A genetically engineered strain with high expression of pdrn, and a preparation method and application thereof
By using Escherichia coli strain 4-64 for fermentation and enzymatic purification, the problems of raw material scarcity and molecular weight control in PDRN extraction were solved, achieving efficient and low-cost PDRN production and improving yield and bioactivity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- 瑞吉明(山东)生物科技有限公司
- Filing Date
- 2026-03-24
- Publication Date
- 2026-06-23
AI Technical Summary
In existing technologies, the extraction of PDRN is limited by the high price and scarcity of raw materials, and it is difficult to control the distribution range of product molecular weight during the degradation process, making it difficult to achieve large-scale production and high-quality control.
High-expression PDRN was prepared by fermentation culture using Escherichia coli strain 4-64, and through feeding and enzymatic purification, achieving efficient and stable PDRN production.
It significantly increased the yield and bioactivity of PDRN, reduced production costs, and enhanced the inhibitory effect on inflammatory factors and tissue repair capabilities.
Smart Images

Figure CN122256183A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a genetically engineered strain that highly expresses PDRN, its preparation method, and its application. Background Technology
[0002] Polydeoxyribonucleotides (PDRNs), as nucleic acid substances with important biological activities, have shown broad application prospects in various fields such as medical treatment, cosmetic research and development, and biorepair. Their core biological activities include promoting cell proliferation and differentiation, accelerating tissue repair and regeneration, and regulating inflammatory responses. Therefore, they have attracted widespread attention and are being applied in wound healing, skin anti-aging, and mucosal repair, leading to a continuous increase in market demand.
[0003] In existing technologies, PDRN preparation mainly relies on extraction from natural raw materials. Among these, fish reproductive cells, especially sperm cells from trout and salmon, have become the mainstream raw material for PDRN extraction due to their rich nucleic acid content and relatively concentrated sources. However, PDRN extraction technology using fish testes as raw materials has many insurmountable drawbacks, severely limiting the large-scale production, quality control, and application promotion of PDRN.
[0004] First, the supply of raw materials is unstable. PDRN relies on extraction from fish testes, but the fish farming cycle and fishing season are constrained by multiple factors such as the natural environment and the scale of farming, making it difficult to maintain a continuous supply of raw materials. This directly drives up product prices and limits its penetration into the low-end market and the development of downstream industries.
[0005] Secondly, the precision of molecular weight control is insufficient. The bioactivity of PDRN is closely related to its molecular weight, and different application scenarios have strict requirements on the molecular weight range of fragments. However, existing nucleic acid degradation processes are difficult to precisely control the degree of degradation, resulting in low enrichment efficiency of target fragments and a wide molecular weight distribution in the product. This reduces the activity purity and increases the difficulty and cost of subsequent separation and purification.
[0006] Secondly, process side reactions affect product quality. Some steps in the existing extraction process require high-temperature conditions. However, impurities such as proteins and sugars in fish testes are prone to undergo Maillard reactions with nucleic acids and their degradation products at high temperatures, leading to yellowing of the product and decreased purity. This not only affects the appearance but may also reduce biosafety, limiting its application in high-end fields such as medicine.
[0007] To address the aforementioned shortcomings of natural extraction techniques, those skilled in the art have begun exploring methods for preparing PDRN using genetic engineering, aiming to achieve large-scale and precise PDRN production. While genetic engineering methods have overcome the limitations of natural raw materials to some extent, this technological approach still has many areas for improvement. Existing technologies, whether natural extraction or preliminary genetic engineering methods, cannot efficiently and stably produce PDRN products that meet high-quality requirements. Therefore, there is an urgent need to develop a superior PDRN preparation technology to overcome the deficiencies of existing technologies.
[0008] Relevant patent documents retrieved: This document, published in China (CN119824022A) on April 15, 2025, discloses a recombinant *E. coli* containing a PDRN sequence and its preparation method. The preparation method includes: S1, preparing a PDRN solution; S2, completing the double strands of the PDRN to blunt ends; S3, constructing a recombinant plasmid; S4, mixing the product of step S3 with *E. coli* DH5α for culture; S5, screening for recombinants; S6, PCR amplification, recording the strains from which fragments longer than 200 bp originated; S7, using the strain prepared in step S6 to prepare a seed culture; S8, fermenting the strain; and S9, collecting the bacterial cells by centrifugation.
[0009] Relevant non-patent literature retrieved: The journal title is *Materials Science and Technology*, and the article title is "Preparation of Polydeoxyribonucleic Acid (PDRN) Materials and Its Research Progress in Biomedicine," volume number 2025, 33(01), published on November 6, 2023. This article discloses that traditional PDRN extraction and purification methods require the use of harmful reagents such as phenol and chloroform, and are cumbersome, time-consuming, and suffer from insufficient safety and efficiency, as well as poor molecular weight controllability. Therefore, developing efficient, mild, and safe preparation methods has become a research hotspot. Various existing PDRN extraction methods have their own advantages and disadvantages. For example, the method of simultaneously obtaining sperm DNA-NA and sperm protamine can improve the utilization value of testes, but the product has a high protein content; the saturated NaCl method is safe and low-cost, but not suitable for large-scale production and has difficulty controlling molecular weight; the enzymatic digestion method has mild reaction conditions, high yield, and excellent product quality, but the restriction endonuclease is expensive and requires additional protein removal. Future research needs to comprehensively consider key factors such as yield, extract safety and stability, extraction mildness, cost control, testicular tissue utilization rate, and control of the molecular weight of active PDRN.
[0010] The prior art represented by the aforementioned documents has at least the following unresolved technical problems or defects: The extraction of PDRN is limited by the high price and scarcity of raw materials, and the difficulty in controlling the molecular weight distribution of the product during degradation. Relevant evidence is that the non-patent literature "Preparation of Polydeoxyribonucleic Acid (PDRN) Materials and its Biomedical Research Progress" clearly points out that traditional PDRN extraction and purification methods have the core defect of poor molecular weight controllability. At the same time, many existing improved extraction methods (such as the simultaneous acquisition of protamine DNA-NA and protamine, saturated NaCl method, and enzymatic digestion method) all have significant limitations, such as high protein content of the product, unsuitability for large-scale production, or high cost. This indirectly confirms that the raw materials and processes on which PDRN extraction depends have bottlenecks in price and large-scale supply, making it difficult to meet the requirements of low cost, high safety, and precise molecular weight control. Summary of the Invention
[0011] The purpose of this invention is to provide: A genetically engineered strain that highly expresses PDRN, its preparation method and application, and related technologies, to solve the technical problems in existing technologies such as the high price and scarcity of raw materials for PDRN extraction, and the difficulty in controlling the distribution range of product molecular weight during degradation, or a combination thereof.
[0012] Terminology Explanation: Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this subject matter pertains. Unless otherwise stated, all patents, patent inventions, and disclosures cited throughout this document are incorporated herein by reference in their entirety. Where multiple definitions exist for terms herein, the definitions provided in this chapter shall prevail.
[0013] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.
[0014] Definitions of standard terms can be found in the references “Molecular Cell Biology (3rd Edition), Higher Education Press, authors: Chen Yeguang, Zhang Chuanmao, Chen Quan, 2019.08” and “Microbiology (9th Edition), Higher Education Press, authors: Shen Ping, Chen Xiangdong, 2025.05”.
[0015] Unless otherwise stated, conventional methods within the scope of this art, such as mixing and ice bath methods, shall be used. Unless specifically defined, the use of all commercially available products used herein shall employ standard techniques. For example, they may be implemented using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various general and more specific documents cited and discussed in this specification.
[0016] The terms “optional / arbitrary” or “optionally / arbitrarily” mean that the event or situation described below may or may not occur, including both the occurrence and non-occurrence of the event or situation.
[0017] The term "PDRN" used in this article refers to polydeoxyribonucleotide, which is a polymeric compound formed by deoxyribonucleotides linked by phosphodiester bonds. It is usually extracted from animal tissues or prepared through microbial fermentation and has biological activities such as promoting cell proliferation, tissue repair, and anti-inflammation in the biomedical field.
[0018] The term "Escherichia coli" as used in this article is Escherichia coli "( )" refers to a type of Gram-negative, facultative anaerobic rod-shaped bacterium that is widely found in the intestines of humans and animals. Some strains are opportunistic pathogens. In the fields of biotechnology and genetic engineering, it is often used as a host bacterium for gene cloning, protein expression, and nucleic acid preparation. It is one of the most commonly used model microorganisms in life science research and industrial production.
[0019] As used in this article, "blunt ends" refers to a structure in which the two strands of a double-stranded DNA molecule are aligned at the ends after being cut by restriction endonucleases or by other means, without producing single-stranded protrusions. Blunt ends can be ligated to other blunt-ended DNA fragments under the catalysis of DNA ligases (such as T4 DNA ligase), and their ligation efficiency is generally lower than that of sticky ends.
[0020] The term "competent gene-deficient DH5α Escherichia coli" used in this article refers to an Escherichia coli strain that has been artificially mutagenized, in which competence-related genes (such as the recA gene) are defective, resulting in a significant reduction in intracellular homologous recombination ability. This strain can form competent cells after treatment with CaCl2 or electroporation, which can efficiently take up exogenous DNA and the exogenous DNA has high stability in the host. It is a commonly used cloning host bacterium in gene cloning experiments.
[0021] The term "T4 DNA ligase" used in this article refers to a class of DNA ligases isolated from Escherichia coli infected with T4 bacteriophage. It can catalyze the formation of phosphodiester bonds between adjacent 5'-phosphate groups and 3'-hydroxyl groups in double-stranded DNA molecules, and can ligate blunt-end DNA fragments or complementary sticky-end DNA fragments. It is a core tool enzyme for constructing recombinant DNA molecules in gene cloning.
[0022] The term "pLB plasmid" used in this article refers to a commonly used Escherichia coli cloning plasmid vector, which typically contains a replication origin site, antibiotic resistance selection marker genes such as ampicillin, and a multiple cloning site (MCS). It is characterized by high copy number and good stability, and is suitable for cloning and preserving exogenous DNA fragments.
[0023] The term "Hieff plasmid" as used in this article refers to a class of highly efficient plasmid vectors developed by commercial biological reagent companies. Depending on their use, they can be divided into subtypes such as cloning plasmids and expression plasmids. They are designed with optimized replication elements and selection markers, and have the advantages of high transformation efficiency, high expression level of target genes, or high cloning success rate. They are widely used in molecular biology experiments.
[0024] The term "OD" used in this article 600 "Absorbance value" refers to the absorbance of microbial bacterial suspension measured at a wavelength of 600 nm, a commonly used indicator for measuring cell concentration in the bacterial suspension. The absorbance at this wavelength is positively correlated with the cell concentration and can be used to monitor bacterial growth curves in real time, guiding the optimal timing for cell collection during fermentation or culture.
[0025] The term "ELISA" used in this article refers to Enzyme-Linked Immunosorbent Assay, an immunoassay technique based on the specific binding of antigens and antibodies. Its principle involves immobilizing antigens or antibodies on a solid-phase support, catalyzing the substrate with an enzyme-labeled secondary antibody to develop color, and then using absorbance values to quantitatively or qualitatively detect the target substance (such as proteins, hormones, cytokines, etc.). It is characterized by high sensitivity, strong specificity, and ease of operation.
[0026] The term "THP-1 cells" used in this article refers to an immortalized cell line derived from human acute monocytic leukemia. Its phenotype and function are similar to human peripheral blood mononuclear cells. After in vitro treatment with inducing agents such as phorbol ester (PMA), it can differentiate into macrophage-like cells and is widely used in research on inflammatory responses, immune regulation, and drug screening.
[0027] The term "macrophage" as used in this article refers to a type of innate immune cell derived from bone marrow hematopoietic stem cells and differentiated from monocytes, widely distributed in various tissues and organs of the body. It plays a central role in immune defense, inflammatory responses, and tissue repair by phagocytizing pathogens and apoptotic cells, presenting antigens, and secreting cytokines.
[0028] The term "TNF-α" used in this article refers to Tumor Necrosis Factor-α, a pro-inflammatory cytokine mainly secreted by activated macrophages and monocytes. It possesses biological activities such as regulating immune cell proliferation and differentiation, inducing tumor cell apoptosis, and mediating inflammatory responses, while also participating in the body's immune response and tissue damage processes.
[0029] The term "IL-6" used in this article refers to interleukin-6, a multifunctional cytokine secreted by various cell types, including macrophages, lymphocytes, and fibroblasts. It participates in regulating the activation and proliferation of immune cells, promoting the synthesis of acute-phase proteins by hepatocytes, and plays an important role in inflammatory responses, immune responses, and tissue repair. Abnormally high expression is associated with various inflammatory diseases.
[0030] The term "human skin fibroblast HS27" used in this article refers to an immortalized fibroblast cell line derived from normal human skin tissue. It has the function of synthesizing and secreting extracellular matrix components such as collagen and elastic fibers, and is often used in in vitro studies on skin tissue repair, wound healing mechanisms, and the safety evaluation of cosmetics / drugs.
[0031] The term "trypsin" as used in this article refers to a class of serine proteases extracted from the pancreas of animals, which can specifically hydrolyze the carboxyl-terminal peptide bonds of lysine and arginine residues in proteins. In cell culture, it is often used to digest protein junctions between cells, causing adherent cells to detach and facilitating cell passage or isolation.
[0032] The term "dense monolayer" used in this article refers to a cell layer that grows and proliferates on the surface of a culture dish or flask until it comes into contact with each other, forming a seamless and uniform layer covering the surface of the carrier. This state is an important indicator for judging cell growth density and is often used to select the optimal timing for experiments such as cell passage, drug treatment, and protein expression.
[0033] In a first aspect, the present invention provides: a strain of Escherichia coli that highly expresses PDRN ( Escherichia coli )4-64.
[0034] This includes: Escherichia coli ( Escherichia coli )4-64.
[0035] Specifically, the Escherichia coli 4-64 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36170.
[0036] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the first aspect of the present invention includes: First preferred option: A strain of Escherichia coli that highly expresses PDRN ( Escherichia coli Escherichia coli strain 4-64 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36170. This technical solution, while addressing the existing technical problem of "PDRN extraction being limited by the high price and scarcity of raw materials, and the difficulty in controlling the molecular weight distribution of the product during degradation," further solves the technical problem of "providing a high-PDRN-expressing Escherichia coli strain that reduces the cost of raw materials."
[0037] Secondly, the present invention provides a method for preparing PDRN.
[0038] This includes: PDRN and methods.
[0039] Specifically, the method includes using the aforementioned Escherichia coli 4-64.
[0040] Specifically, the method includes the following steps: S1. Inoculate the above-mentioned Escherichia coli 4-64 into the fermentation medium for fermentation culture; S2. A feeding process is set up during the fermentation culture process; S3. Stop the culture after fermentation for 130-150 hours, centrifuge the fermentation liquid and collect the cells; S4. Extract recombinant plasmids from the collected bacterial cells to obtain recombinant plasmids containing PDRN insert fragments.
[0041] S5. The recombinant plasmid is digested with enzymes and purified to obtain PDRN.
[0042] Preferably, the fermentation termination time in step S3 is 130-135h, 135-140h, 140-145h, or 145-150h.
[0043] More preferably, the fermentation termination time in step S3 is 130-135h or 135-140h.
[0044] More preferably, the fermentation termination time in step S3 is 139 hours.
[0045] Specifically, the fermentation medium in step S1 includes, but is not limited to: 10-30 g / L yeast extract, 5-15 g / L tryptone, 10-15 g / L potassium dihydrogen phosphate, 0.5-1.5 g / L magnesium sulfate, 5-10 g / L glycerol, and water as the solvent.
[0046] Preferably, the fermentation medium in step S1 comprises, but is not limited to: 20 g / L yeast extract, 10 g / L tryptone, 13.5 g / L potassium dihydrogen phosphate, 1 g / L magnesium sulfate, 8 g / L glycerol, and water as the solvent.
[0047] Specifically, the feeding step in step S2 involves feeding 40-60 mL every 5-7 hours, starting from 20-40 hours of fermentation.
[0048] Preferably, the feeding step in step S2 is to feed 50 mL at a time, starting from 30 hours of fermentation, every 6 hours.
[0049] Specifically, the culture medium used for the feed consists of 70-90 g / L yeast extract, 30-50 g / L tryptone, 10-15 g / L potassium dihydrogen phosphate, 2-6 g / L magnesium sulfate, and 350-450 g / L glycerol.
[0050] Preferably, the culture medium used for the feed contains, but is not limited to: 80 g / L yeast extract, 40 g / L tryptone, 13.5 g / L potassium dihydrogen phosphate, 4 g / L magnesium sulfate, 400 g / L glycerol, and water as the solvent.
[0051] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the second aspect of the present invention includes: The first preferred embodiment is a method for preparing PDRN, wherein the PDRN is prepared from Escherichia coli 4-64 as described above. This technical solution solves the technical problem that "the extraction of PDRN in the prior art is limited by the high price and scarcity of raw materials, and it is not easy to control the distribution range of the molecular weight of the product during the degradation process," and further solves the technical problem that "a method for preparing PDRN from Escherichia coli with high expression of PDRN that reduces the price of raw materials is provided."
[0052] Thirdly, the present invention provides the application of the above-mentioned Escherichia coli 4-64 in the preparation of PDRN.
[0053] Fourthly, the present invention provides: PDRN prepared from the above-mentioned Escherichia coli 4-64.
[0054] Fifthly, the present invention provides the use of the above-mentioned Escherichia coli 4-64, or the above-mentioned PDRN, in the preparation of products with repair and / or anti-inflammatory functions.
[0055] Specifically, the products include, but are not limited to: pharmaceuticals, food, health products, or cosmetics.
[0056] Specifically, the dosage form of the product includes, but is not limited to, solid dosage form, semi-solid dosage form, or liquid dosage form.
[0057] More specifically, the solid dosage forms include, but are not limited to: tablets, capsules, granules, powders, or lyophilized powder injections.
[0058] More specifically, the semi-solid dosage forms include, but are not limited to, ointments, gels, or creams.
[0059] More specifically, the liquid dosage form includes, but is not limited to: solutions, suspensions, emulsions, injections, or sprays.
[0060] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the fifth aspect of the present invention includes: The first preferred embodiment is the application of the aforementioned Escherichia coli 4-64 or the aforementioned PDRN in the preparation of products with repair and / or anti-inflammatory functions. This technical solution, while addressing the existing technical problem that "PDRN extraction is limited by the high price and scarcity of raw materials, and it is difficult to control the molecular weight distribution of the product during degradation," further solves the technical problem of "providing specific applications of the aforementioned Escherichia coli 4-64 or the aforementioned PDRN."
[0061] Sixthly, the present invention provides: a product having repair and / or anti-inflammatory functions. Specifically, the product contains the aforementioned PDRN.
[0062] Specifically, the product also includes excipients acceptable in the food, pharmaceutical, or cosmetic fields.
[0063] More specifically, the excipients acceptable in the food industry include, but are not limited to, any one or more of the following: fillers, diluents, binders, disintegrants, lubricants, flow aids, sweeteners, flavorings, colorings, preservatives, antioxidants, emulsifiers, suspending agents, and stabilizers.
[0064] More specifically, the excipients acceptable in the pharmaceutical field include, but are not limited to, any one or more of the following: excipients, diluents, fillers, binders, disintegrants, lubricants, flow aids, osmotic pressure regulators, pH regulators, protectants, humectants, emulsifiers, suspending agents, preservatives, antioxidants, and stabilizers.
[0065] More specifically, the excipients acceptable in the cosmetics field include, but are not limited to, any one or more of the following: moisturizers, emollients, thickeners, emulsifiers, stabilizers, preservatives, antioxidants, fragrances, pigments, surfactants, and film-forming agents.
[0066] Specifically, the repair functions include, but are not limited to, at least one of: skin barrier repair, mucosal repair, and soft tissue injury repair.
[0067] Based on further solutions to the technical problems of the present invention, or simultaneous solutions to multiple technical problems, the preferred solution in the technical solution provided in the sixth aspect of the present invention includes: The first preferred embodiment is a product with repair and / or anti-inflammatory functions, wherein the product comprises the aforementioned PDRN. This technical solution, while addressing the existing technical problem that "PDRN extraction is limited by the high price and scarcity of raw materials, and the difficulty in controlling the molecular weight distribution of the product during degradation," further solves the technical problem of "providing a product comprising the aforementioned PDRN."
[0068] Examples 1-3 of this invention at least support the protection scope of "Escherichia coli 4-64".
[0069] "Escherichia coli 4-64" is a generalization derived from the common characteristics of "Escherichia coli 4-64" in the foregoing explanation and / or Examples 1-3, such as "strain 4-64," "Escherichia coli," and "strain 4-64 has been submitted for biodeposit." Therefore, those skilled in the art can reasonably infer that "Escherichia coli 4-64," its subordinate concepts, its substantially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing level of technology should all fall within the protection scope of "Escherichia coli 4-64." Replacing "Escherichia coli 4-64" with "Escherichia coli 4-64," etc., still falls within the protection scope of this invention.
[0070] Examples 2-3 of this invention at least support the protection scope of "method for preparing PDRN".
[0071] The term "method for preparing PDRN" is summarized from the aforementioned explanation and / or the corresponding examples 2-3, such as "inoculating strain 4-64 into the above-mentioned fermentation medium and fermenting under the same conditions as step (7) of Example 1" and "digesting the plasmid extracted from the bacterial cells of strain 4-64 obtained from fermentation in Example 2 with XhoⅠ and XbaⅠ to extract the inserted PDRN fragment." Therefore, those skilled in the art can reasonably infer that the "method for preparing PDRN," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing technical level should all fall within the protection scope of the "method for preparing PDRN."
[0072] Examples 2-3 of this invention at least support the protection scope of "the application of Escherichia coli 4-64 in the preparation of PDRN".
[0073] The term "Application of Escherichia coli 4-64 in the Preparation of PDRN" is derived from the aforementioned explanation and / or the corresponding statements in Examples 2-3, such as "the actual PDRN yield of strain 4-64 was determined to be 4.72 mg / L" and "this invention successfully screened a high-yield PDRN strain 4-64," all of which are summarized by the common characteristic that "Escherichia coli 4-64 can produce PDRN." Therefore, those skilled in the art can reasonably infer that "Application of Escherichia coli 4-64 in the Preparation of PDRN," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional and common knowledge based on the existing level of technology should all fall within the protection scope of "Application of Escherichia coli 4-64 in the Preparation of PDRN."
[0074] In this invention, embodiments 2-3 at least support the protection scope of "PDRN".
[0075] The term "PDRN" is derived from the foregoing explanation and / or the corresponding phrases in Examples 2-3, such as "obtaining PDRN with a concentration of 0.2 mg / mL" and "the A260nm / A280nm ratio of PDRN is 1.89," which are summarized by the common characteristic "PDRN prepared by the above preparation method." Therefore, those skilled in the art can reasonably infer that "PDRN," its subordinate concepts, its substantially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing technical level should all fall within the protection scope of "PDRN." Replacing "PDRN" with "polydeoxyribonucleotide," etc., still falls within the protection scope of this invention.
[0076] In this invention, embodiments 1-3 at least support the protection scope of "PDRN application".
[0077] The term "application of PDRN" is summarized in the foregoing explanation and / or the corresponding statements in Examples 1-3, which state that "polydeoxyribonucleotide (PDRN), as a nucleic acid substance with important biological activity, shows broad application prospects in multiple fields such as medical treatment, cosmetic research and development, and biorepair." Therefore, those skilled in the art can reasonably infer that "application of PDRN," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing technical level should all fall within the protection scope of "application of PDRN." Replacing "application of PDRN" with "application of polydeoxyribonucleotide," etc., still falls within the protection scope of this invention.
[0078] In this invention, embodiments 1-3 at least support the protection scope of "products containing PDRN".
[0079] The term "products containing PDRN" is summarized in the foregoing explanation and / or the corresponding descriptions in Examples 2-3, which state that "PDRN's core biological activities include promoting cell proliferation and differentiation, accelerating tissue repair and regeneration, and regulating inflammatory responses, thus attracting widespread attention and being applied in scenarios such as wound healing, skin anti-aging, and mucosal repair." Therefore, those skilled in the art can reasonably infer that "products containing PDRN," its subordinate concepts, its essentially equivalent technical means, and technical means that can replace it within the scope of conventional and common knowledge based on the existing level of technology should all fall within the protection scope of "products containing PDRN." Replacing "products containing PDRN" with "products containing polydeoxyribonucleotides," etc., still falls within the protection scope of this invention.
[0080] The present invention has at least the following beneficial effects: 1. Compared with the existing technology, the present invention has better technical effects in terms of PDRN production, PDRN anti-inflammatory and repair effects.
[0081] (1) According to experimental tests, the present invention increases the actual yield of PDRN from 2.34 mg / L in the prior art to more than 4.72 mg / L.
[0082] (2) Experimental tests have verified that the present invention can significantly enhance the inhibitory effect of PDRN on the inflammatory factor TNF-α, reducing the expression level of TNF-α from 95.67±8.12ng / L in the prior art to below 78.90±6.78ng / L.
[0083] (3) Experimental tests have verified that the present invention can significantly enhance the inhibitory effect of PDRN on the inflammatory factor IL-6, reducing the expression level of IL-6 from 165.45±11.67 ng / L in the prior art to below 128.90±9.45 ng / L.
[0084] (4) Experimental tests have verified that the present invention can significantly improve the migration-promoting effect of PDRN on human skin fibroblasts HS27, increasing the 48h migration rate of the cells from 62.34±5.89% in the prior art to more than 70.12±6.34%.
[0085] 2. The Escherichia coli strain 4-64 of the present invention can efficiently synthesize PDRN, and the PDRN prepared is superior to commercially available products from traditional sources. It has high yield, genetic stability and excellent biological activity, providing reliable support for the large-scale production and industrial application of PDRN.
[0086] Preservation Instructions Preserved strain: Escherichia coli 4-64; Classification and nomenclature: Escherichia coli Escherichia coli ; Accession number: CGMCC No. 36170; Preservation period: October 14, 2025; Preservation Institution: China General Microbiological Culture Collection Center, Management Committee; Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description
[0087] Figure 1 This is a growth curve of strain 4-64.
[0088] Figure 2 This is a growth curve of strain TA4-41.
[0089] Figure 3 This is a growth curve of strain TA3-48. Detailed Implementation
[0090] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following content is merely an exemplary description of the scope of protection claimed by the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, and such changes should also fall within the scope of protection claimed by the present invention.
[0091] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all instruments, devices, equipment, reagents, products, etc., used in the embodiments of the present invention are obtained through conventional commercial means.
[0092] Example 1: Strain Construction (1) Take commercially available powdered PDRN product (Regimemin, polydeoxyribonucleic acid, batch number: 20240918(65), 20240919(65)), add sterile ultrapure water to fully dissolve, and prepare a PDRN dilution solution with a concentration of 200 ng / μL. The PDRN dilution solution was subjected to gel electrophoresis detection. The results showed that the electrophoretic bands were diffuse, indicating that the sequence fragment length in the salmon-derived PDRN raw material product was not uniform, and it was difficult to obtain the ideal fragment length.
[0093] (2) Using the TIANGEN pLB zero-background rapid cloning kit (VT205), 200 ng / μL of PDRN was first used for end-truncation, and then ligated into the plasmid using T4 DNA ligase to construct the recombinant pLB plasmid. This step can also be performed using the YISEN Clone® Plus One Step Cloning Kit to construct the recombinant Hieff plasmid.
[0094] (3) Mix the product of step (2): pLB plasmid with competent DH5α Escherichia coli, incubate on ice for 20 min, then heat shock for 30 to 50 s, incubate on ice again for 2 min, and then add sterile LB liquid medium and shake to culture for 1 h. Centrifuge the cultured Escherichia coli at 3000 g for 3-5 min, retain about 100 μL of medium, remove excess medium, and remix the remaining medium with Escherichia coli. Spread the mixture onto a pre-prepared solid LB agar plate containing ampicillin sodium and culture at 37 °C for 12-16 h (stop culturing before observing the growth of single colonies and before they stick together).
[0095] (4) Select white monoclonal strains on the plate and carry out large-scale culture.
[0096] (5) Take the bacterial culture after expansion in step (4) as a template, and perform PCR amplification with primer pair (pLBF (SEQ ID NO:4): CGACTCACTATAGGGAGAGCGGC and pLBR (SEQ ID NO:5): AAGAACATCGATTTTCCATGGCAG) (if Hieff vector fragment needs to be amplified, universal M13 sequencing primer pair must be used), record the strains from which the fragments longer than 200bp are derived, and obtain strains 4-64, TA4-41 and TA3-48, and then sequence them to obtain gene sequences; The test results showed that strains 4-64, TA4-41, and TA3-48 were all single-fragment insert strains: the PDRN insert size of strain 4-64 was 720 bp, and the sequence was shown in SEQ ID NO:1; the PDRN insert size of strain TA4-41 was 1336 bp, and the sequence was shown in SEQ ID NO:2; and the PDRN insert size of strain TA3-48 was 1024 bp, and the sequence was shown in SEQ ID NO:3.
[0097] SEQ ID NO:1: ; SEQ ID NO:2: SEQ ID NO:3:
[0098] (6) Use liquid LB medium containing ampicillin sodium to add the strain prepared in step (5) to make seed culture.
[0099] (7) Mix the seed culture prepared in step (6) with common Escherichia coli culture medium (LB medium) at a certain ratio (1:99 to 20:80), and add ampicillin sodium to prevent bacterial degeneration. Stop fermentation when the bacterial concentration is high (the relative concentration is determined by measuring the light absorbance at 600 nm using a UV spectrophotometer) and the bacterial growth enters the stationary phase.
[0100] (8) Centrifuge the fermentation liquid at a centrifugal force of 10000g-13000g and collect the bacterial cells.
[0101] Example 2: Strain screening and yield detection The PDRN yield of multiple modified strains obtained in Example 1 was measured to screen for the strain with the optimal yield. The specific detection process is as follows: 1. Experimental strains and culture medium (1) Experimental strains Positive strains obtained from screening in Example 1: strain 4-64, strain TA4-41, strain TA3-48; Blank control: E. coli from the same batch transformed only with the original plasmid (without the PDRN insert fragment, 2974 bp in length) to exclude interference from plasmid extraction and detection, and to verify the specificity of PDRN fragment detection.
[0102] (2) Culture medium Fermentation medium (g / L): yeast extract 20g / L, tryptone 10g / L, potassium dihydrogen phosphate 13.5g / L, magnesium sulfate 1g / L, glycerol 8g / L; solvent: deionized water, pH 7.2.
[0103] Feeding medium (g / L): yeast extract 80g / L, tryptone 40g / L, potassium dihydrogen phosphate 13.5g / L, magnesium sulfate 4g / L, glycerol 400g / L; solvent: deionized water, pH 7.2.
[0104] 2. Experimental Methods (1) Standardized culture and feeding All strains (including blank control) were cultured under completely identical conditions, and a single variable was strictly controlled: the strains were inoculated into the above fermentation medium and fermented under the same conditions as step (7) of Example 1. A feeding cycle was set up during the fermentation process: starting from 30h of fermentation, feeding was carried out once every 6h at a feeding rate of 50mL / time, for a total of 12 feedings, and fermentation was carried out uniformly until 139h.
[0105] (2) Monitoring of growth indicators and quantitative harvesting of microbial cells Samples were taken every 6 hours during fermentation, and the OD of the bacterial culture was measured using a UV spectrophotometer. 600 Values were used to plot growth curves for each strain (see...). Figures 1-3 At the end of fermentation, three parallel samples were taken from each strain, each with 1L of fermentation broth. The samples were centrifuged at 8000rpm and 4℃ for 10min. After discarding the supernatant, the bacterial precipitate was washed twice with PBS buffer, centrifuged again, and weighed. The average wet weight of bacterial cells per liter of broth was calculated, and the relative standard deviation (RSD) was controlled to be <5%.
[0106] (3) Plasmid extraction and precise determination of PDRN yield Take the bacterial cell precipitate after washing and extract plasmids; determine the plasmid purity (OD) using a spectrophotometer. 260 / OD 280 =1.8-2.0 is considered acceptable) and concentration, calculate the average plasmid extraction mass per liter of bacterial solution; ① Combining the ratio of the total length of the recombinant plasmid to the length of the PDRN insert fragment, and taking into account the plasmid extraction and fragment targeting recovery rates, the actual yield of the PDRN insert fragment per liter of bacterial culture is calculated using the following formula: Actual yield of PDRN insert (mg / L) = PDRN insert length (bp) / total length of recombinant plasmid (bp) × mass of plasmid extracted per liter of bacterial culture (mg / L). ② Simultaneously calculate the PDRN yield per unit cell (a core high-yield indicator), using the following formula: PDRN yield per unit cell (mg / g) = Actual yield of PDRN insert (mg / L) / Wet weight of cells (g / L); (4) Verification of plasmid genetic stability At the end of fermentation, the bacterial cultures of each strain were serially diluted and plated on LB agar plates containing the corresponding antibiotics. The plates were incubated at 37°C for 16 hours. Fifty single colonies were randomly selected for PCR verification (using PDRN insert-specific primers). Plasmid retention rate was calculated to verify the genetic stability of the high-yield characteristic. Plasmid retention rate (%) = number of PCR positive colonies / total number of picked colonies × 100%.
[0107] 3. Experimental Results (1) Results of core growth indicators of strains The growth parameters and plasmid stability results of each strain after fermentation for 139 h are shown in Table 1. The OD values of strain 4-64 are also shown in Table 1. 600The PDRN value and wet weight were significantly higher than those of TA4-41 and TA3-48, and the plasmid retention rate reached 100%, indicating that it had a better growth status under high-density fermentation conditions. There was no loss of recombinant plasmid, which provided a cell basis and genetic guarantee for high PDRN production. The blank control strain did not amplify PDRN fragments, eliminating detection interference.
[0108] Table 1. Growth parameters and plasmid stability results of each strain after 139 h of fermentation.
[0109] (2) Core data results of plasmid extraction and PDRN yield Table 2 shows the results of plasmid extraction quality, actual PDRN insert yield, PDRN yield per unit cell, and injection preparation potential for each strain. All data are the average values of three parallel samples, with RSD < 5%, proving that the experimental method has good repeatability and the data is true and reliable. Among them, the actual PDRN yield of strain 4-64 was determined to be 4.72 mg / L, which is the highest value among the three strains.
[0110] Table 2. PDRN yield and application potential of each strain after 139 h of fermentation.
[0111] (3) Quantitative analysis of yield differences among strains The actual PDRN yield of strain 4-64 was 4.72 mg / L, which was 102.0% higher than that of TA4-41 and 177.6% higher than that of TA3-48; the PDRN yield per cell was 0.2919 mg / g, which was 5.2% higher than that of TA4-41 and 21.0% higher than that of TA3-48; the volume of 1.8 μg / μL PDRN injection that could be prepared was 2.6222 mL / L, which was 101.7% higher than that of TA4-41 and 177.7% higher than that of TA3-48.
[0112] The above results indicate that the present invention successfully screened out a high-PDRN-producing strain 4-64.
[0113] (4) Preservation of strains Strain 4-64 was submitted for biological deposit and was deposited on October 14, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 36170 and classified as *Escherichia coli*. Escherichia coli .
[0114] Example 3 Purification of PDRN The plasmid extracted from the bacterial cells of strain 4-64 obtained in Example 2 was double-digested with XhoⅠ and XbaⅠ to extract the inserted PDRN fragment. The fragment was then purified by agarose gel electrophoresis using a TIANGEN brand agarose gel DNA recovery kit (DP209) to obtain PDRN at a concentration of 0.2 mg / mL. The absorbance at 260 nm and 280 nm was measured using a spectrophotometer, and the ratio of A260 nm to A280 nm represents the purity of the PDRN. The results showed that the A260 nm / A280 nm ratio of the PDRN was 1.89 (between 1.8 and 2.0), indicating that the PDRN prepared by this invention has high purity.
[0115] Example 1: Anti-inflammatory effect of PDRN The PDRN prepared in Example 3 at a concentration of 0.2 mg / mL is referred to as "PDRN of this invention". Traditional salmon testis-derived PDRN (purchased from Regeneron Biotech Ltd., hereinafter referred to as "commercially available PDRN") was used as a positive control, and the PDRN-free group served as a blank control. The anti-inflammatory effect of the PDRN of this invention was evaluated by detecting the expression levels of inflammatory factors TNF-α and IL-6. The specific experimental procedure is as follows: 1. Experimental Materials (1) Cells: THP-1 cells (purchased from Wuhan Pronosai Life Science Technology Co., Ltd.)
[0116] (2) Reagents: Complete culture medium (RPMI 1640 cell culture medium containing 10% FBS and 1% penicillin / streptomycin), PMA (phorbol ester, purchased from Shanghai Beyotime Biotechnology Co., Ltd.), LPS (lipopolysaccharide, purchased from Sigma), TNF-α ELISA kit, IL-6 ELISA kit (all purchased from Shanghai Beyotime Biotechnology Co., Ltd.).
[0117] 2. Experimental Methods (1) Induction of THP-1 cells into macrophages The THP-1 cell density was adjusted to 3 × 10⁻⁶ cells using complete culture medium. 6 1 mL of cell suspension was added to each well of the plate, and 1 mL of phorbol ester (PMA) was added to each well to a final concentration of 20 ng / mL. The plate was then incubated at 37°C and 5% CO2 for 24 h to induce THP-1 cells to differentiate into macrophages.
[0118] (2) Post-differentiation cell plating culture Macrophages that have undergone induced differentiation were collected, resuspended in complete culture medium, and the cell density was adjusted to 0.5 × 10⁻⁶. 6Cells / mL; Add 200 μL of the above cell suspension to each well of a 96-well plate and incubate overnight in a 37°C, 5% CO2 incubator to allow the cells to adhere fully to the plate.
[0119] (3) Construction of inflammation model and group intervention Discard 100 μL of the old culture medium in each well, and add 100 μL of lipopolysaccharide (LPS) to each well to construct a cell inflammation model (except for the normal group). Subsequently, group interventions were performed according to the experimental design, with the specific grouping and treatment methods as follows: ① PDRN intervention group: 100 μL of PDRN diluted with complete culture medium was added to each well, with 5 concentration gradients (20, 50, 100, 200, 500 μg / mL); ② Commercially available PDRN control group: 100 μL of 500 μg / mL commercially available PDRN diluted with complete culture medium was added to each well; ③ LPS model group: 100 μL of complete culture medium (containing only LPS, no PDRN intervention) was added to each well; ④ Normal control group: No LPS or PDRN was added, only 100 μL of complete culture medium was added. After grouping and treatment, the 96-well plate was placed in a 37℃, 5% CO2 incubator for 24 h.
[0120] (4) Detection of inflammatory factors After incubation, 100 μL of cell supernatant was collected from each well, and the assay was performed strictly according to the instructions of the TNF-α and IL-6 enzyme-linked immunosorbent assay kit. The absorbance of each well was measured, and the specific expression levels of TNF-α and IL-6 in the supernatant of each well were calculated based on the kit's standard curve.
[0121] The results are shown in Table 3: Compared with the LPS group (model group), the expression levels of TNF-α and IL-6 in the normal group were significantly reduced (P<0.05), while the expression levels of TNF-α and IL-6 in the LPS group were significantly higher than those in the normal group, indicating that the inflammation model was successfully constructed.
[0122] Analysis of the anti-inflammatory effects of different concentrations of PDRN from this invention showed that, compared with the LPS group, the PDRN concentrations of this invention (50-500 μg / mL) significantly reduced the expression levels of TNF-α and IL-6. Furthermore, with increasing PDRN concentration, the expression levels of TNF-α and IL-6 gradually decreased, and the inhibitory effect gradually increased, exhibiting a clear dose-dependent effect. Further comparison of the anti-inflammatory activity of the PDRN from this invention with commercially available PDRN showed that the expression levels of TNF-α and IL-6 in the PDRN 500 μg / mL group were lower than those in the commercially available PDRN 500 μg / mL group, and the cytokine expression levels in both groups were significantly reduced, approaching the levels of the normal group.
[0123] Table 3. Expression levels of TNF-α and IL-6 (ng / L, x±s, n=3)
[0124] Note: The LPS group served as the control group. This means P < 0.05. This means P < 0.01.
[0125] The above results indicate that the PDRN prepared in this invention has excellent anti-inflammatory effects, with the high concentration (100-500 μg / mL) group showing more significant anti-inflammatory effects, which can significantly inhibit the expression and release of inflammatory factors and reduce redness, swelling and exudation at the inflammatory site.
[0126] Test Example 2: Repair effect of PDRN The PDRN prepared in Example 3 at a concentration of 0.2 mg / mL is referred to as "PDRN of this invention". Traditional salmon testis-derived PDRN (purchased from Regeneron Biosciences, hereinafter referred to as "commercially available PDRN") was used as a positive control, and the PDRN-free group served as a blank control. The repair effect of the PDRN of this invention was evaluated by detecting cell migration rate using the HS27 human skin fibroblast scratch model. The specific experimental procedure is as follows: 1. Experimental Materials (1) Cells: Human skin fibroblasts HS27 (purchased from the Cell Bank of the Chinese Academy of Sciences).
[0127] (2) Reagents: Complete culture medium (DMEM high glucose cell culture medium containing 10% FBS and 1% penicillin / streptomycin), serum-free DMEM high glucose culture medium, trypsin digestion solution (purchased from Shanghai Beyotime Biotechnology Co., Ltd.).
[0128] 2. Experimental Methods (1) Cell resuscitation and plating preparation Human skin fibroblasts (HS27) were revived in complete culture medium and cultured in a 37°C, 5% CO2 incubator until the logarithmic growth phase. The cells were then digested with 0.25% trypsin, and the cell suspension was collected and adjusted to a density of 2 × 10⁶ cells / mL using complete culture medium. 5 Quantity / mL, for later use.
[0129] (2) Cell adherence culture Add 2 mL of the adjusted density of HS27 cell suspension to each well of a 6-well cell culture plate and incubate overnight in a 37°C, 5% CO2 incubator until the cells reach 90%-100% confluence and form a dense monolayer of cells.
[0130] (3) Scratch model construction Discard the cell supernatant from each well and gently wash the cell surface twice with phosphate-buffered saline (PBS) to remove residual culture medium. Use a scratcher to create wounds on the cells and wash each well twice again with serum-free DMEM high-glucose medium to thoroughly remove cell debris generated by the scratches.
[0131] (4) Group intervention treatment Subsequently, the cells were divided into three groups according to the experimental design for intervention. The treatment methods for each group were as follows: ① PDRN group of the present invention: 2 mL of PDRN of the present invention diluted with complete culture medium was added to each well, and five concentration gradients of 20, 50, 100, 200 and 500 μg / mL were set; ② Commercially available PDRN group: 2 mL of 500 μg / mL commercially available PDRN diluted with complete culture medium was added to each well; ③ Model group (blank control): 2 mL of complete culture medium was added to each well to maintain cell culture only, without adding PDRN.
[0132] (5) Cultivation and Sample Observation The 6-well plates that had completed the group intervention were placed in a 37℃, 5% CO2 constant temperature incubator for further incubation. At three time points, namely 0h (immediately after scratching), 24h, and 48h, the scratched areas of each well were photographed and recorded under the same fixed field of view using an inverted microscope to ensure the consistency of the observation position.
[0133] (6) Data measurement and statistics ImageJ image analysis software was used to perform quantitative analysis on scratch images taken at various time points, and the width of each scratch region was measured. Cell migration rate was calculated according to the formula: migration rate (%) = (0h scratch width - scratch width at different time points) / 0h scratch width × 100%.
[0134] The results are shown in Table 4. Compared with the model group, the PDRN concentration groups of the present invention (50-500 μg / mL) significantly improved the migration rate of HS27 cells (P<0.05), and there was a clear dose-dependent effect—the cell migration-promoting effect gradually increased with the increase of the PDRN concentration of the present invention. Further comparison of the cell migration-promoting activity of the PDRN of the present invention and commercially available PDRN showed that the cell migration rate of the PDRN 500 μg / mL group at 24h (45.23±5.12%) and 48h (70.12±6.34%) was higher than that of the commercially available PDRN 500 μg / mL group at the same time points (24h: 38.90±4.56%; 48h: 62.34±5.89%). Moreover, there was no significant difference in cell migration rate between the commercially available PDRN 500 μg / mL group and the model group (P>0.05), indicating no significant cell migration-promoting effect.
[0135] Table 4. Migration rate of HS27 cells in different treatment groups (%, x±s, n=3)
[0136] Note: The model group serves as a control. This means P < 0.05. This means P < 0.01.
[0137] The above results indicate that the PDRN prepared in this invention has excellent repair effects, with the high concentration (100-500 μg / mL) group showing more significant repair effects. It can effectively promote the migration of skin fibroblasts and accelerate the repair process of damaged sites.
[0138] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A strain of Escherichia coli that highly expresses PDRN ( Escherichia coli )4-64, characterized in that, The Escherichia coli 4-64 is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 36170.
2. A method for preparing PDRN, characterized in that, The method includes using Escherichia coli 4-64 as claimed in claim 1.
3. The application of Escherichia coli 4-64 as described in claim 1 in the preparation of PDRN.
4. PDRN prepared from Escherichia coli 4-64 as described in claim 1.
5. The use of Escherichia coli 4-64 as described in claim 1, or PDRN as described in claim 4, in the preparation of products with repair and / or anti-inflammatory functions.
6. The application according to claim 5, characterized in that, The products include pharmaceuticals, food, health products, or cosmetics.
7. The application according to claim 6, characterized in that, The dosage form of the product includes solid dosage form, semi-solid dosage form, or liquid dosage form.
8. A product having repair and / or anti-inflammatory functions, characterized in that, The product comprises the PDRN of claim 4.
9. The product according to claim 8, characterized in that, The product also contains excipients acceptable in the food, pharmaceutical, or cosmetic fields.
10. The product according to claim 8, characterized in that, The repair function includes at least one of skin barrier repair, mucosal repair, and soft tissue injury repair.