Promoters and their use
By designing a recombinant promoter with a length of 200bp, the problem of AAV vector capacity limitation was solved, enabling efficient and specific expression of exogenous genes in PR cells, thus improving the efficacy and safety of gene therapy for retinal diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2026-06-30
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biopharmaceuticals, and more particularly to promoters and their applications. Background Technology
[0002] As the first station in the visual pathway, photoreceptor cells primarily function to perform photochemical signal conversion; that is, they are responsible for receiving light signals, converting them into chemical signals, and transmitting them to downstream cells. Finally, the visual system processes these signals to present a complete visual world. Photoreceptor cells are mainly divided into two categories: rod cells and cone cells. There are approximately 120 million rod cells and approximately 6.8 million cone cells, with the former being nearly 20 times more numerous than the latter.
[0003] Rod cells can be well excited in low light and have good detection performance in low light, but they easily become saturated and stop working in strong light. Cone cells, on the other hand, have fewer inner membrane discs and are less likely to reach their response threshold in low light environments with less light signal. Therefore, they often do not work in low light and only start working when the light intensity reaches a certain level. Thus, the cells responsible for light perception in the eye are different in low light and strong light environments. If rod cells are not developed normally, resulting in fewer than normal numbers, or if there is a deficiency of vitamin A and an inability to synthesize rhodopsin normally, dark adaptation will be reduced, and the amplitude of ERG a waves will decrease, making it difficult for people to see objects in the dark. Generally speaking, cone cells are not fully developed at birth, and their number increases with age until around two or three years of age, after which their number will not increase further.
[0004] Several hereditary ophthalmic diseases have been reported, many of which are related to mutations in different genes associated with retinal pathology. When these genes cannot be expressed correctly, progressive cell death occurs, leading to blindness. Therefore, gene therapy, which involves introducing exogenous normal genes into target cells to correct or compensate for diseases caused by gene defects and abnormalities, is a promising treatment approach.
[0005] Specific promoters are those that restrict gene expression to specific tissues and cells, avoiding the waste caused by the non-specific and continuous expression of exogenous genes promoted by broad-spectrum promoters in experimental animals, and enhancing the expression effect of exogenous genes. For gene therapy, the use of specific promoters in conjunction with tissue-specific, tropism-dependent AAV serotypes can further improve treatment specificity, avoid impacts on other organs, and reduce side effects.
[0006] AAV has attracted much attention due to its safety profile, but its very small vector capacity often exceeds its limits when carrying large functional proteins, such as Cas9, leading to problems such as a significant drop in viral titer or truncation of the genome sequence. Therefore, obtaining promoters that are shorter in length but retain the ability to express downstream genes in specific tissues or cell types can solve this problem to some extent, ensuring the specific expression of the target gene while keeping the vector length within the AAV genome's capacity limit. Summary of the Invention
[0007] In view of this, the present invention provides a promoter and its applications. The recombinant promoter provided by the present invention is only about 200 bp in length, which is suitable for the need to express large exogenous genes in AAV vectors and has a wide range of applications. At the same time, the recombinant promoter provided by the present invention has very high expression intensity in PR cells and is also applicable in some scenarios where the expression level of the target gene is required to be high.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0009] This invention provides a nucleic acid molecule selected from any one of (a) to (d) below:
[0010] (a) Having any of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:4;
[0011] (b) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (a);
[0012] (c) A nucleotide sequence in which one or more bases are missing, substituted, or added in the nucleotide sequence shown in (a) or (b);
[0013] (d) Nucleotide sequences that are partially or completely complementary to the nucleotide sequences shown in (a), (b) or (c).
[0014] This invention also provides the application of nucleic acid molecules as promoters.
[0015] In one embodiment, the sequence of SEQ ID NO:1 is: GGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCCTCCGCTCGCCCTGTCTGCCCTTGTCCAGGATTACGCTAATGACCCACCCACAGAAGTCACATAGCCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA (PRA9 promoter (219bp)).
[0016] In one embodiment, the sequence of SEQ ID NO:2 is: TGGGTCATTAGCGTAATCCTGGACAAGGGCAGACAGGGCGAGCGGAGGGCCAGCTCCGGGGCTCAGGCAAGGCTGGGGGCTTCCCCCCCCACAGAAGTCACATAGCCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA (PRA9V1 promoter (219bp)).
[0017] In one embodiment, the sequence of SEQ ID NO:3 is: GGGGGCTTAACCCAGCCTTGCCTGAGCCCGGTCGCTGGCCCTGATCGCCCTGTCTGCCCTTGTCCAGGATTACGCTAATGACCCATGGGACCCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTTGACAATCCGATTA (PRA9V2 promoter (202bp)).
[0018] In one approach, SEQ ID The sequence of NO:4 is: GGGGGAAGCCCCCAGCCTTGCCTGAGCCCCGGAGCTGGCCCTCCGCTCGCCCTGTCTGCCCTTGTCCAGGATTACGCTAATGACCCACCCACAGAAGTCACATAGCTAATCGGA TTCCAAGCAGCTCAGGGGATTGTCTTTTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTGGTGCTGTGTCAGCCCCGG (PRA9V3 promoter (219 bp)).
[0019] In one approach, SEQ ID The sequence of NO:5 is: TAGAAAAAGACAATCCCCTGAGCTGCTTGAGGGCTAACAGAAGATCAAGTCCCATTTTAGCCTCCCTAGCTCTGGCCTACCTCCTCAGTTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCCCTGGCTCATCTCTCAGGATGCCTATCTTGTCCTTAGCACGATGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGGCTAGAAAAAGACAATCCCCGCCTGGCCCGGATCACTTATCCGTTGCCTTTGTGTATTTGGAGGCTGGGAGGCCAGCTGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGATGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA (comparative promoter (373 bp)).
[0020] In one embodiment, the nucleic acid molecule is selected from any one of the following (e) to (h):
[0021] (e) Has the nucleotide sequence shown in SEQ ID NO:1;
[0022] (f) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (e), or a sequence identity of at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%;
[0023] (g) A nucleotide sequence in which one or more bases are missing, substituted, or added in the nucleotide sequence shown in (e) or (f);
[0024] (h) nucleotide sequences complementary to the nucleotide sequences shown in (e), (f) or (g).
[0025] In one approach, a "promoter" contains a nucleotide sequence that directs the transcription of a structural gene, such as a structurally linked gene, to a transcription start site. Typically, promoters are located in the 5' untranslated region or 5' untranslated region (5'UTR) of a gene, near the transcription start site of the structural gene. Sequence elements within a promoter that functions to initiate transcription are typically characterized by shared nucleotide sequences. These sequence elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements, cyclic adenosine monophosphate (cAMP) response elements, serum response elements, and glucocorticoid response elements.
[0026] The present invention also provides an expression cassette comprising the above-described nucleic acid molecule.
[0027] The present invention also provides an expression vector comprising: the above-described nucleic acid molecule and / or the above-described expression cassette.
[0028] In one embodiment, the nucleic acid molecule in the expression vector is linked upstream of the target substance.
[0029] The present invention also provides a transformant for transforming and / or transfecting the above expression vector.
[0030] In one embodiment, the aforementioned transformant includes: a virus.
[0031] The present invention also provides the use of the above-mentioned nucleic acid molecules, expression cassettes, expression vectors and / or transformants in the preparation of products that specifically express retinal structures.
[0032] The present invention also provides the use of the above-mentioned nucleic acid molecules, expression cassettes, expression vectors and / or transformants in the preparation of products for the treatment and / or prevention of retinal diseases.
[0033] The present invention also provides products comprising: the above-described nucleic acid molecule, the above-described expression cassette, the above-described expression vector, and / or the above-described transformant.
[0034] The recombinant promoter provided by this invention is about 200 bp in length, which is suitable for expressing large exogenous genes in AAV vectors and has a wide range of applications. At the same time, the recombinant promoter provided by this invention has very high expression intensity in PR cells and is also applicable in some scenarios where the expression level of the target gene is required to be high. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0036] Figure 1 This diagram shows an expression vector framework used for viral packaging. The upstream inserted promoter sequence can drive the expression of the nuclear red fluorescent protein (NLS-mCherry) gene in the cell.
[0037] Figure 2 The images show slices of cells expressing red fluorescent protein driven by the PRA9 promoter and comparative promoters. From left to right: the first image was taken at 40x magnification and 1000ms exposure time, used to observe red fluorescence expression individually; the second image is a composite of two images obtained after cell expression fluorescence and immunofluorescence staining (exposure times for each channel have been adjusted); the third image is a composite of three images obtained after cell expression fluorescence, immunofluorescence staining, and DAPI staining (exposure times for each channel have been adjusted).
[0038] Figure 3 The bar chart shows the semi-quantitative results of red fluorescence brightness obtained by photographing slices at 40x magnification and 1000ms exposure time, demonstrating the brightness difference between the PRA9 promoter and the comparative promoter under the same conditions.
[0039] Figure 4 The images show slices of cells expressing red fluorescent protein driven by random variant promoters PRA9V1, PRA9V2, and PRA9V3 obtained by mutation and deletion based on the PRA9 promoter. From left to right, the first image is taken at 100x magnification and 500ms exposure time, used to observe red fluorescence expression individually. The second image is a composite image of two images taken after cell expression of red fluorescence and after DAPI staining (the exposure time for each channel has been adjusted). Detailed Implementation
[0040] This invention discloses promoters and their applications.
[0041] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0042] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0043] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0044] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0045] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.
[0046] In Examples 1 and 2 of this invention, the raw materials and reagents used can all be purchased from the market.
[0047] The present invention will be further illustrated below with reference to the embodiments:
[0048] Example 1: Expression vector construction and promoter activity verification
[0049] The PRA9 promoter sequence was obtained through artificial recombination, based on the VB900129-0788gfe vector (internal construction, see https: / / en.vectorbuilder.com / vector / VB900129-0788gfe.html). Figure 1 As shown in SEQ ID NO:5, the CAG promoter was replaced with PRA9 and a comparative promoter respectively using conventional enzyme digestion and ligation methods to construct an expression vector with PRA9 and a comparative promoter (as shown in SEQ ID NO:5) upstream and the nuclear red fluorescent protein (NLS-mCherry) gene downstream. The vector framework is shown in [image missing]. Figure 1 As shown.
[0050] Following conventional virus packaging methods, the expression vectors containing PRA9 and comparative promoters were mixed with the other two helper vector plasmids for AAV packaging (carrying Rep / Capsid genes and E2 / E4 / VA genes, respectively) and transfected into 293T cells for virus packaging. After harvesting the virus, it was purified with cesium chloride to finally obtain virus particles (AAV8 type) for in vivo animal validation experiments.
[0051] Mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Provincial Medical Laboratory Animal Center) were injected subretinally with a viral dose of 1E+10GC / eye. Two weeks after injection, tissue samples were collected for sectioning and immunofluorescence staining. The primary antibody used in the immunofluorescence process was rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number AB15282), which specifically binds to the surface protein of cone cells in the photoreceptor (PR) layer, thereby labeling the photoreceptor layer containing cone cells. The secondary antibody used was goat anti-rabbit IgG with green fluorescence (purchased from Thermofisher, catalog number A-11008). Simultaneously, DAPI was used to stain the nuclei of cells in each layer, resulting in a blue image.
[0052] The slices were photographed to obtain expression slice images of PRA9 and the comparative promoter, as shown below. Figure 2 As shown;
[0053] Slice Image Results Explanation: This section displays images taken at 40x magnification and a 1000ms exposure time. Each result consists of three images from left to right. The first image on the left is a slide taken at a 1000ms exposure time, primarily used for observing red fluorescence expression alone. The second image is a composite of two images obtained after cell expression fluorescence and immunofluorescence staining (exposure times for each channel have been adjusted). The third image is a composite of three images obtained after cell expression fluorescence, immunofluorescence staining, and DAPI staining (exposure times for each channel have been adjusted).
[0054] Based on the above promoter sectioning results, after viral injection, the recombinant promoter PRA9 only expressed red fluorescence in the photoreceptor cell layer under the mouse retina, and no fluorescence expression was observed in other cell layers, showing its high expression specificity.
[0055] ImageJ software was used to perform semi-quantitative analysis on the brightness of the two sets of slices, and the resulting charts are shown below. Figure 3 As shown;
[0056] Figure 3 The brightness trend of red fluorescent protein expressed by the PRA9 promoter was consistent with the corresponding section results. The expression intensity of the PRA9 promoter was significantly better than that of the comparative promoter, and both exhibited very strong PR cell expression specificity. Overall, the PRA9 promoter showed stronger expression activity than the earlier comparative promoter, and its expression specificity was high, making it a superior recombinant promoter.
[0057] Example 2: Functional variants of the PRA9 promoter
[0058] After confirming the expression specificity of the PRA9 promoter, random mutations and deletions / replacements were performed on the PRA9 promoter to construct PRA9 promoter variant sequences PRA9V1, PRA9V2, and PRA9V3 for experiments. The sequence identity between each pair of PRA9 and its variants is shown in Table 1.
[0059] Table 1
[0060]
[0061] Following the method in Example 1, expression vectors were constructed with upstream variant promoters PRA9V1, PRA9V2, and PRA9V3, and downstream expression vectors for the nuclear red fluorescent protein (NLS-mCherry) gene. Viral packaging and purification were performed, and promoter activity was verified in mice. Finally, expression slices of the promoters were obtained, as shown below. Figure 4 As shown.
[0062] Slice image results description: The images shown are taken at 100x magnification and 500ms exposure time. Each result consists of two images from left to right. The first image on the left is the slice taken at the annotated exposure time (500ms), mainly used to observe red fluorescence expression alone; the second image is a combined image of the two images taken after cell expression of red fluorescence and DAPI staining (the exposure time for each channel has been adjusted).
[0063] As can be seen from the slice results, the variant promoters with certain homology can all maintain their expression in photoreceptor cells. Although the expression-driving ability of some variants is slightly weaker than that of the pre-mutation promoter, they all retain their basic expression specificity and expression ability.
[0064] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A nucleic acid molecule, characterized in that, The nucleic acid molecule is selected from any one of the following (a) to (d): (a) Having any of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:4; (b) A nucleotide sequence that has at least 70% identity with the nucleotide sequence shown in (a); (c) A nucleotide sequence in which one or more bases are missing, substituted, or added in the nucleotide sequence shown in (a) or (b); (d) Nucleotide sequences that are partially or completely complementary to the nucleotide sequences shown in (a), (b) or (c).
2. The application of the nucleic acid molecule as described in claim 1 as a promoter.
3. Expression cassette, characterized in that, include: The nucleic acid molecule as described in claim 1.
4. An expression carrier, characterized in that, include: The nucleic acid molecule as described in claim 1 and / or the expression cassette as described in claim 3.
5. The expression vector as described in claim 4, characterized in that, The nucleic acid molecule is linked upstream of the target substance.
6. A transformant, characterized in that, Transformation and / or transfection with the expression vector as described in claim 4 or 5.
7. The transformant as described in claim 6, characterized in that, The transformed organism includes: a virus.
8. The use of the nucleic acid molecule of claim 1, the expression cassette of claim 3, the expression vector of claim 4 or 5, and / or the transformant of claim 6 or 7 in the preparation of products that specifically express retinal structures.
9. The use of the nucleic acid molecule of claim 1, the expression cassette of claim 3, the expression vector of claim 4 or 5, and / or the transformant of claim 6 or 7 in the preparation of products for the treatment and / or prevention of retinal diseases.
10. The product, characterized in that, include: The nucleic acid molecule as described in claim 1, the expression cassette as described in claim 3, the expression vector as described in claim 4 or 5, and / or the transformant as described in claim 6 or 7.