Compositions and methods for treating conditions associated with overexpression of UBE3A

Abstract

This application provides antisense nucleic acid compounds that reduce the levels of certain nutrients in neurons of the central nervous system. UBE3A This application also provides compositions comprising antisense nucleic acid compounds and their application in the prevention or treatment of overdose in subjects. UBE3A Use in methods related to mRNA and / or UBE3A peptide levels.

Description

[0001] Cross-references to related applications This application claims the benefit and priority of U.S. Provisional Application No. 63 / 609,567, filed December 13, 2023, the entire disclosure of which is hereby incorporated herein by reference for all purposes.

[0002] References to sequence lists This application contains a sequence list that has been electronically submitted in XML format. The sequence list XML is incorporated herein by reference. The XML file, created on October 25, 2024, is named UXN 150-01WO_SL and has a size of 3,671,742 bytes.

[0003] The technical field of this disclosure This disclosure relates to methods for inhibiting ubiquitin protein ligase E3A in neurons. UBE3A The expression of antisense nucleic acid compounds and compositions comprising them are used for the treatment of... UBE3A It is used in conditions associated with overexpression, such as chromosome 15q11.2-q13.3 duplication syndrome (Dup15q syndrome). Background of the Invention The ubiquitin ligase E3A (UBE3A) polyubiquitinates cytoplasmic and nuclear proteins, targeting them for degradation by the proteasome. This protein is expressed in many cell types, including neurons, where it is highly localized at axon terminals, but it is also present in the nucleus and mitochondria. In neurons, UBE3A is thought to locally regulate individual synapses through its activity at axon terminals and globally regulate neuronal physiology through its chromatin-modulating activity in the nucleus. UBE3A may participate in the epigenetic regulation of neuronal imprinted genes through its regulation of DNA methylation and chromatin modeling. (See Lopez, Simon Jesse, David J. Segal, and Janine M. LaSalle. "UBE3A: AnE3 ubiquitin ligase with genome-wide impact in neurodevelopmental disease." Frontiers in Molecular Neuroscience 11 (2019): 476).

[0005] ubiquitin protein ligase E3A ( UBE3AThe gene is located at the human 15q11.2-q13.3 locus, a unique and highly regulated genetic locus imprinted on neurons by the parents. Specifically, the maternal allele is selectively methylated, while the paternal allele is unmethylated and expressed in neurons. Meanwhile, the paternal allele... UBE3A Alleles are transmitted via UBE3A antisense transcripts ( UBE3A-ATS UBE3A expression is silenced in neurons. This unique regulation leads to three distinct human neurodevelopmental disorders arising from mutations at the 15q11.2-q13.3 locus: loss of UBE3A expression due to paternal allele silencing, resulting in Angelman syndrome (AS) due to maternal allele deletion; Prad-Willi syndrome (PWS) due to paternal allele deletion; and chromosomal 15q11.2-q13.3 duplication syndrome (Dup15q syndrome) due to maternal allele duplication. (Lopez et al., 2019; see also Copping, Nycole A. et al. "Neuronal overexpression of Ube3a isoform 2 causes behavioral impairments and neuroanatomical pathology relevant to 15q11.2-q13.3 duplication syndrome." Human Molecular Genetics 26.20 (2017): 3995-4010).

[0006] Symptoms of Dup15q syndrome are highly diverse in patients, but typically include hypotonia, speech / language disorders, developmental delay, behavioral challenges, and abnormal EEG. Patients may also present with characteristic facial features, slowed growth, autism, sensory processing disorders, seizures, and hyperpigmentation. Patients with Dup15q syndrome usually have one of the two forms of genetic disruption that cause the syndrome: maternal interstitial duplication and maternal isocentric dicentric duplication (“idic(15)”). Idic(15) patients are tetraploid for the 15q11.2–q13 region (two extra copies of this region, with three maternal copies and one paternal copy), while maternal interstitial duplication patients are triploid for this region (one extra copy, with two maternal copies and one paternal copy). (See Kalsner, Louisa, and Stormy J. Chamberlain. "Prader-Willi, Angelman, and 15q11-q13 duplication syndromes." Pediatric Clinics 62.3(2015): 587-606).

[0007] Various estimates exist, but Dup15q syndrome is believed to affect 1 in 5,000 to 1 in 20,000 individuals, yet no disease-modifying therapies exist. Others have described antisense oligonucleotides targeting human UBE3A (see U.S. Patent Application Publication No. US / 2022 / 0259601A1 and Elamin, Marwa et al. "The role of UBE3A in theautism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons." Stem Cell Reports 18.4 (2023): 884-898); however, no effective ASOs for treating Dup15q syndrome have been identified. Therefore, a high unmet need remains for treatments for Dup15q syndrome and other conditions caused by overexpression or activity of UBE3A. This disclosure provides antisense oligonucleotides targeting human UBE3A. UBE3A Nucleic acids (including) UBE3A (genomic regions and transcripts) and reduce human neurons UBE3A Novel nucleic acid molecules are expressed to address this need. Summary of the Invention

[0008] This disclosure provides information that can be used to inhibit or reduce neuronal activity. UBE3A Compositions expressing novel nucleic acid molecules. This disclosure also provides for the use of these compositions for the prevention or treatment of CNS neurons in subjects. UBE3A Methods for overexpressing relevant conditions. More specifically, embodiments of this disclosure provide targeted methods for humans. UBE3A Antisense nucleic acid compounds (i.e., "antisense compounds") and their use in the treatment of Dup15q syndrome.

[0009] In one aspect, this document provides antisense oligonucleotides (ASOs) comprising at least 16 consecutive nucleotides and having a nucleotide sequence selected from SEQ ID NO:285 to SEQ ID NO:562. An ASO may comprise one or more of the following: a) a gap segment consisting of linked deoxynucleosides; b) a 5' segment consisting of at least two linked nucleotides; c) a 3' segment consisting of at least two linked nucleotides; d) at least one phosphate thioester nucleoside bond; e) at least one nucleoside containing a modified sugar; and f) at least one nucleoside containing a modified nucleobase.

[0010] The nick in ASO can be located between the 5' and 3' regions. The nick can contain 5 to 15 linked nucleosides.

[0011] The 3' region of ASO can contain 2-5 linked nucleosides.

[0012] The 5' region of ASO can contain 2-5 linked nucleosides.

[0013] In some embodiments, at least one nucleotide of the 5' segment and at least one nucleotide of the 3' segment of the ASO may contain a modified sugar. In some embodiments, each nucleotide of the 5' segment and each nucleotide of the 3' segment contains a modified sugar.

[0014] ASO-modified sugars may include bicyclic sugars. Bicyclic sugars may be selected from the following groups: 2′-O(CH2)2OCH3 (MOE); 4′-(CH2)—O-2′ (LNA); 4′-(CH2)2—O-2′ (ENA); and 4′-CH(CH3)—O-2′ (cEt).

[0015] In some implementations, each nucleoside bond of ASO is a thiophosphate nucleoside bond.

[0016] In some implementations, a 5-methylcytosine nucleobase is used to replace a non-5-methylcytosine residue in the ASO.

[0017] ASO can contain a 3-10-3 LNA-DNA-LNA gapmer, in which all nucleoside inter-bonds are phosphate thioside inter-bonds.

[0018] ASO can contain a 3-11-3 LNA-DNA-LNA gapmer, in which all nucleoside inter-bonds are phosphate thioside inter-bonds.

[0019] ASO can contain a 3-12-3 LNA-DNA-LNA gapmer, in which all nucleoside inter-bonds are phosphate thioside inter-bonds.

[0020] ASO can contain a 4-11-5 MOE-DNA-MOE gapmer, in which all nucleoside inter-bonds are phosphate thioside inter-bonds.

[0021] ASO may contain nucleotide sequences according to SEQ ID NO: 295, 307, 309, 310, 327, 328, 329, 330, 340, 341, 342, 343, 351, 356, 359, 366, 394, 402, 523, 527, 528, 529, 539, 542, 549, 550, 551 or 553.

[0022] In some implementations, the ASO is based on compound ID numbers 16-63326LNA, 17-29823LNA, 17-29855LNA, 17-29858LNA, 17-63264LNA, 17-63289LNA, 17-63290LNA, 17-63291LNA, 17-63324LNA, 17-63325LNA, 17-63326LNA, 17-63327LNA, 17-63458LNA, 17-6 Gapmers for 7260LNA, 18-435LNA, 18-29854LNA, 18-63323LNA, 18-63458LNA, 17-63278LNA, 17-63286LNA, 17-63287LNA, 17-63288LNA, 17-63437LNA, 17-29853LNA, 18-63282LNA, 18-63285LNA, 18-63286LNA, or 18-63325LNA.

[0023] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:550.

[0024] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:542.

[0025] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:394.

[0026] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' segment of three linked locked nucleic acid (LNA) nucleotides, a nick segment of a linked deoxynucleoside, and a 3' segment of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:328.

[0027] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:342.

[0028] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:356.

[0029] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:295.

[0030] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' segment of three linked locked nucleic acid (LNA) nucleotides, a nick segment of a linked deoxynucleotide, and a 3' segment of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:351.

[0031] This article also provides an antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:307.

[0032] In some implementations, all cytosine nucleosides of ASO are replaced with 5-methylcytosine nucleosides.

[0033] In some implementations, ASO contains a 2'OMe-modified nucleoside at position 2 in the DNA gap.

[0034] This article also provides compositions comprising ASO or a salt thereof and a pharmaceutically acceptable carrier.

[0035] The composition may be a pharmaceutical preparation.

[0036] It also provides a way to reduce the number of cells UBE3ARNA-level methods ， This includes contacting cells with the ASO composition, thereby reducing the cell's... UBE3A RNA levels.

[0037] Methods for inhibiting the expression of UBE3A protein in cells are also provided, including contacting cells with ASO or a composition to reduce the expression of UBE3A protein in cells.

[0038] In some implementations, the cells are neurons of the central nervous system.

[0039] In some implementation schemes, cells for UBE3A The gene is triploid or tetraploid.

[0040] Cells may contain UBE3A Maternal duplication of alleles.

[0041] The methods described herein can be applied to cells in vitro. In some embodiments, the cells can be in a subject.

[0042] The subjects can be human, and the ASO or the composition can be administered to the subjects.

[0043] In some implementations, ASO is administered to subjects via intravenous, subcutaneous, intramuscular, intraperitoneal, intrathecal, intracerebrospinal, intracisternal, or intraventricular injection.

[0044] It also provides treatment, prevention, or improvement for neurons in the central nervous system of the subject. UBE3A Methods for treating, preventing, or improving the disease associated with overexpression of ASO, including administering the ASO or a combination thereof described herein to a subject. The disease may be Dup15q syndrome. In some cases, the subject may have the idic(15) genotype.

[0045] In some implementations, the method may include administering a second agent to the subject for the treatment, prevention, or improvement of one or more symptoms of Dup15q syndrome. In some cases, the subject may have the idic(15) genotype.

[0046] In some embodiments, the ASO or its compositions described herein are used to treat, prevent, or improve neurons in the central nervous system of a subject. UBE3A The method is used to address diseases associated with overexpression of the idic(15) genotype. The disease could be Dup15q syndrome. In some cases, the subject may have the idic(15) genotype.

[0047] Also provided is the use of the ASO or its compositions described herein for the treatment of a disease associated with elevated levels of the UBE3A protein in neurons of the central nervous system of a subject. The disease may be Dup15q syndrome. In some cases, the subject may have the idic(15) genotype.

[0048] Also provided is the use of the ASO or its compositions described herein in the preparation of a medicament for treating a disease associated with elevated levels of the UBE3A protein in neurons of the central nervous system of a subject. The disease may be Dup15q syndrome. In some cases, the subject may have the idic(15) genotype. Brief description of the attached diagram Figure 1 The dose-response curves of ASO 18-63285LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0050] Figure 2 The dose-response curves of ASO 17-29853LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0051] Figure 3 The dose-response curves of ASO 18-63323LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0052] Figure 4 The dose-response curves of ASO 17-67260LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0053] Figure 5 The dose-response curves of ASO 16-63326LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0054] Figure 6 The dose-response curves of ASO 17-63458LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0055] Figure 7 The dose-response curves of ASO 17-29823LNA in normal human H9 neurons treated for 10 days are shown using multiple QuantiGene assays.

[0056] Figure 8The results show that, compared with the untreated control, 10 days of 3 μM ASO treatment resulted in a decrease in the number of iPSC-derived Dup15q-idic(15) neurons (in triplicate). UBE3A The effect of mRNA levels.

[0057] Figure 9 The effect of 3 μM ASO treatment for 10 days on UBE3A protein levels in iPSC-derived Dup15q-idic(15) neurons (triple copies) compared to the untreated control is shown.

[0058] Figure 10 The dose-response curves for the selected ASOs (17-29853LNA and 17-29823LNA) after 10 days are shown.

[0059] Figure 11 The dose-dependent knockdown of UBE3A protein was demonstrated by Western blot analysis of ASO 17-29823LNA.

[0060] Figure 12 The in vivo target binding of selected ASOs in the mouse brain is shown (ASO1 = 18-63285 LNA; ASO2 = 17-29853 LNA; ASO3 = 18-63286 LNA; ASO4 = 17-63286 LNA; and ASO10 = 17-63458 LNA).

[0061] Detailed description of the invention This disclosure provides antisense nucleic acid compounds, including, for example, antisense oligonucleotides (ASOs), for therapeutic applications. In some embodiments, the antisense compounds comprising ASOs of this disclosure, and their compositions or formulations, can be used to improve, prevent, or treat conditions related to overdose. UBE3A Expression-related conditions include, for example, chromosome 15q11.2-13.1 duplication syndrome or Dup15q syndrome. Genetic and clinical evidence suggests maternal involvement. UBE3A Allelic overexpression is a major contributor to the pathology observed in Dup15q syndrome, a neurodevelopmental disorder caused by maternal duplication of a genetic region on chromosome 15 known as the Prader-Willi syndrome / angel man syndrome key region (PWS / AS-CR). In CNS neurons, UBE3A It is expressed only on maternal chromosomes because its expression on paternal chromosomes is epigenetically silenced. When UBE3A Full presentation of Dup15q syndrome occurs when it is overexpressed on maternal chromosomes. Currently, it is believed that reducing expression in the CNS... UBE3AOverexpression can improve the neurological deficits observed in individuals with Dup15q syndrome. Therefore, this article provides antisense nucleic acid compounds that can be used to reduce [neurological deficits] in individuals with Dup15q syndrome. UBE3A Overexpression and / or causing UBE3A Levels normalized.

[0062] In some implementations, the antisense compound of this disclosure reduces human [health status] in subjects after administration. UBE3A Nucleic acid levels. In some embodiments, the antisense compound of this disclosure reduces the level of UBE3A protein in the subject after administration. The antisense compound can reduce the level of UBE3A protein in the subject after administration. UBE3A The expression of these compounds is reduced to levels seen under genetically normal conditions (i.e., the presence of one paternal and one maternal copy). In these ways, the antisense compounds presented in this paper can slow down, improve, or reverse the expression of these compounds in neurons. UBE3A The effects of overexpression.

[0063] Therefore, this disclosure covers synthetic, purified antisense nucleic acid compounds, such as antisense oligonucleotides (“ASO”), used to reduce [the risk of infection] after administration to a subject. UBE3A Therapeutic uses of nucleic acids and / or reducing UBE3A protein levels. Antisense compounds may contain natural and modified nucleotides, natural and modified nucleoside bonds, different nucleotide lengths, and / or different nucleoside (RNA and DNA) compositions, as provided herein.

[0064] I. Definition Throughout this specification, the terms “about” and / or “approximately” may be used in conjunction with numerical values ​​and / or ranges. The term “about” should be understood as referring to those values ​​close to the stated value. Furthermore, the phrases “less than about [value]” or “greater than about [value]” should be understood according to the definition of the term “about” provided herein. The terms “about” and “approximately” are used interchangeably. Unless otherwise stated, the term “about” immediately preceding a numerical value means ±10% of that value.

[0065] Throughout this specification, numerical ranges are provided for certain quantities. It should be understood that these ranges include endpoints and all subranges therein, including every integer within and between the disclosed ranges. Thus, the range “50 to 80” includes all possible ranges therein (e.g., 51-79, 52-78, 53-77, 54-76, 55-75, 60-70, etc.) and every individual integer from 50 to 80 (e.g., 50, 51, 52, 53, 54, etc.). When ranges are provided in the form of fractions, percentages, decimals, etc., such ranges similarly include all possible subranges therein and every individual fraction, percentage, decimal, etc., within and between the disclosed ranges. For example, the range “0.1 to 1.0” includes all possible ranges therein (e.g., 0.2 to 0.9, etc.) and every individual 1 / 10 decimal from 0.1 to 1.0 (e.g., 0.1, 0.2, 0.3, 0.4, etc.). Furthermore, all values ​​within a given range can be endpoints of the range thus covered (e.g., the range 50-80 includes ranges with endpoints such as 55-80, 50-75, etc.).

[0066] The terms "a" or "an" refer to one or more of the same entity; for example, "targeting". UBE3A "Antisense oligonucleotide" refers to one or more such antisense oligonucleotides or at least one such antisense oligonucleotide. Therefore, the terms "a" (or "an"), "one or more" and "at least one" are used interchangeably in this document.

[0067] The terms “comprise”, “comprising”, etc., used in this specification and claims are used in a non-limiting sense to indicate that the item following the word is included, but do not exclude items not specifically mentioned. The invention may suitably “comprise”, “compose of”, “consist of”, or “substantially consist of” the steps, elements, and / or reagents described in the claims, or “consist of” the steps, elements, and / or reagents described in the claims.”

[0068] "Antisense activity" refers to any detectable and / or measurable change attributable to the hybridization of an antisense compound with its target nucleic acid. Antisense activity includes knocking down or eliminating the expression of genes targeted by compounds with antisense activity.

[0069] An "antisense compound" is a compound that contains or is composed of oligonucleotides, at least a portion of which is complementary to a target nucleic acid to which it can hybridize, thereby producing at least one antisense activity. Antisense oligonucleotides (ASOs) are "antisense compounds".

[0070] "Antisense oligonucleotides" or "ASOs" refer to short (typically 12 to 25 nucleotides), single-stranded, synthetic DNA or RNA or hybrid DNA / RNA molecules that are engineered to target coding or non-coding nucleic acids (such as mRNA or other gene transcript sequences) through complementary base pairing to regulate their expression levels.

[0071] "Bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0072] "Bicyclic sugar moiety" refers to a modified sugar moiety (including but not limited to furanyl glycosyl) comprising a 4- to 7-membered ring, which includes a bridge connecting two atoms of the 4- to 7-membered ring to form a second ring, thereby producing a bicyclic structure. In some embodiments, the 4- to 7-membered ring is a sugar ring. In some embodiments, the 4- to 7-membered ring is a furanyl glycosyl. In some such embodiments, the bridge connects the 2'-carbon and 4'-carbon of the furanyl glycosyl.

[0073] "Ubiquitin protein ligase E3A" or "UBE3A" refers to... UBE3A Any protein encoded by nucleic acids. UBE3A The gene produces 33 known transcript variants. Each variant transcript and each processed mRNA produced from these variants can be as used herein. UBE3A Nucleic acid. In some implementation plans, UBE3A The nucleic acid has the sequence shown in RefSeqGene NG_009268.1 (human chromosome 15 (NC_000015.10) nucleotide positions 25,333,728 to 25,439,056 (genomic background)). In some embodiments, UBE3A The nucleic acid has the sequence shown in GRCh38.p14 (hg38) chr15:25371667-25439024 (SEQ ID NO:1) (referred to herein as the “UBE3A target region”). In some embodiments, UBE3A Nucleic acids have human... UBE3AThe sequences shown in the variant transcripts of the gene include, for example, RefSeq NM_000462.5, NM_001354505.1, NM_001354506.2, NM_001354507.2, NM_001354508.2, NM_001354509.2, NM_001354511.2, NM_001354512.2, NM_001354513.2, NM_001354523.2, NM_001354526.1, NM_001354538.2, NM_001354539.2, and NM_001354540. 2. NM_001354541.2, NM_001354542.2, NM_001354543.2, NM_001354544.2, NM_001354545.2, NM_001354546.2, NM_001354547.2, NM_001354548.2, NM_001354549.2, NM_001354550.2, NM_001354551.2, NM_001374461.1, NM_130838.4 or NM_130839.5. In some cases, throughout the specification, the term UBE3A is used as an abbreviation to refer to the UBE3A gene and / or from... UBE3A Nucleic acids such as UBE3A Proteins expressed by mRNA.

[0074] The term "complementarity" in relation to oligomers (e.g., linked nucleosides, oligonucleotides, or nucleic acids) refers to the ability of such oligomers or regions thereof to hybridize with another oligomer or region thereof under stringent conditions via nucleobase complementarity. Complementary oligomers do not need to have nucleobase complementarity at every nucleoside. Rather, some mismatches are tolerated. In some embodiments, the complementary oligomer or region is complementary at 70% of its nucleobases (70% complementarity). In some embodiments, the complementary oligomer or region is 80% complementary. In some embodiments, the complementary oligomer or region is 90% complementary. In some embodiments, the complementary oligomer or region is 95% complementary. In some embodiments, the complementary oligomer or region is 100% complementary.

[0075] A “conjugate” is a compound comprising two covalently linked molecules. In some embodiments, the conjugate comprises an antibody or other targeting agent and a modified oligonucleotide.

[0076] "Constrained ethyl nucleoside" or "cEt" refers to a nucleoside containing a bicyclic sugar moiety with a 4'-CH(CH3)—O-2' bridge.

[0077] "Expression" refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0078] “Hybridization” or “base pairing” refers to the pairing of complementary oligomers (e.g., antisense compounds and their target nucleic acids). While not limited to a specific mechanism, the most common pairing mechanisms involve the formation of hydrogen bonds between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bond formation.

[0079] "Nucleoside bonding" refers to the covalent bonding between adjacent nucleosides in oligonucleotides.

[0080] "LNA" refers to a nucleoside containing a bicyclic sugar moiety containing a 4'-CH2—O-2' bridge.

[0081] "Mismatch" refers to a situation where, when comparing a first oligomer and a second oligomer, the nucleobases of the first oligomer cannot pair with the corresponding nucleobases of the second oligomer. Either or both of the first and second oligomers can be oligonucleotides.

[0082] "Modified nucleoside bonds" refers to any nucleoside bond other than naturally occurring nucleoside bonds.

[0083] "Modified nucleobases" include universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Specific examples of modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenated uracil and cytosine, 5-propynyl (-C≡C-CH3)uracil and cytosine, and... Other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, 3-deadenine and 3-deadenine. Other modified nucleobases include tricyclic pyrimidines, such as phenoxazincytidine ([5,4-b][1,4]benzoxazin-2(3H)-one), phenthiazincytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps, such as substituted phenoxazincytidines (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazocytidine (2H-pyrimido[4,5-b]indole-2-one), and pyridoindolecytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimido-2-one). The modified nucleobases may also include those in which the purine or pyrimidine bases are replaced by other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone.

[0084] "Modified nucleosides" are nucleosides that contain at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides may contain modified sugar moieties and / or modified nucleobases.

[0085] "Modified oligonucleotides" refer to oligonucleotides containing at least one modified nucleoside and / or at least one modified inter-nucleoside bond. Examples of modified oligonucleotides include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and site-based compounds.

[0086] "Modified sugar" refers to a substituted sugar moiety or sugar substitute present in a modified nucleoside. Substituted sugar moieties include, but are not limited to, furanyl groups containing substituents at the 2', 3', 5', and / or 4' positions. Some substituted sugar moieties are bicyclic sugar moieties. Examples of modified sugars include 2'-substituted sugar moieties (furanyl groups containing substituents other than H or OH at the 2' position). Sugar substitutes are structures that do not contain furanyl groups but can substitute for naturally occurring sugar moieties of the nucleoside, such that the resulting nucleoside subunits can be linked together and / or linked with other nucleosides to form oligomers capable of hybridizing with complementary oligomers. Such structures include rings containing a different number of atoms than the furanyl group (e.g., 4, 6, or 7-membered rings); substitution of the oxygen in the furanyl group with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and substitution of oxygen. Such structures may also include substitutions corresponding to those described for the substituted sugar moiety (e.g., 6-membered carbon-ring bicyclic sugar substitutes optionally containing additional substituents). Sugar substitutes also include more complex sugar substitutes (e.g., acyclic systems of peptide nucleic acids). Sugar substitutes include, but are not limited to, morpholinos, cyclohexenyl, and cyclohexanehexaol. The bicyclic sugar moiety comprises a 4- to 7-membered ring (including, but not limited to, furanyl groups) containing a bridge connecting two atoms of the 4- to 7-membered ring to form a second ring, thereby producing a bicyclic structure. In some embodiments, the 4- to 7-membered ring is a sugar ring. In some embodiments, the 4- to 7-membered ring is a furanyl group. In some such embodiments, the bridge connects the 2'-carbon and 4'-carbon of the furanyl group.

[0087] "Regulation" refers to the change in the quantity or quality of a molecule, function, or activity after intervention, compared to the quantity or quality before intervention or without intervention. For example, regulation includes changes in gene expression, i.e., an increase (stimulation or induction) or a decrease (inhibition or reduction). As another example, regulation of expression can include alterations in the selection of splice sites during precursor mRNA processing, resulting in a change in the absolute or relative amount of a particular splice variant compared to the amount without regulation.

[0088] "MOE" refers to -OCH2CH2OCH3.

[0089] “mRNA” refers to “messenger RNA”, which is an RNA molecule that encodes proteins.

[0090] "Naturally occurring internucleotide bonds" refers to 3' to 5' phosphate diester bonds.

[0091] "Naturally occurring sugar moieties" refer to riboflavin, such as that found in naturally occurring RNA, or riboflavin, such as that found in naturally occurring DNA.

[0092] A "nucleobase" is a group of atoms that can be linked to a sugar moiety to create a nucleoside that can be incorporated into an oligonucleotide, wherein the nucleobase can bond to a complementary, naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases can be naturally occurring or modified. "Unmodified nucleobases" or "naturally occurring nucleobases" refer to naturally occurring heterocyclic nucleobases in RNA or DNA: purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C) (including 5-methylcytosine), and uracil (U).

[0093] A nucleoside is a compound that consists of a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (such as those found in DNA and RNA) and modified nucleosides. Nucleosides can be linked to a phosphate ester moiety.

[0094] A "nucleotide" is a nucleoside that also contains a phosphate ester linker. "Linked nucleosides" may or may not be linked by phosphate ester bonds, and therefore include "linked nucleotides." "Linked nucleosides" are nucleosides linked in a continuous sequence (i.e., there are no other nucleosides between the linked nucleosides).

[0095] "Oligomer" refers to a polymer structure comprising two or more substructures. In some embodiments, the oligomer comprises oligonucleotides. In some embodiments, the oligomer is composed of oligonucleotides.

[0096] "Oligonucleotide" refers to a compound containing multiple linked nucleosides. In some embodiments, oligonucleotides contain one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0097] "Pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to animals. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In some embodiments, such sterile saline is pharmaceutical-grade saline.

[0098] "Polynucleotide" refers to "oligomer," which is a molecule containing at least two monomers and includes oligonucleotides, such as DNA oligonucleotides, RNA oligonucleotides, and mixed DNA / RNA oligonucleotides, as well as polynucleotides including DNA polynucleotides, RNA polynucleotides, and mixed DNA / RNA polynucleotides, and polynucleotides with synthetic or modified monomers (such as modified nucleotides as described herein).

[0099] "Precursor mRNA" refers to RNA transcripts that have not yet been fully processed into mRNA. Precursor RNA contains one or more introns.

[0100] "Subject" means human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes both prenatal and postnatal forms. In many embodiments, the subject is human. A subject can be a patient, which refers to a human presented to a healthcare provider for the diagnosis or treatment of a disease. Unless the context requires otherwise, the term "subject" is used interchangeably with "individual" or "patient" herein. A subject may have or be susceptible to a disease or condition, but may or may not show symptoms of the disease or condition.

[0101] "Substituted sugar moieties" refer to furanyl saccharides that are not naturally occurring sugar moieties. Substituted sugar moieties include, but are not limited to, furanyl saccharides containing substituents at the 2', 3', 5', and / or 4' positions. Some substituted sugar moieties are bicyclic sugar moieties.

[0102] "Sugar moiety" refers to the naturally occurring sugar moiety or modified sugar moiety of a nucleoside.

[0103] "Sugar substitutes" refer to structures that do not contain a furanyl group and can replace the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside subunits can link together and / or link with other nucleosides to form oligomers capable of hybridizing with complementary oligomers. Such structures include rings containing a different number of atoms than the furanyl group (e.g., 4, 6, or 7-membered rings); substitution of the oxygen atom of the furanyl group with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and the substitution of oxygen. Such structures may also contain substitutions corresponding to those described for the substituted sugar moiety (e.g., 6-membered carbon ring bicyclic sugar substitutes optionally containing additional substituents). Sugar substitutes also include more complex sugar substitutes (e.g., acyclic systems of peptide nucleic acids). Sugar substitutes include, but are not limited to, morpholino compounds, cyclohexenyl compounds, and cyclohexanehexaol.

[0104] "Targeting" or "targeting" refers to the association of an antisense compound with a specific sequence or region of a nucleic acid molecule. If the antisense compound is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions, then the antisense compound targets the target nucleic acid.

[0105] "2'-(ara)-F" refers to a 2'-F substituted nucleoside, in which the fluorine group is located at the arabinose position.

[0106] "2'-Deoxynucleoside" refers to a nucleoside containing a 2'-H furanose sugar moiety, such as those found in naturally occurring deoxyribonucleosides (DNA). In some embodiments, 2'-deoxynucleoside may contain modified nucleotides or may contain RNA nucleotides (e.g., uracil).

[0107] "2'-F nucleoside" refers to a nucleoside containing a sugar with fluorine at the 2' position. Unless otherwise stated, the fluorine in 2'-F nucleoside is located at the ribose position (in place of the OH group of the natural ribose).

[0108] "2'-substituted nucleosides" refer to nucleosides containing a substituent other than H or OH at the 2'-position. Unless otherwise stated, 2'-substituted nucleosides are not bicyclic nucleosides.

[0109] "2'-substituted sugar moiety" refers to a furanyl saccharide containing a substituent other than H or OH at the 2'-position. Unless otherwise stated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of the 2'-substituted sugar moiety does not form a bridge with another atom of the furanyl ring).

[0110] "3'-endo-furanosyl nucleotide" refers to an RNA-like nucleotide containing a substituted sugar moiety having a 3'-endo conformation. 3'-endo-furanosyl nucleotides include, but are not limited to: 2'-MOE ("MOE"), 2'-F, 2'-OMe ("OMe"), locked nucleic acid (LNA), 2'-O,4'-C-ethylene-bridged nucleic acid ("ENA"), and 2'-O-ethyl (cEt) nucleotide.

[0111] An "acyl" group is a group formed by removing a hydroxyl group from an organic acid and has the general formula -C(O)-X, where X is typically aliphatic, alicyclic, or aromatic. Examples include aliphatic carbonyl groups, aromatic carbonyl groups, aliphatic sulfonyl groups, aromatic sulfinyl groups, aliphatic sulfinyl groups, aromatic phosphate esters, aliphatic phosphate esters, etc. Acyl groups as used herein may optionally include additional substituent groups.

[0112] "Alicyclic" refers to a cyclic system in which the rings are aliphatic. The cyclic system may contain one or more rings, wherein at least one ring is aliphatic. Preferred alicyclic systems include rings having about 5 to about 9 carbon atoms. Alicyclic systems as used herein may optionally include additional substituent groups.

[0113] "Aliphatic" refers to a straight-chain or branched hydrocarbon group containing up to 24 carbon atoms, wherein the saturation between any two carbon atoms is a single, double, or triple bond. Aliphatic groups preferably contain 1 to about 24 carbon atoms, more typically 1 to about 12 carbon atoms, and more preferably 1 to about 6 carbon atoms. The straight or branched chain of an aliphatic group may be interrupted by one or more heteroatoms, including nitrogen, oxygen, sulfur, and phosphorus. Such heteroatominated aliphatic groups include, but are not limited to, polyalkoxy groups, such as polyalkylene glycols, polyamines, and polyimides. Aliphatic groups as used herein may optionally include other substituent groups.

[0114] "Alkenyl" refers to a straight-chain or branched hydrocarbon chain group containing up to 24 carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, vinyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene, etc. Alkenyl groups typically contain 2 to about 24 carbon atoms, more typically 2 to about 12 carbon atoms, and more preferably 2 to about 6 carbon atoms. Alkenyl groups as used herein may optionally include one or more additional substituent groups.

[0115] "Alkoxy" refers to a group formed between an alkyl group and an oxygen atom, wherein the oxygen atom serves to attach the alkoxy group to the parent molecule. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, and n-hexoxy. Alkoxy groups as used herein may optionally include additional substituent groups.

[0116] "Alkyl" refers to a saturated straight-chain or branched hydrocarbon group containing up to 24 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl, etc. Alkyl groups typically contain 1 to about 24 carbon atoms, more typically 1 to about 12 carbon atoms (C1-C12 alkyl), and more preferably 1 to about 6 carbon atoms.

[0117] "Alynyl" refers to a straight-chain or branched hydrocarbon group containing up to 24 carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, etc. Alynyl groups typically contain 2 to about 24 carbon atoms, more typically 2 to about 12 carbon atoms, and more preferably 2 to about 6 carbon atoms. As used herein, an alkynyl group may optionally include one or more additional substituent groups.

[0118] "Aminoalkyl" refers to an amino-substituted C1-C12 alkyl group. The alkyl portion of the group forms a covalent bond with the parent molecule. The amino group can be located at any position, and the aminoalkyl group can be replaced by additional substituent groups on the alkyl and / or amino portions.

[0119] "Arylalkyl" and "arylalkyl" refer to aromatic groups covalently bonded to C1-C12 alkyl groups. The alkyl portion of the resulting arylalkyl (or arylalkyl) group forms a covalent bond with the parent molecule. Examples include, but are not limited to, benzyl, phenethyl, etc. Arylalkyl groups as used herein may optionally include additional substituent groups attached to the alkyl, aryl, or both groups forming the group.

[0120] "Aryl" and "aromatic" refer to a monocyclic or polycyclic carbocyclic group having one or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indenyl, and indenyl. Preferred aromatic ring systems have about 5 to about 20 carbon atoms in one or more rings. As used herein, aryl groups may optionally include additional substituent groups.

[0121] "Furanyl" refers to a structure containing a 5-membered ring with four carbon atoms and one oxygen atom.

[0122] "Halogen" and "halogen" refer to atoms selected from fluorine, chlorine, bromine, and iodine.

[0123] "Heteroaryl" and "heteroaromatic" refer to groups comprising monocyclic or polycyclic aromatic rings, ring systems, or fused-ring systems, wherein at least one ring is aromatic and includes one or more heteroatoms. Heteroaryl is also intended to include fused-ring systems, including systems in which one or more fused rings do not contain heteroatoms. Heteroaryl groups typically include a ring atom selected from sulfur, nitrogen, or oxygen. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrroleyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isoxazolyl, thiadiazolyl, oxadiazolyl, thiophene, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzoxazolyl, quinoxalinyl, etc. Heteroaryl groups can be directly or via a linking moiety (e.g., an aliphatic group or a heteroatom) to a parent molecule. Heteroaryl groups as used herein may optionally include additional substituent groups.

[0124] II. Overview The targeted humans mentioned in this article UBE3A Antisense compounds of nucleic acids and compositions or formulations containing them may be used to improve, prevent or treat overdose in subjects. UBE3A Express any related symptoms or conditions, such as those caused by maternal duplication within the 15q11.2–q13.3 region, like Dup15q syndrome. For example, targeting humans. UBE3A Antisense compounds of nucleic acids can be used to improve, prevent, or treat any symptoms or diseases associated with an excess of UBE3A protein in a subject's cells, such as neurons. In some implementations, the subject may present with Dup15q syndrome.

[0125] The targeted humans mentioned in this article UBE3A Antisense compounds for nucleic acids can be used to inhibit target genes, i.e. UBE3A Any antisense compound expressed. Targeting humans. UBE3AExemplary sequences of portions of the antisense compounds of nucleic acids are provided in Table 1. For example, antisense compounds include single-stranded and double-stranded nucleic acid compounds and can inhibit target gene expression via RNase H-mediated mRNA decay, steric hindrance-based mechanisms, RNA-induced silencing complex (RISC) mechanisms, or guide-strand-guided nuclease-mediated mRNA decay mechanisms. Therefore, the targeting of human... UBE3A Antisense compounds for nucleic acids may comprise antisense oligonucleotides (ASOs), RNAi compounds such as small interfering RNA (siRNA) and short hairpin RNA (shRNA), or nuclease-guided RNA (gRNA) compounds used in conjunction with nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), Cas9, and similar nucleases. Generally, those skilled in the art will recognize that the antisense compounds disclosed herein (e.g., those in Table 1) are suitable for use as, for example, ASOs, siRNAs, shRNAs, or gRNAs requiring specific modifications. Such modifications include, in particular, incorporation of sense and / or antisense strands, preparation of single-stranded or double-stranded compositions, and the use of DNA or RNA nucleosides and oligonucleotide lengths.

[0126] In some embodiments, the antisense compound of this disclosure is an antisense oligonucleotide, or "ASO". The ASO of this disclosure is designed to target humans. UBE3A Nucleic acids, such as UBE3A mRNA, thereby regulating its expression. ASO can be administered to subjects in need (e.g., patients with Dup15q syndrome) and reduce functional activity in the subjects. UBE3A Therefore, the ASO described herein and compositions or formulations containing it may be used to prevent, treat, improve, or reverse mRNA or UBE3A protein levels in subjects. UBE3A Any symptoms of overexpression. In an exemplary embodiment, the subject is a human patient exhibiting maternal duplication in the 15q11.2-q13.3 region, resulting in overexpression of the UBE3A protein in neurons. In some embodiments, a composition or formulation comprising the ASO disclosed herein may be delivered to the central nervous system of the subject.

[0127] III. Targeting Humans UBE3A Antisense compounds of transcripts In some embodiments, the present invention provides targeting of humans UBE3A Nucleic acids (including) UBE3A (mRNA transcripts of genes) to inhibit UBE3AAntisense nucleic acid compounds for gene expression. Antisense compounds may comprise oligonucleotides. In some embodiments, the oligonucleotides of this disclosure contain one or more chemical modifications, such as one or more nucleoside modifications (including modifications to the sugar moiety and / or nucleobases) and / or modifications to one or more inter-nucleoside bonds.

[0128] A. Modified nucleosides The antisense compounds of this disclosure may comprise or consist of an oligonucleotide containing at least one modified nucleoside. Such modified nucleosides may comprise a modified sugar moiety, a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0129] i. Sugar modification The antisense compounds described herein may contain one or more nucleosides comprising modified sugars to impart desired properties, such as enhanced nuclease stability or increased binding affinity to target nucleic acids relative to antisense compounds comprising unmodified sugar moieties. The modified sugars may be substituted sugar moieties, bicyclic or tricyclic sugar moieties, or sugar substitutes.

[0130] The substituted sugar moiety may contain one or more substituents, including but not limited to substituents at the 2' and / or 5' positions. Examples of suitable sugar substituents at the 2'-position include, but are not limited to, 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'-O(CH2)2OCH3 (“MOE”). In some embodiments, the sugar substituent at the 2'-position is selected from allyl, amino, azide, thio, and O-allyl substituents. Examples of sugar substituents at the 5'-position include, but are not limited to, 5'-methyl (R or S); 5'-vinyl, 5'-vinylphosphonate, and 5'-methoxy.

[0131] Nucleosides containing a 2′-substituted sugar moiety are called 2′-substituted nucleosides. In some embodiments, the 2′-substituted nucleoside comprises a 2′-substituent group selected from the following: halogroup, allyl, amino, azide, O-C1-C10 alkoxy; O-C1-C10 substituted alkoxy, SH, CN, OCN, CF3, OCF3, O-alkyl, S-alkyl, N(Rm)-alkyl; O-alkenyl, S-alkenyl or N(Rm)-alkenyl; O-ynyl, S-ynyl, N(Rm)-ynyl; O-alkylene-O-alkyl, ynyl, alkylaryl, aralkyl, O-alkylaryl, O-aralkyl, O(CH2)2SCH3, O-(CH2)2-ON(Rm)(Rn) or O-CH2-C(=O)-N(Rm)(Rn), wherein each Rm and Rn is independently H, an amino protecting group or a substituted or unsubstituted C1-C10 alkyl group.

[0132] In some embodiments, the 2′-substituted nucleoside comprises a 2′-substituent group selected from the following: F, NH2, N3, OCF3, O-CH3, O(CH2)3NH2, CH2-CH=CH2, O-CH2-CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O-(CH2)2-ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamide (O-CH2-C(=O)-N(Rm)(Rn), wherein each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl group.

[0133] Certain modified sugar moieties contain bridging sugar substituents that form a second ring, resulting in a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moieties contain a bridge between a 4' furanose ring atom and a 2' furanose ring atom. Examples of such 4' to 2' sugar substituents include, but are not limited to: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, -C(RaRb)-N(R)-O-, or -C(RaRb)-ON(R)-; 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (cEt) and 4'-CH(CH2OCH3)-O-2' and their analogues (see, for example, U.S. Patent No. 7,399,845, granted July 15, 2008); 4'-C(CH3)(CH3)-O-2' and their analogues (see, for example, WO / 2009 / 006478); 4'-CH2-N(OCH3)-2' and their analogues (see, for example, WO / 2008 / 150729); 4'-CH2-ON(CH3)-2' (See, for example, US / 2004 / 0171570); 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2'-, wherein each R is independently H, a protecting group, or a C1-C12 alkyl group; 4'-CH2-N(R)-O-2', wherein R is H, a C1-C12 alkyl group, or a protecting group (see U.S. Patent No. 7,427,672, issued September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see, for example, Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' and the like (see WO / 2008 / 154401).

[0134] Nucleosides containing a bicyclic sugar moiety are called bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy(4'-CH2-O-2')BNA, (B) β-D-methyleneoxy(4'-CH2-O-2')BNA (also known as locked nucleic acid or LNA), (C) ethyleneoxy(4'-(CH2)2-O-2')BNA, (D) aminooxy(4'-CH2-ON(R)-2')BNA, (E) oxyamino(4'-CH2-N(R)-O-2')BNA, and (F) methyl(methyleneoxy)(4'-CH(CH3)-O-2')BNA. (Also known as restricted ethyl or cEt), (G) methylene-thio(4'-CH2-S-2')BNA, (H) methylene-amino(4'-CH2-N(R)-2')BNA, (I) methylcarbocyclic(4'-CH2-CH(CH3)-2')BNA, (J) propylenecarbocyclic(4'-(CH2)3-2')BNA and (M) 4'-CH2-O-CH2-2'.

[0135] Other bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahllestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461 and 7,399,845; WO / 2004 / 106356, WO / 1994 / 14226, WO / 2005 / 021570 and WO / 2007 / 134181; U.S. Patent Application Publication Nos. US / 2004 / 0171570, US / 2007 / 0287831 and US / 2008 / 0039618; and WO / 2008 / 150729A2, WO / 2008 / 154401A2 and WO / 2009 / 006478A2.

[0136] In some embodiments, the bicyclic sugar moiety and the nucleoside incorporated into such a bicyclic sugar moiety are further defined by isomer configuration. For example, a nucleoside containing a 4'-2' methylene-oxygen bridge can be either α-L or β-D configuration. Previously, α-L-methyleneoxy(4′-CH2-O-2′) bicyclic nucleosides have been incorporated into antisense oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0137] In some embodiments, the substituted sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted and 4'-2'-bridging sugars). (See WO / 2007 / 134181, where LNA is substituted with, for example, a 5'-methyl or 5'-vinyl group).

[0138] In some embodiments, the modified sugar moiety is a sugar substitute. In some such embodiments, the oxygen atom of a naturally occurring sugar is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some such embodiments, the modified sugar moiety also contains bridging and / or non-bridging substituents as described above. For example, some sugar substitutes contain a 4′-sulfur atom and substitutions at the 2′-position (see, for example, U.S. Patent Application Publication US / 2005 / 0130923) and / or the 5′ position.

[0139] In some embodiments, the sugar substitute comprises a ring having more than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), atroitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854) and fluoroHNA (F-HNA).

[0140] Many other bicyclic and tricyclic sugar and sugar substitute ring systems that can be used to modify nucleosides are known in the art (see, for example, review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).

[0141] In some embodiments, the sugar substitute comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides comprising the morpholine sugar moiety and their use in antisense compounds have been reported (see, for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685, 5,166,315, 5,185,444; and 5,034,506).

[0142] In some embodiments, morpholine compounds can be modified, for example by adding or altering various substituent groups derived from the structure of the morpholine compounds described above. Such sugar substitutes are referred to herein as "modified morpholine compounds".

[0143] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl-substituted nucleosides (for other disclosed 5',2'-disubstituted nucleosides, see WO / 2008 / 101157) and ribosyl epoxides with S substitution and further substitution at the 2'-position (see US Patent Application Publication US / 20050130923) or alternatively, 5'-substitution of bicyclic nucleic acids (see WO / 2007 / 134181, in which the 4'-CH2-O-2' bicyclic nucleoside is further substituted at the 5'-position with 5'-methyl or 5'-vinyl). The synthesis and preparation of carbocyclic bicyclic nucleosides, as well as their oligomerization and biochemical studies, have also been described (see, for example, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0144] ii. Modified nucleobases The antisense compounds described herein may contain one or more nucleosides containing modified nucleobases.

[0145] Modified nucleobases can include universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases. Specific examples of modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenated uracil and cytosine, 5-propynyl(-C≡C-CH3)uracil and cytosine, and... Other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, 3-deadenine and 3-deadenine. Other modified nucleobases include tricyclic pyrimidines, such as phenoxazincytidine ([5,4-b][1,4]benzoxazin-2(3H)-one), phenthiazincytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps, such as substituted phenoxazincytidines (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazocytidine (2H-pyrimido[4,5-b]indole-2-one), and pyridoindolecytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimido-2-one). The modified nucleobases may also include those in which the purine or pyrimidine bases are replaced by other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone.

[0146] B. Modified nucleotide inter-bondage The individual nucleosides of the antisense compounds described herein can be linked together using any inter-nucleoside bond to form oligonucleotides. Inter-nucleoside bonds include phosphorus-containing inter-nucleoside bonds, including but not limited to phosphodiester (P=O), phosphotriester, methylphosphonate, aminophosphate, and thiophosphate (P=S). Phosphorus-free inter-nucleoside bonds include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-OC(O)-S-), thiocarbonylcarbamate (-OC(O)(NH)-S-); siloxane (-O-Si(H)2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified bonds can improve the nuclease resistance of oligonucleotides compared to natural phosphodiester bonds. In some embodiments, inter-nucleoside bonds with chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Representative chiral bonds include, but are not limited to, alkylphosphonates and thiophosphates. Methods for preparing phosphorus-containing and phosphorus-free nucleoside bonds are known to those skilled in the art.

[0147] C. Oligonucleotide motif The antisense compounds described herein may comprise oligonucleotides having one or more chemical modifications, namely one or more modified sugars and / or one or more modified nucleobases and / or one or more modified internucleotide bonds. These chemical modifications (sugar modifications, nucleobase modifications, and / or bond modifications) may be present in a given oligonucleotide according to defined patterns or motifs. The chemical modification patterns of the sugar motif, internucleotide bonds, and nucleobases may be independent of each other. Therefore, oligonucleotides can be described by their sugar modification motifs, internucleotide bond motifs, and / or nucleobase modification motifs (sequences independent of nucleobases).

[0148] i. Glycosylation The oligonucleotides described herein may contain one or more types of modified sugar moieties and / or naturally occurring sugar moieties arranged in a defined pattern along the oligonucleotide or its regions.

[0149] For example, an oligonucleotide may comprise or be composed of a region having a gapmer glycosyl motif, said region comprising two outer regions or segments and a central or inner region or gap. The three regions (5′-segment, gap segment, and 3′-segment) of the gapmer glycosyl motif form a continuous nucleotide sequence, wherein at least some sugar moieties of the nucleotides in each of the 5′ and 3′ segments differ from at least some sugar moieties of the nucleotides in the gap. Specifically, the sugar moieties of at least the nucleotides of each 5′ and 3′ segment closest to the gap (the 3′ nucleotide of the 5′ segment and the 5′ nucleotide of the 3′ segment) differ from the sugar moieties of the adjacent gapped nucleotides, thereby defining the boundary between the 3′ and 5′ segments and the gap. In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap comprises one or more nucleotides having sugar moieties different from the sugar moieties of one or more other nucleotides in the gap. In some embodiments, the glycosyl motifs of the 5′ and 3′ segments are identical to each other (symmetric glycosyl gapmers). In some implementations, the glycosylation of the 5'-segment is different from that of the 3'-segment (asymmetric glycosylation gapmer).

[0150] The segments of a gapmer can be of varying lengths or equal lengths. For example, in some cases, a gapmer consists of a 5' segment of 5 nucleotides, a 5-nucleotide gap segment, and a 3' segment of 5 nucleotides. In other cases, a gapmer consists of, for example, a 5' segment of 3 nucleotides, a 9-nucleotide gap segment, and a 3' segment of 3 nucleotides. In still other cases, a gapmer consists of, for example, a 5' segment of 2 nucleotides, a 10-nucleotide gap segment, and a 3' segment of 3 nucleotides. Therefore, each segment can have a different length compared to the other segments. The lengths of the 5' and 3' segments can vary, typically ranging from 2 to 5 nucleotides. The length of the gap segment can also vary, typically ranging from 5 to 15 nucleotides.

[0151] Gapmers can be identified by the length of their segments in the 5' to 3' direction. For example, a gapmer consisting of a 5' segment of 3 nucleotides, a gap of 10 nucleotides, and a 3' segment of 3 nucleotides can be called a 3-10-3 gapmer, or more specifically, a 3-10-3 16mer. For a specific gapmer in which sugar modifications are defined, the gapmer can be further identified by defining the sugar modifications of each segment. For example, a gapmer consisting of a 5' segment of three nucleotides modified with 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′ or 4′-(CH2)—O-2′ (LNA) sugar, a 10-linked deoxynucleotide nick, and a 3' segment of three nucleotides modified with 2′-O(CH2)2OCH3 (“MOE”) sugar can be called a 3-10-3 LNA-DNA-MOE gapmer, more specifically a 3-10-3 16mer.

[0152] A gapmer can contain one or more modified sugars at specific locations within one or more segments. That is, a gapmer can contain sugar modifications at specific nucleotide positions within the 5' segment, the gap segment, and / or the 3' segment. In some embodiments, the gapmer described herein contains a 2'OMe-modified sugar at a specific location within the DNA gap. For example, a gapmer can contain a 2'OMe-modified sugar at the nucleotide position 2 within the DNA gap.

[0153] ii. Nucleobase modification motif The oligonucleotides described herein may comprise chemical modifications to nucleobases arranged in a defined pattern or nucleobase modification motif along the oligonucleotide or a region / segment thereof. In some embodiments, each nucleobase is modified.

[0154] Oligonucleotides may contain blocks of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleotides at the 3' end of the oligonucleotide. In some such embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleotides at the 5' end of the oligonucleotide.

[0155] Nucleobase modifications can be dependent on specific bases at specific positions within the oligonucleotide. For example, in some embodiments, each purine or each pyrimidine in the oligonucleotide is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each cytosine is modified. In some embodiments, each uracil is modified.

[0156] In some embodiments, the oligonucleotide comprises one or more nucleosides containing modified nucleotides. In some embodiments, the oligonucleotide having a gapmer glycosyl motif comprises a nucleoside containing a modified nucleotide. In some such embodiments, one nucleoside containing the modified nucleotide is located in the central nick of the oligonucleotide having the gapmer glycosyl motif. In some embodiments, the sugar is an unmodified 2'-deoxynucleoside. In some embodiments, the modified nucleotide is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0157] In some embodiments, some or all of the cytosine moieties in the oligonucleotide are 5-methylcytosine, or the absence of a cytosine moiety is 5-methylcytosine. 5-Methylcytosine is not a “modified nucleobase.” Therefore, unless otherwise stated, an unmodified nucleobase includes both cytosine residues having a 5-methyl group and cytosine residues lacking a 5-methyl group. In some embodiments, the methylation state of all or some of the cytosine nucleobases is specified.

[0158] D. The length of the antisense compound This invention provides antisense nucleic acid compounds comprising oligonucleotides of varying nucleotide lengths. For example, the antisense compound may consist of the following: 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 22 to 23, 22 to 24, 22 to 25, 23 to 24, 23 to 25, or 24 to 25 linked nucleosides.In some embodiments, the antisense oligonucleotides of this disclosure can be from about 12 nucleotides to about 25 nucleotides in length, for example, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. Typically, oligonucleotides with n linked nucleosides are referred to as “nmer”, and oligonucleotides with 16 linked nucleosides are referred to as 16mer.

[0159] E. Conjugations used to improve biological distribution The antisense compounds described herein can be modified by attaching one or more conjugation groups. Typically, conjugation groups alter one or more properties of the attached antisense compound, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, biodistribution, charge, and clearance. Conjugation groups are used in the chemical field and are directly or via optional conjugation linkers or conjugation linking groups to parent compounds, such as antisense compounds, such as oligonucleotides. Conjugation groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, and dyes.

[0160] In some embodiments, the conjugating group is attached to the oligonucleotide via a conjugating linker. In some such embodiments, the conjugating linker, including but not limited to bifunctional linkers, such as those known in the art, is suitable for the compounds provided herein. The conjugating linker can be used to attach a conjugating group (such as a chemically stabilizing group, functional group, reporter group, and other groups) to a selected site in a parent compound (such as, for example, an antisense compound). Typically, a bifunctional linker comprises a hydrocarbyl moiety having two functional groups. One functional group is selected to bind the parent molecule or compound of interest, and the other is selected to bind substantially any chosen group, such as a chemical functional group or a conjugating group. In some embodiments, the conjugating linker comprises an oligomer of a chain structure or repeating unit (such as an ethylene glycol or amino acid unit). Examples of functional groups conventionally used for bifunctional linkers include, but are not limited to, electrophiles for reaction with nucleophiles and nucleophiles for reaction with electrophiles. In some embodiments, the bifunctional linker comprises amino, hydroxyl, carboxylic acid, thiol, unsaturation (e.g., double or triple bonds), etc.

[0161] Some non-limiting examples of the linking moiety of the conjugate include pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid succinimide ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl groups, wherein a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0162] The conjugation group can be attached to either end or both ends (i.e., the 5' and / or 3' ends) (terminal conjugation group) and / or any internal location of the oligonucleotide. In some embodiments, the conjugation group is located at or near the 5' end of the antisense compound described herein. In some embodiments, the conjugation group is located at or near the 3' end of the antisense compound described herein.

[0163] In some implementations, the conjugation group can interact with lipid components of the cell membrane, bind to specific cell surface proteins or receptors, and / or penetrate the cell via an endogenous transport mechanism carrying the antisense compound.

[0164] Conjugates can be attached to the 5' and / or 3' ends of the sense and / or antisense strands of an antisense compound via covalent attachment (such as nucleic acid or non-nucleic acid linkers). Conjugates can be linked by urethane groups or other linking groups (see, for example, U.S. Patent Application Publications US / 2005 / 0074771, US / 2005 / 0043219, and US / 2005 / 0158727).

[0165] In some embodiments, the conjugation group may be a molecular entity that facilitates the delivery of the antisense compound into cells, or may be a molecule containing a drug or a label. Examples of conjugation molecules suitable for linking to the antisense compounds of this disclosure include, but are not limited to, lipophilic molecules (e.g., fatty acids), cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), carotenoids, terpenes, bile acids, folates (e.g., folic acid, folic acid analogs and derivatives thereof), sugars (e.g., galactose, galactosamine, N-acetylgalactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, antibodies, aptamers and combinations thereof (see, for example, U.S. Patent Application Publications US / 2003 / 0130186, US / 2004 / 0110296 and US / 2004 / 0249178; and U.S. Patent No. 6,753,423).

[0166] The degree of conjugation of the conjugating group and the antisense compound can be evaluated, as well as the improved pharmacokinetic characteristics, bioavailability, biodistribution, and / or stability of the antisense compound. Therefore, those skilled in the art can use any of a variety of well-known in vitro cell culture techniques or in vivo animal models to screen antisense compounds with various conjugations linked to them to identify conjugations with improved properties.

[0167] In some embodiments, the antisense compounds disclosed herein may be conjugated to lipophilic molecules (e.g., long-chain fatty acids or LCFAs), antibodies (e.g., anti-transferrin receptor antibodies), aptamers, ligands, peptides, or polymers.

[0168] In some embodiments, the antisense compounds disclosed herein can be conjugated to ligands or receptors that have specific binding activity to homologous receptors or ligands of neurons. Therefore, the antisense compounds can specifically target neurons by binding to receptors or ligands expressed on neurons.

[0169] In some embodiments, the antisense compounds disclosed herein may be conjugated to antibodies. In some embodiments, the antibody is a neuron-targeting antibody, such as an antibody specific for neuron-specific cell surface markers.

[0170] IV. Pharmaceutical Preparations In some aspects, this application provides compositions containing the antisense nucleic acid compound described herein and a suitable carrier such as a buffer, solvent, or diluent. The composition may be a liquid, wherein the antisense compound is dissolved in a suitable solvent or diluent, or it may be a solid or lyophilized, wherein the antisense compound is present in dry form with a suitable carrier or buffer. Such compositions containing the antisense compound can be further formulated for specific uses, such as for achieving pharmacological effects in cell-based systems and / or for pharmaceutical applications. Therefore, this disclosure provides pharmaceutical formulations containing polynucleotides (such as ASO of this disclosure) and pharmaceutically acceptable carriers.

[0171] Pharmaceutical formulations can be administered topically or systemically. In some respects, pharmaceutical formulations can have any mode of administration. In some respects, administration can be carried out via any route, including intravenous, intrathecal, intraventricular, subcutaneous, pulmonary, intramuscular, intraperitoneal, skin, oral, inhalation, or nasal administration.

[0172] This disclosure provides pharmaceutical formulations comprising one or more of the antisense compounds described herein. Such pharmaceutical formulations may contain suitable pharmaceutically acceptable diluents or carriers, such as pharmaceutical-grade diluents or carriers. In some embodiments, the pharmaceutical formulation comprises a sterile saline solution and one or more antisense compounds. In some embodiments, such pharmaceutical formulations may consist of a sterile saline solution and one or more antisense compounds. In some embodiments, the pharmaceutical formulation comprises one or more antisense compounds and sterile water. In some embodiments, the pharmaceutical formulation consists of one or more antisense compounds and sterile water. In some embodiments, the pharmaceutical formulation comprises one or more antisense compounds and phosphate-buffered saline (PBS).

[0173] The antisense compounds of this disclosure may be mixed with pharmaceutically acceptable active and / or inert substances to prepare pharmaceutical formulations or preparations, depending on the intended route of administration, disease severity, or dose to be administered.

[0174] The pharmaceutical formulations containing antisense compounds described herein encompass any pharmaceutically acceptable salt, ester, or salt of such esters. In some embodiments, the pharmaceutical formulations containing antisense compounds comprise one or more oligonucleotides that, upon administration to animals (including humans), provide (directly or indirectly) their biologically active metabolites or residues. Therefore, for example, this disclosure also relates to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0175] Prodrugs may include the addition of additional nucleosides to one or both ends of an antisense compound, which are cleaved by endogenous nucleases in the body to form an active antisense nucleic acid compound.

[0176] In some embodiments, the pharmaceutical formulations provided herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical formulations, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0177] Lipid moieties have been used in a variety of compositions and methods for nucleic acid therapy and its delivery systems. For example, nucleic acids can be introduced into pre-formed liposomes or lipid complexes made from a mixture of cationic and neutral lipids. In some methods, DNA complexes having monocationic or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, the lipid moieties are selected to increase the distribution of the agent to specific cells or tissues. In some embodiments, the lipid moieties are selected to increase the distribution of the agent to adipose tissue. In some embodiments, the lipid moieties are selected to increase the distribution of the agent to muscle tissue.

[0178] In some implementations, the antisense compound may be delivered via liposomes, nanoparticles, lipid nanoparticles (LNPs), polymers, microparticles, microcapsules, micelles or extracellular vesicles, and formulations containing them.

[0179] In some embodiments, the antisense compound may be delivered via lipid nanoparticles (LNPs). Examples of LNPs capable of delivering antisense compounds are described in WO / 2015 / 074085, WO / 2016 / 081029, WO / 2017 / 117530, WO / 2018 / 118102, WO / 2018 / 119163, WO / 2018 / 222926, WO / 2019 / 191780, and WO / 2020 / 154746. In some embodiments, the LNP may be decorated with a targeting portion (e.g., an antibody, receptor, or fragment thereof capable of binding a target ligand).

[0180] In some embodiments, the lipid nanoparticles comprise (a) nucleic acids (e.g., antisense compounds described herein), (b) cationic lipids, (c) aggregation-reducing agents (such as PEG-lipids), (d) optionally non-cationic lipids (such as neutral lipids), and (e) optionally sterols. In one embodiment, the lipid nanoparticles comprise (i) at least one cationic lipid; (ii) a neutral lipid, such as DSPC; (iii) a sterol, such as cholesterol; and (iv) PEG-lipids in a molar ratio of about 20%-65% cationic lipids: 5%-25% neutral lipids: 25%-55% sterols; 0.5%-15% PEG-lipids. In some embodiments, the cationic lipids are selected from ATX-002, ATX-081, ATX-095, or ATX-126, as described in WO / 2018 / 222926.

[0181] In some embodiments, the antisense compound is delivered via a nanocarrier comprising a molecule capable of enabling specific receptor-mediated endosome uptake. In one embodiment, the molecule enables receptor binding, endosome uptake, controlled degradation of the endosome membrane, and release of the antisense compound into target cells. Examples of nanocarriers capable of delivering antisense compounds are described in WO / 2009 / 141257. In some embodiments, the nanocarrier is a lipid-based nanocarrier, such as lipid nanoparticles (LNPs).

[0182] The pharmaceutical formulations provided herein may comprise one or more modified oligonucleotides and one or more excipients. In some such embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0183] The pharmaceutical formulations described herein may comprise a cosolvent system comprising, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is an anhydrous ethanol solution comprising 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can be varied significantly without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components can be varied; for example, other surfactants may be used instead of polysorbate 80™; the fraction size of the polyethylene glycol may be varied; other biocompatible polymers may be used instead of polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides may be used instead of dextrose.

[0184] Pharmaceutical formulations as described herein can be formulated for, i.e., prepared for, oral, nasal, sublingual, or injectable administration (e.g., intravenous, intrathecal, intraventricular, subcutaneous, intramuscular, etc.). For example, pharmaceutical formulations may contain a carrier and be formulated in an aqueous solution, such as water, or a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or saline buffer. In some embodiments, other components are included (e.g., components that aid in dissolution or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some pharmaceutical formulations for injection are presented in unit dosage forms, such as in ampoules or multi-dose containers. Some pharmaceutical formulations for injection are suspensions, solutions, or emulsions in oily or aqueous media and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for pharmaceutical formulations for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0185] V. Application Method The effective dose of the antisense compound or pharmaceutical preparation containing the antisense compound in this disclosure may be sufficient to reduce expression under physiological conditions. UBE3A The amount of UBE3A mRNA or UBE3A protein in cells or tissues. For example, an effective dose of the antisense compound described herein can reduce the expression of UBE3A in neurons of individuals with Dup15q syndrome. UBE3A mRNA levels. In some cases, an effective dose will... UBE3A The expression level decreased from that seen in tetraploid idic(15) individuals to that seen in diploid individuals. In some cases, the effective dose will... UBE3AThe expression level decreased from that seen in triploid Dup15q syndrome individuals to that seen in diploid individuals. In these ways, an effective dose can reduce the expression level in neurons of Dup15q individuals. UBE3A The level of expression relative to UBE3A Normalization of subjects without maternal duplication in the allele. Expression under physiological conditions in the absence of an effective dose of the antisense compound or its pharmaceutical formulation described herein. UBE3A Compared to neurons containing genes, an effective dose of the antisense compound of this disclosure or a pharmaceutical preparation containing an antisense compound induces the expression of genes in neurons of the central nervous system. UBE3A The levels of mRNA or UBE3A protein are reduced by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the effective dose makes... UBE3A The amount of mRNA or UBE3A protein is reduced by one-third or about one-half. In some embodiments, the effective dose makes... UBE3A The amount of mRNA or UBE3A protein is reduced by more than half.

[0186] A therapeutically effective dose can be sufficient to reduce, slow, stop, or reverse the activity of neurons in the central nervous system of subjects with Dup15q syndrome. UBE3A The effect of overexpression on the amount of the antisense compound or its formulation. In some embodiments, the therapeutically effective dose causes, compared to neurons in a subject in the absence of a therapeutically effective dose of the antisense compound or its pharmaceutical formulation described herein, to... UBE3A The levels of mRNA or UBE3A protein are reduced by approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the therapeutically effective dose of the antisense compound or its formulation provided herein reduces the levels of mRNA or UBE3A protein in the central nervous system of individuals with Dup15q syndrome. UBE3A Normalization of expression level to UBE3A Alleles are at the level seen in diploid individuals (i.e., individuals without maternal duplication in the alleles).

[0187] Therapeutic effective doses can be administered to the subject in one or more separate administrations via different routes. As understood in the art, a therapeutic effective dose or therapeutically effective amount is determined primarily based on the total amount of therapeutic agent contained in the pharmaceutical formulation of this disclosure. Typically, a therapeutically effective amount is sufficient to achieve a meaningful benefit to the subject (e.g., treatment, modulation, cure, prevention, and / or improvement of neuronal activity in the central nervous system). UBE3A(Overexpression of the relevant disease or condition). For example, a therapeutically effective amount may be sufficient to achieve the desired therapeutic and / or preventative effects. Typically, the amount of therapeutic agent (e.g., ASO as described herein) administered to a subject with an appropriate need will depend on the characteristics of the subject. Such characteristics include the subject's... UBE3A Allelic ploidy, disease severity, general health status, age, sex, and weight. Based on this disclosure, those skilled in the art can determine an appropriate dosage based on these and other relevant factors, such as the pharmacodynamic and pharmacokinetic properties of the therapeutic agents described herein. Furthermore, both objective and subjective determinations may be optionally employed to identify the optimal dosage range.

[0188] A therapeutically effective dose of the antisense compound described herein may be administered to a subject via an appropriate route of administration. For example, the dose may be administered locally or systemically. In some embodiments, the dose of the antisense compound may be administered to a subject via intravenous, intrathecal, intraventricular, subcutaneous, pulmonary, intramuscular, intraperitoneal, skin, oral, inhalation, or nasal administration. In some embodiments, a therapeutically effective dose of the antisense compound may be administered directly to the central nervous system of the subject. Suitable CNS delivery routes for administering the antisense compounds and their pharmaceutical formulations described herein include, for example, intrathecal injection, intracerebellar injection, and intraventricular (internal) injection. In some embodiments, the compounds and formulations described herein may be administered via intrathecal injection into the cerebrospinal fluid (CSF) of a subject in a recumbent (e.g., Trendlenberg position) position, with or without post-injection fluid flushing to disperse the injected fluid and increase CNS distribution in the subject.

[0189] The methods described herein envision both single and multiple applications of therapeutically effective doses of the polynucleotides described herein (e.g., targeted polynucleotides). UBE3A (ASO of nucleic acids). Pharmaceutical formulations containing the polynucleotides described herein can be administered periodically, depending on the nature, severity, and extent of the subject's condition (e.g., the severity of the subject's disease state and associated symptoms). In some embodiments, a therapeutically effective amount of the polynucleotides of this disclosure can be administered periodically at regular intervals, such as once a year, once every six months, once every four months, once every three months, once every two months, once a month, once every two weeks, once a week, or more frequently than once a week. For example, a therapeutically effective amount of the ASO of this disclosure can be administered once a week, once every two weeks, or once a month.

[0190] In some embodiments, the pharmaceutical formulations of this disclosure are formulated to facilitate the prolonged release of the polynucleotides contained therein. Such prolonged-release compositions can be conveniently administered to subjects at extended dosing intervals. Pharmaceutical formulations for reservoir administration (e.g., subcutaneous, intramuscular) to deliver or release the polynucleotides of this disclosure over extended time periods are also envisioned herein. The prolonged-release approach may be combined with modifications to the polynucleotides to enhance stability.

[0191] In some embodiments, administration of a therapeutically effective dose of a composition or formulation containing the polynucleotide of this disclosure may result in a reduction in the level of UBE3A protein in the CNS neurons of the treated subject. In some embodiments, administration of a composition or formulation containing the polynucleotide of this disclosure results in a reduction of UBE3A protein levels in the neurons of the subject by 1 / 3, 1 / 2, 1 / 3 to 1 / 2, or greater than 1 / 2, relative to baseline UBE3A protein levels in the subject before treatment or relative to baseline UBE3A protein levels in age-matched, disease-state-matched, or genotype-matched subjects with Dup15q syndrome. In some embodiments, administration of a therapeutically effective dose of a composition or formulation containing the polynucleotide of this disclosure will result in a reduction in UBE3A protein levels relative to baseline UBE3A protein levels in the CNS tissue of the subject before treatment.

[0192] In some embodiments, when administered periodically, a therapeutically effective dose results in a reduction in UBE3A expression in CNS neurons compared to baseline levels prior to treatment. In some embodiments, administration of a therapeutically effective dose of the compound of this disclosure or a formulation containing an antisense compound results in the expression level of UBE3A in the subject's CNS neurons being equal to or less than about 1 / 3 or 1 / 2, or equal to or less than about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 35%, about 30%, or about 25%, compared to the expression level in the subject's neurons prior to treatment.

[0193] The therapeutically effective dose of the antisense compound or its formulation described herein may comprise approximately 0.01 to approximately 50 mg of the antisense compound per kg of subject body weight. For example, an effective therapeutic dose could be approximately 0.1 to approximately 50 mg / kg body weight, approximately 0.1-25 mg / kg, approximately 0.1-20 mg / kg, approximately 0.1-15 mg / kg, approximately 0.1-10 mg / kg, approximately 0.1-5 mg / kg, approximately 0.1-1 mg / kg, approximately 1 mg / kg, approximately 2 mg / kg, approximately 3 mg / kg, approximately 4 mg / kg, approximately 5 mg / kg, approximately 6 mg / kg, approximately 7 mg / kg, approximately 8 mg / kg, approximately 9 mg / kg, approximately 10 mg / kg, approximately 11 mg / kg, approximately 12 mg / kg, approximately 13 mg / kg, approximately 14 mg / kg, approximately 15 mg / kg, approximately 16 mg / kg, approximately 17 mg / kg, approximately 18 mg / kg, approximately 19 mg / kg, approximately 20 mg / kg, approximately 21 mg / kg, approximately 22 mg / kg, approximately 23 mg / kg, approximately 24 mg / kg, approximately 25 mg / kg, etc. mg / kg, approximately 1-50 mg / kg, approximately 5-50 mg / kg, approximately 10-50 mg / kg, approximately 15-50 mg / kg, approximately 20-50 mg / kg, or approximately 25-50 mg / kg of subject weight.

[0194] In some embodiments, the therapeutically effective dose of the antisense compound or its formulation described herein may comprise about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, or about 20 mg of the antisense compound. The therapeutically effective dose of the antisense compound may be based on the subject's age, sex, disease severity, UBE3A Copy number or a combination thereof.

[0195] VI. Treatment methods This disclosure provides antisense compounds and their formulations for use in improving, preventing, delaying, or treating neuronal activity in the central nervous system of a subject. UBE3A The expression of increased related conditions, such as those expressed by the subject UBE3A It is used for symptoms or conditions caused by maternal duplication in genes. Therefore, it is also provided for improving, preventing, delaying the onset or treatment of conditions associated with elevated UBE3A protein levels in the subject's CNS, such as those caused by the subject's... UBE3AMethods for addressing symptoms or conditions caused by maternal duplication in genes. In some embodiments, the subject is diagnosed with Dup15q syndrome. In some embodiments, the subject is diagnosed with isocentropic dicentric duplication Dup15q syndrome (idic(15)). In some embodiments, the method includes administering an antisense compound or a pharmaceutical preparation thereof to the subject. In some embodiments, the method may further include administering one or more additional therapeutic agents (i.e., "second agent") before, simultaneously with, or after administering the antisense compound or a pharmaceutical preparation thereof.

[0196] Medications that can be co-administered as a second agent according to the methods described herein include, for example, growth hormone, seizure medications (e.g., lorazepam, diazepam, rufenamide, phenytoin, valproic acid, felbamate, levetiracetam, lamotrigine, clonazan, carbamazepine, topiramate, oxcarbazepine, lacosamide, zonisamide, prednisone / prednisolone, and vigabatrin), and medications for abnormal behavior (e.g., clonidine, sertraline, risperidone, quetiapine, and olanzapine), and antidepressants.

[0197] Throughout this specification, when a composition is described as having, including, or comprising a particular component, or when a process or method is described as having, including, or comprising a particular step, it is also contemplated that compositions of this disclosure are substantially composed of or comprised of said components, as well as processes and methods of this disclosure that are substantially composed of or comprised of said steps.

[0198] In this application, when an element or component is considered to be included and / or selected from the list of enumerated elements or components, it should be understood that the element or component may be any one of the enumerated elements or components, or the element or component may be selected from a group consisting of two or more of the enumerated elements or components.

[0199] Furthermore, it should be understood that the elements and / or features of the compositions or methods described herein can be combined in various ways without departing from the spirit and scope of this disclosure, whether express or implied herein. For example, in the case of reference to a particular compound, unless otherwise understood from the context, that compound can be used in various embodiments of the compositions and / or methods of this disclosure. In other words, embodiments have been described and depicted in this application in a manner that enables the writing and drawing of the application to be clear and concise; however, it is intended and will be understood that embodiments can be combined or separated in various ways without departing from the teachings and disclosure. For example, it should be understood that all features described and depicted herein are applicable to all aspects of this disclosure described and depicted herein. All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be replaced by an alternative feature serving the same, equivalent, or similar purpose.

[0200] It should be understood that, unless otherwise understood from the context and use, the expression "at least one" includes each of the stated objects as described, as well as various combinations of two or more stated objects. Unless otherwise understood from the context, the expression "and / or" relating to three or more stated objects will be understood to have the same meaning.

[0201] The use of the terms “include,” “includes,” “including,” “have,” “has,” “having,” “contains,” or “containing,” including their grammatical equivalents, will generally be understood as open-ended and non-restrictive, for example, not excluding additional unlisted elements or steps unless otherwise expressly stated or understood from the context.

[0202] Any and all example or exemplary language used herein, such as “for instance,” “such as,” “for example,” “e.g.,” or “including,” is intended only to better illustrate this disclosure and does not constitute a limitation on the scope of this disclosure unless claimed. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the subject matter of this disclosure.

[0203] It should be understood that this disclosure is not limited to the specific methods, schemes, materials, and reagents described, as these can vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of this disclosure, which will be covered only by the appended claims.

[0204] While the antisense nucleic acid compounds, compositions, formulations, and methods described herein have been specifically described with reference to certain embodiments, the following examples are merely illustrative of these compounds, compositions, formulations, and methods and are not intended to limit them.

[0205] Although the sequence listing attached to this document identifies each sequence as “RNA” or “DNA” as needed, in practice, those sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily understand that, in some cases, the names such as “RNA” or “DNA” used to describe modified oligonucleotides are arbitrary. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA with a modified sugar (2'-OH for the native 2'-H of DNA) or RNA with a modified base (thymine (methylated uracil) for the native uracil of RNA).

[0206] Therefore, the nucleic acid sequences provided herein (including, but not limited to, those in the sequence listing) are intended to cover nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleobases. As a further example and not a limitation, antisense nucleic acid compounds having the nucleobase sequence “ATCGATCG” cover any nucleic acid compound having such a nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds containing RNA bases, such as those having the sequence “AUCGAUCG” and those having some DNA bases and some RNA bases, such as “AUCGATCG”, as well as nucleic acid compounds having other modified or naturally occurring bases, such as “ATmeCGAUCG”, where meC represents a cytosine base containing a methyl group at position 5.

[0207] All publications, patents and patent applications mentioned throughout this specification, including any drawings, sequences and appendices therein, are incorporated herein by reference in their entirety for all purposes, to the extent that each individual publication, patent or patent application, drawing, sequence or appendice is specifically and individually indicated to be incorporated herein by reference in its entirety for all purposes.

[0208] List of implementation plans The scope of this disclosure is indicated by the appended claims and the embodiments listed below, and all changes falling within the meaning and scope of equivalents of the claims and the listed embodiments are intended to be included therein. Therefore, this disclosure provides: Implementation Scheme 1. A nucleic acid compound, such as an antisense oligonucleotide (ASO), comprising at least 16 consecutive nucleotides and having a nucleotide sequence selected from SEQ ID NO:285 to SEQ ID NO:562, said nucleic acid compound comprising one or more of the following: a) A gap segment composed of linked deoxynucleosides; b) A 5' segment consisting of at least two linked nucleosides; c) A 3' segment consisting of at least two linked nucleosides; d) At least one thiophosphate nucleoside bond; e) at least one nucleoside containing a modified sugar; and f) At least one nucleoside containing a modified nucleobase.

[0209] Implementation Scheme 2. The nucleic acid compound according to Implementation Scheme 1, wherein the gap segment is located between the 5' segment and the 3' segment.

[0210] Implementation Scheme 3. The nucleic acid compound according to Implementation Scheme 1 or 2, wherein the nick segment contains 5 to 15 linked nucleosides.

[0211] Implementation Scheme 4. A nucleic acid compound according to any one of Implementation Schemes 1-3, wherein the 3' segment contains 2-5 linked nucleosides.

[0212] Implementation Scheme 5. A nucleic acid compound according to any one of Implementation Schemes 1-4, wherein the 5' segment contains 2-5 linked nucleosides.

[0213] Implementation Scheme 6. The nucleic acid compound according to any one of Implementation Schemes 1-5, wherein at least one nucleotide of the 5' segment and at least one nucleotide of the 3' segment comprise a modified sugar.

[0214] Implementation Scheme 7. The nucleic acid compound according to any one of Implementation Schemes 1-6, wherein each nucleoside of the 5' segment and each nucleoside of the 3' segment comprises a modified sugar.

[0215] Implementation Scheme 8. The nucleic acid compound according to any one of Implementation Scheme 6 or 7, wherein the modified sugar includes a bicyclic sugar.

[0216] Implementation Scheme 9. The nucleic acid compound according to Implementation Scheme 8, wherein the bicyclic sugar is selected from the group consisting of: 2′-O(CH2)2OCH3 (MOE); 4′-(CH2)—O-2′ (LNA); 4′-(CH2)2—O-2′ (ENA); and 4′-CH(CH3)—O-2′ (cEt).

[0217] Implementation Scheme 10. The nucleic acid compound according to any one of Implementation Schemes 1-9, wherein each nucleoside bond is a thiophosphate nucleoside bond.

[0218] Implementation Scheme 11. The nucleic acid compound according to any one of Implementation Schemes 1-10, comprising a 5-methylcytosine nucleobase replacing a non-5-methylcytosine residue.

[0219] Implementation Scheme 12. The nucleic acid compound according to any one of Implementation Schemes 1-11, comprising a 3-10-3 LNA-DNA-LNA gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

[0220] Implementation Scheme 13. The nucleic acid compound according to any one of Implementation Schemes 1-11, comprising a 3-11-3 LNA-DNA-LNA gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

[0221] Implementation Scheme 14. The nucleic acid compound according to any one of Implementation Schemes 1-11, comprising a 3-12-3 LNA-DNA-LNA gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

[0222] Implementation Scheme 15. The nucleic acid compound according to any one of Implementation Schemes 1-11, comprising a 4-11-5 MOE-DNA-MOE gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

[0223] Implementation Scheme 16. The nucleic acid compound according to any one of Implementation Schemes 1-15, wherein the nucleic acid compound comprises a nucleotide sequence according to SEQ ID NO: 295, 307, 309, 310, 327, 328, 329, 330, 340, 341, 342, 343, 351, 356, 359, 366, 394, 402, 523, 527, 528, 529, 539, 542, 549, 550, 551 or 553.

[0224] Implementation Scheme 17. The nucleic acid compound according to Implementation Scheme 1, wherein the nucleic acid compound is according to compound ID numbers 16-63326LNA, 17-29823LNA, 17-29855LNA, 17-29858LNA, 17-63264LNA, 17-63289LNA, 17-63290LNA, 17-63291LNA, 17-63324LNA, 17-63325LNA, 17-63326LNA, 17-63327LNA, 17-6345 Gapmers for 8LNA, 17-67260LNA, 18-435LNA, 18-29854LNA, 18-63323LNA, 18-63458LNA, 17-63278LNA, 17-63286LNA, 17-63287LNA, 17-63288LNA, 17-63437LNA, 17-29853LNA, 18-63282LNA, 18-63285LNA, 18-63286LNA, or 18-63325LNA.

[0225] Implementation Scheme 18. An antisense oligonucleotide (ASO) comprising: a 5' segment of three linked locked nucleic acid (LNA) nucleosides, a nick segment of a linked deoxynucleoside, and a 3' segment of three linked LNA nucleosides, wherein all nucleoside bonds are phosphate thioester nucleoside bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:550.

[0226] Implementation Scheme 19. An antisense oligonucleotide (ASO) comprising: a 5' segment of three linked locked nucleic acid (LNA) nucleosides, a nick segment of a linked deoxynucleoside, and a 3' segment of three linked LNA nucleosides, wherein all nucleoside bonds are phosphate thioester nucleoside bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:542.

[0227] Implementation Scheme 20. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:394.

[0228] Implementation Scheme 21. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleosides, a nick region of a linked deoxynucleoside, and a 3' region of three linked LNA nucleosides, wherein all nucleoside bonds are phosphate thioester nucleoside bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:328.

[0229] Implementation Scheme 22. An antisense oligonucleotide (ASO) comprising: a 5' segment of three linked locked nucleic acid (LNA) nucleotides, a nick segment of a linked deoxynucleotide, and a 3' segment of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:342.

[0230] Implementation Scheme 23. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:356.

[0231] Implementation Scheme 24. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:295.

[0232] Implementation Scheme 25. An antisense oligonucleotide (ASO) comprising: a 5' segment of three linked locked nucleic acid (LNA) nucleotides, a nick segment of a linked deoxynucleotide, and a 3' segment of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:351.

[0233] Implementation Scheme 26. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:307.

[0234] Implementation Scheme 27. The nucleic acid compound or ASO according to any one of Implementation Schemes 1-26, wherein all cytosine nucleosides are replaced by 5-methylcytosine nucleosides.

[0235] Implementation Scheme 28. The nucleic acid compound or ASO according to any one of Implementation Schemes 1-27 contains a 2'OMe-modified nucleoside at position 2 in the DNA nick.

[0236] Implementation Scheme 29. A composition comprising any one of the nucleic acid compounds or ASO or a salt thereof from Implementation Schemes 1-28 and a pharmaceutically acceptable carrier.

[0237] Implementation Scheme 30. The composition according to Implementation Scheme 29, wherein the composition is a pharmaceutical preparation.

[0238] Implementation Scheme 31. A method for reducing cell... UBE3A A method for reducing RNA levels in the cells includes contacting the cells with a nucleic acid compound or ASO according to any one of embodiments 1-28 or a composition according to embodiment 29 or 30, thereby reducing RNA levels in the cells. UBE3A RNA levels.

[0239] Implementation Scheme 32. A method for inhibiting the expression of UBE3A protein in cells, comprising contacting the cells with a nucleic acid compound or ASO according to any one of Implementation Schemes 1-28 or a composition according to Implementation Scheme 29 or 30, thereby reducing the expression of UBE3A protein in the cells.

[0240] Implementation Scheme 33. The method according to Implementation Scheme 31 or 32, wherein the cell is a neuron of the central nervous system.

[0241] Implementation Scheme 34. The method according to any one of Implementation Schemes 31-33, wherein the cells are for UBE3A The gene is triploid or tetraploid.

[0242] Implementation Scheme 35. The method according to any one of Implementation Schemes 31-34, wherein the cell comprises UBE3A Maternal duplication of alleles.

[0243] Implementation Scheme 36. The method according to any one of Implementation Schemes 31-35, wherein the cells are in vitro.

[0244] Implementation Scheme 37. The method according to any one of Implementation Schemes 31-35, wherein the cells are in the subject.

[0245] Implementation Scheme 38. The method according to Implementation Scheme 37, wherein the subject is a human and the nucleic acid compound, ASO, or composition is administered to the subject.

[0246] Implementation Scheme 39. The method according to Implementation Scheme 38, wherein the nucleic acid compound or ASO is administered to the subject via intravenous, subcutaneous, intramuscular, intraperitoneal, intrathecal, intracerebrospinal, or intraventricular injection.

[0247] Implementation Scheme 40. A method for treating, preventing, or improving neurons in the central nervous system of a subject. UBE3AA method for treating, preventing, or improving a disease associated with overexpression of an ASO compound according to any one of embodiments 1-28 or according to embodiment 29 or 30, by administering the ASO compound to the subject.

[0248] Implementation Scheme 41. The method according to Implementation Scheme 40, wherein the disease is Dup15q syndrome.

[0249] Implementation Scheme 42. The method according to Implementation Scheme 40 or 41, wherein the subject has the idic(15) genotype.

[0250] Implementation Scheme 43. The method according to any one of Implementation Schemes 37-42, comprising administering to the subject a second agent for treating, preventing or improving one or more symptoms of Dup15q syndrome.

[0251] Implementation Scheme 44. A nucleic acid compound or ASO according to any one of Implementation Schemes 1-28, or a composition according to Implementation Scheme 29 or 30, for use in the treatment, prevention, or improvement of neurons in the central nervous system of a subject. UBE3A It is used in methods related to the overexpression of disease.

[0252] Implementation Scheme 45. The nucleic acid compound or ASO used according to Implementation Scheme 44, wherein the disease is Dup15q syndrome.

[0253] Implementation Scheme 46. The nucleic acid compound or ASO used according to Implementation Scheme 44 or 45, wherein the subject has the idic(15) genotype.

[0254] Implementation Scheme 47. Use of the nucleic acid compound or ASO according to any one of Implementation Schemes 1-28 or the composition according to Implementation Scheme 29 or 30 for the treatment of a disease associated with elevated levels of UBE3A protein in neurons of the central nervous system of a subject.

[0255] Implementation Scheme 48. Use of the nucleic acid compound or ASO according to any one of Implementation Schemes 1-28 or the composition according to Implementation Scheme 29 or 30 in the preparation of a medicament for treating a disease associated with elevated levels of UBE3A protein in neurons of the central nervous system of a subject.

[0256] Implementation Scheme 49. The use according to Implementation Scheme 47 or 48, wherein the disease is Dup15q syndrome.

[0257] Implementation Scheme 50. The use according to any one of Implementation Schemes 47-49, wherein the subject has the idic(15) genotype.

[0258] Example The present disclosure will now be described in general, and will be more readily understood by referring to the following examples, which are intended to illustrate certain aspects and implementations of the disclosure and are not intended to limit the scope of the disclosure.

[0259] Example 1: ASO Design and Initial Screening Design antisense oligonucleotides of 16, 17, 18, and 20 nucleotide lengths (i.e., 16-, 17-, 18-, and 20-mer, respectively) targeting hg38 chr15:25371667-25439024 (human). UBE3A The target region is a portion of the gene containing at least a portion of the 5' UTR to at least a portion of exon 7. The target region is provided herein as SEQ ID NO:1. The selection of the target region is emphasized. UBE3A The 5' region of the gene promotes faster decay of the mRNA transcript, thereby promoting more efficient ASO.

[0260] In design targeting humans UBE3A When targeting antisense compounds of the target region sequence (SEQ ID NO:1), repeating regions are filtered out to avoid 3' guanine (G) residues. Demothering temperature and GC content are evaluated and considered to avoid off-target interactions within the human genome, and to identify compounds with a preference for human and non-human primates (cynomolgus monkeys). macaca fascicularis )), pig (pig( sus scrofa )) and rodents (house mouse ( mus musculus Homology among target sequences in model organisms was assessed. Based on these parameters, an initial set of ASOs was designed, synthesized, and evaluated in in vitro potency screening (Table 1).

[0261] Each ASO is assigned a unique compound ID with the following informational components: [ASO nucleotide length] - [start position] - [optional SNP alteration] - [chemical modification]. The [ASO nucleotide length] component of each compound ID represents the length of the linker nucleotide of the ASO (e.g., "16", "17", "18", or "20"). The [start position] component represents the nucleotide position of the first 5' residue targeted by the ASO relative to SEQ ID NO:1 (e.g., "480" or "63462", etc.). The [optional SNP alteration] component represents the nucleotide position relative to the target nucleotide. UBE3ASequence-introduced single nucleotide mismatches are used to elucidate the potential impact of single nucleotide polymorphisms (SNPs) falling within the target sequence in certain ASOs, where a single nucleotide within the ASO (located in the middle portion (SNPM) or near the 3' end (SNPE)) is altered according to the underlined residues provided in Table 1 for SNPM and SNPE ASOs. Finally, the [Chemical Modification] component indicates whether each ASO is modified with locked nucleic acid or 2'-O-methoxy-ethyl, as further described below.

[0262] The initial ASO set for screening included locked nucleic acid (LNA-modified) and 2'-O-methoxy-ethyl (MOE-modified) molecules. The LNA-modified ASO contained three linked 5'LNA-modified nucleosides, followed by 10–12 linked DNA nucleosides, and then three linked 3'LNA-modified nucleosides, with fully phosphate-thioester-modified internucleotide bonds, i.e., 3-10-3 and 3-12-3LNA-DNA-LNA gapmers. The MOE-modified ASO contained four linked 5'MOE-modified nucleosides, followed by 11 linked DNA nucleosides, and then five linked 3'MOE-modified nucleosides, with mixed phosphate-thioester and phosphodiester-modified internucleotide bonds, i.e., 4-11-5MOE-DNA-MOE gapmers. All synthesized and screened ASOs had 5-methylcytosine replacing all cytosine residues.

[0263] Throughout the study described herein, certain ASO sequences were used as positive and negative controls. Randomized ASO sequences 17-SCRA1LNA (GATTACAGATTACACAT, SEQ ID NO:563), 18-SCRA2LNA (CATCATCATCATCATCAT, SEQ ID NO:564), and 20-SCRA3MOE (ACATCATCATCATCATCATC, SEQ ID NO:565) were used as negative controls. As positive controls, 20-CTRL1MOE (GGATTCAACTGCTGTCCTTG, SEQ ID NO:566) and 20-CTRL2MOE (TGAGCTATCACCTATCCTTG, SEQ ID NO:567) were used. The positive control ASO 20-CTRL1MOE is described as ASO-015 (SEQ ID NO:298) in US Patent Application Publication No. US / 2022 / 0259601A1, and 20-CTRL2MOE is described in Elamin et al., Stem Cell Reports 18.4 (2023): 884-898 (see Supplementary Information therein).

[0264] In short, a mixed population of normal human H9 neurons was differentiated from a commercially available H9 neural progenitor cell line (Millipore-Sigma, cat# SCR055, ENStem Human Neural Progenitor Cell Expansion Kit). A master cell bank of cryopreserved differentiated H9 neurons was generated and used as the neuron source for ASO selection experiments. H9 neurons were thawed and seeded at 120,000 cells per well in 96-well plates and cultured for 2 weeks to establish mature neuronal cultures. Neurons were treated with a final concentration of 3 μM ASO via naked transfection (gymnosis) and cultured for 6 or 10 days without changing the medium, after which the medium was removed and the cells were lysed. UBE3A mRNA levels were evaluated using the QuantiGene assay (Thermo Fisher Scientific), a hybridization-based assay for the direct measurement of RNA transcripts. A selected group of ASOs were identified using both singlet and multiplex assays, which consistently and effectively knocked down the RNA in experiments (Table 2).

[0265] Table 2 provides the best-performing ASOs identified through initial single-power and multiple-power screening. UBE3A Knockout efficiency, measured relative to untreated control neurons. UBE3A The percentage of mRNA (“%KD”) is expressed as follows (i.e., as an example, “-50%” means a 50% reduction relative to the untreated control, and “50%” means a 50% increase relative to the untreated control). The calculated standard deviation (“St Dev”) and coefficient of variation (“%CV”) for each ASO are also reported in Table 2.

[0266] Table 1. Humans UBE3A ASO – Initial Screening Table 2. ASOs selected from the initial screening Analysis of the ASOs described in Table 2 reveals that many of the best-performing ASOs clustered around the target. UBE3A The regions of the loci are indicated to be highly sensitive to knockdown via antisense mechanisms. These "hotspots" are then used as target sequences for designing additional ASOs, as described in Example 2.

[0267] Example 2: Hotspot identification and secondary ASO screening UBE3A The discovery of certain regions within the target sequence demonstrates the necessity to design and screen additional ASO target sequences targeting these hotspots. UBE3A Regions where ASOs efficiently aggregate within the target sequence. Because the initial screening did not include all designed ASOs, but only those along the target sequence... UBE3A The selection of tightly tiled target sequences was used for hotspot identification, and therefore all remaining ASOs designed for these hotspot regions were subsequently tested. Additional ASOs were screened for their knockdown potency in normal human neurons. Neurons were cultured as in Example 1 and treated with 3 μM ASO for 10 days. The results of the secondary screening of hotspot ASOs are provided in Table 3, where... UBE3A Knockdown efficiency is expressed as measured relative to untreated control neurons. UBE3A mRNA percentage (“%KD”) (i.e., as an example, “-50%” means a 50% reduction relative to the untreated control, and “50%” means a 50% increase relative to the untreated control). Normalized expression levels for the untreated control are also provided (“normalized for UT”).

[0268] Table 3. Hot Topics in ASO – Secondary Filtering Example 3: Repeated studies confirmed the effectiveness of the best-performing ASO. The results of the initial and secondary ASO screenings were evaluated, and the top 30 ASO enhancement groups were selected for replication studies to confirm their knockdown efficacy in normal human neurons. Neurons were cultured as in Example 1 and treated with 3 μM ASO for 10 days. Normalized UBE3A mRNA levels were determined using the multiplex QuantiGene assay. The results are presented in Table 4.

[0269] Table 4. Results of the repeatability study The dose response was evaluated and the half-maximal inhibitory concentration (IC50) was calculated using selected ASOs from the repeatability studies shown in Table 4.

[0270] Example 4: Dose-response study in normal human neurons Following the confirmatory efficacy screening in Example 3, a dose-response study was conducted to determine the IC50 value of the selected ASO. Semi-log dilutions of the selected ASO, ranging from 30 μM to 1 nM, were applied to normal human neurons (H9) for 10 days (Table 5). UBE3AmRNA levels were measured using the multiplex QuantiGene assay. IC50 values ​​were calculated using four-parameter nonlinear regression curves generated using GraphPad Prism software. IC50, confidence interval (“Conf. Int.”), and R-squared (“R-sq.”) analyses are provided in Table 5. Dose-response curves for each selected ASO are shown in Table 5. Figures 1 to 7 middle.

[0271] Table 5. IC50 analysis of selected ASOs in human neurons Based on this analysis, the effectiveness of ASOs was determined, and candidates were ranked according to their effectiveness.

[0272] Example 5: Effectively reducing overexpression of [a specific substance] in iPSC-derived neurons of Dup15q-idic patients. UBE3A RNA and proteins Patient-derived induced pluripotent stem cells (iPSCs) from Dup15q patients with the idic(15) genotype (Dup1-8) and their engineered syngeneic control iPSC line (Dup1-8-corr) (where redundant chromosomes containing two additional UBE3A copies were removed using a CRISPR method (Elamin et al., 2022)) were purchased from the University of Connecticut (UCONN, Technology Commercialization Services Office of the Vice President for Research). iPSCs were differentiated into neurons using a highly efficient SMAD inhibition-mediated neural induction method via the STEMdiff SMADi neural induction kit (Stem Cell Technologies). The relative proportions of iPSC lines within the control group were [not specified in the original text]. UBE3A Genomic DNA levels, assessed by qPCR, were found to be approximately twice the control (corrected) level in the Dup15q idic line, as expected considering the tetraploid idic(15) genotype compared to wild-type diploid cells (data not shown). Relative levels in differentiated neurons... UBE3A mRNA levels were assessed using multiple QuantiGene assays and were found to be approximately twice the control levels in Dup15qidic ​​neurons. Because UBE3A The paternal alleles of Dup15q idic are silenced by antisense transcripts (ATS) in neurons. UBE3AThe predicted mRNA level was 3:1 compared to the syngeneic control neurons. However, the relationship between copy number and expression level did not appear to be linear, as inferred from studies of post-mortem brain tissue from Dup15q patients (Scoles et al., 2011; Molecular Autism, 2(1)).

[0273] To evaluate the effect on UBE3A mRNA levels, iPSC-derived Dup15q-idic(15) neurons were cultured for 10 days in the presence of 3 μM ASO (in triplicate). Measurements were taken. UBE3A mRNA was compared with an untreated control. Results were in Figure 8 As shown in the image.

[0274] To evaluate the effect on UBE3A protein levels, iPSC-derived Dup15q-idic(15) neurons were cultured for 10 days (in triplicate) in the presence of 3 μM ASO. UBE3A protein levels were measured (from a single well, N=1) and compared with an untreated control. Results were presented in... Figure 9 As shown in the image.

[0275] In summary, in human iPSC-derived Dup15q-idic(15) neurons UBE3A In the context of overexpression, the ASOs identified in these studies showed UBE3A Effective reduction in mRNA and protein levels.

[0276] Example 6: Dose-response study in Dup15q-idic(15) neurons Dose-response studies were conducted in Dup15q-idic(15) neurons to determine the IC50 values ​​of selected ASOs (17-29853LNA and 17-29823LNA). Semi-logarithmic dilutions of each ASO ranging from 30 μM to 1 nM were applied to idic(15) neurons in culture for 10 days. Figure 10 The results are provided, including IC50, confidence intervals (“CI”), and R-squared analysis.

[0277] Furthermore, Western blotting of ASO 17-29823LNA confirmed dose-dependent UBE3A protein knockdown, such as... Figure 11 As shown, the relative UBE3A protein levels after treatment with semi-logarithmic dilutions of 17-29823LNA ranging from 30 μM to 1 nM are displayed.

[0278] These data confirm that, despite UBE3A overexpression, dose-dependent target reduction in Dup15q idic neurons follows a similar pattern to that in normal human neurons (H9).

[0279] Example 7. In vivo tolerance study Twelve candidate ASOs were selected for in vivo tolerability screening in mice. Among the 12 ASOs tested, those with compound IDs 18-63285LNA, 17-63286LNA, and 17-63458LNA were found to have favorable tolerability characteristics.

[0280] Example 8. In vivo target binding Based on nucleotide sequences, 18-63285LNA (ASO1), 17-29853LNA (ASO2), 18-63286LNA (ASO3), 17-63286LNA (ASO4), and 17-63458LNA (ASO10) were expected to be compatible with the mouse Ube3a gene. To test the target binding of these ASOs in mice, Ube3a mRNA levels in the mouse cerebral cortex and hippocampus were measured after CNS delivery using the Quantigene RNA assay (N=2). Figure 12 As shown, all tested ASOs exhibited up to 30% Ube3a knockdown in mouse brain regions following a single bolus dose.

[0281] The antisense compound sequence described in this article .

Claims

1. An antisense oligonucleotide (ASO) comprising at least 16 consecutive nucleotides and having a nucleotide sequence selected from the following: SEQ ID NO:267 (GGTAGTAGCGTTCTATTA), SEQ ID NO:244 (GGTAGTAGCGTTCTATT), SEQ ID NO:68 (GCTGAGCTTGCTCCTTT), SEQ ID NO:111 (CGTGCAGGCTTCATTTCC), SEQ ID NO:268 (TGGTAGTAGCGTTCTATT), SEQ ID NO:259 (GTTGTCACACCAGTCTA), SEQ ID NO:58 (TCGTGCAGGCTTCATTT), SEQ ID NO:57 (CGTGCAGGCTTCATTTC), SEQ ID NO:12 (TCGTGCAGGCTTCATT), SEQ ID NO:73 (TCCTCTCTTTCTCTACA), SEQ ID NO:46 (TGGTGGTAGTAGCGTTC), and SEQ ID NO:47 (CTGGTGGTAGTAGCGTT), and wherein the ASO comprises one or more of the following: a) A gap segment composed of linked deoxynucleosides; b) A 5' segment consisting of at least two linked nucleosides; c) A 3' segment consisting of at least two linked nucleosides; d) At least one thiophosphate nucleoside bond; e) at least one nucleoside containing a modified sugar; and f) At least one nucleoside containing a modified nucleobase.

2. The ASO according to claim 1, wherein the gap segment is located between the 5' segment and the 3' segment.

3. The ASO according to claim 1 or 2, wherein the notched segment comprises 5 to 15 linked nucleosides.

4. The ASO according to any one of claims 1-3, wherein the 3' segment comprises 2-5 linked nucleosides.

5. The ASO according to any one of claims 1-4, wherein the 5' segment comprises 2-5 linked nucleosides.

6. The ASO according to any one of claims 1-5, wherein at least one nucleotide of the 5' segment and at least one nucleotide of the 3' segment comprise a modified sugar.

7. The ASO according to any one of claims 1-6, wherein each nucleotide of the 5' segment and each nucleotide of the 3' segment comprises a modified sugar.

8. The ASO according to any one of claims 6 or 7, wherein the modified sugar comprises a bicyclic sugar.

9. The ASO according to claim 8, wherein the bicyclic sugar is selected from the group consisting of: 2′-O(CH2)2OCH3 (MOE); 4′-(CH2)—O-2′ (LNA); 4′-(CH2)2—O-2′ (ENA); and 4′-CH(CH3)—O-2′ (cEt).

10. The ASO according to any one of claims 1-9, wherein each nucleoside bond is a phosphate thioside bond.

11. The ASO according to any one of claims 1-10, comprising a 5-methylcytosine nucleobase replacing a non-5-methylcytosine residue.

12. The ASO according to any one of claims 1-11, comprising a 3-10-3 LNA-DNA-LNA gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

13. The ASO according to any one of claims 1-11, comprising a 3-11-3 LNA-DNA-LNA gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

14. The ASO according to any one of claims 1-11, comprising a 3-12-3 LNA-DNA-LNA gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

15. The ASO according to any one of claims 1-11, comprising a 4-11-5 MOE-DNA-MOE gapmer, wherein all nucleoside inter-bondings are phosphate thioside inter-bondings.

16. An antisense oligonucleotide (ASO), wherein the ASO is according to compound ID numbers 16-63326LNA, 17-29823LNA, 17-29855LNA, 17-29858LNA, 17-63264LNA, 17-63289LNA, 17-63290LNA, 17-63291LNA, 17-63324LNA, 17-63325LNA, 17-63326LNA, 17-63327LNA, 17-63458LN A. 17-67260LNA, 18-435LNA, 18-29854LNA, 18-63323LNA, 18-63458LNA, 17-63278LNA, 17-63286LNA, 17-63287L gapmer for NA, 17-63288LNA, 17-63437LNA, 17-29853LNA, 18-63282LNA, 18-63285LNA, 18-63286LNA or 18-63325LNA.

17. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

550.

18. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

542.

19. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all nucleotide bonds are phosphate thioester nucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

394.

20. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

328.

21. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

342.

22. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all nucleotide bonds are phosphate thioester nucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

356.

23. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

295.

24. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleotide, and a 3' region of three linked LNA nucleotides, wherein all internucleotide bonds are phosphate thioester internucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

351.

25. An antisense oligonucleotide (ASO) comprising: a 5' region of three linked locked nucleic acid (LNA) nucleotides, a nick region of a linked deoxynucleoside, and a 3' region of three linked LNA nucleotides, wherein all nucleotide bonds are phosphate thioester nucleotide bonds, and wherein the ASO comprises the nucleotide sequence of SEQ ID NO:

307.

26. The ASO according to any one of claims 1-25, wherein all cytosine nucleosides are replaced by 5-methylcytosine nucleosides.

27. The ASO according to any one of claims 1-26, wherein a 2'OMe-modified nucleoside is contained at position 2 in the DNA nick.

28. A composition comprising ASO or a salt thereof according to any one of claims 1-27 and a pharmaceutically acceptable carrier.

29. The composition according to claim 28, wherein the composition is a pharmaceutical preparation.

30. A method to reduce cell... UBE3A A method for reducing RNA levels in the cells includes contacting the cells with ASO according to any one of claims 1-28 or the composition according to claim 28 or 29, thereby reducing RNA levels in the cells. UBE3A RNA levels.

31. A method for inhibiting the expression of UBE3A protein in cells, comprising contacting the cells with an ASO according to any one of claims 1-27 or a composition according to claim 28 or 29, thereby reducing the expression of UBE3A protein in the cells.

32. The method according to claim 30 or 31, wherein the cell is a neuron of the central nervous system.

33. The method according to any one of claims 30-32, wherein the cells are for UBE3A The gene is triploid or tetraploid.

34. The method according to any one of claims 30-33, wherein the cell comprises UBE3A Maternal duplication of alleles.

35. The method according to any one of claims 30-34, wherein the cells are in vitro.

36. The method according to any one of claims 30-34, wherein the cells are in the subject.

37. The method of claim 36, wherein the subject is a human, and the ASO or composition is administered to the subject.

38. The method of claim 37, wherein the ASO is administered to the subject via intravenous, subcutaneous, intramuscular, intraperitoneal, intrathecal, intracerebrospinal, or intraventricular injection.

39. A treatment, prevention, or improvement method for neurons in the central nervous system of a subject. UBE3A A method for treating, preventing, or improving a disease associated with overexpression of a substance, comprising administering to the subject ASO according to any one of claims 1-27 or a composition according to claim 28 or 29, thereby treating, preventing, or improving the disease.

40. The method of claim 39, wherein the disease is Dup15q syndrome.

41. The method according to claim 39 or 40, wherein the subject has the idic(15) genotype.

42. The method according to any one of claims 36-41, comprising administering to the subject a second agent for treating, preventing or improving one or more symptoms of Dup15q syndrome.

43. The ASO according to any one of claims 1-27 or the composition according to claim 28 or 29, for use in the treatment, prevention or improvement of neurons in the central nervous system of a subject. UBE3A It is used in methods related to the overexpression of disease.

44. The ASO for use according to claim 43, wherein the disease is Dup15q syndrome.

45. The ASO for use according to claim 43 or 44, wherein the subject has the idic(15) genotype.

46. ​​The use of the ASO according to any one of claims 1-27 or the composition according to claim 28 or 29 for the treatment of a disease associated with elevated levels of UBE3A protein in neurons of the central nervous system of a subject.

47. Use of the ASO of any one of claims 1-27 or the composition of claim 28 or 29 in the preparation of a medicament for treating a disease associated with elevated levels of UBE3A protein in neurons of the central nervous system of a subject.

48. The use according to claim 46 or 47, wherein the disease is Dup15q syndrome.

49. The use according to any one of claims 46-48, wherein the subject has the idic(15) genotype.

Images