A nanocomposite, a preparation method thereof and application thereof in postoperative treatment of pancreatic cancer

Abstract

The present application relates to the field of biological medicine, and particularly relates to a kind of nanocomposite and its preparation method and application in postoperative treatment of pancreatic cancer.The nanocomposite is that RRM2 siRNA is compounded with gold nanocluster AuNCs, then is loaded into mesenchymal stem cell-derived exosome MSC-EVs, and the nanocomposite AuNC-siRNA / EV is prepared.The present application can generate nanocomposite with high drug loading efficiency and lysosome escape ability by electrostatic self-assembly of gold nanoparticles and siRNA and membrane fusion technology of MSC-EVs.RRM2 siRNA can be accurately delivered to residual tumor lesions using the natural homing characteristics of MSC-EVs, thereby inhibiting RRM2 expression, blocking DNA synthesis and stem cell characteristics of tumor cells, and further inhibiting micro-metastasis proliferation and immune escape, which opens up a new paradigm for postoperative treatment of pancreatic cancer.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to a nanocomposite, its preparation method, and its application in the postoperative treatment of pancreatic cancer. Background Technology

[0002] Pancreatic cancer (PC) is a highly malignant gastrointestinal tumor with a five-year survival rate of only about 10% (Nature 2023;618: 144–50; Nature 2024;629: 927–36; Nat RevGastroenterol Hepatol 2024; 21: 7–24.). Currently, there are many treatment options for PC, such as systemic chemotherapy, which aims to control disease progression, prolong survival, and improve quality of life; targeted therapy and immunotherapy, which provide precision treatment for patients with specific gene subtypes; and radiotherapy, which is mainly used for palliative care in locally advanced patients or as part of neoadjuvant / adjuvant therapy. However, among all treatment options, surgical resection is currently the only potentially curative method, but the five-year survival rate after radical resection is relatively low, mainly due to two reasons: 1. It is related to postoperative metastasis and recurrence of PC; residual small lesions after surgery can easily lead to local recurrence or distant metastasis (Lancet Oncol 2024; 25: 853–64). Approximately 50% of patients experience recurrence within 2 years post-surgery (Lancet Gastroenterol Hepatol 2024; 9: 448–59). The 5-year survival rate for patients without metastatic recurrence after pancreatic cancer surgery is 19.5%, with a median overall survival (OS) of 26.3 months. However, the 5-year survival rate drops to 4.8% for patients with recurrence or metastasis, and the median OS also decreases to 17.1 months (Clinical value of re-resection for isolated local recurrence of pancreatic cancer). In addition, a common and serious complication after pancreatic cancer surgery is exocrine pancreatic insufficiency (EPI). EPI refers to the pancreas's inability to produce sufficient digestive enzymes (especially lipases), leading to the inability to properly digest and absorb food (especially fats and proteins). This condition significantly impacts patient survival through multiple pathways. Therefore, developing an integrated treatment strategy that simultaneously eliminates residual tumor, modulates the immune microenvironment, and treats pancreatic fistula has become a significant challenge in current clinical practice.

[0003] Gene therapy is a method of treating or curing diseases by modifying or manipulating gene expression or altering the biological characteristics of living cells. In genes, the ribonucleotide reductase M2 subunit (RRM2) is a key regulator of DNA synthesis, reducing ribonucleotides to deoxyribonucleotides, thus providing the necessary substances for tumor cell proliferation. Studies have shown that RRM2 is abnormally overexpressed in various solid tumors, driving not only tumor cell proliferation, metastasis, and chemotherapy resistance, but also maintaining cancer stem cell characteristics by regulating the nucleotide metabolic pool, making it a key molecular target for postoperative recurrence (Inhibition of hepatocellular carcinoma growth using immunoliposomes forco-delivery of adriamycin and ribonucleotide reductase M2 siRNA). While RNA interference (RNAi)-based RRM2 silencing has high specificity, it is limited by low intracellular delivery efficiency and the instability of nucleic acid drugs in vivo. Therefore, the optimized design of nanocarrier systems has become a key direction for overcoming these delivery barriers. In the field of gene therapy, while viral vectors and non-viral nanocarriers, represented by lipid nanoparticles (LNPs), have become the mainstream delivery systems, their clinical application still faces significant challenges. Viral vectors suffer from high immunogenicity and potential insertional mutation risks; while synthetic nanocarriers generally exhibit common defects such as cytotoxicity, limited targeting, insufficient delivery efficiency, and short in vivo circulation time. These defects severely restrict the efficacy and safety of gene drugs. In contrast, stem cell-derived vesicles (MSCs), as an endogenous natural delivery system, demonstrate unique advantages. Their natural phospholipid bilayer structure and endogenous protein composition endow them with excellent biocompatibility and low immunogenicity, effectively overcoming the toxicity problems of synthetic vectors; the maternal recognition molecules carried on their surface give them inherent targeting and homing capabilities, allowing them to precisely reach lesion sites; at the same time, their flexible membrane structure helps to cross physiological barriers such as the blood-brain barrier, and through engineering modifications, in vivo circulation time can be further extended and drug loading efficiency enhanced. Therefore, stem cell extravesicles can not only effectively solve the three core problems of biosafety, targeting precision, and delivery efficiency of traditional nanocarriers, but also provide a breakthrough solution for building a new generation of intelligent gene delivery systems. Summary of the Invention

[0004] The purpose of this invention is to provide a nanocomposite, its preparation method, and its application in the postoperative treatment of pancreatic cancer.

[0005] The yield of stem cell nanovesicles (MSC-EVs) is low. The inventors' research group previously published extrusion methods in *Advanced Healthcare Materials* and *Materials & Design* to overcome this low yield limitation. However, the efficiency of loading siRNA into MSC-EVs is low, and it faces the challenge of poor responsiveness. The inventors' group previously developed gold nanocarriers, which significantly improved the loading rate. Therefore, this invention proposes to combine gold nanocarriers with siRNA before loading MSC-EVs to significantly improve siRNA loading efficiency. However, tumor gene therapy primarily inhibits tumor cell proliferation, with limited activation of anti-tumor immune effects. Pancreatic tissue repair and inflammation suppression can also reduce tumor metastasis and recurrence. Based on current research findings, stem cell-derived extracellular vesicles can promote pancreatic repair by activating key regenerative signaling pathways within pancreatic tissue. Among these mechanisms, specific microRNAs such as miR-26a carried by the vesicles can effectively inhibit GSK-3β activity, thereby activating the Wnt / β-catenin signaling pathway and inducing the proliferation and differentiation of pancreatic acinar cells. Simultaneously, factors such as TGF-β1, abundant on the vesicle surface, can initiate the Smad2 / 3 signaling cascade, promoting the transformation of pancreatic stellate cells to a repair phenotype and enhancing extracellular matrix remodeling. Notably, these vesicles can also significantly inhibit the abnormal activation of the NF-κB signaling pathway by delivering anti-inflammatory factors such as IL-10, reducing the expression levels of pro-inflammatory factors such as IL-6 and TNF-α in the tumor microenvironment. Based on these mechanisms, it is reasonable to speculate that stem cell vesicles can not only promote pancreatic tissue repair through multi-pathway synergistic effects, but also effectively inhibit the invasive ability of pancreatic cancer cells and the epithelial-mesenchymal transition process by remodeling the inflammatory state of the tumor microenvironment, thereby significantly reducing the risk of tumor metastasis and postoperative recurrence. Therefore, it is hypothesized that stem cell vesicles can not only effectively promote pancreatic repair, but also reduce the occurrence of tumor metastasis and recurrence through inflammation suppression.

[0006] In a first aspect, the present invention provides a nanocomposite prepared by combining RRM2 siRNA with gold nanoclusters (AuNCs) and then loading them into exosomes derived from mesenchymal stem cells (MSC-EVs).

[0007] Furthermore, the nucleotide sequence of the RRM2 siRNA is GGCUUCAUCGCUGAACCGGAAG (5' to 3', SEQ ID NO.1).

[0008] A second aspect of the present invention provides a method for preparing the nanocomposite as described above, comprising the following steps:

[0009] (A) Preparation of AuNC-siRNA complex

[0010] Positively charged AuNC clusters (100 μmol / L), DMF, DEPC, and a disulfide-linked siRNA polymer solution were mixed and incubated overnight on a shaker at 4°C and 500 rpm to allow the siRNA polymer to bind to the AuNC clusters via electrostatic interaction. The mixture was then ultrafiltered for 15 min at 4°C and 12,000 rpm using a 3 kDa Amicon® Ultra 0.5 mL centrifuge tube, followed by washing with PBS. This ultrafiltration process was repeated three times. The resulting sample is abbreviated as AuNC-siRNA.

[0011] (B) Exosome encapsulation of AuNC-siRNA via electroporation

[0012] Mesenchymal stem cell-derived exosomes (25 μg / μL) were electroporated with 20 μL of AuNC-siRNA. In a pre-chilled 100 μL cuvette containing an aluminum electrode, AuNC-siRNA and exosomes were mixed at a molar ratio of 181:1. 100 μL of transfer buffer was added. The reaction was terminated for 10 minutes with the addition of 200 μL of PBS using the D-023 electroporation program. All the above operations were performed on ice. Subsequently, the electroporated AuNC-siRNA / exosome mixture was purified by ultrafiltration to remove free AuNC-siRNA.

[0013] Furthermore, the method for preparing exosomes derived from mesenchymal stem cells is as follows: bone marrow mesenchymal stem cells in the logarithmic growth phase are digested with trypsin and collected in 15 ml centrifuge tubes. The cells are centrifuged at 1000 r / min for 5 min to collect the cell pellet. The cells are then resuspended in PBS, and the cell density is adjusted to 1×10⁻⁶ cells / mL. 6 The cell suspension was sequentially extruded 15 times through 5μm, 1μm and 0.2μm polycarbonate membrane filters using a micro extruder. The final extruded sample was centrifuged at 10000g for 10min at room temperature to remove cell debris and microcapsules.

[0014] A third aspect of the present invention provides the use of the nanocomposite described above in the preparation of a postoperative therapeutic drug for pancreatic cancer.

[0015] Furthermore, the aforementioned postoperative treatment drug for pancreatic cancer is a drug that inhibits the growth of residual tumors after pancreatic cancer surgery.

[0016] The advantages of this invention are:

[0017] This invention innovatively constructs a comprehensive therapeutic platform that combines gold nanoclusters (AuNCs) loaded with RRM2 siRNA with mesenchymal stem cell exosomes (MSC-EVs), achieving the dual goals of "inhibiting recurrence and restoring function" through a cross-scale synergistic mechanism. On one hand, through the electrostatic self-assembly of gold nanoparticles and siRNA and the membrane fusion technology of MSC-EVs, a nanocomposite with high drug loading efficiency and lysosomal escape capability can be generated. Utilizing the natural homing properties of MSC-EVs, RRM2 siRNA can be precisely delivered to residual tumor lesions, thereby inhibiting RRM2 expression, blocking tumor cell DNA synthesis and stem cell characteristics, and thus inhibiting micrometastases and immune escape. On the other hand, the MSC-EVs in this platform can restore pancreatic exocrine function, as evidenced by the recovery of amylase and lipase levels to nearly 100% of normal values, while reducing anti-inflammatory components IL-1β by 68.01%, IL-6 by 47.52%, and TNF-α by 74.52%, effectively alleviating persistent inflammatory damage to pancreatic exocrine function. This dual-module "treatment-repair" synergistic strategy not only breaks through the limitations of traditional single therapy, but also achieves spatiotemporal drug release through biocompatible carriers, opening up a new paradigm for the postoperative treatment and management of pancreatic cancer.

[0018] This invention aims to provide a theoretical basis and technological breakthrough for precise postoperative treatment and organ function protection in pancreatic cancer by systematically evaluating the platform's effects on inhibiting tumor recurrence, restoring pancreatic function, and mitigating long-term toxicity. Attached Figure Description

[0019] Figure 1 (A) Preparation process of gold nanorod-siRNA / exosomes (AuNC-siRNA / EV). Mesenchymal stromal cells are mechanically extruded to form extracellular vesicles, which are then loaded with AuNC-siRNA to finally prepare the therapeutic agent AuNC-siRNA / EV. The scale bar indicates the permeability of different pore sizes (5µM, 1µM, 0.2µM). (B) Antitumor effect of AuNC-siRNA / EV. In a postoperative pancreatic cancer model, AuNC-siRNA / EV targets and inhibits the transcription and translation processes of Panc-02 pancreatic cancer cells, further inhibiting cancer cell activity and demonstrating its core antitumor ability. (C) Anti-inflammatory and immunomodulatory effects. This therapy can alleviate excessive inflammatory responses and regulate immune cell activation in an inflammatory model. (D) Recovery of pancreatic exocrine function. This therapy targets postoperative exocrine pancreatic insufficiency and promotes functional recovery.

[0020] Figure 2Characterization of AuNC-siRNA / EVs. (A). Preparation process of AuNC-siRNA / EV. (B). Gel electrophoresis analysis of siRNA. 1. Ladder, 2. siRNA (SH), 3. siRNA-SS-siRNA, 4. siRNA-SS-siRNA (pH=4), 5. siRNA-SS-siRNA / GSH (pH=4), 6. siRNA-SS-siRNA (pH=6.4), 7. siRNA-SS-siRNA (pH=7.4). (C). High-angle dark-field and Au elemental mapping showing the distribution of AuNC-siRNA / GSH at pH=4. (D). Size analysis of AuNC-siRNA / GSH at pH=4 and AuNC-siRNA / pH=7.4. (E). Transmission electron microscopy images of EVs and AuNC-siRNA / EVs. (F). Fluorescence absorption spectra of AuNC-siRNA / GSH at pH=4, AuNC-siRNA / EV, and EVs. (G). Nanoparticle tracking analysis (NTA) of AuNC-siRNA / EV and EV.

[0021] Figure 3 In vivo antitumor effects of AuNC-siRNA / EV. (A) Schematic diagram of tumor modeling and treatment experiments in mice. (B) In vitro fluorescence imaging of major organs and tumors in different treatment groups after administration at specified time points. Groups were PBS group, siRNA (Cy5 labeled) group, and AuNC-siRNA / EV (Cy5 labeled) group. (C) Multicolor immunofluorescence staining of pancreatic tumor tissue (scale bar: 20 μm). Red: RRM2; Blue: DAPI (nucleus); Green: CD9. (D) Monitoring of tumor fluorescence signals in mice of different treatment groups using a small animal in vivo imaging system (fluorescence represents tumor size). (E) Quantitative analysis of the average fluorescence intensity of the tumor area in (D) (n=5). (F) Extraction of proteins from the excised tumor tissue and verification of the in vivo silencing effect of the RRM2 gene by Western blotting analysis. (G) Quantitative analysis of the Western blotting results in (F) (n=3). (H) Calculation of tumor volume after the experiment (data expressed as mean ± standard deviation, n=5). (I) Tumors were dissected and weighed, and the tumor weight of each group was recorded (data are expressed as mean ± standard deviation, n=5). One-way ANOVA was used for inter-group comparisons. An asterisk in the figure indicates statistical significance compared to the control group (or a specified group): p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

[0022] Figure 4 The restorative effect of AuNC-siRNA / EV on postoperative pancreatic EPI function. Detection of total fecal lipids (A), total fecal protease activity (B), serum lipase levels (C), and serum α-amylase levels (D) in mice with pancreatic tumors, after tumor resection, and after treatment with AuNC-siRNA / EV. qPCR analysis of lipase (E) and α-amylase (F) in the pancreatic tumor group, after tumor resection, and after treatment with AuNC-siRNA / EV. Analysis of pancreatic lipase levels (G) and pancreatic α-amylase levels (H) in the pancreatic tumor group, after tumor resection, and after treatment with AuNC-siRNA / EV. Western blot analysis of pancreatic lipase and α-amylase in the pancreatic tumor group, after tumor resection, and after treatment with AuNC-siRNA / EV (I). Immunohistochemical analysis and quantification (K, L) of pancreatic lipase and amylase in the pancreatic tumor group, after tumor resection, and after treatment with AuNC-siRNA / EV. Detailed Implementation

[0023] The specific implementation methods provided by the present invention will be described in detail below with reference to the embodiments.

[0024] Example:

[0025] 1. Method

[0026] 1.1 Meta-analysis

[0027] HRZ and LY conducted literature searches in PubMed, Embase, and Web of Science databases, with a search deadline of December 20, 2024. The first meta-analysis included studies reporting the correlation between pancreatic exocrine insufficiency (EPI) status and human patient survival, while the second meta-analysis included animal studies investigating tumor growth after the use of RRM2 inhibitors. The inclusion criteria for the first meta-analysis were: (1) studies must provide survival data for both healthy controls and EPI patients. The inclusion criteria for the second meta-analysis were: (1) studies must include quantitative tumor growth data from animal models using and not using RRM2 inhibitors. When multiple studies were published by the same author or institution, only the study with the largest sample size was retained. Studies that were unavailable or did not meet the inclusion criteria were excluded. HRZ and LY screened the initial search results, removing duplicate and irrelevant studies, and resolved any disagreements through discussion.

[0028] In the first meta-analysis, the Newcastle-Ottawa Scale (NOS) was used to assess research quality, with studies scoring above 6 considered high-quality. For the second meta-analysis, the SYRCLE risk of bias assessment tool was used to quantify the risk of bias (RoB), and standardized quantification was performed for each study. Statistical heterogeneity was assessed using I... 2 The statistical measures and p-values ​​were evaluated. If no significant heterogeneity was found (I...), the outcome was determined. 2 If the bias is ≤50% and P≥0.1, a fixed-effects model is used; otherwise, a random-effects model is used. Publication bias is assessed using funnel plots and Egger's test. Given that the second meta-analysis uses unique assessment metrics, we also additionally used the Trim and Fill method to assess publication bias.

[0029] 1.2 Preparation of AuNC-siRNA complex

[0030] Positively charged AuNC clusters (100 μmol / L), DMF, DEPC, and a solution of disulfide-linked siRNA polymer were mixed and incubated overnight at 4°C and 500 rpm on a shaker (ThermoMixer C, Eppendorf, Germany) to allow the siRNA polymer to bind to the AuNC clusters via electrostatic interactions. Then, 3 kDa Amicon... Ultrafiltration was performed in a 0.5 mL centrifuge tube at 4°C and 12,000 rpm for 15 min. The sample was then washed with PBS and ultrafiltered a total of 3 times. The resulting sample is abbreviated as AuNC-siRNA.

[0031] The nucleotide sequence of the siRNA is GGCUUCAUCGCUGAACCGGAAG (5' to 3', SEQ ID NO.1).

[0032] 1.3 Exosome Preparation

[0033] Mouse BMSCs in the logarithmic growth phase were digested with trypsin and collected in 15 ml centrifuge tubes. The cells were centrifuged at 1000 r / min for 5 min to collect the cell pellet. The cells were resuspended in PBS and the cell density was adjusted to 1×10⁶ cells / mL. 6 Cell suspensions were sequentially extruded 15 times through 5μm, 1μm, and 0.2μm polycarbonate membrane filters using a micro-extruder. The final extruded sample (1 mL) was centrifuged at 10000g for 10 min at room temperature to remove cell debris and microvesicles. The sample was then concentrated with PBS for 15 min at room temperature using a 100 kDa ultrafiltration tube. The vesicle protein concentration was determined using a BCA protein quantification kit, and the concentration of cell membrane exosomes (mg / L) was expressed as a percentage. -1The particle size distribution of exosomes was detected using a nanoparticle size analyzer, and the morphology of the nanoparticles was further observed using a transmission electron microscope.

[0034] 1.4 Exosome encapsulation of AuNC-siRNA via electroporation

[0035] Mesenchymal stem cell-derived exosomes (25 μg / μL) were mixed with 20 μL of Lucerne-SiRNA (15 μM, Nucleofector, Lonza, Switzerland). TM Electroporation was performed according to the manufacturer's instructions using a 2b electroporator. AuNC-siRNA and exosomes were mixed at a molar ratio of 181:1 in a pre-chilled 100 μL cuvette containing an aluminum electrode. 100 μL of transfer buffer (4.5:1, 82+18 μL) was added. The reaction was terminated for 10 minutes with the addition of 200 μL PBS using the D-023 electroporation program. All procedures were performed on ice. The electroporated AuNC-siRNA / exosome mixture was then purified by ultrafiltration (100K ultrafiltration tube, 4000 rpm, 5 min) to remove free AuNC-siRNA.

[0036] 1.5 Polyacrylamide gel electrophoresis

[0037] siRNA polymerase (100 nM siRNA equivalent) was placed in pH 4 citrate buffer, pH 4 citrate buffer containing 5 mM GSH, pH 6.4 citrate buffer, and pH 7.4 phosphate buffer, and incubated at 37°C and 300 rpm for 12 hours. 10 μL volumes of free siRNA, siRNA polymerase, and samples incubated with different buffers were injected into the wells of an 8% (w / v) polyacrylamide gel, and a voltage of 100V was applied for 60 minutes. The gels were stained with 4S GelRed staining agent and developed using a chemiluminescence imaging system (ChemiScope 6200 Touch, CLiNX, China). A 20 bp DNA molecular weight standard (Dye Plus) was used as a control.

[0038] 1.6 AuNC-siRNA Polymer Dynamic Light Scattering Experiment

[0039] AuNC-siRNA was incubated for 12 hours in citrate buffer (pH 4) and phosphate buffer (pH 7.4), respectively. The particle size distribution and surface charge characteristics of the AuNC-siRNA complexes prepared under different incubation conditions were systematically analyzed using dynamic light scattering (NanoZS, Malvern, UK) and Zeta potential assay.

[0040] 1.7 Zeta potential measurement

[0041] The zeta potential (ζ-potential) of gold nanocomplex-siRNA after incubation in citrate buffer (pH 4) and phosphate buffer (pH 7.4) for 12 hours was measured using a Zetasizer Nano Series ZS instrument from Malvern Instruments (Malvern Instruments, UK) and a 633 nm helium-neon laser. Samples were diluted to a concentration of 1.5 μmol / L and transferred to a disposable folded capillary ζ-electrode cell. The ζ-potential was calculated based on electrophoretic mobility using the Smoukhovsky approximation. All measurements were performed at room temperature (RT).

[0042] 1.8 Ultraviolet-Visible Absorption Spectrum

[0043] AuNC-siRNA / <ph>The absorption spectra of 4 GSH 5mM, AuNC-siRNA / EV, and EV were determined by ultraviolet spectrophotometer.

[0044] 1.9 Fluorescence spectrum

[0045] AuNC-siRNA / <ph>The fluorescence spectra of 4 GSH 5mM, AuNC-siRNA / EV, and EV were determined by a fluorescence spectrophotometer (Cary Eclipse, Varian, USA).

[0046] 1.10 Western blot for protein immunoblotting

[0047] After ultracentrifugation, the exosomes were resuspended in RIPA lysis buffer and incubated on ice for 20 minutes. Centrifugation removed insoluble substances. Protein concentration was determined using the BCA method, and the samples were subjected to SDS-PAGE electrophoresis to transfer the proteins onto a polyvinylidene fluoride (PVDF) membrane. Non-specific binding sites were blocked using 5% bovine serum albumin (BSA). Rabbit α-CD63 and α-CD73 (Abcam, UK) and rabbit α-CD9 (Cell Signaling, USA) were used as primary antibodies. The antibodies were incubated overnight at 4°C at appropriate dilutions. Horseradish peroxidase-labeled anti-rabbit IgG secondary antibody was used and incubated at room temperature for 2 hours. Finally, the images were developed using ECL-Plus chemiluminescence immunoassay.

[0048] 1.11 Cell Culture

[0049] Mouse pancreatic cancer cell line PANC-02 was cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin at 37°C and 5% CO2. When cell confluence reached 80-90%, cells were digested with 0.25% trypsin, gently scraped off, centrifuged, and passaged at a 1:3 ratio. Mouse monocyte / macrophage Raw264.7 cells were cultured in RPMI 1640 medium containing 10% FBS and 1% penicillin / streptomycin at 37°C and 5% CO2. During the logarithmic growth phase, cells were digested with 0.25% trypsin / EDTA, gently scraped off, centrifuged, and passaged at a 1:2 ratio. Rat pancreatic exocrine AR42J cells were cultured in Ham's F-12K medium containing 20% ​​FBS and 1% penicillin / streptomycin at 37°C and 5% CO2. When the cell confluence reaches 80%, digest with 0.25% trypsin, gently scrape off the cells, collect them by centrifugation, and passage them at a 1:2 ratio.

[0050] 1.12 Intracellular siRNA Release

[0051] Confocal fluorescence microscopy and flow cytometry were used to analyze the intracellular siRNA release characteristics of PANC-02 cells. Cells were cultured at 1.0 × 10⁶ cells per well. 5 Cells were seeded at a density of [number] cells per well in 24-well plates and incubated in DMEM medium containing 5% CO2 at 37°C for 12 hours. After cell attachment, PBS, siRNA-SS-siRNA, AuNC-siRNA, and AuNC-siRNA / EV were added to each group, and incubation continued for 24 hours. Cells were then washed three times with PBS, and nuclei were stained with Hoechst 33342, followed by incubation for another 30 minutes. Fluorescence images were acquired using an LSM 700 confocal laser scanning microscope, with consistent imaging parameters for all samples.

[0052] 1.13 CCK-8 test

[0053] Raw264.7 cell suspension was seeded at a density of 100 μL per well in 96-well plates, with three replicates per group. Cells were cultured at 37°C and 5% CO2 for 24 hours to promote adhesion. After adhesion, cells were treated with different concentrations of AuNC-siRNA / EV (0, 10, 30, 50, 100, 200, 500 nM) for 24 hours. After treatment, 10 μL of CCK-8 reagent (purchased from Beyotime Biotechnology) was added to each well, and the cells were incubated at 37°C and 5% CO2 for 2 hours. After incubation, the absorbance (OD value) of each well was measured at 450 nm using a microplate reader. A blank control group (cell-free medium) was set up to correct for background absorbance.

[0054] 1.14 Live and Dead Cell Staining Experiment

[0055] RAW264.7 cells were spaced at 5 × 10⁶ cells per well. 4 Cells were seeded at a density of 1000 μL in 12-well plates, with three replicates per group. After 24 hours of culture, different treatment reagents were added to each group, and the cells were cultured for another 24 hours. After treatment, the cells were gently washed twice with PBS buffer to remove residual culture medium and reagents. Using a live / dead cell staining kit (Ingenieur Biosciences, Inc.), the cells were incubated with a staining solution of Calcein AM and PI for 30 minutes in the dark. Finally, the staining effect was observed using a fluorescence microscope.

[0056] 1.15 EdU staining experiment

[0057] RAW264.7 cells were spaced at 5 × 10⁶ cells per well. 5 Cells were seeded at a density of 1000 μL in 12-well plates, with three replicates per group. After 24 hours of culture, different treatment reagents were added to each group, and the cells were cultured for another 24 hours. Then, 10 μM EdU (5-ethynyl-2'-deoxyuridine) was added for labeling, and the cells were cultured for another 4 hours. After labeling, the cells were gently washed twice with PBS buffer to remove residual culture medium and EdU. The cells were then fixed with 3.7% formaldehyde for 15 minutes, followed by permeabilization with 0.5% Triton X-100 for 20 minutes. Using an EdU detection kit (purchased from Beyotime Biotechnology, China), the cells were incubated with the staining reagent for 30 minutes, followed by washing with PBS buffer. Finally, the staining results were observed under a fluorescence microscope; EdU-positive cells showed red fluorescence.

[0058] 1.16 Reverse transcription polymerase chain reaction (RT-PCR)

[0059] Cells were packed at 2.0 × 10⁶ cells per well. 5 Cells were seeded at a density of 1000 g / mL in 24-well plates containing 1640 g / mL medium and cultured overnight at 37°C with 5% CO2. After cell attachment, different treatment groups were added and cultured for another 24 hours. Transcriptional levels of Bcl-2 mRNA were detected using a two-step RT-PCR method. Total RNA was extracted using TRIzol according to the manufacturer's recommended protocol, and RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). Total RNA [0.2 optical density units (OD260)] was reverse transcribed for 30 minutes at 42°C using SuperScript III (Thermo Fisher Scientific, Massachusetts, USA), followed by reverse transcription for 5 minutes at 85°C. Amplification was performed using the SSO Advanced Universal SYBR Green Supermix in a Bio-Rad CFX96 Touch qRT-PCR system (Bio-Rad, California, USA). The resulting cDNA was amplified using US primer sequences. Results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression levels. Each data point is the average of three replicates, with each replicate being three times. The primer sequences used were: RRM2, 5'-CATGAG GCT CAG CCC CAG AAC-3' (forward, SEQ ID NO.2) and 5'-AGT CAA TCC CTT TGG TGC TCAC-3' (reverse, SEQ ID NO.3); GAPDH, 5'-TGC ACC ACC AAC TGT TTA GC-3' (forward, SEQ ID NO.4) and 5'-GGC ATG GAC TGT GGT CAT GAG-3' (reverse, SEQ ID NO.5).

[0060] 1.17 Apoptosis

[0061] The treatment method for PANC-02 cells was the same as that used in Western blotting experiments. To analyze apoptosis, researchers collected suspension cells and adherent cells, washed them three times with cold PBS, and then stained them with Alexa Fluor 488-labeled annexin V and PI, respectively. Apoptotic cells were then detected by flow cytometry.

[0062] 1.18 Transwell Experiment

[0063] A 24-well Transwell chamber was used. The upper chamber could be pre-coated with 50 μL of Matrigel (1:8 dilution). The chambers were incubated at 37°C for 4 hours to allow solidification. 200 μL of serum-free culture medium was added to the upper chamber, while 600 μL of culture medium containing 10% fetal bovine serum (FBS) was added to the lower chamber as a chemical inducer. After resuspending the panc-02 cells treated with different materials in serum-free culture medium, 200 μL of the cell suspension (approximately 2 × 10⁻⁶ cells) was collected. 4 (Number of cells) were seeded into the upper chamber of a Transwell plate, with three wells per group. The Transwell plates were incubated at 37°C and 5% CO2 for 24 hours. After incubation, cells that had not migrated to the upper chamber were gently aspirated with a cotton swab. Cells that migrated to the lower chamber were fixed with 4% paraformaldehyde for 15 minutes, washed three times with PBS to remove excess staining agent, and finally stained with 0.1% crystal violet for 20 minutes, followed by three washes with PBS to remove residual staining.

[0064] 1.19 Small Animal Imaging Experiment

[0065] In vivo distribution of a drug labeled with a near-infrared fluorescent dye ([Drug-Cy5.5]) was monitored in 4-6 week old male C57BL / 6 mice via intravenous injection. Real-time tracking was performed at 1, 4, 8, and 24 hours post-injection using an IVIS imaging system (e.g., PerkinElmer IVIS Spectrum). The experiment was conducted under 2% isoflurane anesthesia, and fluorescence signal intensity was quantified by radiation efficiency. Twenty-four hours later, major organs including the heart, liver, spleen, lungs, kidneys, brain, and tumors were harvested for in vitro imaging analysis, and fluorescence intensity was assessed using Living Image 4.5 software. All data were normalized to baseline, and pharmacokinetic parameters (AUC, t) were calculated. 1 / 2 This experimental protocol has been approved by the Institutional Animal Care and Use Committee.

[0066] 1.20 Transwell EV

[0067] Raw264.7 cells were seeded in 24-well plates and allowed to adhere overnight. Lipopolysaccharide (LPS, 1 mg / mL) was then added to stimulate the cells and induce an inflammatory response, followed by co-incubation for 4 hours. Next, 100 μL of AuNC-siRNA / EV complex was added to the upper chamber of a Transwell insert (polycarbonate membrane, 6.5 mm diameter, 0.1 μm pore size), while the LPS-stimulated Raw264.7 cells were placed in the lower chamber and cultured for 24 hours to promote EV internalization. Finally, cell nuclei were stained with DAPI, and fluorescence images were captured using an inverted fluorescence microscope. Fluorescence intensity was quantified using ImageJ software to assess the targeting efficiency of EVs on inflammatory cells. The experiment was repeated three times, and statistical significance was analyzed using Student's t-test.

[0068] 1.21 Hematoxylin-eosin (H&E) staining

[0069] Tissue samples were fixed in 10% neutral buffered formalin for 24 hours at room temperature, followed by dehydration with a gradient of ethanol (70%, 80%, 90%, and 100%). After clearing with xylene (Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number: 1330-20-7), samples were embedded in paraffin. 4-5 μm thick sections were cut using a Leica microtome (HistoCore BIOCUT) and placed on a hematoxylin mounting stage (Jiangsu Shitai Experimental Instrument Co., Ltd., catalog number: 80312-3161). Before staining, sections were dewaxed with xylene and rehydrated with a gradient of ethanol (100%, 90%, 80%, and 70%). Sections were stained with hematoxylin staining solution (Zhuhai Beso Biotechnology Co., Ltd., catalog number: BA4041) for 5-10 minutes, followed by rinsing with running tap water for 5 minutes to remove excess stain. Differentiation was performed for several seconds using 1% acidic ethanol (Togan Biotech, catalog number: DH0085), followed by indigo staining in tap water. After rinsing with distilled water, the sections were counterstained with eosin staining solution (Zhuhai Beso Biotechnology Co., Ltd., catalog number: BA4099) for 1–3 minutes. Finally, the sections were dehydrated using a gradient of ethanol (70%, 80%, 90%, and 100%), cleared with xylene, and then treated with neutral resin (Sinopharm Chemical Reagent Co., Ltd., catalog number: 10004160). After observation under an Olympus CX23 optical microscope, images were acquired using a Sunny HS6 bright-field scanner for subsequent analysis.

[0070] 1.22 Small Animal Imaging

[0071] The experiment used 6-8 week old male C57BL / 6 mice. Pancreatic tumor cells (mouse tumor line Panc-02, 1×10⁻⁶ cells) were injected in situ. 6 Cells (suspended in 100 μL PBS buffer) were implanted into the body. Longitudinal monitoring of tumor progression was performed using the PerkinElmer IVISSpectrum small animal imaging system. The experiment was conducted under 2% isoflurane anesthesia, with D-fluorescein (150 mg / kg) injected on days 3, 5, 7, and 9 post-inoculation to acquire bioluminescent signals. Imaging was initiated 10–15 minutes after fluorescein injection, with exposure times of 1–5 minutes. Tumor signal intensity was quantified using Living Image 4.5 software, standardized against baseline (day 0), and differences between groups were compared using Bonferroni-corrected two-way ANOVA (n=5 per group). All experimental procedures followed the guidelines of the Animal Ethics Committee and were approved by the Animal Ethics Committee of Shanghai Changhai Hospital.

[0072] 1.23 Hemolysis test

[0073] Whole blood was collected from male C57BL / 6 mice aged 6-8 weeks and weighing 20-25 grams via orbital puncture. Red blood cells (RBCs) were separated, washed, and resuspended in a solution containing 2% PBS for in vitro hemolysis experiments. The RBC suspension, along with the test compound group and the PBS control group, was incubated at 37°C for 3 hours, followed by centrifugation, and the absorbance of the supernatant was measured at 540 nm. The percentage of hemolysis was calculated using the following formula: Hemolysis rate (%) = (OD value of test group - OD value of negative control group) / (OD value of positive control group - OD value of negative control group) × 100. Statistical analysis used P < 0.05 as the significance level. All experimental procedures were approved by the Animal Ethics Committee of Shanghai Changhai Hospital and strictly followed animal experimental ethical guidelines.

[0074] 1.24 NF-κB p65 nuclear translocation experiment

[0075] Panc-2 cells derived from mice (ATCC) were used at a rate of 5 × 10⁻⁶. 4 Cells were seeded at a density of 10 cells / well in 6-well plates and cultured in high-glucose DMEM medium containing 10% fetal bovine serum for 24 hours to promote adhesion. They were then pretreated with different materials for 24 hours. After replacing the medium with serum-free medium, LPS was added to a final concentration of 100 ng / mL for 30 minutes of stimulation. Cells were washed with PBS, fixed with 4% paraformaldehyde for 15 minutes, permeabilized with 0.1% Triton X-100 for 10 minutes, and blocked with 5% bovine serum albumin for 30 minutes. Cells were then incubated with primary and secondary anti-p65 antibodies sequentially, stained with ethidium bromide (DAPI), and mounted. Images were acquired using a fluorescence microscope, and the fluorescence intensity ratio of nuclear p65 to cytoplasmic p65 was calculated using ImageJ software.

[0076] 1.25 Elisa

[0077] To quantify pro-inflammatory cytokine levels, supernatant from PANC-2 cells treated with TNF-α (20 ng / mL, 24 h) was collected and centrifuged at 300 × g for 10 min at 4°C to remove debris. Mouse-specific ELISA kits were used for detection (TNF-α: Abcam ab208348; IL-6: ab222503; IL-1β: ab197742). The standard curve concentration ranges were: TNF-α 0–1000 pg / mL, IL-6 0–500 pg / mL, and IL-1β 0–200 pg / mL. The assay procedure included: (1) capture antibody coating (overnight at 4°C); (2) blocking with 1% BSA (1 hour, room temperature); (3) sample / standard incubation (100 μL per well, 2 hours); (4) incubation with biotinylated detection antibody (1 hour); (5) addition of streptavidin-HRP conjugate (protected from light for 30 minutes); (6) color development using TMB substrate (15 minutes), and termination of the reaction with 2N H2SO4. Absorbance was measured at 450 nm (reference 570 nm) using a microplate reader (BioTek SynergyH1). Cytokine concentrations were calculated using a four-parameter logic (4-PL) curve fitting. Method validation confirmed detection limits of 1.7 pg / mL (TNF-α), 2.3 pg / mL (IL-6), and 1.9 pg / mL (IL-1β), with intra-assay coefficients of variation (CV) <8% and inter-assay CV <12%, respectively. Spike recoveries ranged from 85% to 115%. All samples were analyzed in triplicate to ensure data reliability.

[0078] 1.26 Stool test

[0079] To determine the total lipid content in feces, a 1000 mg fecal sample was ground and weighed. A labeled and weighed glass tube was used as a pre-mixed solution. 5 mL of physiological saline was added, and the mixture was transferred to a 15 mL centrifuge tube and vortexed. Then, 5 mL of a chloroform and methanol (2:1) mixture was added and vortexed again. The suspension was centrifuged at 1000 × g for 10 minutes, and the bottom layer was collected and transferred to a glass tube. The glass tube was dried on a drying rack under a fume hood, and the lipid components were weighed. Another 10 mg fecal sample was dissolved in 1 mL of RIPA lysis buffer containing PMSF (PC101, Shanghai Yaqi), sonicated, and centrifuged to collect the supernatant. Finally, protein quantification was performed using a laboratory-wide rapid protein quantification kit (ZJ103, Shanghai Yaqi) according to the manufacturer's instructions.

[0080] 1.27 Serum α-amylase and lipase detection

[0081] According to the manufacturer's instructions, the levels of α-amylase and lipase in the blood and pancreatic tissue of three groups of mice (including the pancreatic cancer model group, the postoperative pancreatic cancer model group, and the AuNC-siRNA / EV treatment group) were detected using the laboratory lipase detection kit (D799801) and α-amylase detection kit (D799323) from Shanghai Shenggong Biotechnology Co., Ltd.

[0082] 1.28 Western Blotting Experiment

[0083] Three models were set up: a mouse pancreatic cancer model, a postoperative pancreatic cancer model, and a group treated with AuNC-siRNA / EV. Pancreatic tissue samples from mice were collected, and total protein was extracted using RIPA lysis buffer (PC101, Shanghai Yaqi) according to the manufacturer's instructions. Protein concentration was determined by the BCA method. Samples were separated by SDS-PAGE electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes. Non-specific binding sites were blocked with 5% bovine serum albumin (BSA). The selected antibodies included α-amylase (12540-1-AP, Wuhan Sanying), lipase (11209-1-AP, Wuhan Sanying), and HSP90 (83950-5-RR, Wuhan Sanying), which were incubated overnight at 4°C with PVDF membranes at appropriate dilutions. Horseradish peroxidase-labeled goat-derived IgG secondary antibody was used. After incubation at room temperature for 2 hours, the antibody was developed using ECL-Plus chemiluminescence reagent.

[0084] 1.29 Histological analysis and immunohistochemical staining

[0085] The procedure is as follows: Mouse pancreatic tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and then sectioned. After dewaxing and hydration, the pancreatic sections were placed in a retrieval chamber containing citrate antigen retrieval buffer (pH 6.0) and subjected to antigen retrieval in a microwave oven. After natural cooling, the slides were placed in PBS buffer (pH 7.4) and washed three times with a decolorizing shaker for 5 minutes each time. The sections were then placed in 3% hydrogen peroxide solution and incubated at room temperature in the dark for 25 minutes. The slides were again placed in PBS buffer (pH 7.4) and washed three times with a decolorizing shaker for 5 minutes each time to block endogenous peroxidase. 3% bovine serum albumin (BSA) was evenly spotted onto the histochemical reaction area of ​​the tissue and blocked at room temperature for 30 minutes. After removing the blocking solution, primary antibodies were added sequentially: α-amylase (12540-1-AP, Sanying Wuhan) / lipase (11209-1-AP, Sanying Wuhan) / HSP90 (83950-5-RR, Sanying Wuhan), and incubated overnight at 4°C. After washing, HRP-labeled goat secondary antibody was applied to the slide surface and incubated at room temperature for 50 minutes. After washing, freshly prepared DAB chromogenic solution was added to the reaction area. The chromogenic time needs to be observed under a microscope; a positive reaction should appear yellowish-brown. The chromogenic reaction was stopped by rinsing the slide with tap water. Subsequently, hematoxylin counterstaining was performed for about 3 minutes, followed by rinsing with tap water, then hematoxylin differentiation solution was added for a few seconds, followed by rinsing with tap water again, then counterstaining with hematoxylin solution, and finally rinsing with running water. After dehydration and mounting, the slides were observed using a Nikon E100 microscope and images were acquired and analyzed using a Nikon DS-U3 image acquisition system.

[0086] 1.30 Reverse transcription polymerase chain reaction (RT-PCR) of pancreatic genes

[0087] Three experimental groups were set up: a mouse pancreatic cancer model group, a post-operative pancreatic cancer model group, and a gold nanocomplex-siRNA / exosome treatment group. Pancreatic tissue samples were collected from mice, and the mRNA transcription levels of α-amylase and lipase were detected using a two-step RT-PCR method. Total RNA was extracted using FreeZol reagent (R711-01, Novozymes, Nanjing, China) according to the manufacturer's instructions. RNA concentration was determined using a NanoDrop2000 spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). Total RNA was reverse transcribed in HiScript IV RT SuperMix qPCR premix (R423-01, Novozymes) at 37°C for 15 minutes (including a gDNA wiper), followed by annealing at 85°C for 5 seconds. Amplification was performed using SupRealQ Ultra Hunter SYBR qPCR premix (Q713-02, Novozymes) in a Bio-Rad CFX96 Touch qRT-PCR system (Bio-Rad Laboratories, California, USA). Results were standardized based on expression levels in the mouse pancreatic cancer group. Each data point represents the average of three replicates, with each experiment performed in triplicate. The primer sequences used were: Amy2a5, GCAACAATGTTGGTGTCCGTAT (forward primer, SEQ ID NO.6); aattccctgttatttggattgagg (reverse primer, SEQ ID NO.7).

[0088] The forward primer is Pnlip tggatgttggagatttgcag, SEQ ID NO.8, and the reverse primer is ggacgtcttccctcactgtc, SEQ ID NO.9.

[0089] 1.31 Single-cell transcriptome sequencing analysis

[0090] After quality assessment, the sequencing reads were aligned to the mouse reference genome (mm10) using the Cell Ranger analysis pipeline (10x Genomics), and their source cells were identified through cell-specific barcoding. The selection criteria were: total feature count ≥300, ≤5000 (used to filter double-cell samples), and mitochondrial gene source features <15%. A total of 51,580 cells were obtained for subsequent analysis, including 24,605 ​​in the treatment group and 26,975 in the control group.

[0091] To integrate cells from different samples into a shared space for unsupervised clustering, we used the Harmony algorithm to integrate six samples. Specifically, we first ran the Harmony algorithm using the RunHarmony function from the Seurat package, and then used Harmony embedding vectors instead of PCA in subsequent analyses. We then used the FindNeighbors and runUMAP functions from the Seurat package to construct the nearest neighbor map and UMAP. When executing the run-UMAP and FindNeighbors functions, we set the reduction parameter to "harmony".

[0092] We used the Scillus software package to identify differentially expressed genes in various cell types in tumor and normal tissues, and performed gene set enrichment analysis (GSEA). The gene sets used were all derived from the Hallmark gene set in the Molecular Characteristic Database (MSigDB).

[0093] 2. Results

[0094] 2.1 Preparation and Physicochemical Properties Analysis of AuNC-siRNA / EV

[0095] Figure 2 A outlines a two-step synthetic process for preparing AuNC-siRNA / EV. The first step involves co-incubating AuNCs with disulfide-linked siRNA to prepare AuNC-siRNA. The second step involves electroporating the AuNC-siRNA into extracellular vesicles according to the protocol to obtain AuNC-siRNA / EV.

[0096] In the first step, AuNC-siRNA was characterized. Polyacrylamide gel electrophoresis showed a significant difference in migration between lanes 4, 5, and 6 and lanes 3 and 7, indicating that the siRNA breaks down under acidic conditions (pH 4, 6.4, etc.), resulting in faster electrophoretic migration. The addition of GSH did not increase the electrophoretic rate, suggesting that disulfide-linked siRNA can be released responsively in an acidic environment. Figure 2 B). High-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) showed that AuNC-siRNA, under acidic conditions of pH = 4 (GSH 5 mM), undergoes self-assembly and forms aggregates due to the cleavage of disulfide bonds and the shedding of siRNA monomers, resulting in a decrease in the water solubility of hydrophobic AuNC. Figure 2 C). Figure 2 Elemental mapping images of Au NCs in C revealed a uniform distribution of Au, demonstrating the Au NC component within the aggregates. Dynamic light scattering (DLS) results showed that the AuNC-siRNA particle size was significantly larger in acidic environments than in neutral environments, further confirming that siRNA can be released responsively when the electrostatic homeostasis of an acidic environment is disrupted. Figure 2 D).

[0097] In the second step, AuNC-siRNA / EV was characterized. Transmission electron microscopy (TEM) was used for direct visualization of EVs. Figure 2 As shown in Figure E, both EV and AuNC-siRNA / EV exhibit a typical disc-shaped bilayer membrane morphology, confirming that the electroporation process did not damage the EV's structure and that AuNC-siRNA entered the EV. A fluorescence spectrophotometer showed no obvious fluorescence absorption peak in EV, while AuNC-siRNA produced its maximum fluorescence absorption peak at 505 nm. After encapsulating the EV, AuNC-siRNA / EV still exhibited fluorescence at 505 nm, but the intensity was significantly reduced, demonstrating that the material was successfully loaded into the EV. Figure 2 F). Nanoparticle tracking analysis (NTA) showed that the average particle sizes of EV and Au NC-siRNA / EV were 117.1 ± 4.0 nm and 170.4 ± 6.1 nm, respectively. Figure 2 (G) This further confirms that the electroporation process did not damage the EV's structure and that AuNC-siRNA entered the EV. In addition, the material stability of AuNC-siRNA / EV was also further confirmed.

[0098] This invention successfully constructed and systematically characterized an acid-responsive gene delivery system, AuNC-siRNA / EV. The complex formed by siRNA linked by disulfide bonds and AuNCs can degrade the disulfide bonds under acidic conditions, achieving specific release of siRNA. This mechanism was fully validated by changes in gel electrophoresis mobility, self-assembly observed by HAADF-STEM, and particle size increase measured by DLS. Subsequently, the complex was efficiently loaded into EVs using electroporation. TEM, fluorescence spectroscopy, and NTA analysis all confirmed that the loading process maintained the structural integrity of the EVs, and AuNC-siRNA encapsulation was successfully achieved. Unlike conventional nanocarriers that only respond to high GSH environments, our system can trigger siRNA release under weakly acidic conditions (pH 4-6.4), which is more consistent with the characteristics of the tumor microenvironment and provides a new approach to solving the problem of insufficient targeting of traditional nanocarriers. From a mechanistic perspective, this system may enhance tumor treatment efficacy through multiple synergistic effects: EVs, as natural carriers, not only prolong the circulating half-life, but their surface proteins may also mediate active targeting; while the acid-responsive release mechanism ensures that siRNA is precisely released primarily in the tumor region, thereby improving efficacy while reducing systemic toxicity. This "smart" delivery strategy provides a new technical pathway to overcome the in vivo delivery barrier of gene therapy drugs.

[0099] 2.2 In vivo distribution and tumor-killing effect of AuNC-siRNA / EV

[0100] Next, the in vivo efficacy of the AuNC-siRNA / EV treatment strategy was investigated in depth. For example... Figure 3 As shown in Figure A, we used a mouse model of orthotopic pancreatic solid tumors after surgery. The specific modeling process was as follows: C57BL / 6 mice carrying pancreatic tumor (Panc-02-luc) cells were used for an experiment lasting 4 to 6 weeks. Two weeks after successfully establishing the orthotopic pancreatic cancer model in C57BL / 6 mice, surgery was performed to remove 90% of the tumor. The mouse orthotopic pancreatic cancer model was successfully established and treated for 18 days, with tissue harvesting on day 19. To evaluate the biodistribution of different formulations, we injected PBS, naked siRNA, and AuNC-siRNA / EV into postoperative C57BL / 6 mice (Panc-02-luc) carrying pancreatic tumors. Twenty-four hours after injection, in vitro imaging of the tumor and major organs was performed. The AuNC-siRNA / EV group showed long-term retention and significant tumor accumulation, while the naked siRNA group showed almost no fluorescence signal in imaging. The targeting advantage of AuNC-siRNA / EV was further confirmed, as shown in... Figure 3 As shown in B.

[0101] To evaluate the effect of AuNC-siRNA / EV treatment on residual tumors after pancreatic cancer surgery, multiplex immunofluorescence staining was performed on mouse tumor tissues. Figure 3 As shown in Figure C, AuNC-siRNA / EV can accurately locate in postoperative pancreatic tumor tissue. AuNC-siRNA / EV significantly reduced RRM2 expression compared to the PBS group, demonstrating a significant inhibitory effect on the RRM2 gene. Figure 3 D. In vivo imaging results combined with quantitative analysis in small animals showed that the AuNC-siRNA / EV group significantly inhibited tumor growth during the treatment period (18 days), while the tumor volume of the PBS, naked siRNA, and EV groups continued to increase, reaching 2.97, 2.64, and 2.17 times that of the AuNC-siRNA / EV group, respectively. Compared with the AuNC-siRNA / EV group, the difference in the PBS group was extremely significant (P < 0.001), the difference in the naked siRNA group was highly significant (P = 0.0029), and the difference in the EV group was significant (P = 0.0429). Western blotting further confirmed that the expression of RRM2 protein in the tumor tissue of the AuNC-siRNA / EV group was specifically inhibited, reaching approximately 42.29% of the control group (P < 0.05), which was significantly better than other control groups, confirming its highly efficient in vivo gene silencing ability.

[0102] In vivo experimental results demonstrate the remarkable therapeutic potential of the AuNC-siRNA / EV delivery system in a postoperative pancreatic cancer model. A deeper analysis of its mechanism of action suggests that the superior tumor-suppressive effect of AuNC-siRNA / EV may stem from multi-level synergistic effects: firstly, specific proteins on the EV surface can recognize and target residual tumor cells after surgery; secondly, the acidic conditions of the tumor microenvironment trigger the intelligent release of siRNA, ensuring efficient silencing of the RRM2 gene within target cells. More importantly, as a key subunit of ribonucleotide reductase, the downregulation of RRM2 may inhibit tumor regeneration through multiple pathways, including interfering with DNA synthesis repair and inducing replication stress, providing a new perspective for understanding the mechanisms of postoperative recurrence.

[0103] 2.3 Protective effect of AuNC-siRNA / EV on EPI in a pancreatic cancer postoperative model

[0104] To better assess and understand EPI, fecal lipid content in mice was measured. It was found that fecal lipid content was higher in mice after pancreatic cancer surgery than in mice with tumors. Treatment with AuNC-siRNA / EV resulted in a 35.5% decrease in fecal lipid content compared to post-surgery (P < 0.01), indicating that EPI occurs in mice after pancreatic cancer surgery, and pancreatic enzyme secretion into the intestinal lumen is reduced. The decrease in fecal lipid content after AuNC-siRNA / EV treatment suggests that this material can alleviate EPI. Figure 4 A). We also investigated the protein content in mouse feces and found that the fecal protein content in mice after pancreatic cancer surgery was higher than that in tumor-treated mice, and decreased by 20.0% after treatment with AuNC-siRNA / EV (P<0.0001), showing a trend consistent with the fecal lipid content. Figure 4 B) Mice developed EPI after surgery, with reduced secretion of pancreatic enzymes and incomplete digestion of lipids and proteins, leading to increased lipid and protein content in feces. EPI recovered after treatment with Au NC-siRNA / EV.

[0105] In addition, serum lipase and α-amylase in mice showed similar trends, namely, serum lipase and α-amylase levels were significantly elevated in mice after pancreatic cancer surgery, and decreased by 28.7% (P<0.01) and 19.9% ​​(P<0.01), respectively, after AuNC-siRNA / EV treatment compared with postoperative levels, indicating that the destruction of acinar cells increased the secretion of pancreatic enzymes into the blood, which recovered somewhat after treatment. Figure 4 (C, D). However, changes in serum indicators only provide indirect evidence of systemic EPI and cannot accurately reflect the local pathological state of pancreatic tissue. To directly assess the degree of EPI damage within pancreatic tissue and clarify the production of lipase and α-amylase locally in the pancreas, we further collected pancreatic tissue specimens. The study found that in pancreatic tissue samples, the mRNA levels of pancreatic lipase and α-amylase were upregulated in the postoperative group, and subsequently downregulated after AuNC-siRNA / EV treatment. Pancreatic lipase decreased by 99.9% after administration compared to postoperative levels (P<0.0001), and α-amylase decreased by 99.9% after administration (P<0.0001). Figure 4 E, F). After assessing the mRNA expression of pancreatic lipase and α-amylase, we also detected the levels of their protein products. The study found that the levels of these two enzymes were higher in the postoperative group than in the tumor-implanted group. After treatment, lipase decreased by 35.2% (P < 0.05) and α-amylase decreased by 23.3% (P < 0.01), further demonstrating that pancreatic acinar cell destruction prevents the normal secretion of lipase and α-amylase into the intestinal lumen, leading to elevated enzyme levels in pancreatic tissue. Treatment can alleviate this (…). Figure 4 G, H). Western blotting also showed that the protein levels of lipase and α-amylase in mouse pancreatic acinar cells were significantly increased in the post-pancreatic cancer surgery group and decreased after AuNC-siRNA / EV treatment. Figure 4 I). Immunohistochemical staining of pancreatic tissue further confirmed the same conclusion. Figure 4 AuNC-siRNA / EV therapy significantly reduced enzyme levels in postoperative pancreatic tissue. Compared with the postoperative state, lipase and α-amylase decreased by 7.7% (P < 0.05) and 11.0% (P < 0.001), respectively. Figure 4 (KL). These data, from the levels of pancreatic enzymes in pancreatic tissue, serum, and feces, as well as mRNA, protein, and enzymes, constitute multi-level and multi-faceted supporting evidence for EPI after pancreatic cancer surgery in mice, and also demonstrate that AuNC-siRNA / EV is effective in alleviating EPI.

[0106] This invention systematically reveals for the first time the significant effect of the AuNC-siRNA / EV therapeutic system in improving pancreatic endocrine function (EPI) after pancreatic cancer surgery. Compared with previous studies, our findings are highly innovative: traditional research has focused on the anti-tumor effects of this system, while this invention reveals its unique value in protecting exocrine function. This dual efficacy—inhibiting tumors and improving digestive function—provides a new perspective for understanding the comprehensive mechanism of action of this therapeutic system. In-depth mechanistic analysis suggests that the improvement in EPI may stem from multiple synergistic effects: effective silencing of the RRM2 gene not only inhibits tumor progression but may also protect the functional integrity of residual acinar cells by reducing tumor compression and infiltration of normal pancreatic tissue. Simultaneously, the nanocarrier itself may indirectly reduce damage to acinar cells by inflammatory factors by regulating the tumor microenvironment. This virtuous cycle of "tumor suppression-functional protection" provides a reasonable explanation for the decrease in fecal lipid content and the return to normal serum pancreatic enzyme levels after treatment.

[0107] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.< / ph> < / ph>

Claims

1. A nanocomposite, characterized in that, The nanocomposite AuNC-siRNA / EV was prepared by combining RRM2 siRNA with gold nanoclusters AuNCs and then loading them into exosomes MSC-EVs derived from mesenchymal stem cells.

2. The nanocomposite according to claim 1, characterized in that, The nucleotide sequence of the RRM2 siRNA is shown in SEQ ID NO.

1.

3. A method for preparing the nanocomposite as described in claim 1, characterized in that, Includes the following steps: (A) Preparation of AuNC-siRNA complex 100 μmol / L of positively charged AuNC clusters, DMF, and DEPC were mixed with a solution of siRNA polymer linked by disulfide bonds and incubated overnight on a shaker at 4°C and 500 rpm to allow the siRNA polymer to bind to the AuNC clusters via electrostatic interaction. Then, the mixture was ultrafiltered for 15 min at 4°C and 12,000 rpm using a 3 kDa Amicon® Ultra 0.5 mL centrifuge tube, followed by washing with PBS. The ultrafiltration was repeated three times. The resulting sample is abbreviated as AuNC-siRNA. (B) Exosome encapsulation of AuNC-siRNA via electroporation Electroporation was performed on 25 μg / μL of mesenchymal stem cell-derived exosomes and 20 μL of AuNC-siRNA. In a pre-chilled 100 μL cuvette containing an aluminum electrode, AuNC-siRNA and exosomes were mixed at a molar ratio of 181:

1. 100 μL of transfer buffer was added. The reaction was terminated for 10 minutes with the addition of 200 μL of PBS using the D-023 electroporation program. All the above operations were performed on ice. Subsequently, the electroporated AuNC-siRNA / exosome mixture was purified by ultrafiltration to remove free AuNC-siRNA.

4. The method for preparing the nanocomposite according to claim 3, characterized in that, The method for preparing exosomes derived from mesenchymal stem cells is as follows: Bone marrow mesenchymal stem cells in the logarithmic growth phase are digested with trypsin and collected in 15 ml centrifuge tubes. The cells are centrifuged at 1000 r / min for 5 min to collect the cell pellet. The cells are then resuspended in PBS and the cell density is adjusted to 1×10⁻⁶. 6 The cell suspension was sequentially extruded 15 times through 5μm, 1μm and 0.2μm polycarbonate membrane filters using a micro extruder. The final extruded sample was centrifuged at 10000g for 10min at room temperature to remove cell debris and microcapsules.

5. The use of the nanocomposite as described in claim 1 in the preparation of a postoperative treatment drug for pancreatic cancer.

6. The application according to claim 5, characterized in that, The aforementioned postoperative treatment drugs for pancreatic cancer are drugs that inhibit the growth of residual tumors after pancreatic cancer surgery.

Images