A fusion immunoglobulin and its use in culturing t cells
By constructing fusion immunoglobulins, fusing IL-2, IL-21, and IL-15 protein fragments with immunoglobulins, the problems of short cytokine half-lives and non-cooperative signal transduction in T cell culture media were solved, achieving efficient proliferation and persistent expansion of T cells, and avoiding the use of animal serum.
Patent Information
- Application Number
- CN202610374303.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-25
- Publication Date
- 2026-07-14
AI Technical Summary
Existing T cell culture media rely on high concentrations of single cytokines for serum-free expansion, leading to T cell functional exhaustion, low proportion of memory subsets, poor in vivo persistence, and short half-life of cytokines with significant off-target stimulation side effects, making it difficult to achieve synergistic and targeted signal transduction.
By constructing fusion immunoglobulins, IL-2, IL-21 and IL-15 protein fragments are fused with immunoglobulins to form variable regions, enabling precise anchoring and long-term stimulation of T cells and promoting T cell proliferation.
The application of fusion immunoglobulins in the culture medium significantly prolongs the half-life of cytokines, promotes high T cell killing, low exhaustion and strong memory phenotype, and ensures good batch-to-batch consistency of the culture medium, avoiding animal-derived serum components.
Smart Images

Figure CN122381202A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a fusion immunoglobulin and its application in cultured T cells. Background Technology
[0002] Currently, the culture medium components for serum-free T cell expansion mainly involve the complete removal of animal serum (such as fetal bovine serum, FBS) and the addition of specific chemical components and recombinant proteins and cytokines (IL-2, IL-15, IL-21) to simulate and optimize the signals required for T cell growth.
[0003] However, current in vitro T cell expansion modalities generally rely on adding high concentrations of a single cytokine (such as IL-2), leading to T cell exhaustion, low proportions of memory subsets, and poor in vivo persistence. Meanwhile, soluble cytokines suffer from short half-lives, significant off-target stimulation side effects, and difficulties in synergistically optimizing the concentrations of multiple factors. Although strategies such as cytokine cocktails or engineered mutants have provided some improvements, they have not fundamentally solved the problems of non-directed and non-synergistic signal transduction. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a fusion immunoglobulin and its application in cultured T cells.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a fusion immunoglobulin, wherein the fusion immunoglobulin is an immunoglobulin fused with IL-2 protein fragments, IL-21 protein fragments and IL-15 protein fragments.
[0006] This invention constructs a fused immunoglobulin by fusing IL-2, IL-21, and IL-15 protein fragments as variable regions, thereby achieving precise anchoring and long-term stimulation of T cells by cytokines and promoting T cell proliferation.
[0007] Furthermore, the IL-2 protein fragment is linked to the C-terminus of the CH3 segment of the heavy chain constant region of immunoglobulin, the IL-21 protein fragment is linked to the N-terminus of the CH1 segment of the heavy chain constant region of immunoglobulin, and the IL-15 protein fragment is linked to the N-terminus of the CL segment of the light chain constant region of immunoglobulin.
[0008] Furthermore, the immunoglobulin is IgG, IgA, IgE, IgD, or IgM.
[0009] Furthermore, the immunoglobulin is IgG1, IgG2, IgG3, or IgG4.
[0010] Furthermore, the IL-2 protein fragment contains a CDS fragment of the IL-2 protein; And / or, the IL-21 protein fragment contains a CDS fragment of the IL-21 protein.
[0011] Furthermore, the IL-2 protein fragment contains a linker and a CDS fragment of the IL-2 protein; And / or, the IL-21 protein fragment contains a CDS fragment and a linker of the IL-21 protein; And / or, the IL-15 protein fragment contains the IL-15 protein; The amino acid sequence of the linker is shown in SEQ ID NO: 3.
[0012] Furthermore, the IL-2 protein fragment consists of a linker and a CDS fragment of the IL-2 protein, with the N-terminus of the CDS fragment of the IL-2 protein linked to the linker.
[0013] Furthermore, the IL-21 protein fragment consists of a linker and a CDS fragment of the IL-21 protein, with the C-terminus of the CDS fragment of the IL-21 protein linked to the linker.
[0014] In a second aspect, the present invention provides a recombinant vector comprising plasmid 1 or plasmid 2, wherein plasmid 1 expresses the IL-2 protein fragment, IL-21 protein fragment and the immunoglobulin heavy chain constant region CH1-CH2-CH3 fragment. Plasmid 2 expresses the IL-15 protein fragment and the CL fragment of the immunoglobulin light chain constant region.
[0015] Furthermore, the protein fragment expressed by plasmid 1 also contains signal peptide 1, which is linked to the N-terminus of the IL-21 protein fragment; the protein fragment expressed by plasmid 2 also contains signal peptide 2, which is linked to the N-terminus of the IL-15 protein fragment; the amino acid fragment of signal peptide 1 is shown in SEQ ID NO: 1, and the amino acid fragment of signal peptide 2 is shown in SEQ ID NO: 5.
[0016] Furthermore, in the protein fragments expressed by plasmid 1, the IL21 protein fragment is linked to the N-terminus of the CH1 segment of the heavy chain constant region of immunoglobulin, and the IL-2 protein fragment is linked to the C-terminus of the CH3 segment of the heavy chain constant region of immunoglobulin; in the protein fragments expressed by plasmid 2, the IL-15 protein fragment is linked to the N-terminus of the CL segment of the light chain constant region of immunoglobulin.
[0017] Thirdly, the present invention provides a recombinant cell containing the aforementioned recombinant vector.
[0018] Fourthly, the present invention provides a method for preparing the fusion immunoglobulin, wherein plasmid 1 and plasmid 2 are co-transfected into cells, expressed and purified, to obtain the fusion immunoglobulin.
[0019] Furthermore, using cDNA from human peripheral blood mononuclear cells as a template, PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO: 7 and 8 to obtain PCR amplification product fragment 1; PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO: 9 and 10 to obtain PCR amplification product fragment 2; PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO: 11 and 12 to obtain PCR amplification product fragment 3; PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO: 13 and 14 to obtain PCR amplification product fragment 4; PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO: 15 and 16 to obtain PCR amplification product fragment 5; Linear vector pcDNA3.1 (Xho1), PCR amplification product fragments 1-3, Assembly Master Mix (2X) and pure water were mixed, incubated, and plasmid 1 was obtained. Linear vector pcDNA3.1 (Xho1), PCR amplification product fragments 4 and 5, Assembly Master Mix (2X), and pure water were mixed, incubated, and plasmid 2 was obtained.
[0020] Furthermore, incubate at 45~55℃ for 15~60 min, preferably at 50℃ for 15 min.
[0021] Fifthly, the present invention provides the application of the fusion immunoglobulin in cultured T cells.
[0022] In a sixth aspect, the present invention provides a culture medium containing the fusion immunoglobulin.
[0023] Furthermore, the working concentration of the fused immunoglobulin in the culture medium is 0.1~5 μg / mL, preferably 1 μg / mL.
[0024] Furthermore, the culture medium is based on RPMI 1640.
[0025] Furthermore, the culture medium also contains 5-7 g / L glucose, 4-6 μg / mL recombinant human insulin, 4-6 μg / mL recombinant human transferrin, 3-5 mM L-glutamine, 4-6 μg / mL plant-derived cholesterol, 4-6 mg / mL human recombinant albumin, 0.5%-1.5% sodium pyruvate, 15-25 μM ethanolamine, 0.1-0.3 mM N-acetylcysteine, 9-11 μM reduced glutathione, 25-35 nM sodium selenate, 4-6 μM zinc sulfate, and a 10-20 mM HEPES buffer system.
[0026] Furthermore, the culture medium also contains 6 g / L glucose, 5 μg / mL recombinant human insulin, 5 μg / mL recombinant human transferrin, 4 mM L-glutamine, 5 μg / mL plant-derived cholesterol, 5 mg / mL human recombinant albumin, 1% sodium pyruvate, 20 μM ethanolamine, 0.2 mM N-acetylcysteine, 10 μM reduced glutathione, 30 nM sodium selenate, 5 μM zinc sulfate, and a 15 mM HEPES buffer system.
[0027] In a seventh aspect, the present invention provides a method for culturing T cells, wherein the T cells are cultured in the aforementioned culture medium.
[0028] Furthermore, the activated T cells are first activated using CD3 / CD28 T cell activation magnetic beads to obtain activated T cells, and then the activated T cells are cultured in the culture medium described above.
[0029] Compared with the prior art, the beneficial effects of the present invention are as follows: The fusion immunoglobulin constructed in this invention delivers IL-15 (promotes the generation and survival of memory T cells), IL-21 (enhances function and reduces exhaustion) and IL-2 (strongly promotes proliferation) together, effectively mimicking the in vivo environment, promoting T cell proliferation, and inducing T cells with excellent phenotypes such as high killing power, low exhaustion and strong memory, and significantly prolonging the half-life of cytokines.
[0030] This invention involves adding fusion immunoglobulins to a culture medium to prepare a fusion protein culture medium, avoiding animal-derived serum components and ensuring excellent batch-to-batch consistency. The fusion immunoglobulins in the culture medium can provide precise, synergistic, and long-lasting stimulation of T cells. Attached Figure Description
[0031] Figure 1 To fuse the structure of immunoglobulins.
[0032] Figure 2The effects of IL-2-containing culture medium, IL-2, IL-15 and IL-21-containing culture medium, and fusion immunoglobulin-containing culture medium on T cell proliferation were investigated.
[0033] Figure 3 The effect of culture media containing different concentrations of fusion immunoglobulin on T cell proliferation.
[0034] Figure 4 The effect of culture media containing different concentrations of recombinant human albumin on T cell proliferation.
[0035] Figure 5 The effect of culture media containing different concentrations of recombinant human insulin on T cell proliferation.
[0036] Figure 6 The effect of culture media containing different concentrations of recombinant human transferrin on T cell proliferation.
[0037] Figure 7 Activating CD3 in different culture media + The number of T cells increases by a factor of 1.
[0038] Figure 8 Flow cytometry plot for cell marker detection on day 0 of activated T cell culture.
[0039] Figure 9 Flow cytometry plot for cell marker detection on day 13 of activated T cell culture.
[0040] Figure 10 Flow cytometry plot for cell marker detection on day 24 of activated T cell culture. Detailed Implementation
[0041] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, other materials and reagents used in the embodiments are commercially available.
[0042] Example 1: Preparation of Targeted Multi-Cytokine Fusion Immunoglobulin 1. DNA Fragment Design and Acquisition Heavy chain module: (1) Fragment 1: The pcDNA3.1 plasmid was digested with Xho1 to obtain the linearized vector backbone pcDNA3.1 (Xho1).
[0043] (2) Fragment 2: IL-21 module, consisting of signal peptide 1, IL-21-CDS and linker. The N-terminus of IL-21-CDS is connected to the signal peptide, and the C-terminus of IL-21-CDS is connected to the linker. The amino acid sequence of signal peptide 1 is MDWTWRILFLVAAATGAHS (SEQ ID NO: 1), and the nucleotide sequence is ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCGGCCGCCACAGGCGCGCACTCC (SEQ ID NO: 2). IL-21-CDS is the CDS sequence of IL-21. The NCBI reference number for IL-21 is NCBIReference Sequence: NM_021803.4. The amino acid sequence of the linker is GGGGSGGGGSGGGGS (SEQ ID NO: 3), and the nucleotide sequence is GGAGGTGGTGGATCCGGCGGTGGCGGTTCTGGTGGAGGTGGATCT (SEQ ID NO: 4).
[0044] (3) Fragment 3: CH1-CH2-CH3 module, which is the CH1-CH2-CH3 fragment of IgG1, with Uniprot accession number P01857.
[0045] (4) Segment 4: IL-2 module, consisting of linker and IL-2-CDS. The N end of IL-2-CDS is connected to the linker. IL-2-CDS is the CDS sequence of IL-2. The number of IL-2 on NCBI is NCBI Reference Sequence: NM_000586.4.
[0046] (5) Light chain module (fragment 5): composed of signal peptide 2, IL-15 and CL. The N-terminus of IL-15 is linked to the signal peptide, and the C-terminus of IL-15 is linked to CL. The amino acid sequence of signal peptide 2 is MLPSQLIGFLLLWVPASRG (SEQ ID NO: 5), and the nucleotide sequence is ATGTTGCCATCACAACTCATTGGGTTTCTGCTGCTCTGGGTTCCAGCTAGCCGCGGC (SEQ ID NO: 6). The NCBI Reference Sequence for IL-15 is NM_000585.5, and the Uniprot accession number for CL is P01857.
[0047] 2. Fragment preparation (PCR amplification or synthesis) To perform the Gibson Assembly reaction, the target fragment needs to be constructed and ligated using two plasmids. A 5' homologous arm is added to the 5' end of the target fragment using a forward primer, and a 3' homologous arm is added to the 3' end of the target fragment using a reverse primer. The nucleotide sequences of the primers and homologous arms are shown in Table 1 and Table 2, respectively.
[0048] Table 1 Plasmid 1 - Heavy Chain Module Fragment Table 2 Plasmid 2 - Light Chain Module Fragments cDNA template preparation: Total RNA was extracted from human peripheral blood mononuclear cells stimulated with lipopolysaccharide (LPS) for 24 h. Using the Total RNA Extraction Kit (DP451) and Reverse Transcriptase Kit (KR116) from Tiangen Biotech, total RNA was extracted from human peripheral blood mononuclear cells stimulated with LPS for 24 h according to the manufacturer's instructions, and first-strand cDNA was synthesized as a PCR template.
[0049] The PCR reaction system is shown in Table 3.
[0050] Table 3 PCR reaction program: 98℃ for 30 s; 98℃ for 10 s, 60℃ for 20 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min.
[0051] The PCR amplification products were purified and recovered, and the fragment size of the PCR amplification products was verified by electrophoresis.
[0052] 3. Gibson Assembly reaction (1) The reaction components of the two plasmids are shown in Table 4 and Table 5, respectively.
[0053] Table 4. Reaction components of plasmid 1 Table 5. Reaction components of plasmid 2 Add the reaction components to the PCR tubes on ice, mix gently, centrifuge briefly, and incubate at 50°C for 15 min (60 min if the number of fragments is >3) to obtain plasmid 1 and plasmid 2. Cool on ice or co-express and transform directly to obtain the assembly product (fusion immunoglobulin). Figure 1 After obtaining the fusion immunoglobulin, the signal peptide is cleaved and no longer exists.
[0054] In plasmid 1, the IL21 module is fused to the N-terminus of the CH1-CH2-CH3 module, and the IL-2 module is fused to the C-terminus of the CH1-CH2-CH3 module.
[0055] In plasmid 2, signal peptide 2-IL15 is fused to the N-terminus of CL.
[0056] 4. Conversion and Screening Take 5 μL of plasmid 1 and 5 μL of plasmid 2, and mix them separately with 50 μL of competent E. coli cells. Incubate on ice for 30 min, heat-activate at 42℃ for 30 s, incubate on ice for 2 min, add 950 μL of SOC medium, and incubate at 37℃ with shaking (220 rpm) for 1 h. Spread the resulting bacterial culture on LB agar plates containing 100 µg / mL ampicillin and incubate overnight at 37℃. Pick 20-50 colonies from the overnight culture and perform PCR amplification to verify successful transformation. Take the plasmid extract from positive clones and perform Sanger sequencing to confirm seamless fusion adapters.
[0057] 5. Verification and Expression (1) Count the CHO cells; the viability should be above 95%. If the cell viability density (VCD) exceeds 4 × 10⁻⁶, the cell viability density is considered to be above 95%. 6 cells / mL, diluted to 4 × 10⁶ cells / mL using fresh culture medium. 6 For every 100 mL of cells transfected, 100 μg of plasmid DNA was used.
[0058] (2) Dilute the transformed plasmid DNA with CHO medium (plasmid 1: plasmid 2 = 1:1, mass ratio). The medium used is 4% of the volume of the transfection mixture (volume concentration). Mix well to obtain the diluted DNA.
[0059] Dilute the transfection reagent PEI (PEI:DNA = 5 μL: 1 μg) with CHO medium. The medium used should be 4% (volume concentration) of the transfection mixture. Mix well to obtain the diluted transfection reagent.
[0060] The diluted transfection reagent and diluted DNA were mixed thoroughly to obtain a transfection mixture, which was incubated at room temperature for 20 min. The incubated transfection mixture was then added dropwise to CHO cells while gently shaking the flask. The flask was then placed in a shaker for incubation (37°C, 80% humidity, 5% CO2 concentration, 110 rpm). During transfection, the glucose concentration was maintained above 4.0 g / L.
[0061] (3) When cell viability is below 60% (4-7 days), cell supernatant is collected for SDS-PAGE and Western blot analysis (using anti-IL-2, anti-IL-21, anti-IL-15 or anti-Fc antibodies). Cytokine activity is detected by ELISA, and the binding and stability of fusion immunoglobulins are assessed by flow cytometry.
[0062] (4) Purification of fusion immunoglobulin: Protein A affinity chromatography.
[0063] ① Centrifuge the cell supernatant at 1000 rpm for 5 min, collect the supernatant and discard the precipitate; filter the supernatant using a 0.22 μm disposable filter (during the operation, be sure to clean the instrument carefully before each use and make a mark), collect the filtrate, and adjust the pH of the filtrate to neutral with 1M Tris-HCl buffer (pH=8.5) to obtain the sample for use.
[0064] ② Turn on the chromatography apparatus and rinse the tubing with 1×PBS buffer until no air bubbles are present. Install the Protein A chromatography column (ensure no gas enters during the process). Insert the tubing into the sample and adjust the flow rate to 1 mL / min. Rinse approximately 10 column sections with 1×PBS buffer to equilibrate.
[0065] ③ Elution and Collection: Elute with glycine to a final concentration of 100 mM (pH 3.5). Collect the eluted protein solution in a 1.5 mL centrifuge tube. Adjust the pH of the protein solution to neutral using 1 M Tris-HCl buffer (pH=8.8), and determine the concentration using Nanoparticles. Combine the high-concentration protein solutions into one tube. Equilibrate 10 columns by washing with 1×PBS buffer.
[0066] ④ Chromatography column preservation: Fill the column with 20% (volume concentration) ethanol and store at room temperature or refrigerated (do not freeze).
[0067] ⑤ Transfer the protein solution from step ③ into an 8-12 kDa dialysis bag, clamp it tightly, place it in 1×PBS solution, dialyze at 4°C, change the solution every 12 h for a total of 3 times, collect the dialyzed protein sample, and determine the protein purity and concentration by SDS-PAGE.
[0068] ⑥ The protein sample after dialysis in step ⑤ is filtered and sterilized to finally obtain fusion immunoglobulins in a stable buffer.
[0069] The fusion immunoglobulin, obtained by recombinating the IgG Fc gene with a cytokine protein gene using DNA recombination technology, exhibits a significantly prolonged half-life compared to the original target protein. This is because the 10 ng / mL fusion protein group shows a significant proliferative effect compared to the addition of only 10 ng / mL IL-2 (PeproTech) or the simultaneous addition of 10 ng / mL each of IL-2, IL-15, and IL-21 (PeproTech) in conventional culture medium. Figure 2 Meanwhile, due to the introduction of the IgGFc fragment, the purification process of the target protein can be simplified by using highly specific affinity chromatography techniques such as Protein A and Protein G.
[0070] Example 2: Preparation of fusion immunoglobulin culture medium Using RPMI 1640 as the basal medium, the following components (final concentration) were added: glucose (6 g / L), recombinant human insulin (5 μg / mL), recombinant human transferrin (5 μg / mL), L-glutamine (4 mM), plant-derived cholesterol (5 μg / mL), human recombinant albumin (5 mg / mL), sodium pyruvate (1%, mass concentration), ethanolamine (20 μM), N-acetylcysteine (0.2 mM), reduced glutathione (10 μM), sodium selenate (30 nM), zinc sulfate (5 μM), HEPES buffer system (15 mM, pH 7.2–7.4), and fusion immunoglobulin (1 μg / mL) to obtain a mixed medium. The mixed medium was then filtered and sterilized using a 0.22 μm pore size PES (polyethersulfone) membrane and a vacuum filtration device to obtain the fusion immunoglobulin medium.
[0071] Example 3: Effect of different component concentrations on the culture medium User CD3 + T-cell sorting kit to isolate CD3 cells from peripheral blood mononuclear cells (PBMCs) of healthy individuals. + T cells, using human CD3 / CD28 T cell activation magnetic beads to activate CD3 + After 72 hours, the magnetic beads were removed from the T cells (the cell suspension was aspirated after being adsorbed by a magnetic rack), and the activated T cells were obtained.
[0072] 1. Different concentrations of fusion immunoglobulin (0 ng / mL, 10 ng / mL, 100 ng / mL, or 1000 ng / mL) were added to conventional culture medium (RPMI 1640 medium containing 10% FBS). Activated T cells were cultured for 9 days in an incubator at 36℃~38℃, 80% humidity, and 5% CO2 concentration, with fresh culture medium added every 2~3 days. The results showed that the higher the dose of fusion immunoglobulin used, the faster the T cell proliferation rate. Figure 3 ).
[0073] 2. When T cells were cultured in serum-free RPMI 1640 medium, it was found that without the addition of human recombinant albumin, T cells could not proliferate or even undergo apoptosis. Therefore, it is necessary to determine the dosage of human recombinant albumin.
[0074] Different concentrations of recombinant human albumin (0.1 mg / mL, 1 mg / mL, 5 mg / mL, or 10 mg / mL) were added to serum-free RPMI 1640 medium. Activated T cells were cultured for 3 days in an incubator at 36℃~38℃, 80% humidity, and 5% CO2 concentration. The results showed that 5 mg / mL of recombinant human albumin had a better promoting effect on T cell proliferation. Figure 4 ).
[0075] 3. Different concentrations of recombinant human insulin (0 μg / mL, 0.1 μg / mL, 1 μg / mL, 5 μg / mL, or 10 μg / mL) were added to serum-free RPMI 1640 medium. Activated T cells were cultured for 3 days in an incubator at 36℃~38℃, 80% humidity, and 5% CO2 concentration. The results showed that 5 μg / mL of recombinant human insulin had a good promoting effect on T cell proliferation. Figure 5 ).
[0076] 4. Different concentrations of recombinant human transferrin (0 μg / mL, 0.1 μg / mL, 1 μg / mL, 5 μg / mL, or 10 μg / mL) were added to serum-free RPMI 1640 medium. Activated T cells were cultured for 3 days in an incubator at 36℃~38℃, 80% humidity, and 5% CO2 concentration. The results showed that 5 μg / mL of recombinant human transferrin had a good promoting effect on T cell proliferation. Figure 6 ).
[0077] Example 4: T cell activation and expansion method 1. User CD3 + T-cell sorting kit to isolate CD3 cells from peripheral blood mononuclear cells (PBMCs) of healthy individuals. +T cells, using human CD3 / CD28 T cell activation magnetic beads to activate CD3 + After 72 hours, the magnetic beads were removed from the T cells (the cell suspension was aspirated after being adsorbed using a magnetic rack), resulting in activated T cells. The activated T cells were cultured in the fusion immunoglobulin medium prepared in Example 2 at 37°C, 80% humidity, and 5% CO2 concentration in an incubator. Fresh medium (containing the same concentration of fusion immunoglobulin) was added every 2-3 days to maintain a T cell density of (0.5-1) × 10⁻⁶ cells / day. 6 Cells / mL. Two to three days after activation, T cells can be seen to aggregate into clusters, increase in size, and begin to divide. After 14 days of culture, the number of cells can reach 300 to 500 times.
[0078] However, when the fusion immunoglobulin medium was replaced with RPMI 1640 medium containing 10% fetal bovine serum (FBS), 1% sodium pyruvate (SBS), and 1% penicillin (100 U / mL, streptomycin 100 μg / mL), the T cells stopped proliferating and even gradually died after 16 days of culture. The fusion immunoglobulin medium prepared in Example 2 of this invention can extend the T cell proliferation cycle to 24 days, and the cell number increases more than 800-fold after 24 days of culture. Figure 7 ).
[0079] 2. The fusion immunoglobulin culture medium prepared in Example 2 of this invention was used to detect biomarkers on days 0, 13 and 24 of activated T cell culture.
[0080] On day 0, CD3 was detected. + The proportion of T cells was 96%, and CD3... + CD8 + The proportion of T cells was 32.4% ( Figure 8 ), cultured to day 13, CD3 + CD8 + The proportion of T cells increased to 89.1%. Figure 9 ), Day 24 CD3 + CD8 + The proportion of T cells has increased to 91%, CD3 + The proportion of T cells was 97.76%, and CD3... - CD56 + The proportion is 0.36% ( Figure 10 The results indicate that the expanded cells were T cells, not NK cells.
[0081] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A fusion immunoglobulin, characterized in that, The fusion immunoglobulin is an immunoglobulin that fuses IL-2 protein fragments, IL-21 protein fragments, and IL-15 protein fragments.
2. The fusion immunoglobulin as described in claim 1, characterized in that, The IL-2 protein fragment is attached to the C-terminus of the CH3 segment of the heavy chain constant region of immunoglobulin, the IL-21 protein fragment is attached to the N-terminus of the CH1 segment of the heavy chain constant region of immunoglobulin, and the IL-15 protein fragment is attached to the N-terminus of the CL segment of the light chain constant region of immunoglobulin.
3. The fusion immunoglobulin as described in claim 2, characterized in that, The immunoglobulins are IgG, IgA, IgE, IgD, or IgM.
4. The fusion immunoglobulin as described in claim 2, characterized in that, The IL-2 protein fragment contains a CDS fragment of the IL-2 protein; And / or, the IL-21 protein fragment contains a CDS fragment of the IL-21 protein.
5. A recombinant vector, characterized in that, The recombinant vector includes plasmid 1 or plasmid 2, wherein plasmid 1 expresses the IL-2 protein fragment, IL-21 protein fragment and the immunoglobulin heavy chain constant region CH1-CH2-CH3 fragment; Plasmid 2 expresses the IL-15 protein fragment and the CL fragment of the immunoglobulin light chain constant region.
6. A recombinant cell, characterized in that, The recombinant cells contain the recombinant vector as described in claim 5.
7. The method for preparing the fusion immunoglobulin according to any one of claims 1 to 4, characterized in that, Plasmid 1 and plasmid 2 as described in claim 5 were co-transfected into cells, expressed and purified to obtain the fusion immunoglobulin.
8. The use of the fusion immunoglobulin according to any one of claims 1 to 4 in cultured T cells.
9. A culture medium, characterized in that, The culture medium contains the fusion immunoglobulin according to any one of claims 1 to 4.
10. A method for culturing T cells, characterized in that, T cells are cultured using the culture medium described in claim 9.