Lipase mutants and uses thereof

Abstract

The application provides a lipase mutant and application thereof, the lipase mutant of the application is that the 81th amino acid of the lipase with the amino acid sequence of SEQ ID NO:2 is changed from serine to leucine and / or the 164th amino acid is changed from valine to glutamic acid.The application realizes comprehensive optimization of enzyme catalytic conformation and reaction intermediate stability through a selected mutation strategy, so that a lipase mutant with significantly improved catalytic performance in the alpha-pinene epoxidation reaction is obtained.Compared with the wild-type lipase, the lipase mutant of the application can significantly improve the conversion rate of the alpha-pinene epoxidation reaction, and provides a high-quality enzyme source for efficient epoxidation of alpha-pinene.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering technology, specifically relating to a lipase mutant and its applications. Background Technology

[0002] α-Epoxypinene is an important intermediate in fragrances, pharmaceuticals, and pesticides. Currently, its industrial production mainly relies on traditional chemical synthesis methods, which generally suffer from low yields, poor selectivity, harsh reaction conditions (often requiring strong acid catalysts and high temperature and pressure), and the generation of large amounts of saline wastewater, which contradicts the concept of environmentally friendly green chemistry.

[0003] Biocatalysis, particularly lipase-based chemoenzymatic epoxidation, is considered a highly promising alternative route due to its advantages such as mild conditions, high selectivity, and environmental friendliness. Its core reaction mechanism involves lipase-catalyzed reaction of carboxylic acid with hydrogen peroxide to generate peroxycarboxylic acid, which then reacts with α-pinene to yield the target product, α-epoxypinene. The carboxylic acid can be generated by the hydrolysis of carboxylic acid esters catalyzed by lipase.

[0004] In existing technologies, the enzymatic epoxidation of α-pinene mainly relies on substances derived from... Candida antarctica CALB (calcium lipase B) was used as a catalyst. Although CALB exhibited some basic catalytic activity for the reaction, its inherently low peroxidation activity resulted in a slow reaction rate and limited α-pinene conversion, making it difficult to meet the dual requirements of efficiency and economy for industrial production.

[0005] Enzyme molecule modification is a core approach to overcoming the aforementioned performance bottlenecks. Through techniques such as site-directed mutagenesis, the spatial structure of enzymes can be rationally adjusted, optimizing the binding between the active site and the substrate, thereby improving catalytic efficiency. However, in the complex reaction system of α-pinene chemo-enzymatic epoxidation, mutations at different sites have significantly different effects on enzyme peroxidation performance, and the structure-activity relationship is complex. To advance the industrialization of green processes for α-pinene epoxidation, it is necessary to develop more lipase mutants with higher intrinsic activity, stronger stability, and better conversion efficiency in the α-pinene epoxidation reaction.

[0006] Furthermore, free enzyme catalysts suffer from problems such as difficulty in recovery, poor reusability, and low operational stability. These issues not only increase the cost of enzyme use but also create difficulties for product separation and process continuity, severely limiting the application prospects of this green process in large-scale production. Therefore, it is necessary to further develop efficient immobilization methods that match high-performance mutants. By constructing stable and recyclable immobilized enzyme preparations, efficient catalyst reuse and substantial reduction in process costs can be achieved, thereby systematically improving the overall economic feasibility and industrialization potential of the technology. Summary of the Invention

[0007] This invention aims to provide a source Candida antarctica A mutant of lipase (CALB) and its application: This lipase mutant exhibits excellent peroxidation catalytic performance in the chemo-enzymatic epoxidation reaction of α-pinene, and can efficiently drive the in-situ generation of peroxycarboxylic acid and the conversion cycle of peroxycarboxylic acid and α-pinene, significantly improving the conversion rate of α-pinene epoxidation reaction.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a lipase mutant, wherein the lipase mutant is a lipase with the amino acid sequence SEQ ID NO: 2 in which the 81st amino acid is changed from serine to leucine and / or the 164th amino acid is changed from valine to glutamic acid.

[0009] A second aspect of the present invention provides a nucleic acid molecule encoding the above-mentioned lipase mutant.

[0010] A third aspect of the present invention provides a recombinant expression vector comprising the above-mentioned nucleic acid molecules.

[0011] In some embodiments, the recombinant expression vector is obtained by cloning a nucleic acid molecule encoding the aforementioned lipase mutant into various expression vectors using methods conventional in the art. The expression vectors include various vectors conventional in the art, meaning that the backbone of the recombinant expression vector includes, but is not limited to, plasmids, bacteriophages, or viral vectors.

[0012] In some specific and preferred embodiments, the vector is the plasmid pPIC9K.

[0013] Further, the DNA fragments of the artificially synthesized CALB or its mutant gene are ligated between EcoRI and NotI on plasmid pPIC9K to obtain the recombinant expression vector.

[0014] A fourth aspect of the present invention provides a recombinant host cell comprising the above-described recombinant expression vector.

[0015] In some embodiments, the host cell is a conventional host cell in the art, as long as the recombinant expression vector can stably replicate itself and the gene of the lipase mutant it carries can be effectively expressed. It can be selected from prokaryotic cells or eukaryotic cells.

[0016] In some specific and preferred embodiments, the host cell is preferably Pichia pastoris, and more preferably Pichia pastoris. Pichia pastoris GS115.

[0017] The recombinant host cell of the present invention can be obtained by transforming the recombinant expression vector into a host cell using conventional methods in the art.

[0018] The fifth aspect of the present invention provides a lipase catalyst, the active ingredient of which is the above-mentioned lipase mutant.

[0019] In some embodiments, the lipase catalyst is a lyophilized enzyme powder.

[0020] In some preferred embodiments, the lipase catalyst is an immobilized lipase.

[0021] Specifically, the immobilized lipase comprises an immobilization carrier, which is a polymer resin.

[0022] In some specific embodiments, the polymeric resin is a macroporous adsorption resin containing epoxy groups.

[0023] In some specific embodiments, the polymer resin includes, but is not limited to, LX-1040, LX-1000HA, LX-1000EP, LX-Ep120, EMC7528, EMC7530, LKZ128, LKZ158, EP818, and D101, wherein LX-Ep120 resin is the most preferred polymer resin.

[0024] The sixth aspect of the present invention provides a method for preparing the lipase catalyst as described above, comprising: fermenting and culturing the recombinant host cell as described above, collecting the fermentation broth, and obtaining a crude enzyme solution containing the lipase mutant by solid-liquid separation.

[0025] In some specific embodiments, the culture medium used for fermentation is any culture medium in the art that can enable recombinant host cells to grow and produce the recombinant lipase described in this invention. There are no particular limitations on the culture method and conditions; appropriate selections can be made according to conventional knowledge in the art, based on factors such as host cell type and culture method, as long as the recombinant host cells can grow and produce the recombinant lipase. Recombinant lipase can be obtained through induced expression; the specific operations for recombinant host cell culture can be performed according to conventional procedures in the art.

[0026] In some specific embodiments, the preparation method further includes: freeze-drying the crude enzyme solution to obtain freeze-dried enzyme powder.

[0027] In some specific embodiments, the preparation method further includes: mixing the crude enzyme solution with activated polymer resin to carry out an immobilization reaction, removing free lipase mutants, and freeze-drying to obtain immobilized lipase. The immobilized lipase of the present invention exhibits superior performance compared to free enzymes in terms of heat resistance, operational stability, and storage stability.

[0028] In some embodiments, the activation treatment includes first soaking the polymer resin in anhydrous ethanol until the polymer resin is fully swollen, then rinsing with distilled water to remove the anhydrous ethanol, and then soaking in PB buffer and filtering.

[0029] Further, the pH value of the PB buffer is 7-10, and the concentration is 25-100 mM. More preferably, the pH value of the PB buffer is 8-9, and the concentration is 40-60 mM.

[0030] Furthermore, the amounts of anhydrous ethanol and PB buffer are each independently at least twice the volume of the polymer resin.

[0031] Furthermore, the soaking time using the anhydrous ethanol and the PB buffer is independently 5-12 h, more preferably 5-9 h.

[0032] In some embodiments, the feed ratio of the crude enzyme solution to the polymer resin is 1 mL : 0.1~1 g, more preferably 1 mL : 0.2~0.8 g, and particularly preferably 1 mL : 0.3~0.5 g.

[0033] In some embodiments, the temperature of the immobilization reaction is 20~45 °C, more preferably 25~35 °C, and particularly preferably 28~32 °C.

[0034] In some embodiments, the immobilization reaction takes 2 to 10 hours, more preferably 4 to 8 hours, and especially preferably 5 to 7 hours.

[0035] The seventh aspect of the present invention provides the use of the lipase mutant or the lipase catalyst described above in the catalytic epoxidation reaction of pinene.

[0036] The eighth aspect of the present invention provides a method for preparing α-epoxypinene, wherein α-pinene, carboxylic acid, and hydrogen peroxide are reacted in a reaction solvent and in the presence of a lipase mutant or a lipase catalyst as described above, wherein the lipase mutant or the lipase catalyst catalyzes the reaction of the carboxylic acid with hydrogen peroxide to generate peroxycarboxylic acid, and the peroxycarboxylic acid then reacts with the α-pinene to obtain the α-epoxypinene.

[0037] In some embodiments, the carboxylic acid is selected from C2-C18 straight-chain or branched aliphatic carboxylic acids.

[0038] Specifically, the carboxylic acid is selected from acetic acid, propionic acid, butyric acid, valeric acid, hexanoic acid, heptanoic acid, caprylic acid, decanoic acid, lauric acid, myristic acid, palmitic acid, or stearic acid.

[0039] A ninth aspect of this invention provides a method for preparing α-epoxypinene, comprising reacting α-pinene, a carboxylic acid ester, and hydrogen peroxide in a reaction solvent and in the presence of a lipase mutant or a lipase catalyst as described above; wherein the lipase mutant or the lipase catalyst catalyzes the hydrolysis of the carboxylic acid ester to generate a carboxylic acid, and catalyzes the reaction of the carboxylic acid with hydrogen peroxide to generate peroxycarboxylic acid, which then reacts with α-pinene to obtain the α-epoxypinene. Excessive acidity may cause ring-opening of the epoxypinene; therefore, a carboxylic acid ester is preferred.

[0040] In some embodiments, the carboxylic acid ester is an ester formed from acetic acid and a C1-C16 alcohol.

[0041] In some specific and preferred embodiments, the carboxylic acid ester is ethyl acetate, and the corresponding reaction mechanism is as follows:

[0042] Lipase first catalyzes the decomposition of ethyl acetate. The product, acetic acid, undergoes a peroxidation reaction with hydrogen peroxide under the catalysis of lipase. The resulting peracetic acid then undergoes an epoxidation reaction with α-pinene to obtain the target product, α-epoxypinene.

[0043] In some specific embodiments, the reaction solvent is selected from methanol, ethanol, propanol, isopropanol, butanol, tert-butanol, pentanol, or hexanol, with tert-butanol being particularly preferred.

[0044] In some specific embodiments, the reaction temperature is 20~60 ℃, more preferably 30~60 ℃, and even more preferably 45~55 ℃.

[0045] In some specific embodiments, the concentration of peroxycarboxylic acid or carboxylic acid ester in the reaction system is 1~4 mol / L, the concentration of hydrogen peroxide is 0.3~0.6 mol / L, and the concentration of α-pinene is 0.1~0.5 mol / L.

[0046] More preferably, in the reaction system, the concentration of peroxycarboxylic acid or carboxylic acid ester is 2.5~3.5 mol / L, the concentration of hydrogen peroxide is 0.4~0.6 mol / L, and the concentration of α-pinene is 0.3~0.4 mol / L.

[0047] In some specific embodiments, after the reaction is completed, the immobilized lipase can be recovered by solid-liquid separation and used for the next batch of reaction.

[0048] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art: This invention achieves comprehensive optimization of enzyme catalytic conformation and reaction intermediate stability through a selected mutation strategy, thereby obtaining a lipase mutant with significantly improved catalytic performance in the α-pinene epoxidation reaction. Compared with wild-type lipase, the lipase mutant of this invention can significantly improve the conversion rate of the α-pinene epoxidation reaction, providing a high-quality enzyme source for the efficient epoxidation of α-pinene.

[0049] Based on the lipase mutant of this invention, catalyst products suitable for the α-pinene epoxidation reaction have been further developed, including lyophilized enzyme powder and its immobilized form. The immobilized lipase, by firmly loading the lipase mutant onto a polymer resin support, achieves convenient catalyst recovery and efficient reuse, with significantly better operational stability and reusability than the free enzyme form. This immobilized catalyst maintains high activity in multiple consecutive batches of reactions, greatly improving process economy. Furthermore, its preparation process is simple, the materials used are readily available on a large scale, and the overall route meets the requirements of green chemistry and sustainable development, demonstrating promising prospects for industrial application. Attached Figure Description

[0050] Figure 1 SDS-PAGE profiles of the CALB mutant (S81L) of Example 1, the CALB mutant (V164E) of Example 2, and the CALB mutant (S81L / V164E) of Example 3 compared with wild-type CALB. Figure 2 The graph shows a comparison of the conversion rates of the CALB mutant (S81L) of Example 1, the CALB mutant (V164E) of Example 2, and the CALB mutant (S81L / V164E) of Example 3 with wild-type CALB in the 2 h and 4 h catalytic α-pinene epoxidation reaction. Figure 3 The graph shows a comparison of the conversion rates of immobilized lipase and Novozym 435 in the catalytic epoxidation of α-pinene for 2 h in a 4 mL reaction system with different enzyme dosages. Figure 4 The graph shows a comparison of the conversion rates of 2 g immobilized lipase and Novozym 435 in the catalytic epoxidation of α-pinene in a 200 mL reaction system after 2 h and 4 h. Figure 5 The graph shows the conversion rate change after 10 consecutive reactions using 2 g of immobilized lipase (LX-Ep120-S81L / V164E) in a 200 mL reaction system. Detailed Implementation

[0051] To improve the efficiency of the chemo-enzymatic epoxidation reaction of α-pinene and reduce industrialization costs, this invention takes a global perspective, optimizing the synergistic effect of the "one-pot" cascade reaction system of the α-pinene epoxidation reaction, focusing on the spatial regulatory role of α-pinene in the active site of lipases. The study found that in the reaction system, α-pinene competes with the actual enzymatic substrate (carboxylic acid ester / carboxylic acid and H₂O₂) for binding to the hydrophobic active site. Its binding mode directly regulates the formation efficiency of the key intermediate—peroxycarboxylic acid—thus profoundly affecting the final conversion rate of the epoxidation reaction.

[0052] Based on the above mechanism, the present invention is derived from Candida antarctica Using CALB (a lipase) as the parent enzyme, molecular docking technology was first used to precisely determine the binding site and orientation of α-pinene within its catalytic cavity. Then, targeting this binding region, without affecting the conserved catalytic residues, the side chain size, hydrophobicity, and charge properties of key amino acid residues were rationally designed to systematically adjust the substrate binding microenvironment. Finally, through a selected mutagenesis strategy, comprehensive optimization of the enzyme's catalytic conformation and the stability of reaction intermediates was achieved, resulting in a lipase mutant with significantly enhanced catalytic performance in the α-pinene epoxidation reaction, and a significant increase in the conversion rate of the α-pinene epoxidation reaction.

[0053] Specifically, the lipase mutant of the present invention is the lipase with the amino acid sequence SEQ ID NO: 2, in which the 81st amino acid is changed from serine to leucine and / or the 164th amino acid is changed from valine to glutamic acid. By reshaping the binding pocket of CALB through mutations of S81L and / or V164E, the α-pinene is directed to a more suitable position. This not only does not hinder the binding and conversion of carboxylic esters / carboxylic acids with H2O2 at the catalytic center, but also promotes the immediate reaction of the in-situ generated peroxyacid with α-pinene. This significantly reduces the risk of enzyme inactivation and side reactions caused by peroxyacid accumulation while increasing the overall epoxidation rate.

[0054] This invention further addresses the key bottlenecks of free enzymes, such as difficulty in recovery, poor operational stability, and high operating costs. Using the aforementioned high-performance lipase mutant as the core, a highly efficient immobilization process was developed to match it. Preferably, a mild covalent coupling between the epoxy resin carrier and the enzyme molecules is utilized, achieving stable immobilization and convenient recovery of the mutant enzyme. The prepared immobilized enzyme retains high catalytic activity while exhibiting excellent operational stability and reusability, significantly reducing enzyme consumption and production costs per batch of reaction.

[0055] The technical solutions and effects of this application are further illustrated below with reference to specific embodiments and comparative examples. The embodiments and comparative examples provided below are for illustrative purposes only and are not intended to limit the invention unless otherwise stated. Therefore, the invention should not be considered limited to the following embodiments, but should be understood to include any and all obvious variations as a result of the teachings provided herein.

[0056] It should be understood that modifications that do not materially affect the activity of various embodiments of the present invention may also be covered within the definition of the invention provided herein. Therefore, the following examples are intended to illustrate the invention but not to limit it.

[0057] Unless otherwise specified, all materials and reagents used in the embodiments and comparative examples in this application are commercially available products. Experimental methods without specific conditions were performed under standard conditions or in accordance with the manufacturer's instructions.

[0058] The recombinant plasmid pPIC9K contains the nucleic acid sequence shown in SEQ ID NO: 1 of the sequence listing, and was constructed by Shanghai Qingke Biotechnology Co., Ltd.

[0059] Pichia pastoris GS115 competent cells ( Pichia pastoris GS115 competent cells (self-prepared).

[0060] MD solid medium: glucose, 20 g / L; agar, 20 g / L; water balance. Sterilize at 121 ℃ for 20 min. After the temperature drops below 65 ℃, add 100 mL / L of 13.4 g / L 10×YNB (sterilized by filtration) and 1 mL / L of 4×10 -4 500× Biotin (filtered and sterilized) g / L.

[0061] BMGY medium: yeast extract, 10 g / L; dipotassium hydrogen phosphate (K₂HPO₄), 3 g / L; potassium dihydrogen phosphate (KH₂PO₄), 11.8 g / L; peptone, 20 g / L; balance water. Sterilize at 121 °C for 20 min. After the temperature drops below 60 °C, add 100 mL / L of 13.4 g / L 10×YNB (sterilized by filtration); 1 mL / L of 4×10 -4 Add 500× biotin (sterilized by filtration) at g / L and 10 mL / L 10% (v / v) glycerol (sterilized).

[0062] BMMY medium (g / L): yeast extract, 10; dipotassium hydrogen phosphate (K₂HPO₄), 3; potassium dihydrogen phosphate (KH₂PO₄), 11.8; peptone, 20; after the temperature drops below 60 ℃, add 100 mL of 13.4 g / L 10×YNB (sterilized by filtration); 1 mL of 4×10 -4 Add 500× biotin (sterilized by filtration) at g / L and 10 mL of 10% (v / v) methanol (sterilized).

[0063] Conversion rate was determined using gas chromatography. An HP-I (Agilent) capillary column was used, with both the injection chamber and detector temperatures set at 220 °C and a split ratio of 10:1. The temperature program was as follows: hold at 60 °C for 1 min, then increase to 220 °C at 10 °C / min, and hold for 5 min. The substrate α-pinene and the product α-epoxypinene were identified by comparison with standards. The concentrations of each component before and after the reaction were calculated using area normalization with correction factors.

[0064] Conversion rate = (1 - [α-pinene]) 反应后 / [α-pinene] 反应前 ) × 100%; Yield = ([α-epoxypinene] / [α-pinene]) 反应前 ) × 100%; Selectivity = (Yield / Conversion Rate) × 100% Among them, [α-pinene] 反应前 and [α-pinene] 反应后 The values ​​represent the corrected relative contents of α-pinene in the mixture before and after the reaction, respectively, while [α-epoxypinene] represents the corrected relative contents of α-epoxypinene in the mixture after the reaction.

[0065] LX-1040, LX-1000HA, LX-1000HA, LX-Ep120, EMC7528, EMC7530, and EP818 were all purchased from Xi'an Lanxiao New Materials Technology Co., Ltd.; LKZ128 and LKZ158 were both purchased from Aimeikejian (China) Biopharmaceutical Co., Ltd.; and D101 was purchased from Shanghai Maclean Biochemical Technology Co., Ltd.

[0066] Comparative Example 1: This comparative example provides the synthesis and expression of wild-type lipase CLAB, as detailed below: Regarding the NCBI report on Candida antarctica ( Candida antarcticaThe lipase CLAB gene (GenBank: Z30645.1) was obtained from Pichia pastoris. Based on the expression characteristics of CLAB lipase and the codon preference of Pichia pastoris, the gene was optimized and synthesized by Beijing Qingke Biotechnology Co., Ltd., and then ligated into the pPIC9K vector to obtain the recombinant plasmid pPIC9K-CALB. After linearization with Sac I, the recombinant plasmid pPIC9K-CALB was introduced into Pichia pastoris by electroporation. Pichia pastoris From strain GS115, positive transformants were screened using MD plates to obtain an expression strain of wild-type lipase CLAB (amino acid sequence as shown in SEQ ID NO: 2).

[0067] The obtained wild-type lipase CLAB expression strain was inoculated into a test tube containing 5 mL of BMGY medium and cultured overnight in a shaker at 28 ℃ and 220 rpm. The culture was then transferred to an Erlenmeyer flask containing 50 mL of BMGY medium and cultured at 28 ℃ and 220 rpm until the OD600 reached 2.0. The flask was then centrifuged at 4 ℃ and 3000 rpm for 20 min, and the bacterial cells were collected and resuspended in BMMY medium. The resuspended cells were inoculated into a 1 L Erlenmeyer flask with a baffle (containing 400 mL of BMMY medium) until the OD600 reached 1.0. The flask was cultured at 28 ℃, and samples were taken every 24 h to detect changes in enzyme activity. After each sampling, 0.5% (v / v) methanol was added, and the culture was continued at 28 ℃ until the bacterial culture was collected after 7 days in BMMY medium.

[0068] Example 1: This example provides the synthesis and expression of the lipase CLAB mutant (S81L), as detailed below: The CLAB lipase mutant in this embodiment is formed by mutating serine at position 81 of the amino acid sequence of the wild-type CLAB lipase in Comparative Example 1 to leucine (S81L). Primers were designed for the mutation site: S81L-F: ACTGGATTCCATTGTTAACCCAATTAGGTTAC (SEQ ID NO: 3); S81L-R: GTAACCTAATTGGGTTAACAATGGAATCCAGT (SEQ ID NO: 4).

[0069] Using the Sac I linearized recombinant plasmid pPIC9K-CALB from Comparative Example 1 as a template, the linearized recombinant plasmid pPIC9K-CALB S81L containing the mutation site was obtained by PCR amplification using primers designed for the mutation site. The linearized recombinant plasmid pPIC9K-CALB S81L was introduced into Escherichia coli and circularized. After screening, the recombinant plasmid pPIC9K-CALB S81L containing the correct mutation site was obtained. Following the method in Comparative Example 1, the recombinant plasmid pPIC9K-CALB S81L was linearized with Sac I and then introduced into Pichia pastoris by electroporation. Pichia pastoris In strain GS115, positive transformants were screened using MD plates to obtain an expression strain of the mutant lipase CLAB S81L. The expression strain of mutant lipase CLAB S81L was cultured according to the culture method of the expression strain of wild-type lipase in Comparative Example 1, and the bacterial culture was collected.

[0070] Example 2: This example provides the synthesis and expression of the lipase CLAB mutant (V164E), as detailed below: The CLAB lipase mutant in this embodiment is formed by replacing valine at position 164 of the amino acid sequence of the wild-type CLAB lipase in Comparative Example 1 with glutamic acid (V164E). Primers were designed for the mutation site: V164E-F: GCACCAGATTATAAAGGTACTGAACTGGCTGGACCTTTGGATGCT (SEQ ID NO: 5); V164E-R: AGCATCCAAAGGTCCAGCCAGTTCAGTACCTTTATAATCTGGTGC (SEQ ID NO: 6).

[0071] Using the Sac I linearized recombinant plasmid pPIC9K-CALB from Comparative Example 1 as a template, the linearized recombinant plasmid pPIC9K-CALB V164E containing the mutation site was obtained by PCR amplification using primers designed for the mutation site. The linearized recombinant plasmid pPIC9K-CALB V164E was then introduced into *E. coli* and circularized. Recombinant plasmids containing the correct mutation site were screened for. Following the method in Comparative Example 1, the recombinant plasmid pPIC9K-CALB V164E was linearized with Sac I and then introduced into *Pichia pastoris* via electroporation. Pichia pastoris In strain GS115, positive transformants were screened using MD plates to obtain an expression strain of the mutant lipase CLAB V164E. The expression strain of mutant lipase CLAB V164E was cultured according to the culture method of the expression strain of wild-type lipase in Comparative Example 1, and the bacterial culture was collected.

[0072] Example 3: This example provides the synthesis and expression of the lipase CLAB mutant (S81L / V164E), as detailed below: The CLAB lipase mutant in this embodiment is formed by mutating serine at position 81 of the amino acid sequence of the wild-type CLAB lipase in Comparative Example 1 to leucine (S81L), and replacing valine at position 164 with glutamic acid (V164E). This embodiment employs a step-by-step sequential mutagenesis method, that is, further performing a V164E point mutation based on Example 1, as detailed below: Using the Sac I linearized recombinant plasmid pPIC9K-CALB S81L from Example 1 as a template, the linearized recombinant plasmid pPIC9K-CALB S81L / V164E containing the mutation site was obtained by PCR amplification using primers designed for the mutation site (SEQ ID NO: 5 and SEQ ID NO: 6). The linearized recombinant plasmid pPIC9K-CALB S81L / V164E was introduced into Escherichia coli and circularized. After screening, the recombinant plasmid pPIC9K-CALB S81L / V164E containing the correct mutation site was obtained. Following the method of Comparative Example 1, the recombinant plasmid pPIC9K-CALB S81L / V164E was linearized with Sac I and then introduced into Pichia pastoris by electroporation. Pichia pastoris In strain GS115, positive transformants were screened using MD plates to obtain an expression strain of the mutant lipase CLAB S81L / V164E. The expression strain of mutant lipase CLAB V164E was cultured according to the culture method of the expression strain of wild-type lipase in Comparative Example 1, and the bacterial culture was collected.

[0073] Protein expression in Comparative Example 1 and Examples 1 to 3 was detected by SDS-PAGE gel electrophoresis. The results are shown in the figure. Figure 1 The lipase protein is 33.8 kDa in size. Figure 1 It can be seen that under the same expression conditions, the expression level of the lipase CLAB mutant S81L / V164E is the highest.

[0074] Detection of peroxidation performance of lipase and its mutants: The bacterial cultures collected in Comparative Example 1 and Examples 1 to 3 were centrifuged and filtered to obtain crude enzyme supernatants. The fermentation supernatants were freeze-dried to prepare enzyme powder. 0.1 g of the freeze-dried enzyme powder was added to the α-pinene epoxidation reaction system (4 mL). The reaction temperature was set at 20-60 °C (optimal: 50 °C), and the reaction time was 2 h and 4 h. The α-pinene epoxidation reaction system consisted of: 1-4 mol / L ethyl acetate (optimal: 3 mol / L), 0.3-0.6 mol / L hydrogen peroxide (optimal: 0.5 mol / L), 0.3 mol / L α-pinene concentration, and solvents such as methanol, ethanol, propanol, isopropanol, butanol, tert-butanol, pentanol, or hexanol (optimal: tert-butanol).

[0075] Analysis was performed using gas chromatography. The capillary column was an HP-I (Agilent), and both the injection chamber and detector temperatures were 220 °C with a split ratio of 10:1. The temperature program was 60 °C held for 1 min, then increased to 220 °C at 10 °C per minute, and held for 5 min. The product was identified by comparison with standards.

[0076] Under the optimal α-pinene epoxidation reaction system and optimal reaction conditions described above, after 2 h of reaction, the conversion rate of α-pinene epoxidation using wild-type lipase CLAB was 38%, the yield of epoxide pinane was 36%, and the selectivity was 94.7%; the conversion rate of α-pinene epoxidation using lipase CLAB mutant S81L was 46%, the yield of epoxide pinane was 45%, and the selectivity was 97.8%; the conversion rate of α-pinene epoxidation using lipase CLAB mutant V164E was 50%, the yield of epoxide pinane was 48%, and the selectivity was 96%; the conversion rate of α-pinene epoxidation using lipase CLAB mutant S81L / V164E was 60.8%, the yield of epoxide pinane was 59.6%, and the selectivity was 98%. After 4 h of reaction, the conversion rate of α-pinene epoxidation using lipase CLAB mutant S81L / V164E reached 98%. Figure 2 The yield of epoxide pinane was 96%, and the selectivity was 98%.

[0077] Application Example 1: Preparation of immobilized lipase and its catalysis of α-pinene epoxidation to synthesize α-epoxypinene, as detailed below: Ten selected resins (LX-1040, LX-1000HA, LX-1000EP, LX-Ep120, EMC7528, EMC7530, LKZ128, LKZ158, EP818, and D101) were activated. The activation process involved soaking the resins in twice the volume of anhydrous ethanol for 8 hours, stirring occasionally to ensure complete swelling. The resins were then continuously washed with distilled water until the effluent remained clear after dilution in a test tube or showed no obvious ethanol odor. Next, the resins were soaked in at least twice the volume of PB buffer (pH 7.0-10.0, 25-100 mM, optimal: pH 8.5, 50 mM) for 6 hours, followed by filtration. The resins were then sealed, protected from light, and stored in a cool, dark place.

[0078] After immobilization, the activated resin was weighed and subjected to immobilization reactions with the supernatant crude enzyme solution of the CLAB lipase bacterial culture and the supernatant crude enzyme solution of the CLAB mutant lipase bacterial culture prepared above. The resin was then washed 2-4 times with PB buffer (pH 7.0-10.0, 25-100 mM, optimal: pH 8.5, 50 mM) to remove unimmobilized free enzyme. The immobilized lipase was then lyophilized. The immobilization reaction system consisted of 10-40 g (optimal: 20 g) of activated resin and 50 mL of supernatant crude enzyme solution. The immobilization reaction conditions were: temperature 20-40 ℃ (optimal: 30 ℃), and immobilization time 2-10 h (optimal: 6 h).

[0079] Performance testing of immobilized lipases: Immobilized lipases were added to the α-pinene epoxidation reaction system (4 mL) at different dosages (0.01~0.1 g). After reacting for 2 h, the α-pinene conversion rate was measured. The optimal α-pinene epoxidation reaction system described above was used, and the reaction conditions were as described above. Experiments showed that the operational stability of each immobilized lipase was significantly better than that of the free enzyme, and it effectively catalyzed the α-pinene epoxidation reaction. The resins were ranked from highest to lowest activity as follows: LX-Ep120, EMC7528, LKZ158, EMC7530, EP818, D101, LX-1040, LKZ128, LX-1000EP, and LX-1000HA. When using LX-Ep120 resin as a carrier, the conversion rate of immobilized lipase LX-Ep120-S81L / V164E (prepared from LX-Ep120 resin and the CLAB mutant S81L / V164E bacterial culture of Example 3 according to the above-mentioned optimal immobilization and adsorption reaction system and optimal immobilization and adsorption reaction conditions) reached 90% when the amount was 0.04 g, and was close to 100% when the amount was 0.06 g. Under the same reaction conditions, the conversion rate of the immobilized lipase LX-Ep120-S81L / V164E of the present invention was significantly higher than that of the commercial immobilized enzyme Novozym 435 (Novozymes) and the immobilized lipase LX-Ep120-CALB (prepared from LX-Ep120 resin and the CALB bacterial culture of Comparative Example 1 according to the above-mentioned optimal immobilization and adsorption reaction system and optimal immobilization and adsorption reaction conditions) at the same amount, as detailed in [see details]. Figure 3 Furthermore, compared to the commercially available immobilized enzyme Novozym 435 (Novozymes), the immobilized lipase of this invention has a significant cost advantage.

[0080] 2 g of immobilized lipase was added to the α-pinene epoxidation reaction system (200 mL). The conversion rate was measured after 2 h and 4 h. The α-pinene epoxidation reaction system used was the optimal α-pinene epoxidation reaction system described above, and the reaction conditions were as described above. The results showed that when LX-Ep120 resin was used as the carrier, the conversion rate of immobilized lipase LX-Ep120-S81L / V164E could still reach over 90% after 2 h, with an epoxide pinane yield of 88.7% and a selectivity of 98.5%; after 4 h, the conversion rate could reach over 98%. Figure 4 The yield of epoxide pinane reached 96.3%, and the selectivity reached 98.3%.

[0081] 2 g of immobilized lipase LX-Ep120-S81L / V164E was added to the α-pinene epoxidation reaction system (200 mL), and the reaction was carried out for 4 h each time. After the reaction, the immobilized lipase was recovered, washed, and then used for the next batch of reaction. This process was repeated 10 times, and the conversion rate of each batch was measured. The α-pinene epoxidation reaction system used was the same as described above, and the reaction conditions were as described above as optimal. The results showed that after 10 consecutive cycles, the α-pinene conversion rate was still close to 100%. Figure 5 The yield of epoxide pinane still reached 98%, and the selectivity reached 98%.

[0082] As can be seen from the above examples and comparative examples, the lipase mutants (S81L, V164E, S81L / V164E) obtained in this invention exhibit significantly enhanced peroxidation catalytic activity in the α-pinene epoxidation reaction, resulting in a significant increase in the conversion rate of the α-pinene epoxidation reaction compared to the wild-type lipase. In particular, the S81L / V164E mutant catalyzes a conversion rate of over 60% higher in the α-pinene epoxidation reaction compared to the wild-type enzyme, achieving a leap in reaction efficiency and providing a high-performance enzyme catalyst for the efficient bio-epoxidation of α-pinene.

[0083] This invention further develops an immobilized enzyme based on the aforementioned lipase mutant, preferably using a synthetic resin rich in epoxy groups as the immobilization carrier. This carrier can achieve mild covalent bonding with amino and carboxyl functional groups on the enzyme molecule surface under room temperature conditions, making the process simple and the bonding strong. The resulting immobilized enzyme has high mechanical strength, is resistant to microbial and chemical corrosion, and can well adapt to complex industrial operating environments. The most preferred immobilization carrier is LX-Ep120 resin, a widely available and economical industrial product. The prepared immobilized lipase LX-Ep120-S81L / V164E achieves a conversion rate of over 90% with only 10 mg / mL enzyme reaction time for 2 hours. Compared to Novozym 435, a commercial immobilized enzyme from Novozymes, this method reduces enzyme dosage while achieving superior conversion results, demonstrating a significant cost advantage. Furthermore, it exhibits good stability, maintaining a conversion rate of over 90% even after 10 consecutive applications, allowing for reuse and reducing enzyme usage costs.

[0084] Furthermore, the lipase mutant of this invention is heterologously expressed using conventional yeast or bacterial expression systems (such as BMM medium induced by methanol), a mature process that is easy to scale up. The lipase catalyst preparation route is simple and controllable, meeting the requirements of green chemistry and sustainable production.

[0085] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A lipase mutant, characterized in that, The lipase mutant is the lipase with the amino acid sequence SEQ ID NO: 2, in which the 81st amino acid is changed from serine to leucine and / or the 164th amino acid is changed from valine to glutamic acid.

2. A nucleic acid molecule encoding the lipase mutant of claim 1.

3. A recombinant expression vector comprising the nucleic acid molecule of claim 2.

4. A recombinant host cell comprising the recombinant expression vector of claim 3.

5. A lipase catalyst, characterized in that, Its active ingredient is the lipase mutant described in claim 1.

6. The lipase catalyst according to claim 5, characterized in that, The lipase catalyst is a pure enzyme, crude enzyme solution, lyophilized enzyme powder, or immobilized lipase. The immobilized lipase contains an immobilization carrier, which is a polymeric resin, preferably a macroporous adsorption resin containing epoxy groups.

7. The method for preparing the lipase catalyst according to claim 6, characterized in that, It includes: The recombinant host cell as described in claim 4 is fermented and cultured. The fermentation broth is collected and separated into solid and liquid components to obtain a crude enzyme solution containing the lipase mutant. The crude enzyme solution can be selectively freeze-dried to obtain freeze-dried enzyme powder, or the crude enzyme solution can be mixed with activated polymer resin for immobilization reaction to remove the free lipase mutant and freeze-dried to obtain immobilized lipase.

8. The lipase catalyst according to claim 7, characterized in that, The feeding ratio of the crude enzyme solution to the polymer resin is 1 mL : 0.1~1 g; And / or, the temperature of the immobilization reaction is 20~45 °C; And / or, the immobilization reaction takes 2 to 10 hours.

9. The use of the lipase mutant as described in claim 1 or the lipase catalyst as described in claim 5 or 6 in the catalytic epoxidation reaction of pinene.

10. A method for preparing α-epoxypinene, characterized in that, α-Pinene, carboxylic acid, and hydrogen peroxide are reacted in a reaction solvent and in the presence of the lipase mutant of claim 1 or the lipase catalyst of claim 5 or 6. The lipase mutant or the lipase catalyst catalyzes the reaction of the carboxylic acid with hydrogen peroxide to generate peroxycarboxylic acid, which then reacts with the α-pinene to obtain the α-epoxypinene.

11. The method for preparing α-epoxypinene according to claim 10, characterized in that, The carboxylic acid is selected from C2-C18 straight-chain or branched aliphatic carboxylic acids.

12. A method for preparing α-epoxypinene, characterized in that, α-Pinene, a carboxylic acid ester, and hydrogen peroxide are reacted in a reaction solvent and in the presence of the lipase mutant of claim 1 or the lipase catalyst of claim 5 or 6; the lipase mutant or the lipase catalyst catalyzes the hydrolysis of the carboxylic acid ester to generate a carboxylic acid, and catalyzes the reaction of the carboxylic acid with hydrogen peroxide to generate peroxycarboxylic acid, which then reacts with α-pinene to obtain the α-epoxypinene.

13. The method for preparing α-epoxypinene according to claim 12, characterized in that, The carboxylic acid ester is an ester formed from acetic acid and a C1-C16 alcohol.

14. The method for preparing α-epoxypinene according to claim 10 or claim 12, characterized in that, The reaction solvent is selected from methanol, ethanol, propanol, isopropanol, butanol, tert-butanol, pentanol, or hexanol; And / or, the temperature of the reaction is 20~60 °C; And / or, after the reaction is complete, the immobilized lipase can be recovered by solid-liquid separation and used in the next batch of reaction.

Images