A pullulanase mutant with improved catalytic activity on highly branched dextrin substrates, and methods of construction and use thereof

By performing site-directed mutagenesis on amino acid 139 of pullulanase, D139A and D139E mutants were obtained, which solved the problem of low catalytic efficiency of pullulanase on highly branched dextrin substrates and significantly improved its hydrolytic activity on highly branched dextrin substrates.

CN122278809APending Publication Date: 2026-06-26JIANGNAN UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2026-05-08
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing pullulanases have low catalytic efficiency in highly branched dextrin substrate systems, making it difficult to meet the enzymatic conversion requirements of complex branched polysaccharide systems.

Method used

By site-directed mutagenesis of pullulanase derived from Klebsiella pneumoniae at amino acid position 139, two mutants, D139A and D139E, were obtained, which enhanced their hydrolytic activity against dextrin substrates with high α-1,6 glycosidic bond content.

Benefits of technology

While maintaining high hydrolytic activity for pullulan, mutants D139A and D139E significantly improved catalytic performance on highly branched dextrin substrates, with hydrolytic activities increasing by approximately 25% and 57%, respectively, and by approximately 210% and 242% on highly branched dextrin substrates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122278809A_ABST
    Figure CN122278809A_ABST
Patent Text Reader

Abstract

This invention discloses a pullulanase mutant with enhanced catalytic activity against highly branched dextrin substrates, its construction method, and its applications, belonging to the fields of enzyme engineering and biotechnology. This invention obtains two mutants, D139A and D139E, by site-directed mutagenesis of the pullulanase derived from Klebsiella pneumoniae at position 139 aspartic acid residue. Compared with the wild-type enzyme, both mutants maintain high hydrolytic activity against pullulan polysaccharides while significantly improving hydrolytic activity against dextrin substrates with high α-1,6 glycosidic bond content. Specifically, the hydrolytic activity against dextrin substrates with 6% and 10% α-1,6 bond content is increased by up to 242% and 110%, respectively. The pullulanase mutants obtained in this invention exhibit excellent catalytic performance in the enzymatic debranching reaction of highly branched dextrin substrates, showing promising application prospects in starch deep processing and related biomanufacturing fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering and biotechnology, specifically relating to a technical field of improving the catalytic performance of pullulanase by molecular modification, and particularly to a pullulanase mutant with enhanced catalytic activity on highly branched dextrin substrates, its construction method and application. Background Technology

[0002] This invention relates to a pullulanase mutant with enhanced catalytic activity against highly branched dextrin substrates and its construction method, belonging to the fields of enzyme engineering and biotechnology. Pullulanase, a typical debranched enzyme in the glycoside hydrolase 13 family, can catalyze the hydrolysis of α-1,6 glycosidic bonds in pullulan polysaccharides, starch, and their derivatives, and is one of the key enzyme preparations in modern biomanufacturing industries. These enzymes play an irreplaceable role in processes such as starch sugar production, beer brewing, resistant dextrin preparation, and functional oligosaccharide synthesis. Through synergistic effects with saccharifying enzymes, pullulanase can significantly improve raw material conversion rates and final product yields; its catalytic efficiency directly affects the economic benefits of the entire industrial process.

[0003] From a catalytic mechanism perspective, pullulanase achieves debranching reactions by recognizing and cleaving α-1,6 glycosidic bonds in polysaccharide molecules. Its catalytic efficiency depends not only on the catalytic activity of the enzyme's active site but also on the spatial accessibility of the substrate branching sites and the binding mode of the substrate segments within the enzyme molecule. When the branching density of the polysaccharide molecule increases, the spatial distribution of α-1,6 glycosidic bonds tends to become denser, and a certain degree of spatial entanglement may occur between the branched chains, making the overall substrate conformation more compact. This, to some extent, affects the effective recognition and binding of the enzyme molecule to the branching sites.

[0004] Dextrins are a class of polysaccharides formed from starch through partial hydrolysis or structural rearrangement. Their backbone is primarily composed of α-1,4 glycosidic bonds, with a certain proportion of α-1,6 glycosidic bond branches. When the α-1,6 glycosidic bond content in dextrins is high, these substrates exhibit a high degree of branching, and their three-dimensional structures are typically more compact and complex. Compared to traditional amylopectin, these highly branched dextrins have a denser distribution of branching sites, and local branching structures may even exhibit a degree of nesting or aggregation, thus affecting the recognition efficiency of pullulanase at these branching sites and the debranching reaction rate to some extent.

[0005] Currently, pullulanases used in industrial applications are mainly developed for conventional starch substrates, and their engineering modification research focuses on improving the enzyme's thermal stability, pH stability, or enhancing its hydrolytic activity against pullulan polysaccharides, a model substrate. However, model substrates such as pullulan polysaccharides typically lack the complex branched topology characteristic of highly branched dextrins, making it difficult to fully reflect the actual catalytic requirements of pullulanases in highly branched dextrin substrate systems. Therefore, existing pullulanases often exhibit low debranching efficiency in dextrin substrate systems with high branch density and more complex spatial structures, which to some extent limits their further application in starch deep processing and the preparation of novel functional sugars. Therefore, there is an urgent need in this field to develop a pullulanase mutant that can exhibit higher debranching activity in highly branched dextrin substrate systems to improve the enzymatic conversion efficiency of complex branched polysaccharide systems. Summary of the Invention

[0006] Technical problem solved: To address the issue of low catalytic efficiency of existing pullulanases in highly branched dextrin substrate systems, this invention provides a pullulanase mutant obtained by site-directed mutagenesis of amino acid 139 from pullulanase derived from Klebsiella pneumoniae, along with its construction method and application. This mutant significantly enhances the hydrolytic activity of pullulanase on dextrin substrates with high α-1,6 glycosidic bond content, effectively increasing the enzymatic debranching efficiency of complex branched polysaccharides.

[0007] Technical solution: A pullulanase mutant, wherein the pullulanase with the amino acid sequence shown in SEQ ID NO. 1 is mutated to have the amino acid sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3.

[0008] A gene encoding the pullulanase mutant described above.

[0009] The nucleotide sequences of the above genes are shown in SEQ ID NO.5 or SEQ ID NO.6.

[0010] Recombinant vectors containing the above-mentioned genes.

[0011] A recombinant microbial cell expressing the pullulanase mutant described above, wherein the recombinant microbial cell carries the gene described above or contains the recombinant vector described above.

[0012] The recombinant microbial cells mentioned above are preferably Escherichia coli, Bacillus subtilis, or yeast.

[0013] A method for constructing the pullulanase mutant involves site-directed mutagenesis of the nucleotide sequence shown in SEQ ID NO.4 to obtain a gene encoding the pullulanase mutant, ligating the gene into an expression vector, and then transforming it into a host cell for expression.

[0014] The application of the pullulanase mutant, gene, recombinant vector or recombinant microbial cell in the degradation of highly branched dextrin, wherein the highly branched dextrin is a dextrin with an α-1,6 glycosidic bond content of 6% to 12%.

[0015] Beneficial effects: This invention obtained two mutants, D139A and D139E, by site-directed mutagenesis of pullulanase derived from K. pneumoniae at position 139 aspartic acid. Compared with the wild-type enzyme, these two mutants, while maintaining high hydrolytic activity towards pullulan, exhibit significantly improved catalytic performance towards highly branched dextrin substrates.

[0016] Experimental results showed that the hydrolytic activity of pullulan by mutants D139A and D139E was increased by approximately 25% and 57%, respectively; when dextrin with an α-1,6 glycosidic bond content of 6% was used as a substrate, their hydrolytic activity was increased by approximately 210% and 242%, respectively; and when dextrin with an α-1,6 glycosidic bond content of 10% was used as a substrate, their hydrolytic activity was increased by approximately 74% and 110%, respectively.

[0017] The above results demonstrate that the pullulanase mutant provided by this invention can significantly improve the hydrolytic activity of dextrin substrates with high α-1,6 glycosidic bond content while maintaining the catalytic ability of conventional substrates, thus showing good application potential in the enzymatic debranching reaction of highly branched dextrin substrates. Attached Figure Description

[0018] Figure 1 The optimal reaction temperature for WT, D139A, and D139E.

[0019] Figure 2 The optimal reaction pH is for WT, D139A, and D139E.

[0020] Figure 3 The 1H NMR spectrum of dextrin with 6% α-1,6 bond content is shown.

[0021] Figure 4 The 1H NMR spectrum of dextrin with 9% α-1,6 bond content is shown.

[0022] Figure 5 The 1H NMR spectrum of dextrin with 10% α-1,6 bond content is shown. Detailed Implementation

[0023] The present invention will be further illustrated below with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. After reading this invention, any modifications of the invention in various equivalent forms by those skilled in the art will fall within the scope defined by the appended claims.

[0024] The carrier involved in the following embodiments is pETM-11.

[0025] The culture media involved in the following examples are as follows: (1) LB liquid culture medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L.

[0026] (2) LB solid medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar powder 15 g / L.

[0027] The detection methods involved in the following embodiments are as follows: Pullulanase hydrolysis activity was determined using the DNS method. Each tube contained 1350 μL of substrate (prepared with buffer at optimal pH) and was incubated at the optimal temperature for 10 min. After incubation, 150 μL of pullulanase was added to the experimental group to initiate the reaction. At time points of 0.5, 1, 2, 3, 5, 7, and 10 min, 150 μL of the reaction solution was transferred to 150 μL of pre-allotted DNS reagent. After sampling at all time points, the solution was boiled for 5 min for color development, and the OD was measured. 540 The enzyme solution was replaced with Tris-HCl buffer (20 mM, pH 7.5, containing 250 mM NaCl) to determine the blank control group. A reducing sugar content-time curve was fitted with reaction time (min) on the x-axis and the reducing sugar content (mg / mL) generated in the enzymatic hydrolysis system on the y-axis. The initial hydrolysis rate was determined from the slope, and the enzyme activity was then calculated.

[0028] One unit of enzyme activity (U) is defined as the amount of enzyme required to release 1 μmol of reducing sugar (calculated as glucose) per minute at a given pH and temperature.

[0029] Enzyme activity: defined as the enzyme activity per unit protein, U / mg.

[0030] Example 1: Construction of a recombinant plasmid containing the pullulanase mutant gene (1) Construction of recombinant plasmids containing wild-type pullulanase gene Chemical synthesis originates from Klebsiella pneumoniaeThe wild-type pullulanase gene of NCTC243 was identified and named KpPul. The natural amino acid sequence of this enzyme can be found in the NCBI GenBank database, with accession number STR29919.1. Based on this natural sequence, the nucleotide sequence encoding the N-terminal signal peptide was removed, and the gene was designed and chemically synthesized. Its nucleotide sequence is shown in SEQ ID NO.4. The gene was then ligated to the expression vector pETM-11 after digestion with restriction endonucleases XbaI and EcoRI, respectively, to construct the recombinant expression vector pETM-11-KpPul.

[0031] (2) Obtaining recombinant plasmids containing mutant genes Using the recombinant plasmid pETM-11-KpPul obtained in step (1) as a template, the 139th aspartic acid residue was mutated by the whole plasmid PCR site-directed mutagenesis method to construct D139A and D139E mutants, respectively, and the recombinant plasmids pETM-11-D139A and pETM-11-D139E containing the mutant gene were obtained.

[0032] The designed primer sequences are as follows: D139A-F: GCTTATCGACAGCGCCCTGCGCGTCTCTT; D139A-R: AAGAGACGCGCAGGGCGCTGTCGATAAGC; D139E-F: GCTTATCGACAGCGAGCTGCGCGTCTCTTTC; D139E-R: GAAAGAGACGCGCAGCTCGCTGTCGATAAGC; The PCR amplification program was set as follows: 98℃ pre-denaturation for 5 min, PCR cycle 30 times (98℃ denaturation for 10 s, 62℃ annealing for 20 s, 68℃ extension for 9 min), 72℃ extension for 10 min, and 4℃ incubation.

[0033] The amplified PCR products were digested using Dpn I enzyme at 37°C for 30 min to eliminate the original template. DNA amplification was then checked by agarose gel electrophoresis. Subsequently, the correctly digested products were heat-shocked into E. coli DH5α at 42°C. The transformation buffer was then plated onto LB solid medium containing 50 μg / mL kanamycin sulfate, and plasmids were extracted and sequenced. Sequencing was performed by Genewiz, Suzhou. The correctly validated plasmids were named pETM-11-D139A and pETM-11-D139E, respectively.

[0034] Example 2: Construction of recombinant Escherichia coli producing pullulanase mutant The recombinant plasmids pETM-11-KpPul, pETM-11-D139A, and pETM-11-D139E obtained in Example 1 were further heat-shocked into E. coli BL21 (DE3) to prepare genetically engineered bacteria: E. coli BL21 / pETM-11-KpPul, E. coli BL21 / pETM-11-D139A, and E. coli BL21 / pETM-11-D139E.

[0035] Example 3: Expression, isolation, purification, and determination of purity and concentration of pullulanase mutants (1) Enzyme expression Seed culture: The genetically engineered bacteria constructed in Example 2 were inoculated into 50 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate and cultured at 37℃ and 200 rpm for 8-10 h to obtain seed culture.

[0036] Cell expansion culture: The prepared seed culture was transferred to 400 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate at an inoculation rate of 5% (v / v), and cultured at 37°C and 200 rpm until OD500. 600 It ranges from 0.4 to 0.6.

[0037] Enzyme induction expression: IPTG at a final concentration of 0.4 mM was added to the expanded bacterial culture, and protein expression was induced at 16℃ and 160 rpm for 16-24 h.

[0038] (2) Isolation and purification of enzymes The fermentation broth was centrifuged at 4℃ and 8000×g for 15 min to collect the bacterial cells. The cells were then washed twice with Tris-HCl buffer (20 mM, pH 7.5, containing 250 mM NaCl) under the same centrifugation parameters. The cells were then collected and weighed.

[0039] Collection of crude enzyme solution: Add 10 mL of Tris-HCl buffer (20 mM, pH 7.5, containing 250 mM NaCl) to 1 g of bacterial sludge, and repeatedly pipette to evenly disperse the cells. Then, treat the resuspended cells with an ultrasonic homogenizer under ice bath conditions for 20 min, centrifuge for 40 min (8000×g, 4℃), and the resulting supernatant is the crude enzyme solution. Subsequently, further filter the crude enzyme using a 0.22 μm filter to remove bacteria.

[0040] Enzyme purification: Nickel affinity chromatography was used. The steps included: packing the chromatography column with nickel-containing packing material, washing and equilibrating sequentially with deionized water and 20 mM Tris-HCl buffer (pH 7.5) containing 250 mM NaCl; loading the crude enzyme solution and cycling the sample once to ensure sufficient binding of the target protein; washing with the above buffer to remove unbound contaminants; gradient elution with buffers containing 20, 50, 100, 300, and 500 mM imidazole, and collecting the target protein in the elution fraction; after purification, cleaning and storing the chromatography column sequentially with buffer, deionized water, and 20% ethanol.

[0041] (3) Determination of enzyme purity and concentration Enzyme purity identification: The purified enzyme solutions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoresis results showed that when the imidazole concentration was 50 mM, all three proteins reached electrophoretic purity (clear single bands could be observed), and the bands were all near the theoretical molecular weight of 119 kDa, proving that wild-type pullulanase and both mutants were expressed.

[0042] Enzyme concentration determination: The absorbance of the electrophoretically pure enzyme protein elution buffer at 280 nm was measured using a Nanodrop spectrophotometer. The instrument initially provided a concentration estimate using the default conversion factor (1 Abs = 1 mg / mL). To obtain an accurate concentration, the theoretical mass extinction coefficient A1 mg / mL 280 nm (280 nm, 1 mg / mL, 1 cm) was calculated based on the amino acid sequence of the target enzyme using the NovoPro online tool, as shown in Table 1. The initial estimate was corrected based on this coefficient to obtain the final protein concentration (mg / mL).

[0043] Table 1 Extinction coefficients of different pullulanase theoretical mass

[0044] Example 4: Determination of the enzymatic properties of pullulanase mutants (1) Optimal temperature A 1% (w / v, 10 mg / mL) pullulan solution was prepared using 20 mM (pH 6.0) phosphate buffer (w / v is weight-volume concentration; 1% (w / v) means 1 g of solute per 100 mL of solution). Enzyme activity was measured at 40, 45, 50, 55, 60, 65, and 70 °C. The highest activity was defined as 100%. Results are as follows... Figure 1 As shown, the optimal temperature for the wild type is 60℃, while the optimal temperature for both mutants is 55℃.

[0045] (2) Optimal pH 1% (w / v, 10 mg / mL) pullulan was prepared using 20 mM buffers at different pH values, specifically: acetate-sodium acetate buffer (pH 4.5–5.5), sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (pH 6.0–8.0), and glycine-sodium hydroxide buffer (pH 8.5–10.5). Enzyme activity was measured at different pH conditions under their respective optimal temperatures. The highest activity was defined as 100%. Results are as follows: Figure 2 As shown, the optimal pH for D139E is consistent with the wild type, at 6.0. The optimal pH for D139A is slightly different from the wild type, at 5.5.

[0046] (3) Determination of catalytic performance on different substrates The substrate specificity of pullulanase (wild type, D139A and D139E) was determined using pullulan (0.3% w / v, 3 mg / mL) and three dextrins with α-1,6 glycosidic bond contents of 6%, 9% and 10%, respectively.

[0047] The α-1,6 glycosidic bond content in the three types of dextrins was determined by... 1 H nuclear magnetic resonance spectrum ( 1 The spectral data were determined by ¹H NMR and are shown below. Figure 3 , Figure 4 and Figure 5 As shown in the figure. The signal peak at a relative chemical shift of 5.42 ppm corresponds to an α-1,4 glycosidic bond, and the signal peak at a relative chemical shift of 4.98 ppm corresponds to an α-1,6 glycosidic bond. In the spectral analysis, the peak area corresponding to the α-1,4 glycosidic bond was normalized to 1, and the relative content of the α-1,6 glycosidic bond was calculated using the following formula:

[0048] in, and These are the peak areas of the normalized α-1,4 and α-1,6 glycosidic bonds, respectively. The α-1,6 glycosidic bond contents in the three dextrins were calculated to be 6%, 9%, and 10%, respectively, using the method described above.

[0049] Enzymatic reactions were performed using the substrates, and the hydrolytic activity of different pullulanases on each substrate was measured to evaluate the substrate specificity of the mutants.

[0050] The results are shown in Table 2. Compared with wild-type pullulanase, mutants D139A and D139E showed increased hydrolytic activity on a variety of substrates.

[0051] Table 2. Specificity of different pullulanase substrates

[0052] Specifically, when pullulan was used as a substrate, the hydrolytic activities of D139A and D139E increased by approximately 25% and 57%, respectively; when dextrin with 6% α-1,6 glycosidic bond content was used as a substrate, the hydrolytic activities increased by approximately 210% and 242%, respectively; when dextrin with 9% α-1,6 glycosidic bond content was used as a substrate, the hydrolytic activities increased by approximately 2% and 32%, respectively; and when dextrin with 10% α-1,6 glycosidic bond content was used as a substrate, the hydrolytic activities increased by approximately 74% and 110%, respectively.

[0053] The above results indicate that mutating the aspartic acid residue at position 139 of pullulanase to alanine or glutamic acid (D139A, D139E) can improve the enzyme's hydrolytic activity on dextrin substrates with high α-1,6 glycosidic bond content, thereby enhancing its catalytic performance on highly branched dextrin substrates.

[0054] The above examples are merely illustrative of the technical concept and features of this invention, intended to enable those skilled in the art to understand the content of this invention and implement it accordingly, and should not be construed as limiting the scope of protection of this invention. All equivalent transformations or modifications made in accordance with the spirit and essence of this invention should be included within the scope of protection of this invention.

Claims

1. A pullulanase mutant, characterized in that, The mutant has the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.

3.

2. A gene encoding the pullulanase mutant of claim 1.

3. The gene according to claim 2, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.5 or SEQ ID NO.

6.

4. A recombinant vector, characterized in that, The vector contains the gene as described in claim 2 or 3.

5. A recombinant microbial cell expressing the pullulanase mutant of claim 1, characterized in that, The recombinant microbial cell carries the gene described in claim 2 or 3, or contains the recombinant vector described in claim 4.

6. The recombinant microbial cell according to claim 5, characterized in that, The microorganisms mentioned are Escherichia coli, Bacillus subtilis, or yeast.

7. A method for constructing the pullulanase mutant of claim 1, characterized in that, Site-directed mutagenesis was performed on the nucleotide sequence shown in SEQ ID NO.4 to obtain the gene encoding the pullulanase mutant of claim 1. The gene was then ligated into an expression vector and transformed into a host cell for expression.

8. The application of the pullulanase mutant of claim 1, the gene of claim 2 or 3, the recombinant vector of claim 4, and the recombinant microbial cell of claim 5 or 6 in the degradation of highly branched dextrin, characterized in that, The highly branched dextrin is a dextrin with an α-1,6 glycosidic bond content of 6% to 12%.