Aspergillus strain BJ-T6F3 and application thereof in preventing and treating plant diseases

By using a suspension of conidia from the Aspergillus ochraceopetaliformis strain BJ-T6F3, the problem of controlling soil-borne diseases such as tomato wilt in greenhouse agriculture has been solved, achieving effective inhibition of various plant pathogens and promotion of plant growth.

CN122214151APending Publication Date: 2026-06-16BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Filing Date
2026-04-02
Publication Date
2026-06-16

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses an Aspergillus strain BJ-T6F3 and application thereof in preventing and treating plant diseases. Aspergillus ochraceopetaliformis The Aspergillus strain is named Aspergillus ochraceus, named BJ-T6F3, and has a registration number of CGMCC No. 42312 in the General Microbiological Center of China Microorganism Strain Preservation Management Committee. The Aspergillus strain BJ-T6F3 has broad-spectrum bacteriostatic activity, and has good inhibiting effects on 23 kinds of plant pathogenic fungi such as cotton pathogenic bacteria, wheat pathogenic bacteria, corn pathogenic bacteria, grape pathogenic bacteria, cherry pathogenic bacteria, stone fruit pathogenic bacteria and solanaceous crop pathogenic bacteria. Moreover, the Aspergillus strain BJ-T6F3 has obvious growth promoting effects on plants such as tomatoes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological control technology for plant diseases, specifically relating to a strain of Aspergillus (… Aspergillus ochraceopatelliform ) and its application in the prevention and control of plant diseases such as tomato wilt. Background Technology

[0002] With the continuous development of facility agriculture, tomatoes are widely cultivated in both northern and southern my country. In 2020, the tomato planting area in my country was approximately 1.103 million hectares. 2 Among them, the planting area of ​​greenhouse tomatoes reached 331,000 hm² (Analysis of the current status and development trend of my country's tomato industry. Modern Agriculture, 2025, (12): 78-82). The production of greenhouse tomatoes is characterized by high multiple cropping index, large amount of fertilizer, strong enclosure, and high temperature and humidity, which can easily lead to a decline in soil quality, a reduction in soil microbial diversity, and an increase in the number of pathogens, ultimately resulting in frequent occurrences of soil-borne diseases and increasingly serious damage.

[0003] Biological control is a green technology that uses microorganisms and their metabolites to inhibit the activity of pathogens. It has the advantages of no pesticide residues, environmental friendliness, and the ability to maintain farmland ecosystems. In recent years, with increasing attention to the potential hazards of chemical pesticides and the problem of pathogen resistance, biological control has gained widespread attention and application globally. Currently, there are reports of various fungi being used for crop disease control. Among them, *Trichoderma* is a more extensively studied fungus. It is widely distributed in soil and is effective against various plant pathogens, making it one of the most effective biocontrol fungi for disease control. For example, *Trichoderma harzianum* is effective in controlling corn rust, small leaf spot and large leaf spot, tomato early blight, strawberry root rot, and other diseases. *Trichoderma tumefaciens* also has a good control effect on silage corn stalk rot. In addition, non-pathogenic *Fusarium oxysporum* and *Paecilomyces lilacinus* have also been extensively studied in the control of soil-borne fungal diseases and nematode diseases. *Aspergillus* fungi (…) Aspergillus Due to its metabolic diversity and uniqueness, it occupies an important position in many fields, such as... Aspergillus niger , Aspergillus flavus , Aspergillus oryzae Aspergillus fungi have wide applications in industrial fermentation, feed production, drug production, and biodegradation. Furthermore, research on plant diseases using Aspergillus is increasingly focused on species like salt-tolerant Aspergillus terreus. Aspergillus terreus It has an inhibitory effect on Sclerotinia sclerotiorum, Fusarium graminearum, and Botrytis cinerea, and Aspergillus sclerotiorum (… Aspergillus sclerotiorum It has antagonistic effects against rice bacterial blight pathogens; the Aspergillus fungi we isolated... Aspergillus ochraceopetaliformisCurrently, this strain has only been reported in the field of pharmaceutical chemistry for metabolite analysis. This study found that the strain has broad antibacterial activity against a variety of crop pathogenic fungi, and can effectively prevent the occurrence of tomato wilt and promote the growth of tomato seedlings. This has not been reported in the biological control of crop diseases. Summary of the Invention

[0004] The purpose of this invention is to provide an Aspergillus strain ( Aspergillus ochraceopetaliformis BJ-T6F3 and its application in the prevention and control of plant diseases. This bacterium has a broad antibacterial spectrum and can effectively inhibit common plant pathogenic fungi. It has inhibitory effects on cotton pathogens, wheat pathogens, corn pathogens, grape pathogens, cherry pathogens, stone fruit pathogens, and solanaceous crop pathogens. It also has a significant control effect on tomato wilt.

[0005] Aspergillus of the present invention ( Aspergillus ochraceopetaliformis The rhizosphere soil samples were collected and isolated from tomato rhizosphere soils in greenhouses affected by Fusarium wilt in Fangshan District, Beijing, and were classified and named as follows: Aspergillus ochraceopatelliform The specimen, named BJ-T6F3, was deposited on November 12, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCCNo. 42312.

[0006] The Aspergillus BJ-T6F3 strain of this invention forms round or nearly round colonies when cultured on PDA plates, with white hyphae that later produce a light brown pigment. Based on IT , TUB , LSU Genetic molecular identification identified the strain as Aspergillus ochraceopetaliformis This strain possesses the ability to decompose cellulose, solubilize phosphorus, fix nitrogen, and produce IAA.

[0007] This invention also provides the application of the Aspergillus strain BJ-T6F3 in the control of common plant pathogenic fungal diseases, which exhibits broad-spectrum antifungal activity. The plant pathogenic fungus is *Verticillium dahliae* (…). Verticillium dahliae Fusarium graminearum ( ) Fusarium gramineae ), wheat root rot flat mite spore ( Bipolaris sorokiniana ), large spot disease bulging umbelliferous worms ( Turkish sedge ), Dioscorea opposita ( Lasiodiplodia theobromae ), Staphylococcus aureus ( Botryosphaeria dothidea ), Sweet Cherry Interstellar Shell ( You will be a diaspora. ), Paraeutypella lemon Brown-spotted schizocarp ( Rosellinia necatrix ), oak pseudostem spot ( Nothopoma quercina Pear tree rot disease Cytospora leucosperma Botrytis cinerea (tomato) Botrytis cinerea ), Brown nail spores ( Yellow passerine Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f. sp. Tomatoes Fusarium oxysporum tomato neck rot and root rot specialized type ( Fusarium oxysporum f. sp.radicis- tomatoes ), Fusarium oxysporum cucumber-specific type ( Fusarium oxysporum f. sp. cucumerinum ), Fusarium solani ( Fusarium chlamydosporum ), Cucumber fusarium ( Plectosphaerella cucumber ), *Cyclocarya paliurus* ( Corynespora cassicola Rhizoctonia solani ( ) Rhizoctonia nightshade ), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum Fusarium solani () Fusarium solani Phytophthora ( Phytophthora capsicum One or more of the following.

[0008] The present invention also provides the application of the Aspergillus strain BJ-T6F3 in the prevention and control of tomato wilt and the promotion of tomato growth, which can be used to prepare biopesticides or microbial fertilizers.

[0009] The application of the Aspergillus strain BJ-T6F3 or its antibacterial active substances in the preparation of biopesticides and / or biofertilizers with antagonistic activity against plant pathogenic fungi and / or growth-promoting effects on plants also falls within the scope of protection of this invention.

[0010] The application of the Aspergillus strain BJ-T6F3 in promoting the growth of plant seedlings also falls within the scope of protection of this invention. Preferably, in this application, the method for promoting the growth of plant seedlings involves diluting the Aspergillus BJ-T6F3 conidia to 1×10⁻⁶. 7 The plant, preferably tomato, is treated by root irrigation at a concentration of CFU / mL.

[0011] Compared with the prior art, the beneficial effects of the present invention include: (1) The Aspergillus strain BJ-T6F3 of this invention has broad-spectrum antibacterial activity, showing good inhibitory effects on 23 kinds of plant pathogenic fungi, including cotton pathogens, wheat pathogens, corn pathogens, grape pathogens, cherry pathogens, stone fruit pathogens, and solanaceous crop pathogens. Among them, Aspergillus strain BJ-T6F3 has a specific inhibitory effect on Fusarium oxysporum tomato neck rot and root rot caused by Tomato neck rot and root rot. Fusarium oxysporum f. sp. tomato root rot The colony-inhibiting effect is the best, with an inhibition rate of up to 82.50%.

[0012] (1) The Aspergillus BJ-T6F3 conidial suspension of the present invention can effectively control tomato wilt caused by Fusarium oxysporum after root irrigation of potted tomatoes, and has a good preventive effect with a control efficacy of up to 60.06%, which is significantly different from the control efficacy of the control Trichoderma treatment.

[0013] (2) The Aspergillus BJ-T6F3 of the present invention has a significant growth-promoting effect on plants such as tomatoes. Attached Figure Description

[0014] Figure 1 Colony morphology of BJ-T6F3. A shows the front view of BJ-T6F3 strain; B shows the back view of BJ-T6F3 strain.

[0015] Figure 2 Phylogenetic tree based on ITS, TUB, and LSU.

[0016] Figure 3 The antibacterial activity of BJ-T6F3 against different plant pathogenic fungi.

[0017] Figure 4 Determination of the antibacterial and growth-promoting abilities of BJ-T6F3. A is the cellulase production capacity assay; B is the nitrogen fixation capacity assay; C is the IAA production capacity assay (1 is the treatment, 2 is the control).

[0018] Figure 5 Effect of BJ-T6F3 on the prevention and control of tomato wilt in indoor potted plants.

[0019] Figure 6 Determination of the number of days that BJ-T6F3 induces resistance in tomato plants.

[0020] Figure 7 The growth-promoting effect of BJ-T6F3 on tomato seedlings.

[0021] Figure 8 The growth-promoting effect of BJ-T6F3 on wheat seeds. A shows the growth of wheat seedlings after 10 days of growth; B shows the root length of wheat seedlings after 10 days of growth; C shows the germination rate data of wheat; D shows the seedling length data of wheat; E shows the root length data of wheat.

[0022] Figure 9 Changes in peroxidase (POD) activity in tomato plants after inoculation with BJ-T6F3.

[0023] Figure 10 Changes in catalase (CAT) activity in tomato plants after inoculation with BJ-T6F3.

[0024] Preservation of biological materials

[0025] Name: Aspergillus ochreus ( Aspergillus ochraceopetaliformisBJ-T6F3; Classification and nomenclature: Aspergillus ochreus Aspergillus ochraceopetaliformis ; Date of preservation: November 12, 2025; Preservation institution: China General Microbiological Culture Collection Center (Address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing); Accession number: CGMCC No.42312. Detailed Implementation

[0026] Example 1: Isolation, screening and identification of Aspergillus BJ-T6F3 1. Soil sampling Rhizosphere soil samples of tomato plants collected in a greenhouse in Fangshan District, Beijing, in May 2023, where tomato wilt disease had occurred.

[0027] 2. Isolation and purification of strains Rhizosphere soil sample preparation: Place 2.5 g of rhizosphere soil sample into a centrifuge tube containing 22.5 mL of sterile water, and shake on a constant temperature shaker at 180 rpm / min until thoroughly mixed to obtain a concentration of 1×10⁻⁶. -1 A soil suspension of g / mL was prepared. To better isolate and culture the microorganisms, it was serially diluted to obtain 1×10⁻⁶ g / mL. -2 1×10 -3 1×10 -4 5×10 -4 1×10 -5 The soil dilution solution is ready for use.

[0028] Five different culture media were used for microbial isolation: Rhodium Bacillus Methane (RBM), Corn Flour Agar (CMA), Malt Extract Agar (MEA), 1 / 10 Potato Agar (1 / 10 PDA), and Soil Extract Agar (SEA). 100 μL of rhizosphere soil suspensions of different concentrations were spread onto each of the above media and incubated at 25°C. Once colonies grew, bacteria were promptly picked onto new PDA plates for rhizosphere bacterial isolation, purification, culture, and preservation.

[0029] 3. Screening of strains 3.1 Flat Standoff Method Inoculate the center of a PDA medium plate with Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f. tomato sp. The isolated and purified fungal strains were inoculated at four points 3 cm away from the fungal cake using the four-point inoculation method, while the control group was inoculated with only the pathogen. The mixtures were incubated at 25°C, and the inhibition rate was observed and the width of the inhibition band was measured. Each treatment was repeated three times.

[0030] 3.2 Detached Leaf Standoff Method Leaves of similar size at the 5-6 leaf stage were cut from healthy tomato plants and disinfected with 75% alcohol for approximately 2-3 seconds to remove surface microorganisms. After drying, the leaves were placed in a transparent box lined with sterile, damp filter paper for later use. The experiment included a treatment group and a control group, with each group inoculated solely with the pathogen *Fusarium oxysporum* tomato-specific strain (…). Fusarium oxysporum f. sp.lycopersici The control group consisted of the strain to be screened (left) and the pathogen (right) inoculated separately on both sides of the main vein of the leaf, with a spacing of about 1 cm. The leaves were cultured at room temperature and kept moist for 6-8 days, and the disease incidence was observed.

[0031] Based on the disease incidence on the leaves after the confrontation, the disease was divided into five levels: level 0, level 1, level 2, level 3, and level 4, in order to further evaluate the biocontrol effect of the strains to be screened.

[0032] The severity levels of the disease are classified as follows: Grade 0: Leaves remain green overall, with no disease spots. Grade 1: Leaves show signs of chlorosis, and the area of ​​lesions is less than 1 / 4 of the leaf area; Grade 2: Leaves show signs of chlorosis, with lesions covering 1 / 4 to 1 / 2 of the leaf area, accompanied by some punctate lesions; Grade 3: Most of the leaves lose their green color, and the lesion area accounts for 1 / 2 to 3 / 4 of the leaf area; Level 4: Leaves are completely chlorotic, and the lesion area covers more than 3 / 4 of the leaf area.

[0033] Based on the screening results of the plate confrontation method and the detached leaf confrontation method, strains with strong inhibitory effects on pathogens were selected, which are the Aspergillus ochraceus strains described in this invention. Aspergillus ochraceopetaliformis )BJ-T6F3.

[0034] 4. Identification of strains Aspergillus BJ-T6F3 colonies on PDA plates are round or nearly round, with white hyphae that may produce light brown pigment later. Figure 1 DNA extraction from strain BJ-T6F3 was performed using a genomic extraction kit (Tiangen Biotech, Beijing). Using the genomic DNA of strain BJ-T6F3 as a template, fungi were selected... IT Universal primers for genes IT 1 and IT 4. TUB Universal primers for genes TUB Bt-2a and TUB Bt-2b and LSU Universal primers for genes LSU LROR and LSULR5 was used for PCR amplification. The primer sequences were as follows: ITS-1:TCCGTAGGTGAACCTGCGG, ITS-4:TCCTCCGCTTATTGATATGC, TUB Bt-2a:GGTAACCAAATCGGTGCTGCTTTC, TUB Bt-2b:ACCCTCAGTGTAGTGACCCTTGGC, LSU LROR: GTACCCGCTGAACTTAAGC, LSU LR5:TCCTGAGGGAAACTTCG。

[0035] The PCR reaction mixture consisted of (25 µL): 22 µL 1.1×S4 Fidelity PCR Mix, 1 µL DNA template, and 1 µL... IT 1 / TUB Bt-2a / LSU LROR, 1 µL IT 4 / TUB Bt-2b / LSU LR5.

[0036] IT The gene PCR amplification reaction program was as follows: 98 °C pre-denaturation for 2 min, 98 °C denaturation for 10 s, 52 °C annealing for 15 s, 72 °C extension for 1 min, 34 cycles, and a final extension at 72 °C for 5 min, and the reaction was terminated at 4 °C.

[0037] TUB The gene PCR amplification reaction program was as follows: 98 ℃ pre-denaturation for 2 min, 98 ℃ denaturation for 10 s, 58 ℃ annealing for 15 s, 72 ℃ extension for 15 s, 34 cycles, and a final extension at 72 ℃ for 5 min, and the reaction was terminated at 4 ℃.

[0038] LSU The gene PCR amplification reaction program was as follows: 94 °C pre-denaturation for 3 min, 94 °C denaturation for 30 s, 52 °C annealing for 30 s, 72 °C extension for 1 min, 34 cycles, and a final extension at 72 °C for 7 min, and the reaction was terminated at 4 °C.

[0039] PCR amplification products were detected by 1% agarose gel electrophoresis and then sent to Beijing Nuosai Genome Research Center Co., Ltd. for sequencing. The obtained strain BJ-T6F3 was then analyzed. TUB Gene sequence (SEQ ID No. 1) and IT Gene sequence (SEQ ID No. 2) and LSU The gene sequence (SEQ ID No. 3) was compared with sequences in the GenBank database on the NCBI website to obtain the strain species with the highest similarity.

[0040] The comparison results showed that the gene sequence of strain BJ-T6F3 was consistent with that of known Aspergillus fungi in the database. Aspergillus ochraceopatelliform CBS 123.55 TUB The gene sequence (GenBank sequence number: AY819955.1) showed a high degree of identity with a confidence level of 99.64%. IT The gene sequence (GenBank sequence number: MH857406.1) has a similarity of 99.66%. LSU The gene sequence (GenBank sequence number: NG_069682.1) has a 100.00% similarity, and it has been preliminarily identified as... Aspergillus ochraceopetaliformis Closely related strains.

[0041] Gene sequences of related strains with high homology were downloaded, and then multi-gene phylogenetic construction analysis was performed using the maximum likelihood (ML) method. The results showed that ( Figure 2 BJ-T6F3 strain and Aspergillus ochraceopetaliformis and Aspergillus pulvericola They are closely related, but... Aspergillus ochraceopetaliformis Based on the fact that the strain clustered on one branch and had a bootstrap support rate of 98%, strain BJ-T6F3 was identified as *Aspergillus ochreae*. Aspergillus ochraceopatelliform The strain BJ-T6F3 was deposited at the China General Microbiological Culture Collection Center (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing) on ​​November 12, 2025, with accession number CGMCC No. 42312.

[0042] Example 2: Determination of the antibacterial activity of Aspergillus BJ-T6F3 against common plant pathogens. Growth inhibition tests were conducted on the isolated *Aspergillus* BJ-T6F3 against pathogens of cotton, wheat, maize, grapes, cherry, stone fruit, and solanaceous crops. The plate confrontation culture method was used, and *Verticillium dahliae* (a type of fungus) cultured at 25 °C for 3-7 days on PDA medium was cut using a 5 mm punch. Verticillium dahliae Fusarium graminearum ( ) Fusarium gramineae ), wheat root rot flat mite spore ( Bipolaris sorokiniana ), large spot disease bulging umbelliferous worms ( Turkish sedge ), Diplosporum cocovenenans (Lasiodiplodia theobromae ), Staphylococcus aureus ( Botryosphaeria dothidea ), Sweet Cherry Interstellar Shell ( You will be a diaspora. ), Paraeutypella citricola Brown-spotted schizocarp ( Rosellinia necatrix ), oak pseudostem spot ( Nothopoma quercina Pear tree rot disease Cytospora leucosperma Botrytis cinerea (tomato) Botrytis cinerea ), Brown nail spores ( Yellow passerine Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f. sp. Lycopersici Fusarium oxysporum tomato neck rot and root rot specialized type ( Fusarium oxysporum f. sp.root-lycopersici ), Fusarium oxysporum cucumber-specific type ( Fusarium oxysporum f. sp. cucumber ), Fusarium solani ( Fusarium chlamydosporum ), Cucumber fusarium ( Plectosphaerella cucumerina ), *Cyclocarya paliurus* ( Corynespora cassicola Rhizoctonia solani ( ) Rhizoctonia solani ), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum Fusarium solani () Fusarium nightshade Phytophthora ( Phytophthora capsici The mycelial cakes at the edge of the colony were placed approximately 2 cm from the edge of the PDA plate, and the mycelial cakes of Aspergillus BJ-T6F3 were placed approximately 2 cm from the edge of the PDA plate on the other side. A control was used, inoculating only the pathogen. This was repeated 3 times. The mixture was incubated at 25 ℃ until the radius of the control pathogen exceeded the inoculation point of the Aspergillus BJ-T6F3 mycelial cake. The colony radius was then measured, and the inhibition rate was calculated (Table 1). Figure 3 ).

[0043] Inhibition rate (%) = (Coronation radius of control pathogen - Colony radius of treated pathogen) / Colony radius of control pathogen × 100% Table 1. Antifungal activity of Aspergillus BJ-T6F3 against different plant pathogenic fungi Disease name Pathogens strain number Antibacterial rate (%) wheat scab Fusarium graminearum PH-1 69.09±0.90 Wheat root rot wheat root rot and umbilical worms XMGF1 80.00±1.20 Maize leaf spot Large spot disease with protruding umbilicus YMDB1 81.63±1.10 cotton Verticillium wilt Verticillium dahliae MHHW 67.21±1.02 grape canker Cocoyoma dispora GX-5-5 59.18±1.06 grape canker Staphylococcus aureus GXZY-02S 77.19±1.01 Grapevine blight Sweet Cherry Blossom Seat Shell 26-2SA 66.67±0.91 Grape rot 2FND-1S9-S1 67.50±1.12 Grape white spot disease Brown-spotted sclerotium QX1R1-3-S1 78.05±1.50 cherry branch blight Oak pseudostem spot SDZG31-A-S3 65.22±1.19 Pear tree rot disease Pear tree rot disease Y220 69.04±1.01 Tomato gray mold Botrytis cinerea FSHCHFQY Gray mold 62.50±0.23 Tomato leaf mold Brown nail spores FSHCHFQY Leaf mold 77.78±0.46 Tomato Fusarium wilt Fusarium oxysporum tomato-specific strain FSKSFQGJ-2 9-10A2 63.16±1.09 Tomato neck rot and root rot Fusarium oxysporum tomato neck rot and root rot specialized type FQJGF-FORL 82.50±1.22 Cucumber wilt Fusarium oxysporum cucumber-specific strain HGKW-FOC 63.83±0.98 Cucumber root rot Fusarium chlamydosporium HGHB-FC 75.93±0.93 Cucumber root rot Cucumber spores HGZQQ-PC 46.01±0.52 Cucumber brown spot disease Multi-master spores JKHZF 1-2 65.52±0.43 Eggplant damping-off Rhizoctonia solani QZLK-RS 43.54±0.02 Sclerotinia stem rot of eggplant Sclerotium FSHCHQZJJ sclerotium 67.34±1.21 Pepper root rot Fusarium solani TZLJG GA1 69.64±1.03 pepper blight Phytophthora PC2 72.73±0.19 Example 3: Aspergillus BJ-T6F3 Antibacterial and Growth-Promoting Determination 3.1 Amylase detection Test culture medium: 10 g soluble starch, 5 g yeast powder, 10 g peptone, 10 g NaCl, 17 g agar, 1000 mL water.

[0044] Detection method: From strains cultured at 25℃ for 6 days, mycelial cakes were collected using a 5 mm diameter punch and inoculated onto test medium, with 3 petri dishes inoculated. The petri dishes were then incubated at 25℃ for 3 days. The amylase test medium was then submerged in Lugol's iodine solution. A clear, transparent hydrolysis zone was visible around colonies producing amylase. The diameter (D) of the transparent zone and the colony diameter (d) were observed and measured. The amylase-producing capacity of the strain was determined based on the D / d ratio.

[0045] 3.2 Protease detection Test culture medium: A: 5 g yeast powder, 10 g peptone, 10 g NaCl, 17 g agar, 900 mL water; B: 7 g skim milk powder, 100 mL water; A and B are sterilized separately and then mixed.

[0046] Detection method: From strains cultured at 25℃ for 6 days, mycelial pellets were collected using a 5 mm diameter punch and inoculated onto test medium in 3 petri dishes. The dishes were then incubated at 25℃ for 3 days. Observation was performed to check for the appearance of a clear, transparent hydrolysis zone around the colony. If this zone appeared, it indicated the production of protease. The diameter of the transparent zone (D) and the colony diameter (d) were measured. The protease production capacity of the strain was determined based on the D / d ratio.

[0047] 3.3 Analysis of the cellulase production capacity of the strain Test culture medium: 7.5 g sodium carboxymethyl cellulose, 1 g KH2PO4, 1 g peptone, 0.5 g yeast extract, 0.5 g MgSO4, 1.5 g NaCl, and 15 g agar.

[0048] Detection method: Mycelial cakes were collected from strains cultured at 25℃ for 6 days using a 5 mm diameter punch and inoculated onto test medium in three petri dishes. The dishes were then incubated at 25℃ for 3 days. Afterward, the bacteria were stained with 1 g / L Congo red for 1 hour, followed by two immersion and washing sessions with 1 mol / L NaCl solution for 30 minutes each to complete destaining. The formation of a clear zone around the colony was observed, and the diameter of the clear zone (D) and the colony diameter (d) were measured. The cellulase production capacity of the strain was determined based on the D / d ratio.

[0049] 3.4 Pectinase Detection Test culture medium: 8 g pectin, 1.4 g NH4Cl, 2 g KH2PO4, 6 g K2HPO4·3H2O, 0.1 g MgSO4·7H2O, 15 g agar, 1 L distilled water, natural pH.

[0050] Detection method: Mycelial cakes were collected from strains cultured at 25℃ for 6 days using a 5 mm diameter punch and inoculated onto test medium in 3 petri dishes. After culturing at 25℃ for 3 days, the mixture was stained with 10 g / L Congo red for 30 min, followed by destaining with 1 mol / L NaCl solution for 30 min. The diameter of the clear zone (D) and the colony diameter (d) were measured. The pectinase production capacity of the strain was determined based on the D / d ratio.

[0051] 3.5 Ferrophilic activity assay The ability to produce heparin was determined by the chromium azure S agar colorimetric method, and the test medium was a modified heparin detection solid medium (Beijing Coollab Technology Co., Ltd.).

[0052] Detection method: From strains cultured at 25℃ for 6 days, mycelial cakes were collected using a 5 mm diameter punch and inoculated onto test medium in 3 petri dishes. The petri dishes were then incubated at 25℃ for 3 days. The presence or absence of a yellow halo around the colonies was observed. The diameter of the yellow halo (D) and the colony diameter (d) were measured. The D / d ratio was used to determine the strain's ability to produce ferophiles.

[0053] 3.6 Analysis of the Phosphate-Solubilizing Ability of Strains Test medium: glucose 10 g, Ca3(PO4)2 5.0 g, MgCl2 5.0 g, MgSO4·7H2O 0.25 g, KCl 0.2 g, (NH4)2SO4 0.1 g, agar 17 g, pH 7.0±0.2 (25℃).

[0054] Detection method: From strains cultured at 25℃ for 6 days, mycelial cakes were collected using a 5 mm diameter punch and inoculated onto test medium in 3 petri dishes. The dishes were then incubated at 25℃ for 3 days. The formation of a transparent phosphate-solubilizing zone was observed, and the diameter of the transparent zone (D) and the colony diameter (d) were measured. The D / d ratio was used to determine the strain's phosphate-solubilizing ability.

[0055] 3.7 Potassium solubilization capacity test Test culture medium: 10 g sucrose, 0.5 g MgSO4·7H2O, 0.2 g (NH4)2SO4, 0.1 g NaCl, 0.1 g CaCO3, 5 g potassium feldspar powder, 20 g agar, 1 L water, pH 7.2.

[0056] Detection method: From strains cultured at 25℃ for 6 days, mycelial cakes were collected using a 5 mm diameter punch and inoculated onto test medium in 3 petri dishes. After incubation at 25℃ for 3-7 days, the presence or absence of hydrolysis zones around the colonies was observed. The diameter of the hydrolysis zone (D) and the colony diameter (d) were measured. The potassium-solubilizing ability of the strain was determined based on the D / d ratio; a stronger potassium-solubilizing ability resulted in a larger hydrolysis zone.

[0057] 3.8 Nitrogen Fixation Capacity Test Modified Assumption medium: K2HPO4 0.2 g, MgSO4·7H2O 0.2 g, NaCl 0.2 g, CaCO3 5 g, K2SO4 0.1 g, glucose 10 g, agar 15 g, pH 7.4±0.2 (Beijing Coollab Technology Co., Ltd.).

[0058] Detection method: From strains cultured at 25℃ for 6 days, use a 5 mm diameter punch to collect mycelial cakes and inoculate them onto the test medium, inoculating 3 petri dishes. Incubate at 25℃ for 5-7 days, observing colony size and morphology. Nitrogen-fixing bacteria will grow colonies.

[0059] 3.9 IAA Activity Assay King's medium: 20g peptone, 1.5g MgSO4·7H2O, 1.5g K2HPO4, 1000 mL water.

[0060] Detection Method: The Salkowski colorimetric method was used to determine the ability of the strain to produce indoleacetic acid (IAA). Mycelial cakes were collected from the strain after 6 days of incubation at 25°C using a 5 mm diameter punch and inoculated into 10 mL of King's medium containing 0.1% L-tryptophan (tryptophan solution sterilized by filtration through a 0.22 µm filter). The culture was incubated at 25°C with shaking at 200 rpm for 3 days. Afterward, the culture was centrifuged at 12000 rpm for 10 min, and 2 mL of the supernatant was transferred to a sterile test tube. 4 mL of Salkowski colorimetric solution (1 mL 0.5 mol / L FeCl3, 50 mL HClO4) was added, and the tube was incubated in the dark at room temperature for 30 min (both shaking and incubation were performed in the dark). The color change of the liquid in the test tube was observed. A pink color indicates the presence of IAA. The absorbance was then measured at 530 nm. Prepare IAA standard samples of different concentrations (dissolved in a small amount of anhydrous ethanol and then diluted to volume) (0, 10, 20, 30, 40, 50 mg / L), and determine the IAA content of the strain based on the standard curve.

[0061] The above research results show that Aspergillus BJ-T6F3 can produce cellulase and IAA, and has nitrogen-fixing activity. Figure 4 It does not produce amylase, protease, pectinase, or heparin, and it lacks the ability to solubilize phosphorus and potassium. The test results (Table 2) show that strain BJ-T6F3 has a strong ability to produce IAA.

[0062] Table 2. Results of Aspergillus BJ-T6F3 antibacterial and antimicrobial activity assays Test Project Activity detection D / d value amylase - / protease - / Cellulase + 1.16 pectinase - / Ferrophilic - / Phosphate solubilization - / Potassium solubilization - / Nitrogen fixation + / IAA + 9.48 Example 4: Efficacy test of BJ-T6F3 strain 1. Indoor pot experiment on the control efficacy of BJ-T6F3 strain against tomato wilt. 1.1 Materials and Methods 1.1.1 Preparation of tomato plants Select healthy tomato seedlings with uniform growth at the two-leaf-one-heart stage, remove the seedlings from the seedling trays, and transplant them into flower pots (13.0cm in diameter, 9.0cm in bottom diameter, and 12.0cm in height). Use about 1000mL of soil per pot and one seedling per pot. After the seedlings have recovered for 2-3 days, they can be used for root irrigation inoculation experiments.

[0063] 1.1.2 Preparation of BJ-T6F3 spore suspension The activated strain BJ-T6F3 was added to PDA medium and cultured in an incubator at 25°C for 5 days. The mycelial cake was then inoculated into PDB liquid medium using a 5 mm punch. After culturing in a shaker at 200 rpm and 28°C for 7 days, the spores were filtered through gauze and diluted to the appropriate concentration for later use.

[0064] 1.1.3 Preparation of pathogen spore suspension Activated Fusarium oxysporum tomato-specific type ( Fusarium oxysporum f. sp. lycopersici Add the mycelium (Fol) to PDA solid medium and incubate at 25℃ for 7 days. Use a 5mm punch to cut out mycelial cakes, and inoculate 5 cakes into a 500 mL Erlenmeyer flask containing 300 mL of PDB liquid medium. Incubate at 25℃ and 180 r / min with constant temperature shaking for 3 days. Filter the culture through gauze, centrifuge at 5000 r / min for 7 min, discard the supernatant, collect the conidia, and dilute with sterile water to prepare 1×10⁻⁶ saturates. 8 A CFU / mL conidial suspension is prepared for use.

[0065] 1.1.4 Optimal Concentration of BJ-T6F3 Strain for Controlling Tomato Fusarium Wilt Control group: (1) Water control; (2) Pathogen control: 1×10 8 CFU / mL Fol 50ml; (3) Commercial reagent control: 200 million CFU / g Trichoderma wettable powder (Shanghai Wanlihua Biotechnology Co., Ltd., PD20160752) 500 times dilution.

[0066] Treatment group: 1×10 6 1×10 7 5×10 7 1×10 8 2×10 8 A CFU / mL suspension of BJ-T6F3 spores was used to drench the roots of two-leaf-one-heart stage tomato seedlings 3 days before pathogen inoculation. Each treatment consisted of 16 seedlings, with 3 replicates. 21 days after pathogen inoculation, the disease incidence and disease index of each treatment were statistically analyzed using the tomato wilt disease severity grading standard. SPSS software was used for statistical analysis of the data.

[0067] 1.1.5 Data Statistics and Analysis Methods Tomato Fusarium wilt disease severity grading standards: 0: No symptoms; 1: One or two leaves turn noticeably yellow; 2: Three or four true leaves turn yellow, and the leaves wilt and droop. 3: Five or six true leaves turn yellow or wilt and droop; 4: The entire plant wilts severely and eventually dies.

[0068] The calculation formula is as follows: Disease index = ∑(Number of diseased plants at each level × Disease level value) / (Total number of plants × Highest level value) × 100% Prevention and control efficacy (%) = (Disease index of control group - Disease index of treatment group) / Disease index of control group × 100% 1.2 Optimal pot test results of BJ-T6F3 strain against tomato wilt The results show (Table 3, Figure 5 Different concentrations of BJ-T6F3 were used to inoculate tomato seedlings, with the concentration being 1×10⁻⁶. 8 CFU / mL and 2×10 8 The CFU / mL formulation showed better preventive efficacy, with control efficacies of 60.06% and 59.26%, respectively, with no significant difference between the two. Treatment with a 500-fold dilution of the control agent, Trichoderma water-dispersible granules, showed a control efficacy of only about 30%, significantly lower than that of BJ-T6F3.

[0069] Table 3. Statistical analysis of the control effect of BJ-T6F3 on tomato wilt disease. deal with Disease index Prevention and control efficacy (%) CK-Fol 83.25±0.12a CK-Trichoderma 500x dilution 58.25±0.21c 30.03±0.78c <![CDATA[1×10 6 CFU / mL]]> 66.75±0.10b 19.82±0.87d <![CDATA[1×10 7 CFU / mL]]> 57.17±1.88c 31.33±2.25c <![CDATA[5×10 7 CFU / mL]]> 53.25±0.21d 36.04±1.01b <![CDATA[1×10 8 CFU / mL]]> 33.25±0.13e 60.06±0.83a <![CDATA[2×10 8 CFU / mL]]> 33.91±0.14e 59.26±0.17a Note: The data in the table are "mean ± standard deviation". Different letters after the data in the same column indicate that the difference is significant at the 0.05 level according to Duncan's new multiple range test.

[0070] 2. Indoor pot induction test of BJ-T6F3 strain for controlling tomato wilt disease.

[0071] 2.1 Materials and Methods 2.1.1 Preparation of tomato plants The method is the same as 1.1.1 in Example 4. 2.1.2 Preparation of BJ-T6F3 spore suspension The method is the same as 1.1.2 in Example 4. 2.1.3 Preparation of pathogen spore suspension The method is the same as 1.1.3 in Example 4. 2.1.4 Optimal induction days for BJ-T6F3 strain to control tomato wilt Control group: (1) Water control; (2) Pathogen control: 1×10 8 CFU / mL Fol 50ml; (3) Biocontrol bacteria control: 1×10 8 CFU / mL BJ-T6F3 50ml. Treatment group: Inoculation concentration was 1×10⁻⁶ d·d, 5d, 3d, and 0d before pathogen inoculation. 8 50 mL of BJ-T6F3 spore suspension (CFU / mL) was administered. Each treatment consisted of 16 plants, with 3 replicates. Soil moisture was maintained regularly after inoculation, and disease incidence was observed. At 21 days post-inoculation, the disease incidence and disease index for each treatment were statistically analyzed using the tomato wilt disease grading standard. SPSS software was used for statistical analysis of the data.

[0072] 2.1.5 Data Statistics and Analysis Methods Same as 1.1.5 in Example 4. 2.2 Data Statistics and Analysis Results The results show (Table 4, Figure 6 Inoculation with BJ-T6F3 spore suspension 3, 5, and 7 days before pathogen inoculation showed good control efficacy against tomato wilt, with efficacy exceeding 60%. However, simultaneous inoculation with the pathogen resulted in only 22.22% control. This indicates that BJ-T6F3 has good preventive and protective effects, and the effect can last for at least 7 days.

[0073] Table 4. Control effect of BJ-T6F3 on tomato wilt disease by different application days CK-Fol 7d-T6F3 5d-T6F3 3d-T6F3 0d-T6F3 Disease index 48.33±2.89a 14.58±3.61c 15.69±6.41c 17.50±2.17c 37.50±0.00b Preventive efficacy (%) / 69.91±6.56a 67.99±11.75b 63.61±5.91c 22.22±4.81d Note: The data in the table are "mean ± standard deviation". Different letters after the data in the same column indicate that the difference is significant at the 0.05 level according to Duncan's new multiple range test.

[0074] Example 5: Growth Promotion Assay of BJ-T6F3 Strains 1. Pot growth promotion experiment of BJ-T6F3 strain tomato 1.1 Materials and Methods 1.1.1 Preparation of BJ-T6F3 spore suspension Activated strain BJ-T6F3 was added to PDA medium and cultured at 25 ℃ for 5 days. Mycelial cakes were then inoculated into PDB liquid medium using a 5 mm punch and cultured on a shaker at 200 rpm and 28 ℃ for 7 days. Spores were then filtered through gauze and diluted to 1×10⁻⁶. 6 1×10 7 1×10 8 5×10 8 1×10 9Five CFU / mL concentrations are available for use.

[0075] 1.1.2 Growth-promoting effect of strain BJ-T6F3 on tomato seedlings The effect of spore suspension of strain BJ-T6F3 on the growth-promoting effect on tomato seedlings was determined using a root drenching method. Tomato seeds were treated with 2% NaClO for 1 min, rinsed three times with sterile water, then treated with 75% alcohol for 1 min, rinsed three times with sterile water, and sterilized. After disinfection, the seeds were evenly placed in petri dishes containing 0.8% water agar, wrapped in black bags, and placed in a 25℃ incubator for germination. Tomato seeds with similar germination stages were selected and sown in flowerpots (13.0 cm in diameter, 9.0 cm in base diameter, and 12 cm in height) filled with nutrient substrate. After emergence, healthy plants with uniform growth were retained. Once the tomato seedlings had developed one true leaf, 50 mL of different concentrations of spore suspension were applied to the roots for drenching, with an equal volume of sterile water used as a blank control. Four treatments were performed, with each treatment spaced 5 days apart; each treatment consisted of 12 pots, replicated three times. The flowerpots were incubated in a 25℃ greenhouse.

[0076] 1.1.3 Data Statistics and Analysis Twenty-eight days after the first inoculation, growth parameters of tomato seedlings, including plant height, stem diameter, above-ground fresh weight, and above-ground dry weight, were measured to assess the effect of the strain on tomato plants. SPSS 27 software was used for statistical analysis of the data.

[0077] 1.2 Results of the growth-promoting effect of strain BJ-T6F3 on tomato seedlings The results show (Table 5, Figure 7 BJ-T6F3 at 1×10 7 At a concentration of CFU / mL, BJ-T6F3 showed a good growth-promoting effect, significantly increasing plant height, stem diameter, chlorophyll content, and both dry and fresh weight. However, the growth-promoting effect of BJ-T6F3 gradually weakened with increasing concentration.

[0078] Table 5. Analysis of the results of the potted plant growth-promoting experiment of strain BJ-T6F3 <![CDATA[CK-H2O]]> <![CDATA[1×10 6 (CFU / mL)]]> <![CDATA[1×10 7 (CFU / mL)]]> <![CDATA[1×10 8 (CFU / mL)]]> <![CDATA[5×10 8 (CFU / mL)]]> <![CDATA[1×10 9 (CFU / mL)]]> Plant height / cm 38.99±0.57c 40.49±0.66b 58.23±1.09a 39.61±1.02bc 36.18±0.44d 33.3±0.78e Stem diameter / cm 3.37±0.06c 3.23±0.03d 4.25±0.05a 3.72±0.03b 3.66±0.05b 3.35±0.04c Fresh weight of aboveground parts / g 10.26±0.35b 11.09±0.23b 20.11±0.08a 10.51±0.38b 9.01±0.89c 10.53±0.77b aboveground dry weight / g 0.94±0.12b 0.91±0.03b 1.45±0.10a 0.59±0.02d 0.61±0.04d 0.76±0.06c Chlorophyll content / Spad 29.72±1.27ab 29.16±1.62ab 30.94±0.85a 29.59±0.89ab 28.39±0.17b 28.69±0.34b Note: The data in the table are "mean ± standard deviation". Different letters after the data in the same column indicate that the difference is significant at the 0.05 level according to Duncan's new multiple range test.

[0079] 2. Effect of BJ-T6F3 strain on wheat seed germination promotion test 2.1 Materials and Methods 2.1.1 Preparation of BJ-T6F3 spore suspension The method is the same as 1.1.1 in Example 5. 2.1.2 Growth-promoting effect of strain BJ-T6F3 bacterial solution on wheat seeds Select uniform and plump wheat seeds. Soak the control group seeds in 20 mL of sterile water, and soak the treatment group seeds in conidial solutions of different concentrations (20 mL for each concentration, 1×10⁻⁶). 6 1×10 7 1×10 8 5×10 8 1×10 9 CFU / mL, soaked overnight (soaking time 8 to 12 h). 30 seeds were used in each treatment group and control group, with a total of 3 replicates. The seeds were then placed on filter paper moistened with sterile water and incubated in a 20°C incubator with water replenished as needed.

[0080] 2.1.3 Data Statistics and Analysis Three days later, photos were taken and the germination status of the seeds was recorded. Ten days later, photos were taken and the root length and seedling height of the germinating seedlings were measured to evaluate the effect of the test strain on the germination and seedling growth of monocotyledonous wheat seeds. SPSS 27 software was used for statistical analysis of the data.

[0081] 2.2 Results of the determination of the growth-promoting effect of BJ-T6F3 on wheat seeds The results showed that ( Figure 8 ), from 1×10 6 Starting at CFU / mL, the germination rate, seedling length, and root length of seeds treated with BJ-T6F3 spore suspension were significantly higher than those treated with water; 1×10 7 1×10 8 CFU / mL concentrations have similar growth-promoting effects, but from 5×10 8 Starting at CFU / mL, the growth status of the treated wheat seedlings was similar to that of the water control.

[0082] Example 6: Effects of BJ-T6F3 strain treatment on the activity of defensive enzymes in tomato plants Materials and Methods 1.1.1 Preparation of tomato plants Select uniformly sized and plump tomato seeds, treat them with 2% NaClO for 1 min, rinse three times with sterile water, then treat them with 75% alcohol for 1 min, rinse three times with sterile water, and sow them in nutrient pots containing 100 g of sterile soil. When the tomato seedlings have grown two leaves and one bud, select tomato plants with uniform growth, clean their roots, and transplant them into tissue culture bottles containing 100 mL of Hoagland's nutrient solution. After culturing for 2-3 days, conduct the experimental treatment.

[0083] 1.1.2 Sample processing and collection The experiment consisted of three treatments, with 10 plants in each group, specifically: (1) sterile water control; (2) pathogen control: 1×10 8 CFU / mL Fol 50ml; (3) Biocontrol bacteria control: 1×10 8 CFU / mL BJ-T6F3 50ml; Root samples were collected from plants with uniform growth in each treatment group at 0 d, 1 d, 3 d, 5 d, and 7 d after inoculation for subsequent enzyme activity testing and analysis.

[0084] 1.1.3 Determination of enzyme activity Take 1 g of plant root sample for crude enzyme extraction. Use the kit (Suzhou Keming Technology Co., Ltd.) to determine peroxidase (POD) and catalase (CAT). Follow the kit instructions for specific operations.

[0085] 1.2 Results Analysis The results showed that after inoculation with BJ-T6F3, the root POD and CAT activities of tomato plants were significantly increased. Specifically, starting from day 3, the POD enzyme activity of BJ-T6F3-inoculated plants was higher than that of the water control and the pathogen control. Furthermore, starting from day 3, the POD activity of pathogen-inoculated plants began to decrease significantly, while the POD activity of BJ-T6F3-inoculated plants remained significantly increased. Figure 9 Regarding changes in CAT activity, we found that from day 1 after inoculation, the CAT activity of plants treated with BJ-T6F3 was higher than that of the water control and the pathogen control; from day 3 onwards, the CAT activity of plants inoculated with the pathogen showed a decreasing trend, while the CAT activity of plants inoculated with BJ-T6F3 continued to increase. Figure 10 ).

[0086] This shows that inoculating plants with the BJ-T6F3 strain can significantly enhance the activity of the plant's own defense enzymes, thereby increasing the plant's resistance and enabling it to resist pathogen infection.

Claims

1. A strain of Aspergillus, classified as Aspergillus ochre-petalus. Aspergillus ochraceopetaliformis The name is BJ-T6F3, and its registration number at the China General Microbiological Culture Collection Center is CGMCC No. 42312.

2. The application of the Aspergillus strain according to claim 1 in the prevention and control of diseases caused by plant pathogenic fungi; wherein, The plant pathogenic fungus is Verticillium dahliae ( ) Verticillium dahliae Fusarium graminearum ( ) Fusarium graminearum ), wheat root rot flat mite spore ( Bipolaris sorokiniana ), large spot disease bulging umbelliferous worms ( Exserohilum turcicum ), Dioscorea opposita ( Lasiodiplodia theobromae ), Staphylococcus aureus ( Botryosphaeria dothidea ), Sweet Cherry Interstellar Shell ( Diaporthe eres ), Paraeutypella citricola Brown-spotted schizocarp ( Rosellinia necatrix ), oak pseudostem spot ( Nothophoma quercina Pear tree rot disease Cytospora leucosperma Botrytis cinerea (tomato) Botrytis cinerea ), Brown nail spores ( Passalora fulva Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f. sp. Lycopersici Fusarium oxysporum tomato neck rot and root rot specialized type ( Fusarium oxysporum f. sp.radicis-lycopersici ), Fusarium oxysporum cucumber-specific type ( Fusarium oxysporum f. sp. cucumerinum ), Fusarium solani ( Fusarium chlamydosporum ), Cucumber fusarium ( Plectosphaerella cucumerina ), *Cyclocarya paliurus* ( Corynespora cassiicola Rhizoctonia solani ( ) Rhizoctonia solani ), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum Fusarium solani () Fusarium solani Phytophthora ( Phytophthora capsici One or more of the following.

3. The application of the Aspergillus strain according to claim 1 in promoting plant growth.

4. The application according to claim 3, characterized in that, The plant in question is a tomato.

5. The use of the Aspergillus strain BJ-T6F3 of claim 1 or its antibacterial active substances in the preparation of biopesticides and / or biofertilizers that have antagonistic activity against plant pathogenic fungi and / or promote plant growth.

6. The application according to claim 5, characterized in that, The plant pathogenic fungus is Verticillium dahliae ( ) Verticillium dahliae Fusarium graminearum ( ) Fusarium graminearum ), wheat root rot flat mite spore ( Bipolaris sorokiniana ), large spot disease bulging umbelliferous worms ( Exserohilum turcicum ), Dioscorea opposita ( Lasiodiplodia theobromae ), Staphylococcus aureus ( Botryosphaeria dothidea ), Sweet Cherry Interstellar Shell ( Diaporthe eres ), Paraeutypella citricola Brown-spotted schizocarp ( Rosellinia necatrix ), oak pseudostem spot ( Nothophoma quercina Pear tree rot disease Cytospora leucosperma Botrytis cinerea (tomato) Botrytis cinerea ), Brown nail spores ( Passalora fulva Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f. sp. Lycopersici Fusarium oxysporum tomato neck rot and root rot specialized type ( Fusarium oxysporum f. sp.radicis-lycopersici ), Fusarium oxysporum cucumber-specific type ( Fusarium oxysporum f. sp. cucumerinum ), Fusarium solani ( Fusarium chlamydosporum ), Cucumber fusarium ( Plectosphaerella cucumerina ), *Cyclocarya paliurus* ( Corynespora cassiicola Rhizoctonia solani ( ) Rhizoctonia solani ), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum Fusarium solani () Fusarium solani Phytophthora ( Phytophthora capsici One or more of the following.

7. The application according to claim 5, wherein the growth-promoting effect on plants is a growth-promoting effect on tomatoes.

8. A biopesticide and / or biofertilizer and / or bio-inoculant that has antagonistic activity against plant pathogenic fungi and / or promotes plant growth, characterized in that, The active ingredient is the Aspergillus strain BJ-T6F3 or its metabolites as described in claim 1.

9. The biopesticide and / or biofertilizer and / or bio-agent according to claim 8, characterized in that, The plant pathogenic fungus is Verticillium dahliae ( ) Verticillium dahliae Fusarium graminearum ( ) Fusarium graminearum ), wheat root rot flat mite spore ( Bipolaris sorokiniana ), large spot disease bulging umbelliferous worms ( Exserohilum turcicum ), Dioscorea opposita ( Lasiodiplodia theobromae ), Staphylococcus aureus ( Botryosphaeria dothidea ), Sweet Cherry Interstellar Shell ( Diaporthe eres ), Paraeutypella citricola Brown-spotted schizocarp ( Rosellinia necatrix ), oak pseudostem spot ( Nothophoma quercina Pear tree rot disease Cytospora leucosperma Botrytis cinerea (tomato) Botrytis cinerea ), Brown nail spores ( Passalora fulva Fusarium oxysporum tomato-specific strain ( Fusarium oxysporum f. sp. Lycopersici Fusarium oxysporum tomato neck rot and root rot specialized type ( Fusarium oxysporum f. sp.radicis-lycopersici ), Fusarium oxysporum cucumber-specific type ( Fusarium oxysporum f. sp. cucumerinum ), Fusarium solani ( Fusarium chlamydosporum ), Cucumber fusarium ( Plectosphaerella cucumerina ), *Cyclocarya paliurus* ( Corynespora cassiicola Rhizoctonia solani ( ) Rhizoctonia solani ), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum Fusarium solani () Fusarium solani Phytophthora ( Phytophthora capsici One or more of the following.

10. The biological pesticide and / or biological fertilizer and / or biological agent according to claim 8, wherein the growth-promoting effect on plants is a growth-promoting effect on tomatoes.