Monitoring a population of cells producing biomolecules
By introducing a multinucleotide vector with a unique identifier sequence into a cell population, targeting and integrating it into the cell genome and selecting cells that amplify specific identifier sequences, the challenge of assessing genetic diversity in cell populations is solved, the stability and consistency of biomolecule production are improved, and the cloning screening process is simplified.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- F HOFFMANN LA ROCHE & CO AG
- Filing Date
- 2024-12-04
- Publication Date
- 2026-06-19
AI Technical Summary
Existing technologies make it difficult to effectively assess and manage the genetic diversity of cells when obtaining engineered cell populations, resulting in difficulty in controlling the consistency and efficiency of biomolecule production.
By using multiple vectors containing unique identifier sequences to contact cells, polynucleotides of interest can be targeted and integrated into the cell genome. By selecting and analyzing the integrated cells, cells with different identifier sequences can be identified and amplified to form monoclonal or polyclonal populations.
It enables precise assessment and management of the genetic diversity of cell populations, improves the stability and consistency of biomolecule production, simplifies the clone screening process, and ensures the efficiency and safety of producer cells.
Smart Images

Figure CN122249551A_ABST
Abstract
Description
[0001] This application claims priority to EP23214270.3, filed on December 5, 2023, the contents and elements of which are incorporated herein by reference for all purposes. Technical Field
[0002] This disclosure relates to the fields of molecular and cell biology and cell culture. In particular, this disclosure relates to monitoring and / or managing the diversity of populations of cells that produce biomolecules. Background Technology
[0003] Methods for obtaining monoclonal populations of cells engineered for the production of biomolecules are well known and described, for example, in Green and Sambrook, Molecular Cloning: A Laboratory Manual (p. 4). (References: Cold Spring Harbor Press, 2012 and Nat Methods. (2008); 5(2): 135-146). Such procedures involve limiting the dilution of polyclonal populations from engineered cells.
[0004] Cells engineered to contain integrated polynucleotides of interest, generated via different integration events, can differ significantly in characteristics related to their suitability for the production of biomolecules of interest (e.g., on a scale suitable for commercial production). For example, cells generated by different integration events can have different phenotypes associated with biomolecule production, such as variable growth characteristics, metabolic profiles, optimal culture conditions, productivity, etc. Summary of the Invention
[0005] In a first aspect, this disclosure provides a method for evaluating the diversity of a library of cells that are genetically distinct, having integrated polynucleotides of interest into their genomic DNA, the method comprising analyzing cells obtained by:
[0006] (a) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest; and
[0007] (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0008] To determine the identity of the identifier sequence integrated into its genomic DNA.
[0009] In some embodiments, the method further includes determining the proportion of cells in the population that have integrated a given identifier sequence.
[0010] This disclosure also provides a method for obtaining a library of genetically distinct cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising:
[0011] (i) Analyze the cells obtained as follows:
[0012] (a) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest; and
[0013] (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0014] To determine the identity of the identifier sequence integrated into its genomic DNA; and
[0015] (ii) Select cells identified in step (i) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification.
[0016] This disclosure also provides a method for obtaining a monoclonal population of cells having a polynucleotide of interest integrated into its genomic DNA, the method comprising:
[0017] (i) Analyze the cells obtained as follows:
[0018] (a) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest; and
[0019] (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0020] To determine the identity of the identifier sequence integrated into its genomic DNA; and
[0021] (ii) Select a single cell, or select multiple cells identified in step (i) as having the same identifier sequence integrated into their genomic DNA, for subsequent amplification.
[0022] This disclosure also provides a method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by:
[0023] (a) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest; and
[0024] (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0025] (c) Analyze the cells obtained after step (b) to determine the identity of the identifier sequence integrated into their genomic DNA; and
[0026] (d) Select cells identified in step (c) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification;
[0027] To determine the identity of the identifier sequence integrated into its genomic DNA.
[0028] This disclosure also provides a method for identifying a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by:
[0029] (a) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest; and
[0030] (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0031] (c) Analyze the cells obtained after step (b) to determine the identity of the identifier sequence integrated into their genomic DNA; and
[0032] (d) Select a single cell, or select multiple cells identified in step (c) as having the same identifier sequence integrated into their genomic DNA, for subsequent amplification;
[0033] To determine the identity of the identifier sequence integrated into its genomic DNA.
[0034] This disclosure also provides a method for evaluating the diversity of a library of cells having genetically distinct polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0035] (i) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest;
[0036] (ii) Selecting cells obtained after step (i) from those cells in which the polynucleotide of interest has been integrated into their genomic DNA; and
[0037] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0038] In some embodiments, the method further includes determining the proportion of cells in the population that have integrated the given identifier sequence obtained after step (ii).
[0039] This disclosure also provides a method for obtaining a library of genetically distinct cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising:
[0040] (i) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest;
[0041] (ii) Select cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0042] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0043] (iv) Select cells identified in step (iii) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification.
[0044] This disclosure also provides a method for obtaining a monoclonal population of cells having a polynucleotide of interest integrated into its genomic DNA, the method comprising:
[0045] (i) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest;
[0046] (ii) Select cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0047] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0048] (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification.
[0049] This disclosure also provides a method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising:
[0050] (i) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest;
[0051] (ii) Select cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0052] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0053] (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and
[0054] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0055] In some embodiments, the method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA is a method for monitoring or assessing the monoclonalness of a putative monoclonal population of cells having a polynucleotide of interest integrated into their genomic DNA.
[0056] This disclosure also provides a method for identifying a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising:
[0057] (i) Contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, the multiple vectors containing nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest;
[0058] (ii) Select cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0059] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0060] (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and
[0061] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0062] In some embodiments, the method for identifying a population of cells having a polynucleotide of interest integrated into their genomic DNA is a method for identifying the monoclonal nature of a presumed monoclonal population of cells having a polynucleotide of interest integrated into their genomic DNA.
[0063] This disclosure also provides the use of multiple vectors in a method for evaluating the diversity of libraries of genetically distinct cells having integrated polynucleotides of interest into their genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cell, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein the method comprises:
[0064] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0065] (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; and
[0066] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0067] In some embodiments, the method further includes determining the proportion of cells in the population that have integrated the given identifier sequence obtained after step (ii).
[0068] This disclosure also provides the use of multiple vectors in a method for obtaining a clonal population of cells having a polynucleotide of interest integrated into its genomic DNA, the multiple vectors comprising a nucleotide sequence that provides targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein the method comprises:
[0069] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0070] (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0071] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0072] (iv) Select cells identified in step (iii) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification.
[0073] This disclosure also provides the use of multiple vectors in a method for obtaining a library of genetically distinct cells having a polynucleotide of interest integrated into its genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cell, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein the method comprises:
[0074] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0075] (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0076] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0077] (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification.
[0078] This disclosure also provides the use of multiple vectors in a method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into its genomic DNA, the multiple vectors comprising a nucleotide sequence that provides targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cell, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein the method comprises:
[0079] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0080] (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0081] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0082] (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and
[0083] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0084] In some embodiments, the method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA is a method for monitoring or assessing the monoclonalness of a putative monoclonal population of cells having a polynucleotide of interest integrated into their genomic DNA.
[0085] This disclosure also provides the use of multiple vectors in a method for identifying a population of cells having a polynucleotide of interest integrated into its genomic DNA, the multiple vectors comprising a nucleotide sequence that provides targeted integration of the polynucleotide of interest, including an identifier sequence, into the genomic DNA of the cell, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein the method comprises:
[0086] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0087] (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA;
[0088] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0089] (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and
[0090] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0091] In some embodiments, the method for identifying a population of cells having a polynucleotide of interest integrated into their genomic DNA is a method for identifying the monoclonal nature of a presumed monoclonal population of cells having a polynucleotide of interest integrated into their genomic DNA.
[0092] In some embodiments according to various aspects of this disclosure, prior to integration of the polynucleotide of interest, the cell contains genomic DNA having at least one single-copy landing pad that provides targeted integration of the polynucleotide of interest.
[0093] In some embodiments, the polynucleotide of interest comprises a nucleotide sequence encoding one or more polypeptides of interest. In some embodiments, the one or more polypeptides of interest are each independently selected from the group consisting of: antigen-binding polypeptides, aptamers, constituent polypeptides of antigen-binding polypeptide complexes, antibody / antigen-binding fragments or derivatives thereof, constituent polypeptides of antibody / antigen-binding fragments or derivatives thereof, Fc fusion polypeptides, anticoagulants, blood factors, bone morphogenetic polypeptides, decoy receptors for ligands, decoy ligands for receptors, enzymes, enzyme cofactors, growth factors, hormones, interferons, interleukins, thrombolytic agents, transcription factors, epigenetic modifiers, constituent polypeptides of site-specific nuclease nucleic acid editing systems, constituent polypeptides of ribonucleoproteins, viral polypeptides, or polypeptides that can be used for the production of biomolecules. Detailed Implementation
[0094] This disclosure broadly relates to the application of DNA barcoding techniques for monitoring and / or managing the genetic diversity of cells in culture, particularly cells expressing peptides of interest.
[0095] The dynamics of producer cell populations play a crucial role in the consistency and yield of peptide production. These dynamics encompass a variety of production-related factors, such as growth rate, cell viability and individual cell productivity, as well as the overall clonal composition of the population.
[0096] The generation of clonal cell lines has been used to ensure identical genetic makeup and efficient control over the dynamics of producer cells, thereby improving the consistency, reproducibility, and safety of biomolecules for therapeutic applications. However, such cell lines still exhibit a large number of production-related phenotypes, requiring time-consuming and resource-intensive clonal screening processes.
[0097] This disclosure applies unique identifier sequences to stable producer cell pools, such as CHO cells. Introducing unique identifier sequences into polynucleotides for targeted single-copy integration enables the monitoring of stable producer libraries and the fate of their individual clones, allowing for detailed observation of the population dynamics of stable producer cell populations. This is useful for maintaining stable, high-yield cell lines for the production of therapeutic proteins and provides potentially unlimited labeling and tracking of large cell populations.
[0098] Polynucleotides of interest
[0099] This disclosure relates to generating cells with the polynucleotide of interest integrated into their genomic DNA by introducing a vector having a nucleotide sequence that provides targeted integration of the polynucleotide of interest into the cells.
[0100] "Polynucleotide" refers to a polymer chain of multiple nucleotide monomers linked by bonds between monomers, typically phosphodiester bonds (e.g., in the case of polynucleotides formed from naturally occurring nucleotide monomers). Polynucleotides include oligonucleotides, which typically contain ≤50 nucleotides. Polynucleotides can be single-stranded or double-stranded (i.e., can contain a double helix formed by hydrogen bonds between complementary nucleotides). Polynucleotides according to this disclosure may comprise or consist of double-stranded DNA.
[0101] In some embodiments, the polynucleotide according to this disclosure comprises or is composed of DNA. In some embodiments, the polynucleotide is a polydeoxyribonucleotide. In some embodiments, the polynucleotide comprises or is composed of double-stranded DNA.
[0102] This document defines the polynucleotides of this disclosure by reference to their constitutive nucleotide sequences. It should be understood that the constitutive nucleotide sequences of the polynucleotides of interest according to this disclosure are provided as subsequences of the complete sequence of the polynucleotide of interest.
[0103] The polynucleotides of interest disclosed herein contain identifier sequences.
[0104] As used herein, an "identifier sequence" refers to a nucleotide sequence that can be used to identify an entity containing a polynucleotide of interest (i.e., the nucleotide sequence of the polynucleotide of interest). Polynucleotides are well-suited for use as identifiers because they are highly polymorphic (and therefore can produce a very large diversity of unique identifier sequences), and highly sensitive and specific techniques for their detection (e.g., next-generation sequencing) are widely available. Identifier sequences may also be referred to as "barcodes," and labeling a polynucleotide of interest / vector with distinct identifier sequences may be referred to as "barcode coding." It should be understood that within a given set of multiple identifier sequences, each identifier sequence has a unique nucleotide sequence.
[0105] In some embodiments, the identifier sequence according to this disclosure comprises or is composed of a DNA polynucleotide (i.e., a polydeoxyribonucleotide). In some embodiments, the identifier sequence comprises or is composed of a nucleotide sequence having 5 to 100 nucleotides (e.g., one of 7 to 80, 5 to 50, or 10 to 25 nucleotides).
[0106] In some embodiments, within a given plurality of identifier sequences, each identifier sequence contains one or more (e.g., 2 to 25, 2 to 20, 5 to 15, or 5 to 10) positions that are invariant among the identifier sequences in the plurality. That is, in addition to nucleotide sequences that are unique to the individual identifier sequences in the plurality, the identifier sequences may additionally include nucleotide sequences that are conserved among the identifier sequences in the plurality and common to the identifier sequences in the plurality (e.g., containing or consisting of 2 to 25, 2 to 20, 5 to 15, or 5 to 10 nucleotides).
[0107] Therefore, in some embodiments, the identifier sequences among the plurality of identifier sequences according to this disclosure include (i) variable nucleotide sequences that are not identical among the identifier sequences in the plurality, and (ii) invariant nucleotide sequences that are conserved among the identifier sequences in the plurality and are common to the identifier sequences in the plurality. The variable nucleotide sequence may comprise or consist of 5 to 50 nucleotides (e.g., one of 10 to 30, 10 to 25, or 10 to 20 nucleotides). The invariant nucleotide sequence may comprise or consist of 2 to 25, 2 to 20, 5 to 15, or 5 to 10 nucleotides.
[0108] Invariant nucleotide sequences can be used to identify identifier sequences from a given plurality of identifier sequences. For example, invariant nucleotide sequences can be used to identify identifier sequences originating from a common population of polynucleotides / vectors / cells. The use of identifier sequences containing invariant sequences is particularly useful in embodiments of this disclosure, where a plurality (e.g., 2, 3, 4, 5, 6, 7, 8 or more) of polynucleotides of interest with different sequences of interest (e.g., nucleotide sequences encoding different polypeptides / nucleic acids of interest) are to be integrated into the genomic DNA of a cell. According to such embodiments, invariant sequences can be used to identify identifier sequences of a given polynucleotide of interest, such as from a plurality of polynucleotides of interest.
[0109] In an illustrative manner, it may be desirable to modify cells to integrate three different polynucleotides of interest (e.g., polynucleotides of interest according to A, B, and C) containing different sequences of nucleotides of interest into their genomic DNA. For example, A, B, and C may encode different polypeptides of interest. The method may include contacting a population of cells with (i) multiple vectors containing polynucleotides of interest according to A, (ii) multiple vectors containing polynucleotides of interest according to B, and (iii) multiple vectors containing polynucleotides of interest according to C.
[0110] According to (i), each polynucleotide of interest according to A in the multiple vectors encodes the same polypeptide of interest, but contains a unique identifier sequence. The unique identifier sequence then comprises a variable nucleotide sequence (which is unique to a given polynucleotide of interest according to A in a given vector of the multiple (i)) and a constant nucleotide sequence (which is common to the polynucleotide of interest according to A in the multiple vectors of the multiple (i)). Similarly, each polynucleotide of interest according to B in the multiple vectors of (ii) encodes the same polypeptide of interest, but contains a unique identifier sequence comprising a variable nucleotide sequence (which is unique to a given polynucleotide of interest according to B in a given vector of the multiple (ii)) and a constant nucleotide sequence (which is common to the polynucleotide of interest according to B in the multiple vectors of the multiple (ii)). Similarly, each of the multiple vectors according to (iii) encodes the same polypeptide of interest according to C, but contains a unique identifier sequence comprising a variable nucleotide sequence (unique to the given polynucleotide of interest according to C in a given vector of the multiple (iii)) and an invariant nucleotide sequence (common to the polynucleotide of interest according to C in the multiple vectors of the multiple (iii)). The invariant sequences of the identifier sequences of the polynucleotides of interest according to A, B, and C are preferably not identical, such that the invariant nucleotide sequences of a given identifier sequence enable the given identifier sequence to be identified as the identifier sequence of the polynucleotide of interest according to A, B, or C (i.e., capable of identifying the polynucleotide of interest derived from the multiple vectors according to (i), (ii), or (iii)).
[0111] It should be understood that the identifier sequences of this disclosure provide a means of detecting and identifying polynucleotides / vectors of interest containing identifier sequences by analyzing the nucleotide sequences of the identifier sequences. In a preferred embodiment, a given polynucleotide of interest according to this disclosure contains a single identifier sequence.
[0112] The polynucleotide of interest according to this disclosure preferably also includes the nucleotide sequence of interest.
[0113] The nucleotide sequence of interest can be any nucleotide sequence. The nucleotide sequence may, for example, encode one or more polypeptides of interest, and / or may encode one or more nucleic acids of interest. For example, the nucleotide sequence of interest may encode RNA of interest, such as miRNA, shRNA, siRNA, etc. In some embodiments, the nucleotide sequence of interest according to this disclosure encodes one or more polypeptides of interest. Therefore, in some embodiments, the polynucleotide of interest according to this disclosure comprises a nucleotide sequence encoding one or more polypeptides of interest.
[0114] The polypeptide of interest can be any polypeptide. In some embodiments, the polypeptide of interest according to this disclosure may be selected from the following: antigen-binding polypeptides, aptamers, constituent polypeptides of antigen-binding polypeptide complexes, antibody / antigen-binding fragments or derivatives thereof, constituent polypeptides of antibody / antigen-binding fragments or derivatives thereof, Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, decoy receptors for ligands, decoy ligands for receptors, enzymes, enzyme cofactors, growth factors, hormones, interferons, interleukins, thrombolytic agents, transcription factors, epigenetic modifiers, constituent proteins of site-specific nuclease nucleic acid editing systems (e.g., CRISPR / Cas9 system, CRISPR / Cpf1 system, CRISPR / C2c1 system, CRISPR / C2c2 system, CRISPR / C2c3 system, ZFN system, or TALEN system), constituent proteins of ribonucleoproteins, viral proteins (e.g., capsid proteins or viral enzymes), or proteins that can be used for the production of biomolecules.
[0115] In some embodiments, the polynucleotide of interest comprises a nucleotide sequence encoding a polypeptide or multiple polypeptides for generating a polypeptide complex of interest.
[0116] In some embodiments, the polypeptide of interest is a polypeptide suitable for the treatment or prevention of a disease / symptom, or a constituent polypeptide of a polypeptide complex suitable for the treatment or prevention of a disease / symptom. A polypeptide / polypeptide complex suitable for the treatment or prevention of a disease / symptom can be any polypeptide / polypeptide complex for which application is permitted for the treatment or prevention of a disease / symptom.
[0117] In some embodiments, the polypeptide of interest is an antigen-binding polypeptide or a constituent polypeptide of an antigen-binding polypeptide complex. An antigen-binding polypeptide / polypeptide complex comprises an antibody (i.e., an immunoglobulin (Ig)) and an antigen-binding fragment of the antibody. As used herein, "antibody" includes monoclonal antibodies, polyclonal antibodies, monospecific and multispecific (e.g., bispecific, trispecific, etc.) antibodies, and antibody-derived antigen-binding molecules such as scFv, scFab, diabody, triabody, scFv-Fc, microantibodies, and single-domain antibodies (e.g., VhH, etc.). Antigen-binding fragments of antibodies include, for example, Fv, Fab, F(ab')2, and F(ab') fragments.
[0118] Antigen-binding peptides / peptide complexes also include, for example, aptamers, thioredoxins, monobodies, anticalin, Kunitz domains, avimer, knottin, fynomer, atrimer, DARPin, affibody, nanobodies (i.e., single-domain antibodies (sdAbs)), affilin, armadillo repeat protein (ArmRP), OBody, and fibronectin, which are reviewed, for example, in Reverdatto et al., Curr Top Med Chem. 2015; 15(12): 1082–1101, which is incorporated herein by reference in its entirety (see also, for example, Boersma et al., J BiolChem (2011) 286:41273-85 and Emanuel et al., Mabs (2011) 3:38-48).
[0119] In some embodiments, the polypeptide of interest is a multispecific antigen-binding polypeptide or a constituent polypeptide of a multispecific antigen-binding polypeptide complex. "Multispecific" means that the antigen-binding polypeptide / polypeptide complex exhibits specific binding to more than one target antigen (e.g., one of two, three, four, five, six, or more target antigens). In some embodiments, the multispecific antigen-binding polypeptide / polypeptide complex is a bispecific antigen-binding polypeptide / polypeptide complex.
[0120] In some embodiments, the multispecific antigen-binding peptide / peptide complex comprises at least two distinct antigen-binding domains. The antigen-binding domains of the multispecific antigen-binding peptide / peptide complex may include (e.g., an antibody capable of binding to a given target antigen) a variable heavy chain region (VH) and a variable light chain region (VL).
[0121] In some embodiments, the peptide of interest is a detectable peptide or a peptide with detectable activity. The detectable peptide may be or contains a fluorescent peptide. Fluorescent peptides include green fluorescent protein and its variants (e.g., enhanced green fluorescent protein), yellow fluorescent protein (e.g., citrine), red fluorescent protein and its variants (e.g., mOrange, mCherry), blue fluorescent protein and its variants (e.g., TagBFP), cyan fluorescent protein and its variants (e.g., mTurquoise, cerulean), allophycocyanin, phycocyanin, phycoerythrin, and phycoerythrocyanin. The detectable peptide may be or contains an epitope tag. Epitope tags include, for example, His (e.g., 6XHis; SEQ ID NO:23), FLAG, c-Myc, StrepTag, hemagglutinin, E-tag, calmodulin-binding protein (CBP), glutathione S-transferase (GST), maltose-binding protein (MBP), thioredoxin, S-peptide, T7 peptide, SH2 domain, avidin, streptavidin, and haptens (e.g., biotin, digoxigenin, dinitrophenol). The polypeptide with detectable activity may be or contains an enzymatic moiety. Enzymatic moieties include, for example, luciferase, glucose oxidase, galactosidase (e.g., β-galactosidase), glucorinidase, phosphatase (e.g., alkaline phosphatase), peroxidase (e.g., horseradish peroxidase), and cholinesterase.
[0122] In some embodiments, the polynucleotide of interest according to this disclosure comprises a nucleotide sequence encoding more than one polypeptide of interest. In some embodiments, the polynucleotide of interest encodes one of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides of interest. In embodiments in which the polynucleotide of interest encodes more than one polypeptide of interest, it should be understood that each polypeptide of interest is independently a polypeptide of interest according to this disclosure.
[0123] In some embodiments where the polynucleotide of interest encodes more than one polypeptide of interest, the multiple polypeptides of interest can associate to form a polypeptide complex. That is, in some embodiments, the polynucleotide of interest encodes more than one polypeptide of interest, and the polypeptide of interest is a constituent polypeptide of the polypeptide complex. According to such embodiments, following expression of the polypeptide of interest from the polynucleotide of interest in a cell containing the polynucleotide of interest, the polypeptides of interest can associate with each other to form a polypeptide complex.
[0124] In some embodiments, the polynucleotide of interest encodes a constituent polypeptide of an antigen-binding polypeptide complex. In some embodiments, the polynucleotide of interest encodes a constituent polypeptide of a multispecific (e.g., bispecific) antigen-binding polypeptide complex.
[0125] In some embodiments, the polynucleotide of interest may additionally include one or more non-peptide-coding nucleotide sequences. Non-peptide-coding nucleotide sequences include, for example, promoters, enhancers, stop codons, 5' caps, 5' UTRs, 3' UTRs, and / or polyadenylation signaling sequences.
[0126] In some embodiments, the polynucleotide of interest is contained in the 5' UTR of the start codon (i.e., upstream, in the context of the polynucleotide's nucleotide sequence).
[0127] In some embodiments, the polynucleotide of interest is contained in the 3' UTR of the stop codon (i.e., downstream, in the context of the polynucleotide's nucleotide sequence). In some embodiments, the polynucleotide is contained in the 3' UTR of the polyadenylation signal sequence 5'. In some embodiments, the polynucleotide is contained in both the stop codon 3' and the 3' UTR of the polyadenylation signal sequence 5'.
[0128] In some embodiments, the polynucleotide of interest further comprises a nucleotide sequence for expressing one or more polypeptides encoded by the polynucleotide of interest. In some embodiments, the polynucleotide of interest comprises one or more regulatory nucleotide sequences operatively linked to the nucleotide sequence encoding one or more polypeptides of interest according to this disclosure. The regulatory nucleotide sequence includes a promoter sequence and an enhancer sequence for driving and / or increasing the expression of one or more polypeptides from the polynucleotide of interest. The term “operatively linked” can include situations where the nucleotide sequence nucleic acid encoding one or more polypeptides of interest and the regulatory nucleotide sequence (e.g., promoter sequence and / or enhancer sequence) are covalently linked in such a manner that the expression of the nucleotide sequence nucleic acid encoding one or more polypeptides of interest is placed under the influence or control of the regulatory nucleotide sequence (thus forming an expression cassette). Thus, if the regulatory nucleotide sequence is capable of influencing the transcription of the nucleotide sequence, the regulatory nucleotide sequence is operatively linked to the nucleotide sequence encoding one or more polypeptides of interest. The resulting transcript can then be translated into the polypeptide of interest.
[0129] According to this disclosure, any suitable regulatory nucleotide sequence may be employed in the polynucleotide of interest. In some embodiments, the promoter sequence is a promoter sequence that drives expression in mammalian cells. The promoter may provide constitutive expression of the nucleic acid under the control of the promoter, or may provide inducible expression of the nucleic acid under the control of the promoter (e.g., in response to a given chemical substance). Suitable promoter sequences for expression in mammalian cells are well known to those skilled in the art, and examples of such promoters are described, for example, in Chen et al., PLoS ONE (2011) 6(8):e23376, which is incorporated herein by reference in its entirety. Such promoter sequences include the chicken β-actin promoter, the human EF1α promoter, the mouse PGK promoter, the human ubiquitin C promoter, the MC1 promoter, the immediate early enhancer of human CMV, deletion derivatives of the CMV promoter (e.g., CMVd1), and the CMV immediate early enhancer / chicken β-actin promoter / rabbit β-globin intron complex promoter (CAG). In some embodiments, the promoter sequence is a CMV promoter or an SV40 promoter.
[0130] In some embodiments, the polynucleotide of interest comprises a nucleotide sequence encoding an optional marker to facilitate the identification and / or selection of cells containing / expressing the polynucleotide of interest. Optional markers include proteins conferring resistance to cytotoxic compounds (e.g., antibiotics) or other toxins (e.g., puromycin, blastomycin, ampicillin, neomycin, methotrexate, or tetracycline), as well as proteins that supplement auxotrophic deficiencies. By way of example, in an experimental example of this disclosure, the polynucleotide of interest comprises a nucleotide sequence encoding a puromycin N-acetyltransferase that confers resistance to puromycin.
[0131] The aspects and embodiments of this disclosure relate to a plurality of polynucleotides of interest. According to such aspects and embodiments, the identifier sequences of individual polynucleotides of interest within the plurality of polynucleotides are not identical. In a preferred embodiment, the identifier sequence of a polynucleotide of interest within the plurality of polynucleotides of interest is not identical to the identifier sequence of any other polynucleotide of interest within the plurality of polynucleotides of interest. That is, each polynucleotide of interest within the plurality of polynucleotides of interest preferably contains a unique identifier sequence (i.e., relative to the identifier sequences of other polynucleotides of interest in the plurality).
[0132] In a preferred embodiment, a polynucleotide of interest within a plurality of polynucleotides of interest contains a nucleotide sequence that encodes the same polypeptide as other polynucleotides of interest within the plurality of polynucleotides of interest.
[0133] In a preferred embodiment, among a given plurality of polynucleotides of interest, (i) each polynucleotide of interest contains a unique identifier sequence, and (ii) the polynucleotides of interest in the plurality of polynucleotides of interest encode the same polypeptide of interest.
[0134] Polynucleotides containing polynucleotides of interest, vectors
[0135] In some embodiments, the polynucleotide of interest according to this disclosure is provided within a larger polynucleotide (i.e., contained within the larger polynucleotide). That is, the nucleotide sequence of the polynucleotide of interest is contained within the larger polynucleotide and is a subsequence of the larger polynucleotide. In some embodiments, the polynucleotide containing the polynucleotide of interest is a vector. In some embodiments, the polynucleotide containing the polynucleotide of interest is subsequently contained within a vector.
[0136] In this document, "vector" refers to a nucleic acid molecule used as a medium for transferring exogenous nucleic acids into cells. Vectors according to this disclosure contain polynucleotides of interest according to this disclosure and facilitate the delivery of these polynucleotides of interest into cells. Vectors contemplated in connection with this disclosure include DNA vectors, RNA vectors, plasmids (e.g., conjugating plasmids (e.g., F plasmids), non-conjugating plasmids, R plasmids, col plasmids, episomes), viral vectors (e.g., retroviral vectors, such as gamma retroviral vectors (e.g., murine leukemia virus (MLV)-derived vectors, such as SFG vectors), lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vaccinia virus vectors, and herpesvirus vectors), transposon-based vectors, and artificial chromosomes (e.g., yeast artificial chromosomes), as described, for example, in Maus et al., Annu Rev Immunol. (2014) 32:189-225 and Morgan and Boyerinas, Biomedicines (2016) 4:9, both of which are incorporated herein by reference in their entirety. In some embodiments, the vectors according to this disclosure are lentiviral vectors.
[0137] In some embodiments, the polynucleotide (e.g., a vector) containing the polynucleotide of interest includes a nucleotide sequence that facilitates integration of the polynucleotide of interest into the genomic DNA of the cell in which it is introduced. For example, the polynucleotide / vector containing the polynucleotide of interest may include a nucleotide sequence that facilitates integration of the polynucleotide of interest into the genomic DNA of the cell in which it is introduced via homologous recombination. In some embodiments, the nucleotide sequence facilitating integration of the polynucleotide of interest into the genomic DNA of the cell in which it is introduced is also provided on a polynucleotide other than the polynucleotide containing the polynucleotide of interest.
[0138] In a preferred embodiment, a nucleotide sequence that promotes the integration of the polynucleotide of interest into the genomic DNA of the cell in which the polynucleotide of interest is introduced provides targeted integration of the polynucleotide of interest. “Targeted integration” or “site-specific integration” of a given nucleotide sequence into a recipient nucleotide sequence generally refers to integration at a specific location in the recipient nucleotide sequence, and is distinguished from random / non-specific integration. The site of integration into the recipient nucleotide sequence can be controlled by a nucleotide sequence that promotes integration into one or both of the nucleotide sequence to be integrated and / or the recipient nucleotide sequence.
[0139] In a preferred embodiment, the nucleotide sequence that facilitates the integration of the polynucleotide of interest into the genomic DNA of the cell in which the polynucleotide of interest is introduced provides integration of a single copy of the given polynucleotide of interest according to this disclosure. That is, in a preferred embodiment, only a single copy of the given polynucleotide of interest according to this disclosure is integrated into the genomic DNA of the given cell in which the polynucleotide of interest is introduced. Therefore, according to such embodiments, a cell having the polynucleotide of interest integrated into its genomic DNA contains a single identifier sequence unique to that cell for the given polynucleotide of interest.
[0140] For clarity, aspects and embodiments of this disclosure contemplate the integration of multiple different polynucleotides of interest comprising different nucleotide sequences of interest (e.g., encoding different polypeptides / nucleic acids). According to such aspects and embodiments, a single copy of a given polynucleotide of interest (i.e., a given polynucleotide of interest among the plurality) is still integrated, but additional different polynucleotides of interest (e.g., containing different nucleotide sequences of interest relative to the given polynucleotide of interest sequence) are also integrated.
[0141] A given polynucleotide (e.g., a vector) containing the polynucleotide of interest according to this disclosure preferably contains a single copy of the given polynucleotide of interest, and therefore contains a single identifier sequence for the given polynucleotide of interest.
[0142] In some embodiments, the polynucleotide containing the polynucleotide of interest (e.g., a vector) comprises a nucleotide sequence that provides integration of the polynucleotide of interest into the genomic DNA of the cell into which the polynucleotide of interest is to be introduced. In some embodiments, the nucleotide sequence providing integration of the polynucleotide of interest is additionally or alternatively provided on a polynucleotide (e.g., a vector) that does not contain the polynucleotide of interest.
[0143] In some embodiments, the integration of the polynucleotide of interest into the genomic DNA of the cell into the genomic DNA of the cell is provided via recombinase-mediated cassette exchange (RMCE).
[0144] Site-specific recombinase (SSR) systems for introducing a given nucleotide sequence into a recipient nucleotide sequence via RMCE are well known in the art. Such SSR systems include, for example, the Cre-Lox, Flp-FRT, and Dre-rox systems, and are described, for example, in Tian and Zhou, J Biol Chem. (2021) 296: 100509 and Turan et al., Gene (2013) 515(1):1-27, both of which are incorporated herein by reference in their entirety. Such SSR systems and variants of other SSR systems are also well known in the art and can be similarly employed. The use of RMCE to introduce a polynucleotide of interest encoding a polypeptide of interest into the genomic DNA of a cell is described, for example, in Srirangan et al., Crit Rev Biotechnol. (2020) 40(6):833-851, which is incorporated herein by reference in its entirety.
[0145] In some embodiments, the polynucleotide (e.g., a vector) containing the polynucleotide of interest contains one or more target sequences of a recombinase (e.g., Cre recombinase, Flp recombinase, Dre recombinase, etc.). In some embodiments, the polynucleotide / vector containing the polynucleotide of interest contains a target sequence of the polynucleotide of interest side-joined to a recombinase.
[0146] In some embodiments, the target sequence of the recombinase according to this disclosure is a lox sequence, such as loxP, loxFAS, or L3 (homological recombination between compatible lox sequences is catalyzed by Cre recombinase). In some embodiments, the target sequence of the recombinase is an FRT sequence (homological recombination between such sequences is catalyzed by Flp recombinase). In some embodiments, the target sequence of the recombinase is a rox sequence (homological recombination between such sequences is catalyzed by Dre recombinase).
[0147] It should be understood that the nucleotide sequence that promotes the integration of the polynucleotide of interest into the genomic DNA of the cell into which the polynucleotide of interest is to be introduced is selected to be suitable for (i.e., compatible with) the integration of the polynucleotide of interest into the genomic DNA of the cell. That is, the nucleotide sequence that promotes the integration of the polynucleotide of interest is complementary to the nucleotide sequence that provides targeted integration of the polynucleotide of interest into the genomic DNA of the cell into which the polynucleotide / vector is to be introduced. For example, it may be selected for compatibility with such a nucleotide sequence that promotes the integration of the polynucleotide of interest provided in the genomic DNA of the cell into which the polynucleotide of interest is to be introduced. By way of example, in the case where the genomic DNA of the cell into which the polynucleotide of interest is to be integrated contains one or more lox sequences, the polynucleotide / vector containing the polynucleotide of interest may contain lox sequences flanked by the nucleotide sequence of the polynucleotide of interest.
[0148] In some embodiments (particularly those in which the polynucleotide of interest is to be integrated into the genomic DNA of a cell via RMCE), the polynucleotide / vector containing the polynucleotide of interest may further comprise a nucleotide sequence encoding the associated recombinase. For example, in some embodiments where the polynucleotide / vector containing the polynucleotide of interest comprises a target sequence flanking the polynucleotide of interest for a given recombinase, the polynucleotide / vector may further comprise a nucleotide sequence encoding the given recombinase. By way of example, in cases where the polynucleotide / vector containing the polynucleotide of interest comprises a lox sequence flanking the polynucleotide of interest, the polynucleotide / vector may further comprise a nucleotide sequence encoding the Cre recombinase.
[0149] Aspects and embodiments of this disclosure relate to multiple polynucleotides (e.g., multiple vectors) comprising a polynucleotide of interest. According to such aspects and embodiments, the identifier sequences of the individual polynucleotides / vectors comprising the polynucleotide of interest from the plurality are not identical. In some embodiments, the polynucleotide of interest differs only in the nucleotide sequence of its identifier sequence.
[0150] In some embodiments, the identifier sequences of individual polynucleotides / vectors in the plurality of embodiments comprise variable nucleotide sequences that are different from each other. In some embodiments, the identifier sequences of individual polynucleotides / vectors in the plurality of embodiments comprise (i) variable nucleotide sequences that are different from each other, and (ii) invariant nucleotide sequences that are conserved among the individual polynucleotide / vector identifier sequences in the plurality of embodiments and are common to the identifier sequence.
[0151] In a preferred embodiment, the identifier sequence of the polynucleotide of interest contained in the polynucleotide / vector containing the polynucleotide of interest is different from the identifier sequence of any other polynucleotide of interest contained in the polynucleotide / vector containing the polynucleotide of interest within the plurality of polynucleotides of interest. That is, each polynucleotide / vector containing the polynucleotide of interest within the plurality of polynucleotides of interest preferably contains a unique identifier sequence (i.e., relative to the identifier sequences of the other polynucleotides / vectors among the plurality of polynucleotides of interest).
[0152] In some embodiments, for a given plurality of polynucleotides (e.g., a plurality of vectors) containing a polynucleotide of interest, each individual polynucleotide / vector in the plurality contains a polynucleotide of interest having the same sequence of nucleotides of interest. In some embodiments, for a given plurality of polynucleotides (e.g., a plurality of vectors) containing a polynucleotide of interest, each individual polynucleotide / vector in the plurality contains a polynucleotide of interest encoding the same polypeptide.
[0153] In a preferred embodiment, within a given plurality of polynucleotides (e.g., a plurality of vectors) containing the polynucleotide of interest, (i) each of the plurality of polynucleotides / vectors contains the polynucleotide of interest with a unique identifier sequence, and (ii) the polynucleotide of interest contained within the plurality of polynucleotides / vectors contains the same nucleotide sequence of interest. In a preferred embodiment, within a given plurality of polynucleotides (e.g., a plurality of vectors) containing the polynucleotide of interest, (i) each of the plurality of polynucleotides / vectors contains the polynucleotide of interest with a unique identifier sequence, and (ii) the polynucleotide of interest contained within the plurality of polynucleotides / vectors encodes the same polypeptide of interest.
[0154] In some embodiments, within a given plurality of polynucleotides (e.g., a plurality of vectors) containing a polynucleotide of interest, (i) each of the plurality of polynucleotides / vectors contains a polynucleotide of interest having a unique identifier sequence comprising (a) a unique variable nucleotide sequence and (b) an invariant sequence that is conserved among the identifier sequences of the individual polynucleotides / vectors in the plurality of polynucleotides and is common to the identifier sequence; and (ii) the polynucleotide of interest contained within the polynucleotides / vectors in the plurality of polynucleotides encodes the same polypeptide of interest.
[0155] The aspects and embodiments of this disclosure contemplate the introduction of multiple (e.g., 2, 3, 4, 5, 6, 7, 8 or more) polynucleotides of interest into the genomic DNA of a cell, wherein individual polynucleotides of interest among the multiple polynucleotides of interest contain different nucleotide sequences of interest (e.g., nucleotide sequences encoding different polypeptides / nucleic acids of interest). For example, the integration of at least two different polynucleotides of interest is contemplated: a first polynucleotide of interest containing a first nucleotide sequence of interest and a second polynucleotide of interest containing a second nucleotide sequence of interest, wherein the first nucleotide sequence of interest and the second nucleotide sequence of interest are different.
[0156] Therefore, in some aspects and embodiments, this disclosure provides a plurality of (e.g., 2, 3, 4, 5, 6, 7, 8 or more) polynucleotides (e.g., a plurality of vectors), each comprising a polynucleotide of interest according to this disclosure. According to such aspects and embodiments, the plurality of polynucleotides within a larger group may comprise different nucleotide sequences of interest. In some embodiments, the plurality of polynucleotides within a larger group encode different polypeptides or nucleic acids of interest.
[0157] By way of example, three different types of polynucleotides (e.g., three different vectors) can be provided: multiple polynucleotides containing a polynucleotide of interest according to A, multiple polynucleotides containing a polynucleotide of interest according to B, and multiple polynucleotides containing a polynucleotide of interest according to C. The polynucleotide of interest according to A provided within the multiple polynucleotides containing the polynucleotide of interest according to A encodes the same polypeptide of interest, but contains a different identifier sequence. Similarly, the polynucleotide of interest according to B provided within the multiple polynucleotides containing the polynucleotide of interest according to B encodes the same polypeptide of interest, but contains a different identifier sequence. Similarly, the polynucleotide of interest according to C provided within the multiple polynucleotides containing the polynucleotide of interest according to C encodes the same polypeptide of interest, but contains a different identifier sequence. The polynucleotides of interest according to A, B, and C can encode different polypeptides of interest. That is, the polynucleotide of interest according to A can encode a polypeptide of interest that is different from the polypeptide of interest encoded by the polynucleotide of interest according to B, and also different from the polypeptide of interest encoded by the polynucleotide of interest according to C. Similarly, the polynucleotide of interest according to B can encode a polypeptide of interest that is different from the polypeptide of interest encoded by the polynucleotide of interest according to A, and also different from the polypeptide of interest encoded by the polynucleotide of interest according to C. Likewise, the polynucleotide of interest according to C can encode a polypeptide of interest that is different from the polypeptide of interest encoded by the polynucleotide of interest according to A, and also different from the polypeptide of interest encoded by the polynucleotide of interest according to B.
[0158] According to such aspects and embodiments, the identifier sequences of a given plurality of polynucleotides within a larger group may contain the same invariant nucleotide sequences (except for their unique variable nucleotide sequences). Therefore, the invariant nucleotide sequences can be used to identify identifier sequences from a given plurality of polynucleotides (from their larger group).
[0159] By way of example, three different types of polynucleotides (e.g., three different vectors) may be provided: multiple polynucleotides containing a polynucleotide of interest according to A, multiple polynucleotides containing a polynucleotide of interest according to B, and multiple polynucleotides containing a polynucleotide of interest according to C. Each polynucleotide of interest according to A may contain an identifier sequence with the same invariant nucleotide sequence; each polynucleotide of interest according to B may contain an identifier sequence with the same invariant nucleotide sequence; and each polynucleotide of interest according to C may contain an identifier sequence with the same invariant nucleotide sequence. The invariant nucleotide sequence of the polynucleotide of interest according to A is different from the invariant nucleotide sequence of the polynucleotide of interest according to B, and also different from the invariant nucleotide sequence of the polynucleotide of interest according to C. Similarly, the invariant nucleotide sequence of the polynucleotide of interest according to B is different from the invariant nucleotide sequence of the polynucleotide of interest according to A, and also different from the invariant nucleotide sequence of the polynucleotide of interest according to C. Similarly, the invariant nucleotide sequence of the polynucleotide of interest according to C is different from the invariant nucleotide sequence of the polynucleotide of interest according to A, and also different from the invariant nucleotide sequence of the polynucleotide of interest according to B.
[0160] cell
[0161] This disclosure relates to cells having a polynucleotide of interest integrated into its genomic DNA according to this disclosure. This disclosure also relates to cells into which the polynucleotide of interest according to this disclosure is to be introduced.
[0162] The cells described in this disclosure can be eukaryotic cells, such as mammalian cells. Mammals can be primates (rhesus monkeys, cynomolgus monkeys, non-human primates or humans) or non-human mammals (e.g., rabbits, guinea pigs, rats, mice or other rodents (including any animal in the order Rodentia), cats, dogs, pigs, sheep, goats, cattle (including dairy cows, such as dairy cows, or any animal in the order Bos), horses (including any animal in the family Equus), donkeys and non-human primates).
[0163] In some embodiments, the cells are or are derived from cell types commonly used to express peptides for human therapies. Exemplary cells are described, for example, in Kunert and Reinhart, Appl Microbiol Biotechnol. (2016) 100:3451–3461 (which is incorporated herein by reference in its entirety), and include, for example, CHO, HEK 293, PER.C6, NSO, and BHK cells. In a preferred embodiment, the cells are or are derived from CHO cells.
[0164] The cell to which the polynucleotide of interest according to this disclosure is to be introduced (i.e., prior to such introduction) lacks the polynucleotide of interest according to this disclosure. In some embodiments, the genomic DNA of such cells contains a nucleotide sequence that facilitates the integration of the polynucleotide of interest into the genomic DNA (i.e., after the polynucleotide of interest is introduced into the cell).
[0165] It should be understood that in embodiments where the genomic DNA of a cell according to this disclosure contains a nucleotide sequence that promotes the integration of the polynucleotide of interest, the sequence is selected to be suitable for (i.e., compatible with) the integration of the polynucleotide of interest provided on a polynucleotide (e.g., a vector) containing the polynucleotide of interest according to this disclosure. That is, the nucleotide sequence of the genomic DNA of the cell promoting the integration of the polynucleotide of interest is complementary to a nucleotide sequence that facilitates the integration of the polynucleotide of interest provided on a polynucleotide / vector containing the polynucleotide of interest. For example, a cell into which the polynucleotide of interest is to be integrated may contain a nucleotide sequence that promotes the integration of the polynucleotide of interest into its genomic DNA via homologous recombination (i.e., after the polynucleotide of interest has been introduced into the cell).
[0166] In a preferred embodiment, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated comprises a nucleotide sequence providing targeted integration of the polynucleotide of interest (i.e., after the polynucleotide / vector containing the polynucleotide of interest is introduced into the cell). The targeted integration receptor nucleotide sequence providing the nucleotide sequence to be integrated is also referred to in the art as a "landing pad." Therefore, in some embodiments, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated according to this disclosure comprises a landing pad for the polynucleotide of interest.
[0167] In a preferred embodiment, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated comprises an integrating nucleotide sequence providing a single copy of the given polynucleotide of interest according to this disclosure. The nucleotide sequence providing a single copy of the integrating recipient nucleotide sequence to be integrated may also be referred to as a “single-copy landing pad.” Therefore, in some embodiments, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated according to this disclosure comprises a single-copy landing pad for the polynucleotide of interest.
[0168] Therefore, after the polynucleotide of interest is integrated into the genomic DNA of a cell according to this disclosure, the cell preferably contains only a single copy of the polynucleotide of interest, and similarly contains a single identifier sequence that is unique to the cell.
[0169] In some embodiments, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated comprises a nucleotide sequence that provides integration of the polynucleotide of interest into the genomic DNA via RMCE.
[0170] In some embodiments, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated contains one or more target sequences of a recombinase (e.g., Cre recombinase, Flp recombinase, Dre recombinase, etc.). The target sequence of the recombinase may be, for example, a lox sequence (e.g., loxP (also known as "L2"), loxFAS, or L3 sequence), an FRT sequence, or a rox sequence.
[0171] It should be understood that in embodiments where the cell into which the polynucleotide of interest is to be integrated contains a nucleotide sequence that promotes the integration of the polynucleotide of interest into the genomic DNA (i.e., after the polynucleotide of interest is introduced into the cell), the nucleotide sequence that promotes integration is selected to be suitable for (i.e., compatible with) the integration of the polynucleotide of interest into the genomic DNA of that cell. For example, it may be selected for compatibility with such a nucleotide sequence that promotes the integration of the polynucleotide of interest provided in the polynucleotide / vector containing the polynucleotide of interest. By way of example, in cases where the polynucleotide / vector containing the polynucleotide of interest to be integrated contains a lox sequence flanking the nucleotide sequence of the polynucleotide of interest, the genomic DNA of the cell into which the polynucleotide of interest is to be integrated may contain one or more lox sequences.
[0172] In some embodiments, the genomic DNA of a cell into which the polynucleotide of interest is to be integrated according to this disclosure comprises nucleotide sequences that facilitate the integration of multiple (e.g., 2, 3, 4, 5, 6, 7, 8 or more) polynucleotides of interest (wherein the multiple polynucleotides of interest have different nucleotide sequences of interest, e.g., nucleotide sequences encoding different polypeptides / nucleic acids of interest). After the different polynucleotides of interest are integrated into the genomic DNA of such cells, the cell contains only a single copy of each of the different polynucleotides of interest and thus contains a unique identifier sequence profile (i.e., identifier sequences derived from the different polynucleotides of interest among the multiple).
[0173] It should be understood that in embodiments where the genomic DNA of a cell according to this disclosure contains nucleotide sequences that promote the integration of multiple different polynucleotides of interest, the sequences are selected to be suitable for (i.e., compatible with) the integration of the different polynucleotides of interest. That is, the nucleotide sequences of the genomic DNA of the cell that promote the integration of the multiple different polynucleotides of interest are complementary to nucleotide sequences that facilitate the integration of the different polynucleotides of interest provided in a polynucleotide / vector containing the different polynucleotides of interest.
[0174] For example, a cell into which multiple different polynucleotides of interest (e.g., nucleotide sequences encoding different polypeptides / nucleic acids of interest) are to be integrated may contain nucleotide sequences that facilitate the integration of various different polynucleotides of interest into their genomic DNA via homologous recombination (i.e., after the polynucleotides of interest are introduced into the cell).
[0175] In some embodiments, the genomic DNA of a cell into which the polynucleotide of interest according to the present disclosure is to be integrated comprises more than one single-copy landing pad. In some embodiments, the genomic DNA of a cell into which the polynucleotide of interest according to the present disclosure is to be integrated comprises 2, 3, 4, 5, 6, 7, 8 or more single-copy landing pads.
[0176] Such cells, containing multiple single-copy landing pads, can be used to generate cells containing multiple (e.g., 2, 3, 4, 5, 6, 7, 8, or more) integrated polynucleotides of interest, each of which has a different sequence of nucleotides of interest (e.g., encoding different polypeptides / nucleic acids of interest). After integrating the different polynucleotides of interest into the genomic DNA of such cells, the cells preferably contain only a single copy of each of the different polynucleotides of interest and thus contain a unique identifier sequence profile (i.e., identifier sequences derived from the different polynucleotides of interest among the multiple).
[0177] By way of example, a cell may contain, for example, three different single-copy landing pads, which can be used for the targeted integration of three different polynucleotides of interest (e.g., polynucleotides of interest according to A, B, and C), wherein the polynucleotides of interest according to A, B, and C encode different polypeptides of interest. The polynucleotides of interest according to A, B, and C can be integrated into the genomic DNA of a cell by contacting a population of such cells with the following under conditions suitable for introducing a vector into the cell: (i) multiple vectors containing nucleotide sequences providing targeted integration of the polynucleotide of interest according to A (including an identifier sequence), (ii) multiple vectors containing nucleotide sequences providing targeted integration of the polynucleotide of interest according to B (including an identifier sequence), and (iii) multiple vectors containing nucleotide sequences providing targeted integration of the polynucleotide of interest according to C (including an identifier sequence). Each of the multiple vectors contains polynucleotides of interest with unique identifier sequences; that is, referring to the preceding statements, no two vectors in (i) have the same identifier sequence, no two vectors in (ii) have the same identifier sequence, and no two vectors in (iii) have the same identifier sequence. After integration, the cell contains genomic DNA containing a single copy of the polynucleotide of interest according to A, a single copy of the polynucleotide of interest according to B, and a single copy of the polynucleotide of interest according to C. The cell also contains a unique identifier sequence profile formed by the identifier sequences of the integrated polynucleotides of interest according to A, the integrated polynucleotides of interest according to B, and the integrated polynucleotides of interest according to C.
[0178] In some embodiments, the genomic DNA of a cell into which multiple different polynucleotides of interest are to be integrated comprises nucleotide sequences that provide integration of the different polynucleotides of interest into the genomic DNA via RMCE.
[0179] In some embodiments, the genomic DNA of a cell into which multiple different polynucleotides of interest are to be integrated contains target sequences of multiple different recombinases. By way of example, the cell may contain target sequences of Cre recombinase, Flp recombinase, and Dre recombinase.
[0180] In some embodiments, the genomic DNA of a cell into which one or more polynucleotides of interest according to this disclosure are to be integrated contains three distinct target sequences (i.e., target sequences 1, 2, and 3) of a recombinase. Target sequences 1, 2, and 3 may be provided in such an arrangement that target sequence 3 is provided between target sequence 1 and target sequence 2. Target sequences 1, 2, and 3 are preferably non-cross-reactive (i.e., they are incompatible for recombination with each other). In some embodiments, a nucleotide sequence encoding an optional marker is provided between target sequence 1 and target sequence 3. In some embodiments, each of target sequences 1, 2, and 3 is a target sequence of the same recombinase. In some embodiments, each of target sequences 1, 2, and 3 is a target sequence of Cre recombinase. In some embodiments, one of target sequences 1, 2, and 3 is an L3 sequence, another of target sequences 1, 2, and 3 is a loxP sequence, and the remaining target sequences in target sequences 1, 2, and 3 are loxFAS sequences.
[0181] In some embodiments, target sequence 1 is an L3 sequence, target sequence 2 is a loxP sequence, and target sequence 3 is a loxFAS sequence.
[0182] Such cells can be employed in a “dual-vector” strategy, which targets the integration of one or more polynucleotides of interest into their genomic DNA, for example, by means of: (i) a first polynucleotide (e.g., a vector) comprising (5' to 3'): (a) a first target sequence of recombinase for target sequence 1 of the cell’s genomic DNA that is recombinantly compatible (e.g., the same target sequence of the recombinase as target 1), (b) a promoter and a start codon, and (c) a second target sequence of recombinase for target sequence 3 of the cell’s genomic DNA that is recombinantly compatible (e.g., the same target sequence of the recombinase as target 3); and (ii) a second polynucleotide (e.g., a vector) comprising: (a) a third target sequence of recombinase for target sequence 3 of the cell’s genomic DNA that is recombinantly compatible (e.g., the same target sequence of the recombinase as target 3), and (b) a nucleotide sequence encoding an optional marker lacking a start codon (in embodiments where the cell’s genomic DNA contains such an optional nucleotide sequence, which differs from the target sequence 1 provided in the cell’s genomic DNA). (c) the optional marker encoded by the nucleotide sequence between the target sequence 3 and the target sequence 2 of the recombinase (e.g., the same target sequence of the recombinase as target 2).
[0183] Targeted integration can be achieved via dual RMCE, wherein the promoter and start codon of the first polynucleotide are integrated via RCME between the first target sequence of the recombinase and target sequence 1 of the cell's genomic DNA, and between the second target sequence of the recombinase and target sequence 3 of the cell's genomic DNA; and wherein the nucleotide sequence encoding an optional marker lacking the start codon is integrated via RCME between the third target sequence of the recombinase and target sequence 3 of the cell's genomic DNA, and between the fourth target sequence of the recombinase and target sequence 2 of the cell's genomic DNA. After dual RMCE, the cell's genomic DNA has the nucleotide sequence of the integrated first polynucleotide (b) and the nucleotide sequence of the integrated second polynucleotide (b). Cells that have undergone dual RMCE can be identified by appropriate selection for the expression of the optional marker, which will be expressed only by cells that have integrated both the nucleotide sequences of the first polynucleotide (b) and the nucleotide sequences of the integrated second polynucleotide (b).
[0184] According to such embodiments, the first polynucleotide may contain a nucleotide sequence of interest according to this disclosure (e.g., encoding one or more polypeptides of interest) between the first target sequence of the recombinase and the second target sequence of the recombinase (e.g., the 5' of the promoter and start codon); and / or the second polynucleotide may contain a nucleotide sequence of interest according to this disclosure (e.g., encoding one or more polypeptides of interest) between the third target sequence of the recombinase and the fourth target sequence of the recombinase (e.g., the 3' of a nucleotide sequence encoding an optional marker lacking a start codon). According to such embodiments, the first polynucleotide may contain an identifier sequence according to this disclosure between the first target sequence of the recombinase and the second target sequence of the recombinase (e.g., the 5' of the promoter and start codon), or the second polynucleotide may contain an identifier sequence according to this disclosure between the third target sequence of the recombinase and the fourth target sequence of the recombinase (e.g., the 3' of a nucleotide sequence encoding an optional marker lacking a start codon).
[0185] It should be understood that this disclosure also provides a first polynucleotide (e.g., a vector) according to the embodiments described in any one of the preceding three paragraphs, and also provides a second polynucleotide (e.g., a vector) according to the embodiments described in any one of the preceding three paragraphs.
[0186] In some embodiments, the cell into which the polynucleotide of interest according to this disclosure is to be introduced is a targeted integration (TI) host cell according to any embodiment described in WO 2019 / 126634 A2, which is incorporated herein by reference in its entirety. In some embodiments, the cell according to this disclosure is a targeted integration (TI) host cell containing an exogenous nucleotide sequence at an integration site within a specific locus in the genome of the host cell, wherein the locus is at least about 90% homologous to the sequences selected from SEQ ID NO: 1 to 7 of WO 2019 / 126634 A2.
[0187] In some embodiments, the cell into which the polynucleotide of interest according to this disclosure is to be introduced according to this disclosure is a "TI host cell" according to any embodiment described in WO 2019 / 126634 A2, or a TI host cell derived from any embodiment described in WO 2019 / 126634 A2. In some embodiments, the cell into which the polynucleotide of interest according to this disclosure is to be introduced is a TI host cell according to any embodiment described in WO 2019 / 126634 A2, which has been further genetically modified (e.g., to reduce or prevent the expression of one or more genes).
[0188] In some embodiments (particularly in embodiments where the polynucleotide of interest is integrated into the cell's genomic DNA via RMCE), the cell may further contain / express the relevant recombinase or a nucleic acid encoding the relevant recombinase. For example, in some embodiments where the cell contains genomic DNA containing one or more target sequences of a given recombinase, the cell may further contain / express the given recombinase or a nucleic acid encoding the given recombinase. By way of example, in cases where the cell contains genomic DNA containing one or more lox sequences, the cell may further contain / express a Cre recombinase or a nucleic acid encoding a Cre recombinase.
[0189] As a result of the engineering to include nucleic acids encoding the relevant recombinase, cells can contain the relevant recombinase / nucleic acid encoding the relevant recombinase. For example, the nucleic acid encoding the relevant recombinase may have already been introduced into the cell.
[0190] In some embodiments, the cell contains an extragenomic (i.e., non-genomic) nucleic acid encoding the relevant recombinase. In some embodiments, the cell contains a vector containing a nucleotide sequence encoding the relevant recombinase. In some embodiments, the cell's genomic DNA contains a nucleotide sequence encoding the relevant recombinase. In some embodiments, the cell transiently expresses the relevant recombinase.
[0191] The aspects and embodiments of this disclosure relate to a plurality of cells according to this disclosure.
[0192] Aspects and embodiments of this disclosure relate to a plurality of cells comprising genomic DNA containing a polynucleotide of interest (i.e., after the polynucleotide of interest has been integrated into the genomic DNA of such cells). In some embodiments, the plurality of cells comprises cells containing genomic DNA (which, as a result of different integration events, contains the polynucleotide of interest). For example, the plurality of cells can be generated by a method in which a population of cells is contacted with a plurality of polynucleotides / vectors containing the polynucleotide of interest under conditions providing introduction of the polynucleotide / vector into the cells and integration of the polynucleotide of interest into the genomic DNA of the cells, wherein each of the plurality of polynucleotides / vectors contains the polynucleotide of interest having a unique identifier sequence.
[0193] A cell containing a polynucleotide of interest integrated into its genomic DNA can be described as "stable" containing the polynucleotide of interest. A cell that stably contains a given polynucleotide is distinguished from a cell that transiently contains a polynucleotide. In a cell that transiently contains a given polynucleotide, the given polynucleotide may not be integrated into the cell's genomic DNA, and the given polynucleotide may instead be extrachromosomal.
[0194] Cells containing a polynucleotide of interest according to this disclosure integrated into their genomic DNA can be described as "stablely containing" the polynucleotide of interest. The daughter cells (i.e., daughter cells after mitotic cell division) of cells stably containing a given polynucleotide of interest also contain the polynucleotide of interest. Cells stably containing a polynucleotide of interest are distinguished from cells that transiently express the polynucleotide of interest (where the polynucleotide may instead exist as an extrachromosomal polynucleotide). Similarly, cells containing a polynucleotide of interest according to this disclosure integrated into their genomic DNA can be described as "stablely expressing" a polypeptide of interest encoded by the polynucleotide of interest, or having "stable expression" of that polypeptide of interest. Cells stably expressing a polypeptide of interest encoded by the polynucleotide of interest according to this disclosure do so as a result of expression (via mRNA transcription and subsequent translation) of the polynucleotide of interest integrated into the cell's genomic DNA. The daughter cells (i.e., daughter cells after mitotic cell division) of cells stably expressing the polypeptide of interest also express the polypeptide of interest. Stable expression is distinct from transient expression, which in turn refers to the expression of polypeptides from polynucleotides (e.g., extrachromosomal polynucleotides) that have never been integrated into the genomic DNA of a cell.
[0195] This disclosure provides a plurality of cells comprising genomic DNA containing the polynucleotide of interest according to this disclosure, wherein the genomic DNA of the cells in the plurality of cells contains different identifier sequences. Such a plurality of cells comprising cells having genomic DNA containing different identifier sequences may also be referred to as a cell library or a polyclonal population of cells.
[0196] In some embodiments, each of a plurality of cells comprising cells having genomic DNA containing an identifier sequence has a unique identifier sequence (i.e., an identifier sequence relative to the genomic DNA of the other cells within the plurality).
[0197] In some embodiments, the plurality of cells including cells having genomic DNA containing different identifier sequences also includes cells having the same identifier sequence, for example, as a result of mitotic cell division of cells containing genomic DNA with a given identifier sequence. That is, in some embodiments, the plurality of cells includes (i) cells having genomic DNA containing different identifier sequences (i.e., cells each containing the polynucleotide of interest due to different integration events), and also includes cells having genomic DNA containing the same identifier sequence (i.e., cells that are daughters of cells containing the polynucleotide of interest due to a given integration event).
[0198] This disclosure also provides a plurality of cells, each of which contains genomic DNA having the same identifier sequence. Due to a given integration event, the cells in the plurality can be progeny of a cell containing the polynucleotide of interest, and the plurality of cells can be generated as a result of mitotic cell division of a single given cell. Such a plurality of cells comprising cells having genomic DNA containing the same identifier sequence can also be referred to as a monoclonal population of cells.
[0199] Generate cells containing the polynucleotides of interest integrated into their genomic DNA.
[0200] Aspects and embodiments of this disclosure relate to generating cells containing polynucleotides of interest integrated into their genomic DNA.
[0201] This disclosure provides methods for generating cells containing a polynucleotide of interest integrated into its genomic DNA, and cells obtained or available through such methods. Methods for generating cells containing a given polynucleotide of interest integrated into its genomic DNA are well known to those skilled in the art and typically involve introducing a polynucleotide / vector containing the given polynucleotide of interest into the cell. Such methods may include nucleic acid transfer for persistent (i.e., stable) integration of the given polynucleotide of interest.
[0202] Any suitable genetic engineering platform may be used, including gamma retroviral vectors, lentiviral vectors, adenoviral vectors, DNA transfection, transposon-based gene delivery, and RNA transfection, for example, as described in Maus et al., Annu Rev Immunol (2014) 32:189-225, which is incorporated herein by reference in its entirety. Methods also include, for example, those described in Wang and Rivière Mol Ther Oncolytics. (2016) 3:16015, the entire contents of which are incorporated herein by reference. Suitable methods for introducing polynucleotides / vectors into cells include transduction, transfection, and electroporation.
[0203] Cells containing the polynucleotide of interest according to this disclosure integrated into their genomic DNA can be produced by a method comprising: contacting the cells with a polynucleotide / vector containing the polynucleotide of interest according to this disclosure under conditions suitable for introducing the polynucleotide / vector into the cells. Those skilled in the art will recognize suitable conditions for the efficient introduction of the polynucleotide / vector into cultured cells.
[0204] In some embodiments, the method further includes subjecting a cell containing a polynucleotide / vector of interest that has been introduced therein to conditions suitable for integrating the polynucleotide into the cell's genomic DNA.
[0205] In embodiments where a polynucleotide / vector containing the polynucleotide of interest and / or a cell into which the polynucleotide / vector is introduced contains an integration nucleotide sequence of the polynucleotide of interest into the cell's genomic DNA via RMCE, the method may include culturing the cells under conditions suitable for RMCE to occur. For example, the method may include culturing the cells under conditions suitable for the expression and / or recombinase activity of the associated recombinase. In an illustrative embodiment where the cell's genomic DNA contains one or more lox sequences, the polynucleotide / vector containing the polynucleotide of interest contains a lox sequence side-joined with the nucleotide sequence of the polynucleotide of interest, and the cell further contains a nucleotide sequence encoding a Cre recombinase, the method may include culturing the cells under conditions suitable for Cre recombinase expression from the nucleotide sequence encoding the Cre recombinase and / or Cre recombinase-mediated integration of the polynucleotide of interest into the cell's genomic DNA.
[0206] In some embodiments, the method includes selecting cells that have undergone conditions suitable for the introduction of a polynucleotide / vector containing the polynucleotide of interest into the cell and subsequent integration of the polynucleotide of interest into the genomic DNA of the cell, to select cells that have already integrated the polynucleotide of interest into their genomic DNA.
[0207] In some embodiments, the method includes culturing cells in the presence of a cytotoxic compound, wherein the cells are sensitive to the cytotoxic compound in the absence of integration of the polynucleotide of interest, and cells that have integrated the polynucleotide of interest exhibit resistance to the cytotoxic compound. In embodiments in which the polynucleotide of interest comprises a nucleotide sequence encoding an optional marker, the method may include culturing cells in the presence of a cytotoxic compound to which the optional marker confers resistance. By way of example, in embodiments in which the polynucleotide of interest comprises an antibiotic resistance gene (e.g., a nucleotide sequence encoding puromycin N-acetyltransferase), the method may include culturing cells in the presence of an associated antibiotic (e.g., puromycin).
[0208] Analyze the identifier sequence
[0209] Aspects and embodiments of this disclosure relate to analyzing one or more cells to determine the identity of identifier sequences contained therein. Specifically, aspects and embodiments include analyzing the nucleic acids of cells in which polynucleotides of interest have been integrated into their genomic DNA to determine the identity of identifier sequences.
[0210] The analysis may include determining the structure of the identifier sequence. In some embodiments, the analysis includes determining the nucleotide sequence of the identifier sequence. The method may include: extracting genomic DNA from a cell that has already integrated the polynucleotide of interest into its genomic DNA, and subsequently analyzing the nucleotide sequence of the identifier sequence in the genomic DNA integrated into the cell.
[0211] The nucleotide sequence of a polynucleotide can be determined by any suitable technique well known to those skilled in the art, including, for example, Sanger sequencing. In a preferred embodiment, next-generation sequencing (NGS) technology can be used to determine the nucleotide sequence of the identifier sequence according to this disclosure. This analysis can employ oligonucleotide primers to amplify nucleotide sequences containing or consisting of identifier sequences, for example, by polymerase chain reaction.
[0212] population of cells
[0213] Aspects and embodiments of this disclosure relate to culturing cells (e.g., in vitro) to increase their quantity. Such aspects and embodiments may include culturing cells under conditions that facilitate the generation of populations of such cells (e.g., as a result of cell division).
[0214] Such aspects and embodiments may include culturing multiple cells under conditions suitable for expanding their number. That is, in some aspects and embodiments, a population of cells may be cultured under conditions suitable for expanding the population of cells.
[0215] Suitable culture conditions will be apparent to those skilled in the art. Culture conditions for mammalian cell culture are described, for example, in Birch and Racher, Adv Drug Deliv Rev. (2006) 58(5-6):671-85 and Li et al., MAbs (2010) 2(5):466-477, both of which are incorporated herein by reference in their entirety. Suitable culture conditions include those suitable for maintaining cells in CHO cells in vitro.
[0216] Cells are cultured in a cell culture medium containing amino acids, vitamins, inorganic salts, and sugars. In some embodiments, the cell culture medium contains amino acids selected from the following: L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine / L-cysteine, L-glutamic acid, L-glutamine, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine. In some embodiments, the cell culture medium contains vitamins and / or vitamin-like substances selected from the following: D-biotin, choline chloride, D-calcium pantothenate, folic acid, inositol, nicotinamide, pyridoxine hydrochloride, riboflavin, thiamine hydrochloride, and vitamin B12. In some embodiments, the cell culture medium comprises additional components selected from the group consisting of calcium chloride, hypoxanthine, ferric nitrate, linoleic acid, putrescine hydrochloride, pyruvic acid, magnesium sulfate, potassium chloride, sodium bicarbonate, sodium chloride, sodium dihydrogen phosphate, lipoic acid, and thymidine. In some embodiments, the cell culture medium comprises D-glucose.
[0217] In some embodiments, the cell culture medium is a cell culture medium suitable for mammalian cell culture. Such cell culture media include Roswell Park Memorial Institute (RPMI) 1640 medium, Duchenne Modified Eagle Medium (DMEM), F-12 medium, DMEM / F12, CD-CHO medium, and PowerCHO medium.
[0218] In a preferred embodiment, the cell culture medium is a suitable cell culture medium for culturing cells that are intended to produce molecules to be used in human therapies. Such media include, for example, EX-CELL AdvancedCHO Fed-Batch medium.
[0219] It should be understood that cells are cultured under suitable environmental conditions. Cells can be cultured at temperatures ranging from 28°C to 38°C, for example, at one of the following: approximately 28°C, approximately 28.5°C, approximately 29°C, approximately 29.5°C, approximately 30°C, approximately 30.5°C, approximately 31°C, approximately 31.5°C, approximately 32°C, approximately 32.5°C, approximately 33°C, approximately 33.5°C, approximately 34°C, approximately 34.5°C, approximately 35°C, approximately 35.5°C, approximately 36°C, approximately 36.5°C, approximately 37°C, approximately 37.5°C, or approximately 38°C. Cells can be cultured in 4% to 10% CO2, for example, 5% to 8% CO2. Cells can be cultured, for example, at ≥90% humidity (e.g., approximately 95% humidity). Cells can be cultured with or without stirring. Stirring can be performed at 75 rpm to 175 rpm, for example, 90 rpm to 130 rpm, for example, about 110 rpm. The pH of the cell culture can be between 6.8 and 7.4, for example, one of about 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, or 7.4. In some embodiments, the pH of the cell culture is about 7.0. In some embodiments, the pH of the cell culture is about 7.2.
[0220] Cell culture can be carried out in a bioreactor that provides an appropriate supply of nutrients, air / oxygen, and / or growth factors. The bioreactor allows for the monitoring and control of environmental conditions (such as pH, oxygen, inlet and outlet flow rates, and agitation within the vessel) to provide optimal conditions for the cultured cells.
[0221] The culture can be a continuous culture, wherein cell culture medium is continuously fed into the cell culture vessel and cultured cells are continuously discharged from the cell culture vessel. In some embodiments, the culture can be a batch culture using a closed system and a limited amount of cell culture medium. In some embodiments, the culture can be a fed-batch culture, wherein cell culture medium is supplied to the cell culture vessel during culture, but wherein, unlike continuous culture, no material is removed from the cell culture vessel during the cell culture process.
[0222] In some embodiments, the method includes adding one or more components to the cell culture during a culture cycle. In some embodiments, the method includes adding cell culture medium to the cell culture during a culture cycle. In some embodiments, the method includes adding nutrients to the cell culture during a culture cycle. In some embodiments, the method includes adding amino acids to the cell culture during a culture cycle.
[0223] The aspects and embodiments of this disclosure envision selecting certain cells that are superior to other cells for subsequent culture and / or expansion.
[0224] In some aspects and embodiments, cells or cell groups are selected for subsequent culture and / or amplification based on the identity of an identifier sequence contained in their genomic DNA. In some embodiments, the method according to this disclosure includes separating / classifying / segmenting cells based on their identifier sequence identity.
[0225] In some embodiments, a cell having genomic DNA containing a polynucleotide of interest with a given identifier sequence is separated / classified / divided from another cell having genomic DNA containing a polynucleotide of interest with an identifier sequence different from the given identifier sequence.
[0226] Application of technology
[0227] The articles (e.g., polynucleotides, vectors, cells) and methods disclosed herein can be used in a variety of applications, particularly in the context of biomolecule production.
[0228] The use of a unique identifier sequence in the polynucleotide of interest results in the ability to identify cells containing the polynucleotide of interest as a result of a targeted integration event. If cells in a plurality of these cells contain different identifier sequences, they must contain the polynucleotide of interest as a result of multiple distinct targeted integration events. Conversely, if two or more cells in a plurality of these cells contain the same identifier sequence, they must contain the polynucleotide of interest as a result of the same targeted integration event, and therefore must be progeny of the cell in which the targeted integration of the relevant polynucleotide of interest occurred.
[0229] Cells derived from the same parent cell typically share similar characteristics, such as growth characteristics (e.g., doubling time), metabolic profile, optimal culture conditions, and productivity (e.g., in terms of biomolecule production, such as the expression of polypeptides of interest encoded by polynucleotides of interest according to this disclosure). Conversely, cells derived from different parent cells sometimes possess different characteristics.
[0230] In some cases, it may be desirable to obtain / maintain a monoclonal population of cells and / or reduce the diversity of polyclonal populations of cells, for example, for predictability and to maximize the consistency of cell performance in culture (e.g., in terms of growth characteristics, culture requirements, productivity, etc.). In other cases, it may be desirable to obtain / maintain a polyclonal population of cells and / or increase the diversity of polyclonal populations of cells, for example, to maintain sufficient diversity to identify and subsequently select cells with the desired characteristic profile (e.g., in terms of growth characteristics, culture requirements, productivity, etc.).
[0231] The products and methods can be used to obtain / generate a monoclonal population of cells with a polynucleotide of interest integrated into its genomic DNA. One or more cells resulting from a given integration event can be identified by analyzing the identifier sequence (i.e., the identifier sequence of the integrated polynucleotide of interest) of the cells obtained by: (a) contacting the population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, wherein each of the plurality of vectors contains a nucleotide sequence that provides targeted integration of the polynucleotide of interest containing the identifier sequence into the genomic DNA of the cell to which the vector has been introduced, and wherein each of the plurality of vectors contains the polynucleotide of interest with a unique identifier sequence; and (b) selecting the cells obtained after step (a) for cells that have integrated the polynucleotide of interest into their genomic DNA. Such cells can then be selected and separated / classified / divided from cells with different identifier sequences to obtain a clonal / monoclonal population of cells. The cells can then be cultured (i.e., separated from cells with different identifier sequences) to increase their number / expand the population.
[0232] The products and methods disclosed herein can also be used to obtain / generate libraries of genetically distinct cells (i.e., polyclonal populations of cells) having integrated polynucleotides of interest into their genomic DNA. Cells resulting from different integration events can be identified by analyzing the identifier sequences of cells obtained by: (i.e., identifier sequences of the integrated polynucleotides of interest); (a) contacting a population of cells with multiple vectors under conditions suitable for introducing vectors into cells, wherein each of the multiple vectors contains a nucleotide sequence that provides targeted integration of the polynucleotide of interest containing the identifier sequence into the genomic DNA of the cell into which the vector has been introduced, and wherein each of the multiple vectors contains the polynucleotide of interest having a unique identifier sequence; and (b) selecting the cells obtained after step (a) for cells that have integrated the polynucleotide of interest into their genomic DNA. Cells resulting from different integration events can then be selected to obtain a library / polyclonal population of cells. Cells can then be cultured to increase their number / expand the population.
[0233] The articles and methods of this disclosure can also be used to monitor and / or manage (e.g., reduce or increase) the diversity of multiple cells containing a polynucleotide of interest according to this disclosure by analyzing cells obtained by: (a) contacting a population of cells with multiple vectors under conditions suitable for introducing the vectors into the cells, wherein each of the multiple vectors contains a nucleotide sequence that provides targeted integration of the polynucleotide of interest containing the identifier sequence into the genomic DNA of a cell into which the vector has been introduced, and wherein each of the multiple vectors contains a polynucleotide of interest having a unique identifier sequence; and (b) selecting cells obtained after step (a) for cells that have integrated the polynucleotide of interest into their genomic DNA. In some embodiments, the method further includes determining the proportion of cells in the population that have integrated the given identifier sequence.
[0234] The assessment of the diversity of the plurality of cells containing the polynucleotides of interest according to this disclosure also enables the monitoring / evaluation / confirmation of the purity of a putative monoclonal population of cells. Therefore, this disclosure provides methods and uses related to monitoring / evaluating / confirming the monoclonal nature of a putative monoclonal population of cells. Sometimes, a putative monoclonal cell culture may be accidentally contaminated by other cells. In cases where such analysis detects only a single identifier sequence in the cells of the population, the purity / monoclonality of the population is confirmed. In cases where such analysis detects one or more additional identifier sequences in the cells of the population, the population is determined to be contaminated or not monoclonal. In such cases, one or more cells resulting from a given integration event (e.g., having the expected identifier sequence) may then be selected and separated / classified / divided from cells with different identifier sequences to obtain a clonal / monoclonal population of cells, and then the cells may be cultured (i.e., separated from cells with different identifier sequences) to increase their number / expand the population.
[0235] It should be understood that, in some aspects and embodiments of this disclosure, the method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into its genomic DNA is a method for monitoring / assessing / confirming the monoclonal nature of a presumed monoclonal population of cells. It should also be understood that, in some aspects and embodiments, the method for confirming the identity of a population of cells having a polynucleotide of interest integrated into its genomic DNA can be a method for monitoring / assessing / confirming the monoclonal nature of a presumed monoclonal population of cells.
[0236] For example, such assessments also enable the evaluation / confirmation of the identity of a monoclonal population of cells. Sometimes, accidental mixing of cell cultures can occur. In cases where such analyses detect expected identifier sequences in the cells of the population, the population's identity is confirmed.
[0237] In some cases, it may be desirable to preserve or increase the genetic diversity of multiple genetically dissimilar cells (i.e., a polyclonal population of cells) that have integrated polynucleotides of interest into their genomic DNA. In the case of culturing multiple genetically dissimilar cells, over time, one or more clones of the population may expand into a dominant clone that constitutes a higher proportion of the polyclonal population than other clones. This can subsequently lead to a loss of genetic diversity in the polyclonal population of cells, as other clones are competitively eliminated. Such a reduction in the genetic diversity of the polyclonal population may be undesirable because it may inhibit / prevent the identification of cells with a desired profile of characteristics (e.g., in terms of growth characteristics, culture requirements, productivity, etc.). Therefore, in such cases, cells resulting from different integration events can be selected from the population and subsequently cultured to obtain a polyclonal population of cells. In some embodiments, cells from clones that are dominant clones in the population prior to such selection may not be selected for subsequent culture.
[0238] The assessment of diversity in multiple cells containing the polynucleotide of interest according to this disclosure also enables the monitoring over time of diversity and / or population dynamics of multiple genetically distinct cells (i.e., polyclonal populations of cells) having the polynucleotide of interest integrated into their genomic DNA. Repeated analysis of cells maintained in culture to identify their identifier sequences at different time points enables the detection of changes in the number / proportion of cells with a given identifier sequence over time.
[0239] The evaluation from the previous section can be employed during the iterative process of optimizing the culture conditions for a polyclonal population of cells with desired diversity. In this case, the diversity of the polyclonal population of cells produced after culturing under given culture conditions can be determined and compared with the diversity of polyclonal populations of cells produced after culturing under different conditions. From this, the conditions for culturing the polyclonal population of cells to obtain optimal diversity can be deduced.
[0240] The products and methods disclosed herein can also be used to evaluate the performance of populations of cells having a polynucleotide of interest integrated into their genomic DNA and / or to optimize methods for producing such populations. The conditions of method steps (a) and / or (b) for producing large or small diverse populations of polyclonal cells can be identified by analyzing the identifier sequence of the cells obtained by: (i.e., the identifier sequence of the integrated polynucleotide of interest); (a) contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, wherein each of the plurality of vectors contains a nucleotide sequence that provides targeted integration of the polynucleotide of interest containing the identifier sequence into the genomic DNA of the cells in which the vector has been introduced, and wherein each of the plurality of vectors contains the polynucleotide of interest having a unique identifier sequence; and (b) selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA. In particular, it may be desirable to determine the conditions of method steps (a) and / or (b) for generating highly diverse polyclonal populations of cells so that cells with a desired profile of characteristics (e.g., in terms of growth characteristics, culture requirements, productivity) can be identified and subsequently selected.
[0241] The evaluation based on the preceding paragraph can be employed during the iterative process of optimizing the method steps according to (a) and / or (b) to generate a polyclonal population of cells with desired diversity. In this case, the diversity of the polyclonal population of cells generated by a given set of conditions for method steps (a) and / or (b) can be determined and compared with the diversity of the polyclonal population of cells generated by different conditions for method steps (a) and / or (b). Thus, the conditions of method steps (a) and / or (b) for providing optimal diversity in the obtained polyclonal population of cells can be deduced.
[0242] Aspects and embodiments related to cells that integrate multiple polynucleotides of interest
[0243] As explained above, aspects and embodiments of this disclosure relate to methods and uses in which cells are modified such that their genomic DNA contains a plurality of (e.g., 2, 3, 4, 5, 6, 7, 8 or more) integrated polynucleotides of interest. According to such aspects and embodiments, each of these plurality of polynucleotides of interest preferably contains a different sequence of nucleotides of interest (e.g., encoding different polypeptides / nucleic acids of interest).
[0244] In the following aspects and embodiments, the reference to "two or more polynucleotides of interest" is used. It should be understood that this covers embodiments relating to, for example, three, four, five, six, seven, eight or more polynucleotides of interest.
[0245] Similarly, it should be understood that "a first polynucleotide of interest containing a marker sequence and a second polynucleotide of interest containing a marker sequence" encompasses, for example, a first polynucleotide of interest containing a marker sequence, a second polynucleotide of interest containing a marker sequence, and a third polynucleotide of interest containing a marker sequence; or a first polynucleotide of interest containing a marker sequence, a second polynucleotide of interest containing a marker sequence, a third polynucleotide of interest containing a marker sequence, and a fourth polynucleotide of interest containing a marker sequence; or a first polynucleotide of interest containing a marker sequence, a second polynucleotide of interest containing a marker sequence, a third polynucleotide of interest containing a marker sequence, a fourth polynucleotide of interest containing a marker sequence, and a fifth polynucleotide of interest containing a marker sequence; and so on. It should be understood that the marker sequences of different polynucleotides of interest are not identical (that is, the marker sequence of a first polynucleotide of interest containing a marker sequence is not identical to the marker sequence of a second polynucleotide of interest containing a marker sequence). In fact, the marker sequence of a single copy of a given polynucleotide of interest is not identical. According to such embodiments, the marker sequence is unique in each vector containing the relevant polynucleotide of interest (e.g., the third polynucleotide, the fourth polynucleotide, etc. of interest).
[0246] Therefore, this disclosure provides a method for evaluating the diversity of a library of genetically dissimilar cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by:
[0247] (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest; and
[0248] (b) Select the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0249] To determine the identity of the identifier sequence integrated into its genomic DNA.
[0250] In some embodiments, the method further includes determining the proportion of cells in the population that have integrated a given identifier sequence.
[0251] This disclosure provides a method for obtaining a library of genetically distinct cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0252] (i) Analyze the cells obtained as follows:
[0253] (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest; and
[0254] (b) Select the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0255] To determine the identity of the identifier sequence integrated into its genomic DNA; and
[0256] (ii) Select cells that have different identifier sequence profiles as determined in step (i) for subsequent amplification.
[0257] Based on the preceding paragraph, it should be understood that the identifier sequence profile (i.e., for a given cell that has integrated the first polynucleotide of interest and the second polynucleotide of interest into its genomic DNA) refers to the combination of identifier sequences from the first polynucleotide of interest and the second polynucleotide of interest. It should also be understood that the identifier sequence from the first polynucleotide of interest is different from the identifier sequence from the second polynucleotide of interest.
[0258] By way of example, a first cell may have integrated a first polynucleotide of interest containing identifier sequence A and a second polynucleotide of interest containing identifier sequence X. A second cell having a different identifier sequence profile than the first cell may contain a first polynucleotide of interest containing an identifier sequence other than A (e.g., it may contain a first polynucleotide of interest containing, for example, identifier sequence B or C), and / or may contain a second polynucleotide of interest containing an identifier sequence other than X (e.g., it may contain a second polynucleotide of interest containing, for example, identifier sequence Y or Z). Conversely, a second cell having the same identifier sequence profile as the first cell contains a first polynucleotide of interest containing identifier sequence A and a second polynucleotide of interest containing identifier sequence X.
[0259] This disclosure provides a method for obtaining a library of genetically distinct cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0260] (i) Analyze the cells obtained as follows:
[0261] (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest; and
[0262] (b) Select the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0263] To determine the identity of the identifier sequence integrated into its genomic DNA; and
[0264] (ii) Select a single cell, or select multiple cells that were identified in step (i) as having the same identifier sequence profile, for subsequent amplification.
[0265] This disclosure also provides a method for assessing the diversity of a population of cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by:
[0266] (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0267] (b) Select the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0268] (c) Analyze the cells obtained after step (b) to determine the identity of the identifier sequence integrated into their genomic DNA; and
[0269] (d) Select cells that have different identifier sequence profiles as determined in step (c) for subsequent amplification;
[0270] To determine the identity of the identifier sequence integrated into its genomic DNA.
[0271] This disclosure also provides a method for identifying a population of cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by:
[0272] (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0273] (b) Select the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0274] (c) Analyze the cells obtained after step (b) to determine the identity of the identifier sequence integrated into their genomic DNA; and
[0275] (d) Select a single cell, or select multiple cells that were identified in step (c) as having the same identifier sequence profile for subsequent amplification;
[0276] To determine the identity of the identifier sequence integrated into its genomic DNA.
[0277] This disclosure also provides a method for evaluating the diversity of a library of genetically distinct cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0278] (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of a first polynucleotide of interest containing at least an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0279] (ii) Selecting the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA; and
[0280] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0281] In some embodiments, the method further includes determining the proportion of cells in the population that have integrated the given identifier sequence obtained after step (ii).
[0282] This disclosure also provides a method for obtaining a library of genetically distinct cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0283] (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of a first polynucleotide of interest containing at least an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0284] (ii) Selecting the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA; and
[0285] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA; and
[0286] (iv) Select cells that have different identifier sequence profiles as determined in step (iii) for subsequent amplification.
[0287] This disclosure also provides a method for obtaining a monoclonal population of cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0288] (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of a first polynucleotide of interest containing at least an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0289] (ii) Selecting the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA; and
[0290] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA; and
[0291] (iv) Select a single cell, or select multiple cells that were identified in step (i) as having the same identifier sequence profile, for subsequent amplification.
[0292] This disclosure also provides a method for assessing the diversity of a population of cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0293] (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of a first polynucleotide of interest containing at least an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0294] (ii) Selecting the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA; and
[0295] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA; and
[0296] (iv) Select a single cell, or multiple cells identified in step (i) as having the same identifier sequence profile, for subsequent amplification; and
[0297] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0298] In some embodiments, the method for assessing the diversity of a population of cells having two or more polynucleotides of interest integrated into their genomic DNA is a method for monitoring or assessing the monoclonalness of a putative monoclonal population of cells having two or more polynucleotides of interest integrated into their genomic DNA.
[0299] This disclosure also provides a method for identifying a population of cells having two or more polynucleotides of interest integrated into their genomic DNA, the method comprising:
[0300] (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors containing nucleotide sequences that provide targeted integration of a first polynucleotide of interest containing at least an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells; wherein the identifier sequence is unique in each of the plurality of vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest;
[0301] (ii) Selecting the cells obtained after step (a) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA; and
[0302] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA; and
[0303] (iv) Select a single cell, or multiple cells identified in step (i) as having the same identifier sequence profile, for subsequent amplification; and
[0304] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0305] In some embodiments, the method for identifying a population of cells having two or more polynucleotides of interest integrated into their genomic DNA is a method for identifying the monoclonal nature of a presumed monoclonal population of cells having two or more polynucleotides of interest integrated into their genomic DNA.
[0306] This disclosure also provides the use of multiple vectors in a method for evaluating the diversity of libraries of genetically distinct cells having two or more polynucleotides of interest integrated into their genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing a identifier sequence and a second polynucleotide of interest containing a identifier sequence into the genomic DNA of the cell, wherein the identifier sequence is unique in each of the multiple vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each vector containing the second polynucleotide of interest, and wherein the method comprises:
[0307] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0308] (ii) Selecting the cells obtained after step (i) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA; and
[0309] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0310] In some embodiments, the method further includes determining the proportion of cells in the population that have integrated the given identifier sequence obtained after step (ii).
[0311] This disclosure also provides the use of multiple vectors in a method for obtaining a clonal population of cells having two or more polynucleotides of interest integrated into their genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing a marker sequence and a second polynucleotide of interest containing a marker sequence into the genomic DNA of the cells, wherein the marker sequence is unique in each of the multiple vectors containing the first polynucleotide of interest; and wherein the marker sequence is unique in each of the vectors containing the second polynucleotide of interest, and wherein the method comprises:
[0312] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0313] (ii) Select the cells obtained after step (i) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0314] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0315] (iv) Select cells that have different identifier sequence profiles as determined in step (iii) for subsequent amplification.
[0316] This disclosure also provides the use of multiple vectors in a method for obtaining a library of genetically distinct cells having two or more polynucleotides of interest integrated into their genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing a marker sequence and a second polynucleotide of interest containing a marker sequence into the genomic DNA of the cell, wherein the marker sequence is unique in each of the multiple vectors containing the first polynucleotide of interest; and wherein the marker sequence is unique in each of the vectors containing the second polynucleotide of interest, and wherein the method comprises:
[0317] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0318] (ii) Select the cells obtained after step (i) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0319] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0320] (iv) Select a single cell, or select multiple cells that were identified in step (iii) as having the same identifier sequence profile, for subsequent amplification.
[0321] This disclosure also provides the use of multiple vectors in a method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing a marker sequence and a second polynucleotide of interest containing a marker sequence into the genomic DNA of the cell, wherein the marker sequence is unique in each of the multiple vectors containing the first polynucleotide of interest; and wherein the marker sequence is unique in each of the vectors containing the second polynucleotide of interest, and wherein the method comprises:
[0322] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0323] (ii) Select the cells obtained after step (i) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0324] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0325] (iv) Select a single cell, or multiple cells identified in step (iii) as having the same identifier sequence profile, for subsequent amplification; and
[0326] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0327] In some embodiments, the method for assessing the diversity of a population of cells having two or more polynucleotides of interest integrated into their genomic DNA is a method for monitoring or assessing the monoclonalness of a putative monoclonal population of cells having two or more polynucleotides of interest integrated into their genomic DNA.
[0328] This disclosure also provides the use of multiple vectors in a method for identifying a population of cells having a polynucleotide of interest integrated into its genomic DNA, the multiple vectors comprising nucleotide sequences that provide targeted integration of at least a first polynucleotide of interest containing an identifier sequence and a second polynucleotide of interest containing an identifier sequence into the genomic DNA of the cell, wherein the identifier sequence is unique in each of the multiple vectors containing the first polynucleotide of interest; and wherein the identifier sequence is unique in each of the vectors containing the second polynucleotide of interest, and wherein the method comprises:
[0329] (i) Contact the cell population with the plurality of carriers under conditions suitable for introducing the carriers into the cells;
[0330] (ii) Select the cells obtained after step (i) to select cells in which the first polynucleotide of interest and the second polynucleotide of interest have been integrated into their genomic DNA;
[0331] (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into its genomic DNA;
[0332] (iv) Select a single cell, or multiple cells identified in step (iii) as having the same identifier sequence profile, for subsequent amplification; and
[0333] (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into its genomic DNA.
[0334] In some embodiments, the method for identifying a population of cells having two or more polynucleotides of interest integrated into their genomic DNA is a method for identifying the monoclonal nature of a presumed monoclonal population of cells having two or more polynucleotides of interest integrated into their genomic DNA.
[0335] In some embodiments, prior to the integration of the two or more polynucleotides of interest, the cell contains genomic DNA with a single-copy landing pad that provides targeted integration of the two or more polynucleotides of interest.
[0336] In some embodiments, the two or more polynucleotides of interest comprise nucleotide sequences encoding one or more polypeptides of interest.
[0337] In some embodiments, the one or more polypeptides of interest are each independently selected from the group consisting of: antigen-binding polypeptides, aptamers, constituent polypeptides of antigen-binding polypeptide complexes, antibody / antigen-binding fragments or derivatives thereof, constituent polypeptides of antibody / antigen-binding fragments or derivatives thereof, Fc fusion polypeptides, anticoagulants, blood factors, bone morphogenetic polypeptides, decoy receptors for ligands, decoy ligands for receptors, enzymes, enzyme cofactors, growth factors, hormones, interferons, interleukins, thrombolytic agents, transcription factors, epigenetic modifiers, constituent polypeptides of site-specific nuclease nucleic acid editing systems, constituent polypeptides of ribonucleoproteins, viral polypeptides, or polypeptides that can be used for the production of biomolecules.
[0338] ***
[0339] This disclosure includes combinations of the described aspects and preferred features, unless such combination is obviously not permitted or explicitly avoided.
[0340] The chapter headings used here are for organizational purposes only and should not be construed as limiting the topics described.
[0341] Aspects and embodiments of this disclosure will now be illustrated by way of example with reference to the accompanying drawings. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned herein are incorporated herein by reference.
[0342] Throughout the specification (including the following claims), unless the context otherwise requires, the word “comprising” and variations such as “including” and “containing” should be understood to imply inclusion of the stated integer or step or group of integers or steps, but not to exclude any other integer or step or group of integers or steps.
[0343] As used herein, the amino acid sequence “corresponding to” a specified reference amino acid sequence, or a region of a polypeptide, or a region of a polypeptide having at least 60% (e.g., at least ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥91%, ≥92%, ≥93%, ≥94%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100%) sequence identity with that amino acid sequence / region / position. The amino acid sequence / region / position of the polypeptide / amino acid sequence “corresponding to” a specified reference amino acid sequence / region / position can be identified by sequence alignment of the subject sequence with a reference sequence, for example, using sequence alignment software such as ClustalOmega (Söding, J. 2005, Bioinformatics 21, 951-960).
[0344] In the context of referring to amino acids (other than glycine), both the L and D enantiomers of the relevant amino acid are explicitly contemplated. In some embodiments, unless otherwise specifically stated, reference to amino acids herein specifically refers to the L enantiomer, which is the form in which the amino acid occurs in nature.
[0345] It should be noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context explicitly specifies otherwise. A range herein may be expressed as “about” a particular value and / or to “about” another particular value. When expressing such a range, another embodiment includes from one particular value and / or to another particular value. Similarly, when a value is expressed as an approximation, the use of the antecedent “about” will be understood to form another embodiment of a particular value.
[0346] When this paper discloses the nucleic acid sequence, its reverse complementary sequence is also explicitly considered.
[0347] The methods described herein are preferably performed in vitro. The term "in vitro" is intended to cover procedures performed in cultures using cells, while the term "in vivo" is intended to cover procedures performed using / on intact multicellular organisms.
[0348] A value may be expressed herein as “about” a specific value. Similarly, a range may be expressed herein as from “about” a specific value and / or to “about” another specific value. The term “about” in relation to numerical values is optional and means, for example, + / - 10%. By way of example, a reference to “about 10%” should be interpreted as 9% to 11%. In cases where “about” is used herein, the value preceding it is also specifically contemplated. By way of example, a reference to “about 10%” also specifically contemplates 10%. Attached Figure Description
[0349] Embodiments and experiments illustrating the principles of this disclosure will now be discussed with reference to the accompanying drawings.
[0350] Figures 1A through 1E. Targeted barcode integration into stable CHO producer cells. (1A) Schematic diagram of the targeted integration loci in CHO cells containing the pre- and post-plasmids and the barcode library adjacent to the L2 lox site. (1B) Experimental timeline used to assess stable pool composition during cell line development. (1C) Schematic diagram of the cell pool selection and recovery process. (1D) Left side: Cell pool recovery kinetics, shown as cell viability %; and right side: Barcode fractionation pre- and post-selection of three increasingly complex antibody molecules: M1 (top inset), M2 (middle inset), and M3 (bottom inset). (1E) Pool composition over 80 days measured by barcode fractionation in recovered CHO cell pools expressing three increasingly complex antibody molecules: M1 (top inset), M2 (middle inset), and M3 (bottom inset).
[0351] Figures 2A through 2D. Validation of plasmid libraries. (2A) Diversity of post-plasmid barcode libraries evaluated by amplicon deep sequencing shows a uniform barcode representation. (2B) (SEQ ID NO: 4 to 11) Homologous nucleotide probabilities at each position in the N15 barcode region. (2C) Lower bound of total barcode diversity within each library estimated based on observation counts using the Chao1 capture-recapture estimator. (2D) Label capacity of each library estimated by overlapping barcode conflicts. Mean of 100 replicate simulations (resampling).
[0352] Figures 3A through 3E. Barcoding allows for the differentiation of cell clones originating from the same or different RMCE events. (3A) An overview of experiments assessing cell production performance of clones originating from different RMCE events. (3B) (SEQ ID NO: 12 to 22) Clustering of cell clones sharing the same barcode is partly based on antibody chain expression. (3C through 3E) Absolute differences in (C) product quality parameters, (D) metabolite concentrations, and (E) cell characteristics between unique barcodes compared to barcodes that appear ≥ 3 times. Dashed lines indicate the arithmetic mean.
[0353] Figures 4A and 4B. Barcoding allows for the detection of clonal cross-contamination. (4A) Detection of clones encoded by two different barcodes via amplicon deep sequencing. (4B) Detection of 3, 5, and 17 different barcodes mixed and transmitted via amplicon deep sequencing. The dashed line indicates the minimum reading count cutoff value for distinguishing erroneous barcodes from genuine barcodes using an unbiased inflection point detection algorithm.
[0354] Example
[0355] Example 1: Targeted integration of individually labeled polynucleotides of interest
[0356] 1.1 Materials and Methods
[0357] Cell culture and production
[0358] All cell lines were formed using previously generated CHO host cell lines containing targeted integration sites (described in WO 2019 / 126634 A2, which is incorporated herein by reference in its entirety). The cells contained a single-copy landing pad that provided integration of the polynucleotide of interest via recombinase-mediated cassette exchange (RMCE).
[0359] Cells from the targeted integration CHO cell line (described in WO 2019 / 126634 A2) were cultured in proprietary cell culture medium in 125 to 500 mL shake flasks at 150 rpm, 37°C, 80% rH, and 5% CO2. Cells were incubated at 3–6 x 10⁻⁶ cells / day every 3 to 4 days. 5 Cells were passaged at a seeding density of 10 cells / mL. Pools of cells stably expressing the bispecific antibody molecule were generated, as described in Carver, J., et al. (2020) Biotechnol Prog, 36, e2967. Briefly, expression plasmids were transfected into CHO cells via MaxCyte STX electroporation (MaxCyte, Inc.). Transfected cells were then selected, and mAb expression was confirmed by flow cytometry via human IgG staining (BD FACS Canto II flow cytometer, BD). After culturing for 5 days in 96 wells, CHO clones were randomly selected during single-cell cloning using limiting dilutions with a confluence threshold of 10%.
[0360] Fed-batch production cultures were conducted in an ambr15 bioreactor (Sartorius AG) using a production medium with a proprietary chemical composition. After acclimatization to the production medium during two passages, the cultures were fed at a rate of 2 × 10⁻⁶ on day 0 of the production phase. 6 Cells were seeded at 100 cells / mL. A proprietary feed bolus was added to the culture on days 3, 6, 9, and 12. Cells were cultured for 14 days. Production in the ambr15 system was run at setpoints of 37°C, DO 40%, pH 7.2, and agitation rate of 1300 rpm.
[0361] Generation and analysis of barcode-based libraries
[0362] The construct was generated by standard cloning procedures and restriction enzyme digestion of the final plasmid.
[0363] Nucleotide barcodes containing 15 nucleotides, a randomized region (N15), and 10 fixed positions were introduced into the final plasmid.
[0364] For genomic DNA, use the Blood & Cell Culture DNA MaxiKit (Qiagen) to extract 10, according to the manufacturer's instructions. 8 DNA from individual cells was used. Amplicons for deep sequencing were generated using primers with side-linked barcode regions, 100 ng of plasmid DNA as input, and 30 cycles of PCR amplification. To detect cell barcodes, 2 µg of gDNA was used as input, with 30 cycles of PCR amplification using primers with side-linked barcode regions and one primer located outside the RMCE integration site (to distinguish between off-target and on-target integration events). Sequencing libraries were prepared using the KAPAHyperPlus Kit (Roche) with 50 to 100 ng (fixed 20 µl of purified PCR) of amplicon DNA as input (without fragmentation) and between 20 to 24 cycles of PCR amplification (post-ligation library amplification) to achieve a total DNA library of 1 µg per sample. The libraries were sequenced by Genewiz using the NovaSeq 6000 platform (Illumina), with 30M 150 bp reads from the paired ends per sample.
[0365] Barcode-coded cells (10 x 10) sampled from the ambr15® bioreactor on day 10. 6The RNA was washed twice in PBS and rapidly frozen in liquid nitrogen. RNA extraction, Illumina TruSeq RNA library preparation, poly(A) enrichment, and sequencing (NextSeq, v2.5, high-output 1*75bp) were performed by Microsynth AG (Belgach, Switzerland). The transgene sequences were manually incorporated into the reference genome (GCF_003668045.3, PICRH1.0). Readings were aligned using the hisat2 package (version 2.2.1), and transcript abundance was calculated using featureCounts (version 2.0.1). Downstream analysis was performed using PCAtools (v2.2.0), and differential expression was assessed using edgeR (v3.32.1).
[0366] To characterize the diversity of the barcode library, raw readings (2 x 150 bp) of the forward and reverse paired ends of the universal Illumina adapter were trimmed using cutadapt (v4.1) (Marcel, M. (2011) EMBnet.journal, 17, 10-12) and subsequently merged with flash (v1.2.11) (Magoc, T. and Salzberg, SL (2011) Bioinformatics, 27, 2957-2963). Barcodes were extracted by detecting sidebands (antibody molecules M1: GCTTAGACCGCTTAAT AACATCTAATGCGTA (SEQ ID NO:1), M2: CTTAGCCGCTTAATAACTTAGCTCGCGTA (SEQ ID NO:2), M3: GCTTAGACCGCTTAAT AACCTCGCTTGCGTA (SEQ ID NO:3)), and all readings that did not match the expected barcode length of 15 were discarded. The inverse complement readings were reversed using the FASTX toolbox (v0.0.14). The final barcode diversity was estimated using the Chao1 capture-recapture estimator (Chao, A. (1987) Biometrics, 43, 783-791) based on barcodes observed in repeated resampling at different depths. As described in Horns, F. et al., (2023) Cell, 186, 3642-3658 e3632, the collision probability (defined as the proportion of cells sharing a barcode at the start of the experiment due to the overlap of independent barcode encoding events rather than a common clonal origin) is analyzed. For a given number of cells N, N barcodes are sampled without replacement from the observed barcode pool (where the sampling probability is proportional to the abundance of the barcode). The proportion of unique sampled barcodes within a sample is calculated, denoted as p, such that the collision probability is 1 - p.
[0367] Previously characterized, barcoded CHO cell lines (verified as monoclonal by fluorescence microscopy and subsequently barcoded Sanger sequencing) were cultured and mixed at a predetermined ratio of 1 x 10⁻⁶. 7Cells. Sequencing libraries were prepared from genomic DNA as described above. Readings were preprocessed using Starcode (v1.4) with Levenshtein distance 1 using an additional barcode clustering step as described above (Zorita, E. et al., (2015) Bioinformatics, 31, 1913-1919). The number of clone barcodes was detected using an unbiased inflection point threshold based on the reading count distribution, with N=2 for cross-contamination or N as shown in Figure 4 (Horns, F. et al., (2023) Cell, 186, 3642-3658e3632).
[0368] Antibody analysis in supernatant
[0369] The supernatant was clarified (1000 g, 30 min, 4 °C centrifugation and 1.2 μm filtration, AcroPrep 96 Filter Plates, Pall Cooperation). Protein A chromatography was analyzed using UHPLC with UV detection (Dionex Ultimate 3000 UHPLC with POROS™ A 20 µm column, Thermo Fisher Scientific Inc.).
[0370] Antibody integrity was analyzed following protein A affinity chromatography (PreDictor RoboColumn MabSelect SuRe, Cytiva) and protein quantification normalization using UV measurement (Nanoquant Infinite M200, Tecan). Under non-reducing conditions, the percentage of correctly assembled antibodies (Main-Peak) was assessed by CE-SDS (HT Antibody Assay 200 on a LabChip GXII system, PerkinElmer) through relative quantification of expected protein size to total protein content.
[0371] 1.2 Single-copy targeted barcode integration enables tracking of diversity in producer cells.
[0372] Most barcoding delivery methods result in uneven labeling of the population, where each individual cell may have no or multiple barcodes delivered. In contrast, the aim of this study was to achieve exhaustive single-copy labeling of the entire population at the transfection time point. This was achieved within a relevant CHO system suitable for the production of therapeutic proteins, combining plasmid barcoding with a single-copy targeted integration recombinase-mediated cassette exchange (RMCE) strategy (Ng, D. et al., (2021) Biotechnol Progr, 37).
[0373] Plasmid pairs (pre and post) containing nucleotide sequences encoding antibody chains were integrated into CHO host cell lines containing landing pads (with lox receptor sites: L3, LoxFas, L2) via recombinase-mediated cassette exchange (RMCE). The post plasmid contained a barcode library (N15) positioned adjacent to the L2 lox site to distinguish between on-target and off-target integration events.
[0374] The N15 region is positioned near the genomic region outside the landing pad, allowing for differentiation between on-target and off-target integration events by locating primer binding sites during amplicon deep sequencing. A schematic diagram of the targeted integration locus (post-integration) is shown in Figure 1A.
[0375] The plasmid library was validated by amplicon deep sequencing and showed an approximately uniform barcode representation with a uniform nucleotide composition at each position (Figures 2A and 2B). This yielded >2x10 7 The minimum diversity, sufficient to label 10 with a conflict probability of <0.3%. 5 Individual cells (Fig. 2C and Fig. 2D).
[0376] In the selection of stable CHO pools, it has been previously observed that the rate of CHO pool recovery (i.e., loss of cell population viability) is related to the molecules encoded in the expression plasmids. To investigate a representative library of therapeutic proteins generated in CHO cell lines, we selected three distinct antibody molecules with increasing complexity (e.g., larger plasmids, larger antibodies, or greater misfolding chances) based on the cell population viability loss observed during the stable pool selection process: 5–10%: M1DutaFab (described, for example, in Beckmann et al., Nature Comm. (2021) 12(708)), 1–5%: M2TCB (T cell bispecific antibody; described, for example, in Bacac et al., Clin Cancer Res. (2016) 22(13):3286–3297), <1%: M3BS-Fusion (brain shuttle bispecific antibody; described, for example, in Weber et al., CellRep. (2018) 22(1):149–162).
[0377] Notably, placing the start codon of the puromycin resistance gene on the Front expression vector ensures that only cells with in-frame and adjacent integration survive. Additionally, all off-target integrations of the expression plasmid do not lose the thymidine kinase encoded in the host cell line's landing pad. Therefore, only cells that undergo the correct in-target recombination between the three LoxP sites become resistant to puromycin and survive in the presence of FIAU. This rigorous selection process ensures that all surviving cells carry a single copy of the barcode plasmid.
[0378] CHO host cells were transfected on day 0 with pre- and post-plasmids encoding the molecule of interest and containing a barcode library. Pool composition was analyzed at two time points during stable pool selection: pre-selection on day 5 post-transfection and post-selection when the cell population reached 80% viability. Selection began on day 6 and continued until the cell pool recovered (cell viability >80%). All cells reached minimum pool viability on day 13, but cell pool recovery depended on the molecule encoded on the expression plasmid. The timeline of cell line development and evaluation is shown in Figure 1B, with a schematic diagram of the cell pool selection and recovery process shown in Figure 1C.
[0379] Figure 1D illustrates the cell pool recovery dynamics (left inset) for molecules M1 (top inset), M2 (middle inset), and M3 (bottom inset) and the fractions of unique barcode pre-selection and post-selection (right inset). The more complex the expressed antibody, the longer the cell pool recovery period. The pool composition at the pre-selection time point was higher, with a fold increase of approximately 3x, compared to post-selection across all three molecules, indicating rapid clonal loss during the rigorous selection process. The recovered stable pool consisted of low total barcodes (M1: Ø 2848, M2: Ø 1692, M3: Ø 1158), where a skewed population distribution was already present at post-selection. Notably, in M3, the most abundant barcodes covered 10% of the population at the post-selection time point.
[0380] Barcodes reflect the number of successful RMCE events and therefore pool diversity. All cell populations showed a reduced number of barcodes after the selection process: 80-90% of successfully integrated barcodes were lost during pool selection for all three antibody molecules. Antibody complexity further reduced the barcode score. At the end of selection, 95% of pool M1 contained 2075 barcodes, 95% of pool M2 contained 335 barcodes, and 95% of pool M3 contained only 53 barcodes.
[0381] Next, population dynamics were analyzed over a total of 11 weeks in the stable expression pool. Figure 1E shows that pool composition drifted during extended culture and diversity decreased significantly within 80 days: the number of barcodes detected in each population was significantly reduced in all three replicates, with 80–87% of barcode variants lost over the observation period. This implies that 80–90% of the initial biodiversity was lost due to pool segregation during standard culture. Notably, this effect was more pronounced where initial pool diversity was low. After 12 weeks of culturing CHO cells expressing M3, the number of barcodes in the stable pool had decreased from 53 to only 7. This indicates that the stable CHO pool exhibits rapid cloning kinetics under standard passage conditions.
[0382] Overall, these experiments show that the pool of CHO producers generated by RMCE exhibits low diversity (which further depends on the expressed molecules) and undergoes rapid population skew toward dominant clones.
[0383] 1.3 Cells originating from a single RMCE event share its production profile and can be distinguished from those originating from other RMCE events. Cells of the component
[0384] Despite sharing genetic context and copy number, CHO cell clones generated from stable RMCE expression pools have previously been observed to exhibit a wide range of production-related markers, such as volume titer, metabolite profile, and growth rate. The described genetic barcoding method allows for tracing of CHO lines from the transfection time point. This allows for differentiation between related cell clones originating from the same RMCE event (sharing the same barcode sequence) and those from different RMCE events (different barcodes).
[0385] Cell clones were generated from a barcoded CHO producer pool to test whether observed diversity relative to production-related biomarkers was due to pre-existing cellular intrinsic factors or whether the population underwent clonal variation during cell line development. Cell clones were randomly selected during limiting dilutions, with a confluence threshold of 10% in 96-well plates at day 12. The composition of barcodes within all generated clones reflected the population composition within the original cell pool. A microbial reactor system was used to test production-related biomarkers of cell clones, as schematically illustrated in Figure 3A.
[0386] Following micropurification (porosA), the expression of individual antibody chains was analyzed using CE-SDS. Clustering of individual producer clones was analyzed using a binary distance matrix and a full clustering method. Note the distance between cells sharing the same barcode.
[0387] Figure 3B shows that cell clones sharing the same barcode unexpectedly aggregated partly based on antibody chain expression (reduced CE-SDS from purified supernatant). To comprehensively compare phenotypic distances between clones, absolute difference pairs were compared across all measured bioreactor data points. Cell clones were divided into two groups: those with unique barcodes from individual RMCE events, and those with the same barcodes from (≥ 3) cell clones sharing a common RMCE event.
[0388] Figures 3C to 3E show that most of the relevant parameters exhibit significantly lower variance within the same barcode group. Notably, the relationships between product quality attributes are stronger than those between product concentration and product quality attributes.
[0389] This suggests that phenotypic diversity can be enriched or reduced, respectively, by selecting more unique / more identical barcodes during the cell clone selection process. Furthermore, experiments show that while some diversity is preserved within cells sharing the same barcode (potentially generated by cell line development or intrinsic methodological variance), most of the observed phenotypic diversity is likely pre-existing and cellularly intrinsic.
[0390] 1.4 Demonstrating Monoclonal Capabilities through Gene Barcoding
[0391] To limit heterogeneity in cell banks and ensure consistent product quality, proof of monoclonal identity has become a key focus for regulatory agencies during the IND review process. While simple methods exist, such as cell sorting (flow cytometry), cell printing, or microscopic images, they cannot detect clonal cross-contamination or verify the integrity of stock cell lines. Genetic barcoding provides the inclusion of intrinsic nucleotide markers within the cells, which can be repeatedly used to verify the monoclonal identity of a given cell line throughout the production process.
[0392] To test the sensitivity of barcode detection within this workflow, validated monoclonal cell lines were pooled together (validated by image detection and Sanger sequencing). Unbiased inflection point filtering was used to distinguish genuine barcodes from background introduced by sequencing errors. Figure 4A shows that barcodes from two pooled clones could detect clonal cross-contamination at clone ratios between 1:1 and 1:1000. Figure 4B shows that 3, 5, and 17 different barcodes could be detected and distinguished.
Claims
1. A method for assessing the diversity of a library of cells having genetically distinct polynucleotides of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by: (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; and (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; To determine the identity of the identifier sequence integrated into its genomic DNA.
2. The method of claim 1, wherein the method further comprises determining the proportion of cells in the population that have integrated a given identifier sequence.
3. A method for obtaining a library of genetically distinct cells having polynucleotides of interest integrated into their genomic DNA, the method comprising: (i) Analyze the cells obtained as follows: (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; and (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; To determine the identity of the identifier sequence integrated into its genomic DNA; and (ii) Select cells identified in step (i) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification.
4. A method for obtaining a monoclonal population of cells having a polynucleotide of interest integrated into its genomic DNA, the method comprising: (i) Analyze the cells obtained as follows: (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; and (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; To determine the identity of the identifier sequence integrated into its genomic DNA; and (ii) Select a single cell, or select multiple cells identified in step (i) as having the same identifier sequence integrated into their genomic DNA, for subsequent amplification.
5. A method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by: (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; and (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (c) Analyze the cells obtained after step (b) to determine the identity of the identifier sequence integrated into their genomic DNA; as well as (d) Select cells identified in step (c) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification; To determine the identity of the identifier sequence integrated into its genomic DNA.
6. A method for identifying a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising analyzing cells obtained by: (a) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; and (b) Selecting cells obtained after step (a) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (c) Analyze the cells obtained after step (b) to determine the identity of the identifier sequence integrated into their genomic DNA; as well as (d) Select a single cell, or select multiple cells identified in step (c) as having the same identifier sequence integrated into their genomic DNA, for subsequent amplification; To determine the identity of the identifier sequence integrated into its genomic DNA.
7. A method for assessing the diversity of a library of cells having genetically distinct polynucleotides of interest integrated into their genomic DNA, the method comprising: (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; as well as (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA.
8. The method of claim 7, wherein the method further comprises determining the proportion of cells in the population that have integrated the given identifier sequence obtained after step (ii).
9. A method for obtaining a library of genetically distinct cells having polynucleotides of interest integrated into their genomic DNA, the method comprising: (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select cells identified in step (iii) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification.
10. A method for obtaining a monoclonal population of cells having a polynucleotide of interest integrated into its genomic DNA, the method comprising: (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification.
11. A method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA, the method comprising: (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into their genomic DNA.
12. The method of claim 11, wherein the method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA is a method for monitoring or assessing the monoclonalness of a putative monoclonal population of cells having a polynucleotide of interest integrated into their genomic DNA.
13. A method for identifying a population of cells having a polynucleotide of interest integrated into its genomic DNA, the method comprising: (i) Contacting a population of cells with a plurality of vectors under conditions suitable for introducing the vectors into the cells, the plurality of vectors comprising nucleotide sequences that provide targeted integration of a polynucleotide of interest containing an identifier sequence into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the plurality of vectors containing the polynucleotide of interest; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into their genomic DNA.
14. The method of claim 13, wherein the method for identifying a population of cells having a polynucleotide of interest integrated into its genomic DNA is a method for identifying the monoclonal nature of a presumed monoclonal population of cells having a polynucleotide of interest integrated into its genomic DNA.
15. Use in a method for evaluating the diversity of libraries of genetically distinct cells having integrated polynucleotides of interest into their genomic DNA, said plurality of vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cell, wherein the marker sequence is unique in each of the plurality of vectors containing the polynucleotide of interest, and wherein said method comprises: (i) Contact the population of cells with the plurality of carriers under conditions suitable for introducing the carriers into the cells; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; as well as (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA.
16. The use according to claim 15, wherein the method further comprises determining the proportion of cells in the population that have integrated the given identifier sequence obtained after step (ii).
17. Use of multiple vectors in a method for obtaining a clonal population of cells having a polynucleotide of interest integrated into its genomic DNA, said multiple vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein said method comprises: (i) Contact the population of cells with the plurality of carriers under conditions suitable for introducing the carriers into the cells; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select cells identified in step (iii) as having distinct identifier sequences integrated into their genomic DNA for subsequent amplification.
18. Use of multiple vectors in a method for obtaining a library of genetically distinct cells having a polynucleotide of interest integrated into its genomic DNA, said multiple vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cell, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein said method comprises: (i) Contact the population of cells with the plurality of carriers under conditions suitable for introducing the carriers into the cells; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification.
19. Use of multiple vectors in a method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into its genomic DNA, said multiple vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including a marker sequence, into the genomic DNA of the cells, wherein the marker sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein said method comprises: (i) Contact the population of cells with the plurality of carriers under conditions suitable for introducing the carriers into the cells; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into their genomic DNA.
20. The use according to claim 19, wherein the method for assessing the diversity of a population of cells having a polynucleotide of interest integrated into their genomic DNA is a method for monitoring or assessing the monoclonalness of a putative monoclonal population of cells having a polynucleotide of interest integrated into their genomic DNA.
21. Use of multiple vectors in a method for identifying a population of cells having a polynucleotide of interest integrated into its genomic DNA, said multiple vectors comprising nucleotide sequences that provide targeted integration of the polynucleotide of interest, including an identifier sequence, into the genomic DNA of the cells, wherein the identifier sequence is unique in each of the multiple vectors containing the polynucleotide of interest, and wherein said method comprises: (i) Contact the population of cells with the plurality of carriers under conditions suitable for introducing the carriers into the cells; (ii) Selecting cells obtained after step (i) for cells in which the polynucleotide of interest has been integrated into their genomic DNA; (iii) Analyze the cells obtained after step (ii) to determine the identity of the identifier sequence integrated into their genomic DNA; (iv) Select a single cell or multiple cells identified in step (iii) as having the same identifier sequence integrated into their genomic DNA for subsequent amplification; and (v) Analyze the cells obtained after step (iv) to determine the identity of the identifier sequence integrated into their genomic DNA.
22. The use according to claim 21, wherein the method for identifying a population of cells having a polynucleotide of interest integrated into its genomic DNA is a method for identifying the monoclonal nature of a presumed monoclonal population of cells having a polynucleotide of interest integrated into its genomic DNA.
23. The method of any one of claims 1 to 14, or the use of any one of claims 15 to 22, wherein prior to integration of the polynucleotide of interest, the cell comprises genomic DNA having at least one single-copy landing pad, the at least one single-copy landing pad providing targeted integration of the polynucleotide of interest.
24. The method according to any one of claims 1 to 14 or claim 23, or the use according to any one of claims 15 to 23, wherein the polynucleotide of interest comprises a nucleotide sequence encoding one or more polypeptides of interest.
25. The method of claim 24 or the use of claim 24, wherein the one or more polypeptides of interest are each independently selected from the group consisting of: antigen-binding polypeptides, aptamers, constituent polypeptides of antigen-binding polypeptide complexes, antibody / antigen-binding fragments or derivatives thereof, constituent polypeptides of antibody / antigen-binding fragments or derivatives thereof, Fc fusion polypeptides, anticoagulants, blood factors, bone morphogenetic polypeptides, decoy receptors for ligands, decoy ligands for receptors, enzymes, enzyme cofactors, growth factors, hormones, interferons, interleukins, thrombolytic agents, transcription factors, epigenetic modifiers, constituent polypeptides of site-specific nuclease nucleic acid editing systems, constituent polypeptides of ribonucleoproteins, viral polypeptides, or polypeptides that can be used for the production of biomolecules.