Use of a haplotype molecular marker associated with sheep body weight and muscle fiber diameter

Abstract

The present application relates to the technical field of genetic breeding, and particularly relates to application of a haplotype molecular marker related to sheep weight and muscle fiber diameter, wherein the haplotype molecular marker is 1) and 2): 1) a nucleotide sequence shown in SEQ ID NO. 1; the nucleotide at the 101bp site of the SEQ ID NO. 1 is T or C; 2) a nucleotide sequence shown in SEQ ID NO. 2; the nucleotide at the 101bp site of the SEQ ID NO. 2 is C or T. Through the significant SNP site related to weight, early identification of the muscle fiber diameter of live sheep is realized, which can be used for assisting breeding to reduce the muscle fiber diameter of offspring, has the characteristics of non-damage, high efficiency and precision, and can effectively shorten the breeding cycle and improve the growth performance of sheep and the efficiency of meat quality improvement.

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a haplotype molecular marker related to sheep weight and muscle fiber diameter. Background Technology

[0002] Muscle fiber diameter is a key trait determining the core qualities of mutton, such as tenderness, juiciness, and flavor. Studies have shown that generally, the smaller the muscle fiber diameter and the higher the density, the more tender the mutton, the better its taste, and the higher its market added value. Therefore, precise control of muscle fiber diameter is of great significance in sheep breeding and meat quality improvement. However, traditional muscle fiber diameter improvement relies on post-slaughter histological testing (section preparation, staining, and microscopic observation, etc.). This method is irreversible and cannot be applied to early selection in vivo, resulting in the screening of superior traits only being carried out after slaughter. This leads to problems such as lengthy breeding cycles, prolonged generation intervals, and low selection efficiency, seriously restricting the genetic improvement of mutton quality traits. To overcome these technical bottlenecks, the industry is attempting to explore the correlation between easily observable traits in vivo and muscle fiber diameter, aiming to establish an indirect selection breeding strategy. Body weight, as one of the most easily measurable growth traits in sheep, has a direct biological link with muscle fiber development: body weight gain depends on muscle tissue deposition, and muscle fiber, as the basic structural unit of skeletal muscle, directly affects total muscle mass and overall body weight. Studies in humans and poultry have shown that body weight and muscle fiber diameter are regulated by common genetic factors. However, in sheep, the genetic link between the two has not yet been systematically elucidated, and there is a lack of mature technical methods to indirectly distinguish or predict muscle fiber diameter using body weight-related genetic markers.

[0003] In conclusion, there is an urgent need to develop a molecular marker technology that relies on body weight-related SNP loci to distinguish the diameter of muscle fibers in live sheep during sheep breeding. This would break through the limitations of traditional phenotypic selection, construct a precise, timely, and non-destructive screening system for sheep muscle fiber diameter, and drive sheep breeding towards higher efficiency. Summary of the Invention

[0004] To address the above problems, this invention provides an application of body weight-related haplotype molecular markers in identifying sheep muscle fiber diameter. This solves the problem that traditional techniques for determining muscle fiber diameter rely on post-slaughter tissue sampling, which cannot be applied to early live breeding, resulting in lengthy breeding cycles, long generation intervals, and low breeding efficiency.

[0005] This invention is achieved through the following technical solution: Application of haplotype molecular markers related to sheep body weight and muscle fiber diameter, said haplotype molecular markers being 1) and 2). 1) The nucleotide sequence shown in SEQ ID NO.1; the nucleotide at the 101 bp site of SEQ ID NO.1 is T or C.

[0006] 2) The nucleotide sequence shown in SEQ ID NO.2; the nucleotide at the 101 bp site of SEQ ID NO.2 is C or T.

[0007] The application refers to any one of the following (1) to (4): (1) Identifying the weight of sheep: When the nucleotide at the 101 bp site of SEQ ID NO.1 is C and the nucleotide at the 101 bp site of SEQ ID NO.2 is T, the sheep has a larger weight.

[0008] (2) Identification of the diameter of sheep muscle fibers: When the nucleotide at the 101 bp site of SEQ ID NO.1 is T and the nucleotide at the 101 bp site of SEQ ID NO.2 is C, the muscle fiber diameter is smaller.

[0009] (3) Increase the weight of sheep offspring: Select sheep individuals with nucleotide C at the 101bp site of SEQ ID NO.1 and nucleotide T at the 101bp site of SEQ ID NO.2 as parents for selective breeding in order to increase the weight of sheep offspring.

[0010] (4) Reduce the diameter of muscle fibers in sheep offspring: Select sheep individuals with nucleotide T at the 101 bp site of SEQ ID NO.1 and nucleotide C at the 101 bp site of SEQ ID NO.2 as parents for selective breeding to reduce the diameter of muscle fibers in sheep offspring.

[0011] The nucleotide sequence of SEQ ID NO.1 is shown below: ACCACACACCCCTGCCTCCAGTCCCCTCTTCCTGGCACTTTGGGCTGTGGATGCCGGGGTGACTGTTTGTTTATCATCTGTCTCCTTTGCAGACAGACCC[T / C]GTCCTCTGCCAGGCCGGGGCCACTTCTGCTCAAAAGGTACCTCCAGAGCCTGGCACGTGGCCTGGTATGTGGTGCACCCTGGCACATGCTTAAGGAATGA.

[0012] The nucleotide sequence of SEQ ID NO.2 is shown below: CACACCCCTGCCTCCAGTCCCCTCTTCCTGGCACTTTGGGCTGTGGATGCCGGGGTGACTGTTTGTTTATCATCTGTCTCCTTTGCAGACAGACCCTGTC[C / T]TCTGCCAGGCCGGGGCCACTTCTGCTCAAAAGGTACCTCCAGAGCCTGGCACGTGGCCTGGTATGTGGTGCACCCTGGCACATGCTTAAGGAATGATCGA.

[0013] Preferably, the specific method for determining the weight of a sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0014] Determine the genotype of the sheep at position 101 of SEQ ID NO.1 and SEQ ID NO.2.

[0015] If the haplotype combination formed by the genotype at position 101bp of SEQ ID NO.1 and the genotype at position 101bp of SEQ ID NO.2 is CCTT, then the sheep has a body weight of 31.06kg to 41.7kg.

[0016] Preferably, the specific method for determining the diameter of sheep muscle fibers is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0017] Determine the genotype of the sheep at position 101 of SEQ ID NO.1 and SEQ ID NO.2.

[0018] If the haplotype combination formed by the genotype at position 101bp of SEQ ID NO.1 and the genotype at position 101bp of SEQ ID NO.2 is TTCC, then the sheep muscle fiber diameter is small; the small muscle fiber diameter refers to a muscle fiber diameter value of 38.96μm~48.16μm.

[0019] Preferably, the specific method for increasing the weight of sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0020] Determine the genotype of the sheep at position 101bp in SEQ ID NO.1 and SEQ ID NO.2.

[0021] By selecting sheep individuals whose haplotype combination of the genotypes at 101bp of SEQ ID NO.1 and 101bp of SEQ ID NO.2 forms CCTT as parents for breeding, it is possible to increase the weight of sheep offspring.

[0022] Preferably, the specific method for reducing the diameter of muscle fibers in sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0023] Determine the genotype of the sheep at position 101bp in SEQ ID NO.1 and SEQ ID NO.2.

[0024] By selecting sheep individuals whose haplotype combination of the genotypes at 101bp of SEQ ID NO.1 and 101bp of SEQ ID NO.2 forms TTCC as parents for breeding, it is possible to reduce the muscle fiber diameter of sheep offspring.

[0025] Preferably, the genomic DNA is derived from sheep blood.

[0026] Preferably, the sheep is a lamb.

[0027] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of haplotype molecular markers related to sheep weight and muscle fiber diameter, wherein the haplotype molecular markers are 1) and 2): 1) the nucleotide sequence shown in SEQ ID NO.1; the nucleotide at the 101bp site of SEQ ID NO.1 is T or C. 2) the nucleotide sequence shown in SEQ ID NO.2; the nucleotide at the 101bp site of SEQ ID NO.2 is C or T. The application refers to any one of the following (1) to (4): (1) identifying sheep weight; (2) identifying sheep muscle fiber diameter; (3) increasing the weight of sheep offspring; (4) decreasing the muscle fiber diameter of sheep offspring. This invention reveals for the first time the strong correlation between sheep weight-related haplotype molecular markers and muscle fiber diameter. By detecting the haplotype combination TTCC at the 101bp site of SEQ ID NO.1 and SEQ ID NO.2, sheep individuals with smaller muscle fiber diameters can be accurately identified in vivo, avoiding the irreversibility of traditional methods that rely on post-slaughter histological testing, and realizing early, non-destructive, and high-throughput screening of muscle fiber diameter. This method is simple to operate and yields stable results, and can be directly applied to the selection of breeding parents. By retaining TTCC haplotype individuals as parents, it can effectively reduce the muscle fiber diameter of offspring and improve quality traits such as lamb tenderness. This invention overcomes the limitations of indirect selection based on body weight phenotype, providing reliable molecular markers and an efficient technical pathway for the genetic improvement of sheep meat quality traits, significantly shortening the breeding cycle and improving the accuracy and economic benefits of selection. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 This invention relates to a chromosome density diagram of lamb sheep.

[0030] Figure 2 The Manhattan plot and QQ plot are for the genome-wide association analysis of age and weight in this invention; where (A) is the Manhattan plot and (B) is the QQ plot.

[0031] Figure 3 This is a linkage disequilibrium heatmap of the present invention; wherein, (A) is chromosome 2; (B) is chromosome 4; (C) is chromosome 9; (D) is chromosome 22; and (E) is chromosome 24.

[0032] Figure 4 This is a schematic diagram of the field of view of HE staining of the longissimus dorsi muscle fibers of sheep according to the present invention; wherein, (A) is a tissue section of group G muscle fibers; and (B) is a tissue section of group L muscle fibers. Detailed Implementation

[0033] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0034] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0035] This invention collected blood samples from 321 Xinggao meat sheep born in winter at Dumei Livestock Co., Ltd. in Xing'an League, Inner Mongolia. Genomic DNA was extracted and its quality was tested to ensure that the DNA quality met sequencing requirements. Sequencing was performed using the DNBSEQ-T7 platform, and the raw sequencing data was converted into fastq format sequence files after base identification. Because the raw data contained interference information such as adapters, low-quality bases, and undetected bases, data filtering was performed first to obtain effective base sequences. Subsequently, the effective sequences were aligned to the sheep reference genome (Oar_v4.0, GCF_000298735.2) using BWA software, and repetitive sequences were removed using SAMTOOLS software. After sequence alignment, in-depth analysis was conducted on the resequencing data to determine the correlation between individuals in terms of copy number and structural variation. The sample alignment rate reflects the similarity between the sequencing data and the reference genome, while the sequencing coverage depth and range directly reflect the consistency of the data and its homology with the reference sequence. SNP detection in the population was then performed using SAMTOOLS software, followed by quality control of the detected SNPs using Plink v1.9 software. The quality control criteria were: minimum allele frequency <0.05, SNP deletion rate >0.1, and Hardy-Weinberg equilibrium test p-value <10. -6 The SNP loci were identified, ultimately yielding 21,455,405 high-quality SNPs. Finally, GEMMA was used to perform association analysis on the correlation traits among different populations.

[0036] .

[0037] y represents the phenotypic trait, X represents the indicator matrix of the fixed effects, α represents the estimated parameters of the fixed effects, Z represents the indicator matrix of the SNP, β represents the effect of the SNP, W represents the indicator matrix of the random effects, μ represents the predicted random individuals, and e represents the random residuals.

[0038] Gene annotation was performed on the 500kb regions flanking and downstream of significant SNP sites using ANNOVAR software. GO and KEGG enrichment analyses were conducted on candidate genes associated with each trait using the DAVID database. Haploview software was then used for haploid linkage analysis of significant SNP sites.

[0039] To verify the association between significant weight-related SNPs identified through genome-wide association analysis and muscle fiber diameter, the experimental population was divided into two groups, G and L, based on the dominant allele at each locus. Group G consisted of homozygous individuals with the dominant allele, corresponding to a high-weight phenotype; Group L consisted of individuals with the non-dominant allele, corresponding to a low-weight phenotype. Subsequently, longissimus dorsi muscle tissue samples were collected from both groups according to standard slaughter procedures. After HE staining, panoramic scanning of the HE-stained sections was performed using an LG-S80 digital pathology slide scanner. Fields of view were selected using Saiviewer 1.0.11 software, and the area, diameter, and density of muscle fibers were measured using Image-Pro Plus 6.0 image analysis software. Five non-overlapping fields of view were randomly selected for each sample. Results are expressed as mean ± standard error. The differences in muscle fiber diameter between the two groups were compared and analyzed to verify the association between weight-related SNPs and muscle fiber diameter.

[0040] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0041] Example 1 A total of 321 samples were aligned with the reference genome in this sequencing study. The average alignment rate of the population samples was 99.14%, which directly reflects the similarity between the sequencing data and the reference genome. Combined with the average sequencing depth of 7.79X and average coverage of 95.12% (meaning that bases with a depth greater than 1X account for 95.12% of the total bases in the reference genome), and the 4x coverage of 74.09%, as shown in Table 1, the sample alignment rate reflects the similarity between the sample sequencing data and the reference genome. Coverage depth and coverage are key indicators for evaluating the homogeneity of sequencing data and the homology between the sample and the reference sequence. The high alignment rate results indicate that the sequencing data of all samples meet the core requirements of resequencing analysis, demonstrating excellent homology matching and data homogeneity. Further validation of genomic data quality showed that the average percentage of bases with a quality value ≥20 was 99.27%, and the average percentage of bases with a quality value ≥30 was 97.47%. The Q20 and Q30 indicators directly reflect the accuracy of sequencing data, and the higher the percentage, the smaller the data error. The average GC content was 44.05%, as shown in Table 2. All of the above indicators meet the high-quality data standards for genomic analysis, indicating that the sequencing data has no obvious base bias and has excellent accuracy and reliability.

[0042] Table 1. Statistics on sequencing depth and coverage

[0043] Table 2 Summary of Sequencing Data Quality Assessment

[0044] After quality control screening, 21,455,405 SNPs were identified. Among them, 75,938 SNPs had synonymous mutations in exons, 47,274 had non-synonymous mutations, 404 SNPs had mutations at splice sites, 7,192,627 SNPs were located in intronic regions, and 12,443,588 SNPs had mutations in intergenic regions. The number of SNPs located 1 kb upstream and 1 kb downstream of one gene were 153,144 and 158,485, respectively. There were 4,446 SNPs located 1 kb upstream of one gene and 1 kb downstream of another gene. To observe the genome-wide distribution of SNPs after quality control, a genome-wide SNP distribution map was plotted using the CMplot package in R, with a window size of 1 MB. Figure 1 As shown in the figure, SNPs are evenly distributed across all chromosomal regions, with no uncovered areas, and can be used for subsequent GWAS.

[0045] In genome-wide association studies (GWAS), due to factors such as phenotypic error, population structure, and marker density, significant loci identified in trait association analyses may not be causative loci. Loci that are undetectable nearby or linked to the trait may be the truly causative loci. Haplotype combination analysis, however, can effectively account for interactions between non-allelic genes and linkage disequilibrium among multiple variant loci, providing an important method for determining whether false positives exist at relevant loci.

[0046] Based on Table 3 and Figure 2 It was found that among the 321 lambs, 172 individuals had resequencing data available at 6 months of age. Sixty significant SNP loci associated with body weight were detected, located on chromosomes 2, 3, 4, 7, 8, 9, 10, 11, 12, 13, 20, 22, 24, and 27. Gene annotation and enrichment analysis were performed on these significant SNPs. Genes MLST8, TELO2, TSC2, and ECI1 were found to be related to growth, with a total of 7 SNP loci detected. The association analysis results between each genotype and growth trait are as follows: chr24:1446268 G / A:GG genotype individual phenotypic value was 28.58±2.48. a The value for the GA type is 30.59±3.72. b The AA type had a score of 37.80. The AA type was significantly higher than the GG type. P <0.05, indicating the dominant genotype. chr24:1448549 G / A: GG type 28.47±2.42 a , GA type 30.00±2.92 b , AA type 33.97±5.56 c Significant differences were found among the three genotypes. P<0.05, AA type is the dominant genotype. chr24:1450140 G / A: GG type 28.59±2.48 a , GA type 30.63±3.74 b The AA type was 37.80. The AA type was significantly higher than the GG type. P <0.05, indicating the dominant genotype. chr24:1453713 T / C: TT type 28.59±2.49 a TC type 30.76±3.76 b The CC type was 37.80. The CC type was significantly higher than the TT type. P <0.05, indicating the dominant genotype. chr24:1460414 T / C: TT type 28.65±2.50 a TC type 29.28±2.82 a CC type 36.38±5.32 b The CC type was significantly higher than the TT and TC types. P <0.05, indicating the dominant genotype. chr24:1460418 C / T: CC type 28.66±2.56 a CT scan: 29.31 ± 2.60 a TT type 36.38±5.32 b The TT type was significantly higher than the CC and CT types. P <0.05 indicates the dominant genotype. chr24:1460452T / C: TT type 28.63±2.52 a TC type 30.24±3.25 b CC type 39.20±4.10 c Significant differences were found among the three genotypes. P <0.05, CC type is the dominant genotype. Subsequently, haplotypes were constructed using Haploview software, revealing that chr24:1460414 and chr24:1460418 on chromosome 24 constitute a haplotype block, such as... Figure 3 As shown in Table 4, haplotype analysis was performed on the chr24:1460414 and chr24:1460418 loci, resulting in three haplotypes. Among them, the CT haplotype showed the highest growth trait values, significantly higher than the other haplotypes. P <0.05 indicates a dominant haplotype affecting the growth traits of Xinggao meat sheep.

[0047] This invention performed haplotype analysis on some significant SNP loci. The haplotype analysis results further enhanced the reliability of the association analysis results of this invention. The association analysis results between dominant genotypes and phenotypic traits at some significant SNP loci are shown in Table 3.

[0048] Table 3. Association analysis of genotypes at different gene loci in sheep with body weight.

[0049] Note: Different letters indicate significant differences; the same letter indicates no significant differences.

[0050] Table 4. Construction of different haplotypes of genes

[0051] Note: Different letters indicate significant differences; the same letter indicates no significant differences.

[0052] As shown in Table 4, there was no significant difference in the mean body weight between H1H1 and H1H2. P >0.05), but all were significantly lower than H2H2. P <0.05); This indicates that the CT haplotype, i.e., H2, may influence body weight in a recessive manner, meaning that a homozygous state is required for a significant increase in body weight. Therefore, this invention selects homozygous individuals with a clear genetic background as the high-body-weight group (G group); and homozygous individuals with H1H1 as the low-body-weight group (L group), to exclude the confounding effects of heterozygous genotypes and ensure comparability between the two groups. Although H1H2 also has a low body weight, it is heterozygous, and including it in any homozygous group might interfere with the results; therefore, it was not included in the grouping.

[0053] Therefore, based on haplotype analysis of the significant SNP loci chr24:1460414 and chr24:1460418, individuals with haplotype combination H2H2 (i.e., homozygous CC at locus 414 / homozygous TT at locus 418) and a weight ≥36kg were selected as group G; individuals with haplotype combination H1H1 (i.e., homozygous TT at locus 414 / homozygous CC at locus 418) and a weight ≤29kg were selected as group L, and relevant performance indicators were measured. Subsequently, the slaughter and dissection procedures were carried out in accordance with the "Livestock and Poultry Slaughter Operation Procedures for Sheep" (GB / T 43562-2023), with the reference being "National Technical Committee on Standardization of Slaughtering and Processing (SAC / TC 516). Livestock and Poultry Slaughter Operation Procedures for Sheep: GB / T 43562-2023 [S]. China Standards Press, 2023."; The sampling of the longest dorsal muscle was strictly carried out in accordance with the "Technical Specification for Determination of Meat Sheep Production Performance" (T / CAAA 080—2022) and relevant national regulations, with the reference being "T / CAAA 080—2022 Technical Specification for Determination of Meat Sheep Production Performance [J]. Animal Husbandry Industry, 2023, (04): 27-35." and fixed with 4% paraformaldehyde (by weight / volume fraction) to prepare for subsequent HE staining.

[0054] The specific steps for HE staining are as follows: Tissue was rinsed under running water for 4 hours → dehydrated in gradient concentrations of ethanol → cleared with xylene for 30 minutes → incubated with liquid paraffin at 60°C for 2 hours → dissolved paraffin and embedded in tissue blocks → cooled to form paraffin blocks → sections were cut to 5 μm thickness → sections were developed in warm water → dried at 60°C for 4 hours → sections were sequentially immersed in environmentally friendly dewaxing solution I for 10 minutes, environmentally friendly dewaxing solution II for 10 minutes, environmentally friendly dewaxing solution III for 10 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, and anhydrous ethanol III for 5 minutes. 5 min → Rinse with distilled water for 2 min → Immerse in hematoxylin stain for 5 min → Immerse in a solution containing 1% hydrochloric acid and 75% ethanol for 3 s → Rinse with running water for 20 min → Immerse in distilled water for 2 min → Immerse in eosin stain for 3 min → Immerse in 75% ethanol for 2 min → Immerse in 85% ethanol for 2 min → Immerse in 95% ethanol for 2 min → Immerse in anhydrous ethanol I for 5 min → Immerse in anhydrous ethanol II for 5 min → Immerse in xylene I for 10 min → Immerse in xylene II for 10 min. Scanning and analysis: The muscle tissue sample sections were scanned using a microscope, and the images were analyzed using Image Proplus 6.0 software.

[0055] Slaughter performance is a core evaluation indicator for measuring meat production in sheep, reflecting the level of feeding management and overall economic benefits during the production process. As shown in Table 5, at 10 months of age, the average pre-slaughter weight of group G was 46.75±5.58 kg; the average pre-slaughter weight of group L was 32.38±3.70 kg. The carcass weight of group G was 21.58±2.62 kg; the average carcass weight of group L was 14.19±2.47 kg. The dressing percentage of group G was 46.24±1.23 kg; the dressing percentage of group L was 42.56±2.80 kg. In this invention, the dressing percentage of group G sheep was 46.24%, higher than that of group L sheep (42.56%), indicating that group G sheep had better meat production performance.

[0056] Table 5. Sheep Slaughter Performance

[0057] Note: Data in the same column may have significantly different subscript letters. P <0.05; the same letter indicates no significant difference. P >0.05.

[0058] Methods and results for measuring muscle fibers: For each sample within each group, five muscle fibers from different locations were selected, and all muscle fibers were selected in each image. The diameter of the muscle fibers in each field of view was measured (μm); the cross-sectional area of ​​the muscle fibers was also measured (μm). 2 Muscle fiber density, roots / mm 2 A schematic diagram of the HE staining field of the longissimus dorsi muscle fibers in sheep is shown below. Figure 4 As shown.

[0059] As shown in Table 6, the muscle fiber diameter of sheep in group G was 54.84±7.57 mm, which was significantly larger than that of sheep in group L (43.56±4.6 mm). P <0.05; muscle fiber density showed the opposite trend, with group G sheep at 190.75±8.49, significantly lower than group L sheep at 203.30±12.64. P <0.05; Regarding the cross-sectional area of ​​muscle fibers, the area of ​​group G sheep was 2693.85±772.23, which was significantly greater than that of group L sheep (1718.96±407.6). P <0.05. This indicates a significant correlation between sheep body weight and muscle fiber diameter, density, and cross-sectional area; sheep with larger body weight have thicker muscle fibers, larger cross-sectional areas, and lower muscle fiber density.

[0060] Table 6 Comparative Analysis of Sheep Muscle Fiber Diameter, Density, and Cross-sectional Area

[0061] Note: Data in the same column may have significantly different subscript letters. P <0.05; the same letter indicates no significant difference. P >0.05; " / " indicates that this item is not present.

[0062] In summary, this invention clarifies the significant association between body weight and muscle fiber traits through phenotypic analysis. Combined with genome-wide association analysis (GWAS) to identify significant SNPs associated with body weight, it further confirms a strong correlation between the genotypes of these loci and sheep muscle fiber diameter—individuals carrying the dominant allele not only exhibit superior body weight but also have significantly larger longissimus dorsi muscle fiber diameters. The experimental results of this invention provide direct validation of muscle fiber phenotypic data and demonstrate a high degree of agreement between predicted and actual muscle fiber trait performance. This provides a reliable and practical technical approach and theoretical support for the efficient identification of sheep muscle fiber diameter and the genetic improvement of meat quality and growth performance.

[0063] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0064] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. The application of a haplotype molecular marker related to sheep body weight and muscle fiber diameter, characterized in that, The haplotype molecular markers are 1) and 2): 1) The nucleotide sequence shown in SEQ ID NO.1; the nucleotide at the 101 bp site of SEQ ID NO.1 is T or C; 2) The nucleotide sequence shown in SEQ ID NO.2; the nucleotide at the 101 bp site of SEQ ID NO.2 is C or T; The application refers to any one of the following (1) to (4): (1) Identifying the weight of sheep: When the nucleotide at the 101 bp site of SEQ ID NO.1 is C and the nucleotide at the 101 bp site of SEQ ID NO.2 is T, the sheep has a larger weight; (2) Identification of the diameter of sheep muscle fibers: When the nucleotide at the 101 bp site of SEQ ID NO.1 is T and the nucleotide at the 101 bp site of SEQ ID NO.2 is C, the muscle fiber diameter is smaller; (3) Improve the weight of sheep offspring: Select sheep individuals with nucleotide C at the 101 bp site of SEQ ID NO.1 and nucleotide T at the 101 bp site of SEQ ID NO.2 as parents for selective breeding in order to improve the weight of sheep offspring; (4) Reduce the diameter of muscle fibers in sheep offspring: Select sheep individuals with nucleotide T at the 101 bp site of SEQ ID NO.1 and nucleotide C at the 101 bp site of SEQ ID NO.2 as parents for selective breeding to reduce the diameter of muscle fibers in sheep offspring.

2. The application as described in claim 1, characterized in that, The specific methods for determining the weight of a sheep are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp in SEQ ID NO.1 and SEQ ID NO.2; If the haplotype combination formed by the genotype at position 101bp of SEQ ID NO.1 and the genotype at position 101bp of SEQ ID NO.2 is CCTT, then the sheep has a body weight of 31.06kg to 41.7kg.

3. The application as described in claim 1, characterized in that, The specific method for determining the diameter of sheep muscle fibers is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp in SEQ ID NO.1 and SEQ ID NO.2; If the haplotype combination formed by the genotype at position 101bp of SEQ ID NO.1 and the genotype at position 101bp of SEQ ID NO.2 is TTCC, then the sheep muscle fiber diameter is small; the small muscle fiber diameter refers to a muscle fiber diameter value of 38.96μm~48.16μm.

4. The application as described in claim 1, characterized in that, The specific methods to increase the weight of sheep offspring are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp in SEQ ID NO.1 and SEQ ID NO.2; By selecting sheep individuals whose haplotype combination of the genotypes at 101bp of SEQ ID NO.1 and 101bp of SEQ ID NO.2 forms CCTT as parents for selective breeding, the weight of sheep offspring can be increased.

5. The application as described in claim 1, characterized in that, The specific methods to reduce the diameter of muscle fibers in sheep offspring are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp in SEQ ID NO.1 and SEQ ID NO.2; By selecting sheep individuals whose haplotype combination of the genotypes at 101bp of SEQ ID NO.1 and 101bp of SEQ ID NO.2 forms TTCC as parents for selective breeding, the muscle fiber diameter of sheep offspring can be reduced.

6. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from sheep blood.

7. The application as described in claim 1, characterized in that, The sheep in question are Xinggao meat sheep.

Images