Application of a soybean rhizobium and a bacillus complex inoculation

Abstract

This invention relates to a soybean rhizobium strain and its application in co-inoculation with Bacillus subtilis, encompassing the fields of microbiology and agricultural technology. Specifically, it relates to a soybean rhizobium strain and its application in co-inoculation with Bacillus subtilis. The soybean rhizobium strain of this invention is *Bradyrhizobium ottawaense* HH50, deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 36728. This *Bradyrhizobium ottawaense* HH50 significantly promotes nodulation in 12 different soybean species from different accumulated temperature zones in Heilongjiang Province, demonstrating broad-spectrum activity. Furthermore, the co-inoculation of *Bradyrhizobium ottawaense* HH50 with *Bacillus subtilis* B5 promotes soybean plant height, effective nodule count, and biomass, providing an important theoretical basis for guiding the efficient implementation of symbiotic nitrogen fixation in soybeans.

Description

Technical Field

[0001] This invention relates to the fields of microbiology and agricultural technology, specifically to a soybean rhizobium strain and its application in co-inoculation with Bacillus. Background Technology

[0002] The symbiotic nitrogen-fixing system between soybeans and rhizobia has significant application value in agricultural production. High soybean yields depend on the interaction of multiple factors, including genotype, symbiotic rhizobia, biophysical environment, and agronomic management. Different ecological zones have different main soybean varieties and local breeds, resulting in variations in the rhizobia communities within their root microbiota. Due to the presence of these native rhizobia, exogenous rhizobium agents often fail to achieve the desired inoculation effect. Therefore, it is crucial to screen for soybean rhizobia that have high affinity with local main soybean varieties, adapt to local soil and climate conditions, and possess broad adaptability. Utilizing soybean rhizobia to inoculate leguminous plants to enhance their nitrogen-fixing efficiency is a cost-effective and efficient agricultural measure widely used in many countries. However, in China, the origin of soybeans, the inoculated area of ​​soybean rhizobia accounts for only about 2% of the total soybean planting area, far lower than the inoculation rate of over 70% in major soybean-producing countries such as the United States, Brazil, and Argentina. The main reason is that traditional rhizobium inoculants often have problems such as poor environmental adaptability, low nodule occupancy rate, resulting in low nitrogen fixation efficiency and unstable inoculation effect, which restrict their application and development. Summary of the Invention

[0003] To address the problems of poor environmental adaptability, low nodule occupancy rate, low nitrogen fixation efficiency, and unstable inoculation effect often found in existing rhizobium inoculants, this invention provides soybean rhizobium HH50 and its application in co-inoculation with Bacillus.

[0004] The soybean rhizobium of this invention is Bradyrhizobium ottawaense HH50, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 36728.

[0005] This invention relates to a compound microbial agent of soybean rhizobium and Bacillus, wherein the compound microbial agent is composed of Bradyrhizobium ottawaense HH50 and Bacillus velezensis B5 (accession number CGMCC No. 33537, which has been disclosed in previous patent documents).

[0006] The present invention relates to the application of the combination of soybean rhizobium and Bacillus in increasing soybean yield.

[0007] Beneficial effects of this invention:

[0008] The Bradyrhizobium ottawaense HH50 of this invention was isolated from the Heihe 43 experimental field of the Heihe Branch of the Heilongjiang Academy of Agricultural Sciences. Preliminary reinoculation experiments have confirmed that Bradyrhizobium ottawaense HH50 can significantly promote nodulation of 12 different soybean species from different temperature zones in Northeast China, demonstrating broad-spectrum activity. Furthermore, the mixed inoculation of Bradyrhizobium ottawaense HH50 and Bacillus vesiculosus B5 in this invention significantly improved the plant height, effective nodule count, plant fresh weight, and plant dry weight of Heihe 43 soybean compared to the mixed inoculation of Bradyrhizobium japonicum USDA110 and Bacillus vesiculosus B5. This indicates that Bradyrhizobium ottawaense HH50 and Bacillus vesiculosus B5 have a better synergistic effect, which can improve traits such as plant height, effective nodule count, and biomass of soybean, and has the potential to develop compound microbial agents.

[0009] This invention enriches the resources of rhizobium strains. The mixed inoculation of Bradyrhizobium ottawaense HH50 and Bacillus belyi B5 in soybeans promotes plant height, effective nodule count, and biomass, providing an important theoretical basis for guiding the efficient implementation of symbiotic nitrogen fixation in soybeans.

[0010] Bradyrhizobium ottawaense HH50 is a species of Bradyrhizobium belonging to the genus Bradyrhizobium. It is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 36728 and deposit date of November 21, 2025. Attached Figure Description

[0011] Figure 1 This is a colony morphology diagram of Bradyrhizobium ottawaense HH50 cultured on YMA medium for 5 days in Example 1.

[0012] Figure 2 This is a four-gene phylogenetic tree constructed based on the "maximum likelihood method" for Bradyrhizobium ottawaense HH50 in Example 1.

[0013] Figure 3 This is a Gram staining image of Bradyrhizobium ottawaense HH50 from Example 1;

[0014] Figure 4 This is a bar chart showing the statistical results of different soybean nodulation patterns 30 days after inoculation with Bradyrhizobium ottawaense HH50 in Example 2. Figure 4 Plot the data using mean ± standard deviation, with ** indicating a significant difference at the 0.01 level;

[0015] Figure 5 This is a diagram showing the confrontation between Bradyrhizobium ottawaense HH50 and Bacillus belyss B5 in Example 3.

[0016] Figure 6 This is a diagram showing the confrontation between Bradyrhizobium japonicum USDA110 and Bacillus belysinus B5 in Example 3.

[0017] Figure 7 This is the growth of soybean Heihe 43 30 days after the strains (HH50 and HH50+ B5) in Example 4 were inoculated;

[0018] Figure 8 This is a statistical graph of agronomic traits of soybean Heihe 43 after 30 days of inoculation with strains (HH50 and HH50+ B5) in Example 4; the graph is plotted with mean ± standard deviation as the data, and * and ** indicate significant differences at the 0.05 and 0.01 levels, respectively.

[0019] Figure 9 This is the growth of soybean Heihe 43 30 days after inoculation with strains (USDA110 and USDA110+ B5) in Example 4;

[0020] Figure 10 This is a statistical graph of agronomic traits of soybean Heihe 43 after 30 days of inoculation with strains (USDA110 and USDA110+ B5) in Example 4; the graph is plotted with mean ± standard deviation as the data, and * and ** indicate significant differences at the 0.05 and 0.01 levels, respectively. Detailed Implementation

[0021] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0022] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0023] YMA solid medium is short for Yeast Mannitol Agar. Each liter of YMA medium consists of 10.0g mannitol, yeast extract, 0.2g K₂HPO₄, 0.2g MgSO₄·7H₂O, 0.05g NaCl, 15.0g agar, and the remainder double-distilled water, with a final pH of 7.0 ± 0.2. Plates containing Congo red are prepared by adding 10 mL of 0.5% Congo red to YMA solid medium and sterilizing at 121°C for 30 min.

[0024] YMA liquid medium is short for Yeast Mannitol Agar. Each liter of YMA medium is made from 10.0g mannitol, yeast extract, 0.2g K2HPO4, 0.2g MgSO4·7H2O, 0.05g NaCl, and the remainder double-distilled water, with a final pH of 7.0 ± 0.2.

[0025] The LB liquid culture medium consisted of 10.0 g tryptone, 5 g yeast extract, and 10 g NaCl, with 1000 mL of distilled water added, and sterilized at 121°C for 30 min.

[0026] Example 1

[0027] In this embodiment, a soybean rhizobium strain was isolated from a single root nodule of soybean in the Heihe 43 soybean experimental field of the Heihe Branch of the Heilongjiang Academy of Agricultural Sciences. When this strain was inoculated onto YMA medium, it was found that the strain took 5-7 days to grow single colonies (e.g., ...). Figure 1(As shown). DNA was extracted from this strain, and the 16S rDNA region, the conserved genes glutamine synthase (glnII), the β subunit (atpD) of membrane-bound F-type ATP synthase, and the recA gene sequence were sequenced. Phylogenetic analysis of these four genes identified it as *Bradyrhizobium ottawaense*, a slow-growing rhizobium species from Ottawa (as shown). Figure 2 As shown in the image, it is named *Bradyrhizobium ottawaense* HH50. *Bradyrhizobium ottawaense* HH50 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on November 21, 2025, with accession number CGMCC No. 36728. After Gram staining, *Bradyrhizobium ottawaense* HH50 appears red (as shown in the image). Figure 3 As shown in the figure, this indicates that the strain Bradyrhizobium ottawaense HH50 is a Gram-negative bacterium.

[0028] When cultured on YMA medium, the single colony morphology of Bradyrhizobium ottawaense HH50 typically ranges from 3 to 8 mm in diameter. The colonies are round with neat edges and a slightly raised center, exhibiting a translucent, milky-white color. The colonies are also sticky and viscous.

[0029] This embodiment uses rDNA 16S sequence analysis and bacterial DNA is extracted using the Ezup column-based bacterial genomic DNA extraction kit. PCR amplification is performed using 16S rDNA (27F: AGAGTTTGATCCTGGCTCAG; 1492R: AAGGAGGTGATCCAGCC), the conserved gene glutamine synthase glnII (12F: YAAGCTCGAGTACATYTGGCT; 689R: TGCATGCCSGAGCCGTTCCA), the β subunit atpD of membrane-bound F-type ATP synthase (225F: GCTSGGCCGCATCMTSAACGT; 782R: GCCGACACTTCMGAACNNGCCTG), and recA (41F: TTCGGCAAGGGMTCGRTSATG; 640R: ACATSACRCCGATCTTCATGC). The total amplification volume was 20 μL, including 10 μL of 2×Taq mix, 2 μL of bacterial DNA, 1 μL of each primer, and 6 μL of ddH2O. The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were assembled and aligned to the NCBI database. Simultaneously, a maximum likelihood phylogenetic tree was constructed using iqtree-3.0.1. The optimal model calculated by the software was GTR+F+R2, with 1000 bootstrap iterations, to determine the taxonomic position of the bacteria.

[0030] This embodiment amplifies the 16S rDNA sequence of Bradyrhizobium ottawaense HH50 as shown in SEQ ID NO: 1; amplifies the conserved gene glutamine synthase glnII base sequence of Bradyrhizobium ottawaense HH50 as shown in SEQ ID NO: 2; amplifies the β subunit atpD base sequence of membrane-bound F-type ATP synthase of Bradyrhizobium ottawaense HH50 as shown in SEQ ID NO: 3; and amplifies the recA base sequence of Bradyrhizobium ottawaense HH50 as shown in SEQ ID NO: 4.

[0031] Example 2

[0032] In this embodiment, the rhizobium Bradyrhizobium ottawaense HH50 was aseptically inoculated onto 12 major soybean varieties from different temperature zones in Heilongjiang Province and the American soybean variety Williams 82 (all provided by the Heihe Branch of the Heilongjiang Academy of Agricultural Sciences), with no rhizobium inoculation serving as a control. The experimental results showed that Bradyrhizobium ottawaense HH50 could promote nodulation in different soybean varieties (Table 1). Figure 4 A) indicates that Bradyrhizobium ottawaense HH50 possesses broad-spectrum nodulation characteristics. Furthermore, soybeans treated with Bradyrhizobium ottawaense HH50 showed varying degrees of increase in both the fresh weight and dry weight of effective root nodules (Table 1). Figure 4 B, 4C).

[0033] Table 1. Statistical table of nodulation in different soybeans 30 days after inoculation with Bradyrhizobium ottawaense HH50.

[0034]

[0035] In this embodiment, soybean seeds were disinfected with 1% sodium hypochlorite for 10 min, rinsed with sterile water, and planted in a sterile vermiculite:perlite (2:1) mixed substrate with nitrogen-free nutrient solution. They were then cultured in a greenhouse at 27°C with a light / dark cycle of 16h / 8h. Once the first true leaf of the soybean emerged, 1 mL of inoculated bacterial suspension (resuspended in sterile water to OD) was added. 600 A bacterial suspension (0.8–1.0 g / L) was injected into the soybean roots, with sterile water used as a control. The soybean potted plants were inoculated and cultured for 30 days. The plants were photographed and their physiological parameters, including the number of effective root nodules, the fresh weight of effective root nodules, and the dry weight of effective root nodules, were measured.

[0036] Example 3

[0037] In this embodiment, the model strain of slow-growing soybean rhizobium, *Bradyrhizobium japonicum* USDA110 (purchased from Baosai Plasmid Strain Resources Company), and the *Bradyrhizobium ottawaense* HH50 of this invention were respectively cultured in confrontation with *Bacillus velezensis* B5 (accession number: CGMCC No. 33537) on YMA solid medium. The results showed that neither *Bradyrhizobium japonicum* USDA110 nor *Bradyrhizobium ottawaense* HH50, nor *Bacillus velezensis* B5 colonies, affected the growth of the other (e.g., ...). Figure 5 , Figure 6 As shown in the figure, there is no confrontation, indicating that Bradyrhizobium japonicum USDA110 and Bradyrhizobium ottawaense HH50 can be mixed with Bacillus bereaves B5 in subsequent inoculation experiments.

[0038] In this embodiment, soybean rhizobium was streaked on YMA plates and cultured at 28°C until clear colonies appeared. Single colonies were then picked and cultured in YMA liquid medium at 28°C with shaking. Bacillus belye B5 was streaked on LB plates and cultured at 30°C until clear colonies appeared. Single colonies were then picked and cultured in LB liquid medium at 30°C with shaking. Rhizobium was first spot-inoculated onto YMA solid medium, and after 3 days of growth, Bacillus belye B5 was spot-inoculated. After 2 days of culture, the presence of confrontation was observed.

[0039] Example 4

[0040] Bradyrhizobium ottawaense HH50 and Bacillus belye B5 were cultured in YMA and LB broths, respectively, until their respective logarithmic growth phases. Both bacterial suspensions were then prepared into bacterial suspensions using sterile water. These suspensions were inoculated sequentially at a ratio of 1:2 (v:v=1) into the roots of soybean plants of Heihe 43 grown in sterile substrate. Bradyrhizobium ottawaense HH50 alone served as a control. After 30 days of culture, agronomic traits of Heihe 43 soybeans (e.g., ...) were analyzed. Figure 7As shown in Table 2). The results showed that inoculation with a mixture of Bradyrhizobium ottawaense HH50 and Bacillus belyi B5 significantly promoted soybean growth, with the average plant height increasing by 39.3% (Table 2). Figure 8 A); Compared with the control group, the average number of effective root nodules in soybeans after mixed inoculation was significantly increased by 42.17% (Table 2, Figure 8 E); In addition, the fresh weight and dry weight of the plants were significantly increased, by 27.83% respectively (Table 2, Figure 8 H) and 32.11% (Table 2, Figure 8 I).

[0041] Table 2. Statistical table of agronomic traits of soybean Heihe 43 30 days after inoculation (HH50 and HH50+B5)

[0042]

[0043] Note: The data are plotted using mean ± standard deviation. * and ** indicate that the difference is significant at the 0.05 and 0.01 levels, respectively.

[0044] Bradyrhizobium japonicum USDA110 and Bacillus belysin B5 were cultured in YMA and LB broths, respectively, until their respective logarithmic growth phases. Both bacterial suspensions were then prepared into bacterial suspensions using sterile water. These suspensions were inoculated sequentially at a ratio of 1:2 (v:v=1) into the roots of Heihe 43 soybean plants grown in sterile substrate. Bradyrhizobium japonicum USDA110 alone served as a control. After 30 days of culture, agronomic traits of Heihe 43 soybeans (such as...) were analyzed. Figure 9 As shown). The results showed that inoculation with a mixture of slow-growing soybean rhizobium (Bradyrhizobium japonicum) USDA110 and Bacillus belyi B5 significantly increased the dry weight of Heihe 43 soybean plants by 12.28%. Figure 10 I, Table 3), but it had no significant effect on agronomic traits such as plant height (I, Table 3). Figure 10Table 3 shows that, compared with the mixed inoculation of Bradyrhizobium ottawaense HH50 and Bacillus vesiculosus B5, the plant height, effective nodule number, plant fresh weight, and plant dry weight of Heihe 43 soybean were significantly increased in the present invention. This indicates that Bradyrhizobium ottawaense HH50 and Bacillus vesiculosus B5 have a better synergistic effect and can improve traits such as plant height, effective nodule number, and biomass of soybean, demonstrating the potential for the development of compound microbial agents.

[0045] Table 3. Statistical analysis of agronomic traits of soybean variety Heihe 43 30 days after inoculation (USDA110 and USDA110+ B5)

[0046]

[0047] Note: Data are plotted using mean ± standard deviation.

[0048] In this embodiment, soybean seeds were disinfected with 1% sodium hypochlorite for 10 minutes, rinsed with sterile water, and planted in a sterile vermiculite:perlite (2:1) mixed substrate with nitrogen-free nutrient solution. The seeds were then cultured in a greenhouse at 27°C with a light / dark cycle of 16h / 8h. Once the first true leaf of the soybean emerged, the rhizobium and Bacillus belye B5 were collected by centrifugation, and the bacterial cultures were resuspended in sterile water to OD. 600 The concentration was 0.8–1.0. Rhizobium:Bacillus belycecin B5 suspension (v:v=1:2) was injected sequentially into the soybean roots, consisting of 2.5 mL of Rhizobium and 5 mL of Bacillus belycecin B5 suspension. A control group was inoculated with only 2.5 mL of Rhizobium. The soybean potted plants were cultured for 30 days after inoculation. The plants were photographed and the following parameters were measured: chlorophyll content, nitrogen content, plant height, root length, number of effective root nodules, fresh weight of effective root nodules, dry weight of effective root nodules, fresh weight of the plant, and dry weight of the plant.

Claims

1. A soybean rhizobium strain, Bradyrhizobium ottawaense HH50, is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 36728.

2. A compound inoculant of soybean rhizobium and Bacillus, characterized in that, The compound microbial agent consists of Bradyrhizobium ottawaense HH50 and Bacillus velezensis B5.

3. Application of the above-mentioned combination of soybean rhizobium and Bacillus in increasing soybean yield.

Images