, and cattle, with high expression in granulosa cells of growing follicles and significantly downregulated expression in atretic follicles, indicating that it may play a key regulatory role in the follicular development process. However, there are still relatively few studies on the expression characteristics, regulatory functions and molecular mechanisms of IGFBP5 in sheep ovarian granulosa cells. Summary of the Invention

[0004] This invention addresses the technical problem at hand and overcomes the shortcomings of existing technologies by providing an IGFBP5 gene related to the proliferation of sheep ovarian granulosa cells and its application. The IGFBP5 gene is used to positively regulate the proliferation of sheep ovarian granulosa cells.

[0005] One of the objectives of this invention is to provide an IGFBP5 gene associated with the proliferation of sheep ovarian granulosa cells, the nucleotide sequence of which is shown in SEQ ID NO.1, and the IGFBP5 gene regulates the proliferation of sheep ovarian cells.

[0006] The above-mentioned IGFBP5 gene regulates the proliferation of sheep ovarian granulosa cells in the following ways: overexpression of the IGFBP5 gene promotes the proliferation of sheep ovarian granulosa cells, and inhibition of IGFBP5 gene expression inhibits the proliferation of sheep ovarian granulosa cells.

[0007] This invention analyzes the effect of regulating the expression level of the IGFBP5 gene on the proliferation of sheep ovarian granulosa cells. Experiments confirmed that overexpression of IGFBP5 promotes the proliferation of sheep ovarian granulosa cells, while inhibiting the gene's expression inhibits cell proliferation. Therefore, IGFBP5 can serve as a regulatory element for sheep ovarian granulosa cells, opening up new avenues for molecular breeding of sheep.

[0008] The present invention further provides a recombinant vector containing the IGFBP5 gene.

[0009] The second objective of this invention is to provide the application of the IGFBP5 gene or the recombinant vector in regulating sheep reproductive traits, specifically: the IGFBP5 gene or the recombinant vector containing the IGFBP5 gene improves sheep reproductive traits by positively regulating the proliferation of sheep ovarian granulosa cells, thereby cultivating sheep breeds with high reproductive performance.

[0010] This invention targets the IGFBP5 gene to regulate sheep reproductive traits. By specifically regulating the balance between proliferation and apoptosis of sheep ovarian granulosa cells, it directly affects key reproductive processes such as follicle development and ovulation rate, thereby regulating reproductive traits such as multiple births, number of lambs, and follicle development rate. Based on this target, molecular breeding, cellular regulation, and in vivo targeted intervention methods are constructed to improve sheep reproductive traits, providing technical support for the breeding of high-fertility sheep breeds and the improvement of reproductive performance.

[0011] A third objective of this invention is to provide a reagent for targeting and regulating the IGFBP5 gene, the reagent comprising the recombinant vector containing the IGFBP5 gene or siRNA that specifically interferes with the expression of the IGFBP5 gene, the nucleotide sequence of the siRNA that specifically interferes with the expression of the IGFBP5 gene being shown in SEQ ID NO:2 and SEQ ID NO:3.

[0012] The present invention also provides the application of the above-mentioned reagents in the preparation of products that affect the proliferation of sheep ovarian granulosa cells.

[0013] In the above applications, products containing a recombinant vector of the IGFBP5 gene promote the proliferation of sheep ovarian granulosa cells, while products containing siRNA that specifically interferes with the expression of the IGFBP5 gene inhibit the proliferation of sheep ovarian granulosa cells.

[0014] The above method for promoting the proliferation of sheep ovarian granulosa cells includes: introducing a reagent that promotes the expression of the IGFBP5 gene as described in claim 1 into sheep ovarian granulosa cells.

[0015] This invention constructed an IGFBP5 gene overexpression system and an IGFBP5 gene expression inhibition system to investigate the effects of two regulatory mechanisms on the proliferation of sheep ovarian granulosa cells. The results showed that IGFBP5 gene overexpression significantly promoted the proliferation of sheep ovarian granulosa cells, while significant inhibition of IGFBP5 gene expression significantly inhibited their proliferation. Therefore, the IGFBP5 gene can serve as a regulatory element for sheep ovarian granulosa cells, providing a molecular target for novel molecular breeding techniques related to sheep reproductive performance.

[0016] In summary, this invention clarifies the regulatory role of the IGFBP5 gene on the proliferation of sheep ovarian granulosa cells, and for the first time confirms its application value as a core element in regulating sheep reproductive traits. Compared with existing technologies, it achieves multiple beneficial effects in theoretical research, molecular breeding, and livestock industry applications. Attached Figure Description

[0017] Figure 1 A schematic diagram showing the effects of RT-qPCR detection of IGFBP5 overexpression and interference expression on proliferation marker genes in sheep ovarian granulosa cells.

[0018] Figure 2 A schematic diagram showing the effects of immunoblotting on proliferation marker genes in sheep ovarian granulosa cells by IGFBP5 overexpression and interference expression.

[0019] Figure 3 This is a schematic diagram showing the results of CCK-8 assays on the promotion and inhibition of IGFBP5 in ovarian granulosa cells.

[0020] Figure 4 This is a schematic diagram showing the results of EDU detection of ovarian granulosa cell activity after promoting and inhibiting IGFBP5. Detailed Implementation

[0021] This invention provides a gene IGFBP5 associated with sheep reproductive traits, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0022] In this invention, to clarify the relationship between the IGFBP5 gene and sheep reproductive traits, the effects of overexpressing and inhibiting the expression of the IGFBP5 gene on ovarian granulosa cells were investigated. The results showed that the proliferation marker gene was positively correlated with the expression level of the IGFBP5 gene at both the mRNA and protein levels. Simultaneously, EdU and CCK-8 assays also showed a positive correlation between the activity and proliferation capacity of sheep ovarian granulosa cells and the expression level of the IGFBP5 gene. Therefore, overexpression of the IGFBP5 gene promotes ovarian granulosa cell proliferation. Thus, the IGFBP5 gene can be used to improve sheep reproductive traits and cultivate new high-yielding sheep breeds.

[0023] This invention provides a derivative product containing the IGFBP5 gene, comprising an IGFBP5 gene overexpression recombinant vector and reagents for promoting IGFBP5 gene expression. This invention does not impose any particular limitation on the type of backbone vector for the IGFBP5 gene overexpression recombinant vector; any overexpression vector commonly used in mammalian cells and well-known in the art can be used, such as the pcDNA3.1(+) vector. The reagents for promoting IGFBP5 gene expression preferably include gene elements such as promoters and enhancers.

[0024] This invention provides the application of the IGFBP5 gene or the functional derivative thereof in the breeding of sheep breeds with high reproductive performance.

[0025] In this invention, the preferred method for breeding high-yield sheep breeds is to overexpress the heritable gene IGFBP5 in sheep cells to construct transgenic sheep breeds.

[0026] This invention provides the application of the gene IGFBP5 or its derivatives in improving reproductive traits in sheep.

[0027] This invention also provides the application of reagents that target and regulate IGFBP5 gene expression in the preparation of products that affect sheep ovarian granulosa cells.

[0028] In this invention, the reagents include a recombinant vector containing the IGFBP5 gene or siRNA with nucleotide sequences that interfere with the expression of the IGFBP5 gene, such as those shown in SEQ ID NO. 2 and SEQ ID NO. 3. In embodiments of this invention, the siRNA is obtained by hybridization of DNA fragments with nucleotide sequences shown in SEQ IDN NO. 10 and SEQ IDN NO. 11.

[0029] IGFBP5 gene derivatives can positively regulate the expression of proliferation marker genes in ovarian granulosa cells, thereby promoting ovarian granulosa cell proliferation and improving sheep reproductive performance. Conversely, siRNA that interferes with IGFBP5 gene expression downregulates the expression of IGFBP5 proliferation marker genes in ovarian granulosa cells, inhibiting ovarian granulosa cell proliferation and thus reducing sheep reproductive performance.

[0030] This invention provides a method for promoting the proliferation of sheep ovarian granulosa cells by introducing the gene IGFBP5 or its derivative into sheep ovarian granulosa cells.

[0031] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.

[0032] The materials and reagents mentioned in this invention are available to the public through commercial channels both domestically and internationally, and will not be described in detail here. Example 1

[0033] (1) Construction of IGFBP5 overexpression recombinant vector and interfering fragment A small interfering RNA specifically targeting IGFBP5, namely si-IGFBP5, was designed and synthesized for the IGFBP5 gene sequence (as shown in SEQ ID NO:1), with the following sequences: GCUUGGUGCGUGGACAAGUAUG (SEQ ID NO:2); UACUUGUCCACGCACCAGCAG (SEQ ID NO:3). The above si-IGFBP5 double-stranded interfering fragments were synthesized and purified by Qingke Biotechnology.

[0034] Using the goat IGFBP5 gene CDS sequence (SEQ ID NO.1) as the target fragment, restriction endonucleases were introduced at its 5' and 3' ends, respectively. BamH I and Not The IGFBP5 gene coding region fragment was cloned into the pcDNA3.1(+) vector via double enzyme digestion and directional ligation at the I restriction site. After enzyme digestion identification and sequencing verification, the IGFBP5 gene overexpression recombinant vector, denoted as oe-IGFBP5, was obtained. The above vector construction and sequencing verification were entrusted to Qingke Biotechnology.

[0035] (2) Cell transfection experiment of IGFBP5 overexpression recombinant vector and interfering fragment Based on the IGFBP5 sequence, an oe-IGFBP5 overexpression vector and a si-IGFBP5 fragment were designed and synthesized, and then transfected into sheep ovarian granulosa cells, respectively. A blank control group and a negative control group were also set up to verify the transfection efficiency and the regulatory effect of IGFBP5 gene expression. The specific experimental steps are as follows: Sheep ovarian granulosa cells that have reached the logarithmic growth phase were seeded into 6-well cell culture plates, with approximately 5 × 10⁶ cells per well. 5 / well, place in an incubator and culture until the cell density reaches 50%–70% before transfection; Discard the complete culture medium in the 6-well cell culture plate, gently rinse the cell surface once with sterile PBS buffer, discard the PBS buffer, add 900 µL of serum-free DMEM / F-12 basal medium to each well, and incubate in an incubator for 30 min to stabilize. Prepare the overexpression vector transfection group: In tube A (target vector + basal medium), take 15 µL of oe-IGFBP5 vector plasmid and add 50 µL of basal medium, then gently pipette to mix; In tube B (transfection reagent + basal medium), take 3 µL of transfection reagent (using Gemma Gene GP-transfect-Mate, catalog number: G04008) and add 50 µL of basal medium, then gently mix; Slowly add the solution from tube B to tube A, gently pipette to mix, and let stand at room temperature for 20 min to allow the vector plasmid and transfection reagent to form a stable transfection complex. Prepare the interference fragment transfection group: In tube A (siRNA + basal medium), take 15 µL of siRNA fragment, add 50 µL of basal medium, and gently pipette to mix; In tube B (transfection reagent + basal medium), take 3 µL of transfection reagent, add 50 µL of basal medium, and gently mix; Slowly add the solution from tube B to tube A, gently pipette to mix, and let stand at room temperature for 20 min. Control group configuration: oe-NC (empty vector control group), with empty vector plasmid pcDNA3.1 (+) replacing oe-IGFBP5, and the remaining steps are the same as the overexpression vector transfection steps; si-NC group (interference negative control group), with Si-IGFBP5 control group si-NC replacing siRNA, and the remaining steps are the same as the interference fragment transfection steps. Slowly add the prepared transfection mixtures to the corresponding wells of the cell culture plate. After adding, gently shake the culture plate to distribute the transfection mixture evenly on the cell surface. The culture plates were placed in a constant temperature incubator and incubated statically for 6 hours. The culture medium was then replaced with complete culture medium, and the cells were cultured for another 48 hours before being collected. The complete culture medium consisted of basal medium + 10% fetal bovine serum (FBS) + 1% penicillin / streptomycin.

[0036] (3) Total RNA extraction from sheep ovarian granulosa cells 48 h after transfection, discard the culture medium, add 1 ml Trizol to each well, and let stand for 10 min. Transfer the liquid to a 1.5 ml enzyme-free tube, add 200 µL of chloroform, vortex for 15 s, and let stand for 10 min. Centrifuge at 12000 rpm at 4 °C for 15 min, aspirate the supernatant and transfer to a new enzyme-free tube, add an equal volume of isopropanol, and let stand for 10 min. Centrifuge at 12000 rpm at 4 °C for 10 min, discard the supernatant, add 1 mL of 75% ethanol, centrifuge at 12000 rpm at 4 °C for 5 min, and discard the supernatant. Dry at room temperature for 2 min, dissolve in DEPC water, measure RNA concentration and purity, and store at -80 °C.

[0037] (4) Detect the effect of IGFBP5 overexpression or interference on the expression of proliferation marker genes in ovarian granulosa cells. ① RT-qPCR detection Using total RNA from goat ovarian granulosa cells as a template, RT-qPCR reaction systems were prepared using primers PCNA-F (TAGCCGTGTCATTGCGACTC, SEQ ID NO:4) / PCNA-R (TTCACGCCACTTGAGCTGAT, SEQ ID NO:5), CDK2-F (CGAGCACCGGAAATCCTTCT, SEQ ID NO:6) / CDK2-R (CGGGTCACCATCTCAGCAAA, SEQ ID NO:7), and CyclinD1-F (GGCGGGGAACAGTTTCCTAA, SEQ ID NO:8) / CyclinD1-R (CCCACTTCCGCTAACACCAT, SEQ ID NO:9). The reaction system consisted of: 2 μL template, 0.4 μL primer F, 0.4 μL primer R, 10 μL TB Green Premix Ex Taq II Fast qPCR (2X), and 7.2 μL H2O. The internal control gene was β-actin, and the internal control primers were β-actin-F (AACTTGCGCAGAAAACGAGA, SEQ ID NO:10) and β-actin-R (GATGCTCGATCCAACCGACT, SEQ ID NO:11). The reaction program was 95℃ for 30 seconds, 95℃ for 10 seconds, 95℃ for 5 seconds, and 60℃ for 10 seconds, for a total of 40 cycles. After the reaction, the relative expression levels of the experimental data were calculated using the 2-ΔΔCt method, and the results are shown below. Figure 1IGFBP5 expression was overexpressed or suppressed in cells, and the expression levels of proliferation marker genes were detected by RT-qPCR. The results showed that the expression levels of PCNA, CDK2, and Cyclin D1 increased significantly after IGFBP5 overexpression, and the expression levels of PCNA, CDK2, and Cyclin D1 decreased significantly after IGFBP5 suppression.

[0038] ② Protein extraction and Western blot detection Collect approximately 1x10 cells from each group. 6 Afterward, the cell pellet was resuspended (100 μL per tube) in a cell lysis buffer containing phosphatase inhibitors and protease inhibitors, and lysed on ice for 10 min after pipetting. The mixture was then centrifuged at 12000 g for 15 min at 4 °C, and the supernatant was collected as the total protein extract. 5× loading buffer was added at a protein:loading buffer ratio of 4:1, and the mixture was boiled at 100 °C for 10 min to denature the protein.

[0039] Prepare BCA working solution according to the sample quantity, using a volume ratio of reagent A: reagent B = 50:1. Add 25 μL of each diluted protein sample to a 96-well plate. Add 200 μL of the prepared BCA working solution to each well and incubate at 37°C for 30 min. Measure the absorbance at 562 nm using a microplate reader.

[0040] After cleaning and drying the glass plates, align the bottoms of two glass plates and place them in the gel holder, securing them with clips. Pour separating gel to 3 / 4 of the glass plate height, seal with distilled water, let stand for 30 minutes, pour out the water, fill with stacking gel, insert the comb, and let stand for 1 hour until solidified. After the stacking gel has solidified, gently remove the comb. Denature the proteins in a 95°C water bath, and after cooling, dilute 5× loading buffer to 1× with protein. Determine the protein loading amount based on the gel well size and experimental requirements. Insert the glass plates into the gel tank, fix them, and place them in the electrophoresis apparatus. Pour electrophoresis buffer into the electrophoresis apparatus to fill the gel tank, load the samples, and add 4 μL of pre-stained protein marker at the edge.

[0041] Set the electrophoresis voltage to 130 V and start electrophoresis. After the pre-stained protein marker bands separate, change the voltage to 180 V and continue electrophoresis. Stop electrophoresis when the loading buffer is about to run out. Cut off the unwanted portions according to the pre-stained protein markers, leaving only the necessary portions. Cut the PVDF membrane to be slightly larger than the gel size. Soak the PVDF membrane in ethanol for 2 min, then remove it and place it in a wet transfer apparatus in a specific order. Use a glass rod to repeatedly squeeze out air bubbles. Place the transfer apparatus in an ice bath with an ice box inside, cover it, and transfer at 250 mA for 80-90 min. After transfer, remove the PVDF membrane and block it with 5% skim milk at room temperature for 1 h. Take 30 mL of TBST (adjust the amount according to the specific usage), and add the primary antibody (CDK2 (Affinity), cyclin D1 (Wuhan Sanying), β-actin (Affinity), 1:1000 dilution) according to the dilution ratio. Place the PVDF membrane in the primary antibody and incubate overnight at 4°C. Remove the PVDF membrane, wash it three times with TBST for 5 min each time, then place it in secondary antibody incubation solution (rabbit antibody and mouse antibody, diluted 1:5000) and incubate at room temperature for 1 h. Wash it three times with TBST for 5 min each time, and then perform color development. HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG were used as secondary antibodies.

[0042] The two reagents from the ECL ultraluminescence kit were mixed in a 1:1 ratio to prepare the luminescent solution. The solution was then uniformly dropped onto a PVDF membrane and developed using a chemiluminescence imaging system. ImageJ software was used to analyze the band grayscale values; the ratio of the grayscale value of the target protein to that of β-actin represents the relative expression level of the target protein. Results are shown below. Figure 2 Overexpression or inhibition of IGFBP5 expression in cells, and Western blot analysis of growth factor expression levels showed that overexpression of IGFBP5 significantly increased the expression levels of PCNA, CDK2, and Cyclin D1, while inhibition of IGFBP5 significantly decreased the expression levels of these three growth factors.

[0043] (5) Detection of ovarian granulosa cell proliferation ① CCK-8 assay for ovarian granulosa cell proliferation Primary sheep ovarian granulosa cells in logarithmic growth phase were seeded at an appropriate density into 96-well plates and cultured at 37°C for 12 h. Cells were then transfected using the method described above. The experiment consisted of four groups: si-NC, si-IGFBP5, oe-NC, and oe-IGFBP5. After transfection, cells were incubated at 37°C for another 24 h. After incubation, the supernatant was discarded, and 100 μL of medium containing 10% CCK8 was added to the cells, followed by incubation at 37°C for 2 h. Finally, the absorbance of the samples at 450 nm was measured using a microplate reader.

[0044] ② EdU detection of ovarian granulosa cell proliferation Cells were grouped and transfected as described above. Two hours before the cell culture was complete, 2×EdU working solution (250 μl per well) was prepared using culture medium. The original culture medium was discarded, and the prepared 2×EdU working solution was added to bring the final EdU concentration to 10 μM. The cells were incubated at 37°C for 2 hours. The culture plate was removed, and the EdU staining solution in the wells was discarded. 500 μl of fixative (4% paraformaldehyde) was added to each well, and the cells were fixed at room temperature for 15 minutes. The fixative was removed, and the cells were washed three times with 1 ml of washing buffer for 3-5 minutes each time. The washing buffer was removed, and the cells were incubated at room temperature for 10-15 minutes with 1 ml of permeabilizer for 10-25 minutes with 1 ml of washing buffer for 3-5 minutes each time with 1 ml of washing buffer. The washing buffer was removed, and 0.5 ml of Click reaction solution was added to each well. The culture plate was gently shaken to ensure that the reaction mixture evenly covered the sample. The cells were incubated at room temperature in the dark for 30 minutes. Remove the Click reaction solution from the wells, wash three times with washing buffer for 3-5 minutes each time. Discard the washing buffer, and perform nuclear staining with DAPI for 5 minutes. Discard the DAPI, wash twice with washing buffer, and then take a fluorescence photograph and save the image. The results are shown in [Figure number missing]. Figure 4 , Figure 3 The results from CCK-8 and EdU studies showed that inhibition of IGFBP5 significantly decreased the activity of ovarian granulosa cells, while overexpression of IGFBP5 significantly increased their activity.

[0045] This invention analyzes the effects of IGFBP5 overexpression and IGFBP5 repression on the expression of proliferation marker genes (PCNA, CDK2, and Cyclin D1) in sheep ovarian granulosa cells. The results show that IGFBP5 overexpression promotes the expression of these proliferation marker genes in sheep ovarian granulosa cells, while IGFBP5 repression inhibits their expression. This indicates that IGFBP5 positively regulates the expression of these proliferation marker genes in ovarian granulosa cells. Furthermore, this invention also investigates the effects of IGFBP5 overexpression and IGFBP5 repression on ovarian granulosa cell proliferation. The results show that IGFBP5 overexpression promotes ovarian granulosa cell proliferation, while IGFBP5 repression inhibits it. Therefore, the IGFBP5 gene provided by this invention can positively regulate ovarian granulosa cell proliferation and can serve as a regulatory element for ovarian granulosa cells, providing a new approach for sheep molecular breeding.

[0046] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An IGFBP5 gene associated with the proliferation of sheep ovarian granulosa cells, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1. The IGFBP5 gene regulates the proliferation of sheep ovarian cells.

2. The IGFBP5 gene according to claim 1, characterized in that, The IGFBP5 gene regulates the proliferation of sheep ovarian granulosa cells in the following ways: overexpression of the IGFBP5 gene promotes the proliferation of sheep ovarian granulosa cells, and inhibition of IGFBP5 gene expression inhibits the proliferation of sheep ovarian granulosa cells.

3. A recombinant vector containing the IGFBP5 gene.

4. The application of the IGFBP5 gene as described in claim 1 or the recombinant vector as described in claim 3 in regulating sheep reproductive traits, characterized in that, The IGFBP5 gene or recombinant vector containing the IGFBP5 gene improves sheep reproductive traits and breeds high-reproductive-performance sheep by positively regulating the proliferation of sheep ovarian granulosa cells.

5. A reagent for targeting and regulating the IGFBP5 gene of claim 1, characterized in that, The reagent includes the recombinant vector containing the IGFBP5 gene as described in claim 3 or the siRNA that specifically interferes with the expression of the IGFBP5 gene, wherein the nucleotide sequence of the siRNA that specifically interferes with the expression of the IGFBP5 gene is shown in SEQ ID NO:2 and SEQ ID NO:

3.

6. The use of the reagent as described in claim 5 in the preparation of products that affect the proliferation of sheep ovarian granulosa cells.

7. The application according to claim 6, characterized in that, Products containing a recombinant vector of the IGFBP5 gene promote the proliferation of sheep ovarian granulosa cells, while products containing siRNA that specifically interferes with the expression of the IGFBP5 gene inhibit the proliferation of sheep ovarian granulosa cells.

8. A method for promoting the proliferation of granulosa cells in sheep ovaries, characterized in that, The reagent that promotes the expression of the IGFBP5 gene as described in claim 1 was introduced into sheep ovarian granulosa cells.