SLC15A1 targeted protein degradation agent, construction method thereof and application thereof in preparation of drug for treating lung adenocarcinoma brain metastasis

By constructing IL-PROTAC, a PROTAC protein degrader targeting SLC15A1, and using ibuprofen and lenalidomide conjugation, the problem of the lack of SLC15A1 protein degraders in the prior art was solved, and effective inhibition of LUAD brain metastases and prolongation of survival were achieved.

CN122444690APending Publication Date: 2026-07-24HENAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610816844.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-08
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Current technologies lack effective SLC15A1 protein degraders for the treatment of lung adenocarcinoma brain metastases. Traditional small molecule inhibitors are difficult to sustainably reduce SLC15A1 protein levels, and existing treatments are insufficient to fully block SLC15A1-mediated tumor promotion.

Method used

We constructed IL-PROTAC, a PROTAC protein degrader targeting SLC15A1. Using ibuprofen as the SLC15A1 recognition unit, it was coupled with the E3 ubiquitin ligand lenalidomide via a linker to induce SLC15A1 protein degradation and inhibit LUAD cell proliferation, invasion, and MAPK signaling activation.

Benefits of technology

IL-PROTAC significantly inhibits tumor growth in the LUAD brain metastasis model, prolongs the survival period of the animal model, provides a new targeted intervention method, and has a better anti-tumor effect than traditional inhibitors. It can induce SLC15A1 protein degradation and block the EMT process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122444690A_ABST
    Figure CN122444690A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and relates to an SLC15A1 targeted protein degradation agent, a construction method thereof and application of the agent in preparation of a drug for treating brain metastasis of lung adenocarcinoma. The application constructs an SLC15A1 targeted PROTAC protein degradation agent IL-PROTAC. The degradation agent couples ibuprofen with a ligand of an E3 ubiquitin ligase, lenalidomide, through a linker, so as to form a bifunctional molecule capable of targeting SLC15A1 and inducing protein degradation of SLC15A1. The IL-PROTAC drug constructed by the application has been proved to be capable of significantly inhibiting tumor growth of a LUAD brain metastasis model and prolonging the survival cycle of an animal model.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to IL-PROTAC, a protein degrader targeting the solute carrier family member SLC15A1, its construction method, and its application in the preparation of drugs for treating brain metastases of lung adenocarcinoma. Background Technology

[0002] Lung cancer is one of the leading causes of cancer-related deaths worldwide, posing a serious threat to human health and being a major cause of cancer-related deaths globally. Lung cancer can be pathologically classified into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), with NSCLC accounting for approximately 85% of all lung cancer cases. Lung adenocarcinoma (LUAD) is the most common histological subtype of NSCLC, exhibiting significant molecular heterogeneity and a high metastatic rate. With the development of omics technologies, LUAD has been shown to contain multiple molecular abnormalities, including EGFR, KRAS, BRAF, and ALK, accompanied by abnormal activation of signaling pathways such as MAPK and PI3K. However, current research has not fully elucidated the signal activation mechanisms and lacks potential therapeutic targets.

[0003] LUAD has a high tendency for distant metastasis, with the brain being one of the most common and serious sites of metastasis. The median survival for patients with organ metastases is approximately 12.19 months, significantly shorter than the 36.4 months for those without. Of these, approximately 23.4% of patients already have brain metastases at diagnosis. The median survival for patients with brain metastases is only 6 months, significantly shorter than for those without brain metastases. Furthermore, when the number of brain metastases exceeds one, the median survival sharply decreases to 4.7 months (Sayin, SI et al. Distinct metastatic organotropism shapes prognosis in lung adenocarcinoma with brain metastasis). Frontiers in OncologyVolume 15 - 2025 (2025). These clinical data suggest that brain metastasis is a significant factor contributing to the deterioration of prognosis in patients with LUAD, and current treatments are still insufficient to adequately improve the long-term survival of patients with brain metastases. Although patients with positive driver genes such as EGFR and ALK can benefit from molecularly targeted drugs with central nervous system activity, current treatment approaches are highly dependent on patient molecular subtypes and are easily constrained by factors such as blood-brain barrier limitations, intratumoral heterogeneity, and acquired drug resistance. Furthermore, LUAD brain metastasis has a complex and unique molecular basis, and existing classic driver genes and therapeutic targets cannot fully explain or effectively intervene in its occurrence and development. Therefore, further exploration of key molecules related to LUAD brain metastasis and the development of novel drugs that can effectively intervene against these molecules are of great significance for improving the prognosis of patients with LUAD brain metastases.

[0004] SLC15A1, also known as PEPT1, is a proton-dependent oligopeptide transporter that mediates the intracellular uptake of dipeptides and tripeptides (Smith, DE, Clémençon, B. & Hediger, MA Proton-coupled doligopeptide transporter family SLC15: physiological, pharmacological and pathological implications). Mol Aspects Med 34, 323–336 (2013). Studies have shown that SLC15A1 is associated with the malignant progression of various cancers. SLC15A1 has been shown to activate the MAP4K4 / G3BP2 signaling axis in hepatocellular carcinoma cells through dipeptide transport, thereby promoting tumor metastasis (Song, F. et al. Peptide Transporter 1-Mediated Dipeptide Transport Promotes Hepatocellular Carcinoma Metastasis by Activating MAP4K4 / G3BP2 Signaling Axis). Adv Sci (Weinh)11, e2306671 (2024). Structural biology studies have further revealed the conformational basis of SLC15A1, confirming that it has a well-defined space for small molecule recognition and drug intervention (Killer, M., Wald, J., Pieprzyk, J., Marlovits, TC & Löw, C. Structural snapshots of human PepT1 and PepT2 reveal mechanistic insights into substrate and drug transport across epithelial membranes). Science Advances 7, eabk3259). However, the role of SLC15A1 in the development and progression of LUAD brain metastases has not been fully studied, and there are currently no studies based on SLC15A1 as a therapeutic target for LUAD brain metastases.

[0005] Traditional small molecule inhibitors typically inhibit the function of target proteins by occupying their active sites, substrate binding sites, or conformational regulatory sites. For target proteins with defined enzymatic activity, small molecule inhibitors exert their effects by inhibiting enzymatic catalytic activity. However, for proteins like SLC15A1, which do not depend on enzymatic catalytic activity and primarily function as transmembrane transporters, small molecule inhibitors usually only block substrate recognition or transport to a certain extent, failing to reduce the expression level of the target protein itself. Functional inhibition alone is also insufficient to fully block the SLC15A1-related tumor-promoting effects. Therefore, developing targeted protein degraders that can induce SLC15A1 protein degradation can more thoroughly block SLC15A1-mediated tumor-promoting and metastatic effects compared to traditional small molecule inhibitors. However, current technology lacks publicly available protocols for using SLC15A1-targeted protein degraders for the treatment of LUAD brain metastases. Summary of the Invention

[0006] This invention addresses the shortcomings in existing treatments for LUAD brain metastases, including insufficient effective intervention targets, a lack of therapeutic interventions targeting SLC15A1, and the difficulty of traditional small molecule inhibitors in sustainably reducing SLC15A1 protein levels. It provides an SLC15A1-targeting PROTAC protein degrader, IL-PROTAC, its preparation method, and its application in the prevention and treatment of LUAD brain metastases. The IL-PROTAC constructed in this invention can induce SLC15A1 protein degradation, inhibit LUAD cell proliferation, invasion, MAPK signaling activation, and epithelial-mesenchymal transition (EMT), thereby providing a new targeted intervention for LUAD brain metastases.

[0007] The present invention specifically adopts the following technical solution:

[0008] This invention, through analysis of primary and brain metastasis LUAD patient samples, found that SLC15A1 is significantly overexpressed in brain metastasis patients and is associated with poor prognosis. Functional studies have shown that SLC15A1 is highly associated with tumor cell invasion, and knockdown of SLC15A1 expression can significantly inhibit EMT, thereby inhibiting tumor cell invasion. The study fully confirms that SLC15A1 has the potential to serve as a therapeutic target for LUAD brain metastasis.

[0009] Based on this, the present invention constructs a PROTAC protein degrader (IL-PROTAC) targeting SLC15A1. This degrader uses ibuprofen (IBF) as the SLC15A1 recognition unit. IBF has been reported as a non-competitive inhibitor of SLC15A1 (Omkvist, DH, Brodin, B. & Nielsen, CU). Ibuprofen is a non-competitive inhibitor of the peptide transporter hPEPT1 (SLC15A1): possible interactions between hPEPT1 substrates and ibuprofen. British Journal of Pharmacology References 161, 1793–1805 (2010) suggest an underlying interaction between IBF and SLC15A1, suggesting that IBF could serve as an SLC15A1 recognition unit for constructing protein-targeting degradative agents. Furthermore, IBF is coupled to the E3 ubiquitin ligand lenalidomide via a linker, forming a bifunctional molecule capable of targeting SLC15A1 and inducing its protein degradation. The IL-PROTAC drug constructed in this invention has been shown to significantly inhibit tumor growth and prolong the survival of the LUAD brain metastasis model in animals.

[0010] Based on the above, in a first aspect, the present invention provides an SLC15A1 protein-targeting degrader (IL-PROTAC), wherein the degrader uses ibuprofen as the SLC15A1 recognition unit and is obtained by coupling ibuprofen to a ligand of an E3 ubiquitin ligase via a linker. In a further embodiment, the linker is a flexible C6 alkylbisamide linker arm of N-Boc-6-aminohexanoic acid (C6H... 11 NO: -NH-(CH2)5-CO-), as shown in equation (I):

[0011]

[0012] Formula (I).

[0013] The E3 ubiquitin ligase is CRBN, and the ligand of the E3 ubiquitin ligase is lenalidomide.

[0014] In a further embodiment, the SLC15A1 protein-targeting degrader is a compound as shown in formula (II) or a pharmaceutically acceptable salt thereof:

[0015]

[0016] Equation (II).

[0017] In a further embodiment, the preparation method of the SLC15A1 protein-targeting degrader includes:

[0018] Step 1: Lenalidomide and N-Boc-6-aminohexanoic acid undergo an amidation reaction under the action of a condensing agent and a catalyst to form an amide intermediate containing a tert-butyloxycarbonyl group. The condensing agent in Step 1 is DIC, and the catalyst is DMAP. The tert-butyloxycarbonyl group is a protecting group. The molar ratio of lenalidomide to N-Boc-6-aminohexanoic acid is 5:6. In this step, the aromatic amino group of lenalidomide and the carboxyl terminus of N-Boc-6-aminohexanoic acid undergo an amidation reaction under the action of the condensing agent DIC and the catalyst DMAP.

[0019] Step 2: The amide intermediate is subjected to a tert-butyloxycarbonyl group removal reaction under hydrochloric acid / 1,4-dioxane solution to obtain an intermediate containing a terminal primary amine. Step 3: The intermediate containing the terminal primary amine undergoes an amidation reaction with ibuprofen in the presence of a condensing agent and an organic base to obtain the SLC15A1 protein-targeting degradation agent IL-PROTAC. The condensing agent in Step 3 is TBTU, and the organic base is DIPEA. The molar ratio of the intermediate containing the free primary amine to ibuprofen is 5:6.

[0020] All the above reactions were carried out at room temperature under a protective gas, namely nitrogen. Lenalidomide and ibuprofen used in steps 1 and 3 can be synthesized in-house or are commercially available products.

[0021] Secondly, this invention provides the application of the SLC15A1 protein-targeting degrader in the preparation of a drug for treating brain metastases of lung adenocarcinoma. Examples of this invention demonstrate that the SLC15A1 protein-targeting degrader IL-PROTAC can significantly inhibit brain tumor burden in animal models of LUAD brain metastases. Simultaneously, IL-PROTAC treatment significantly prolonged the survival time of mice in the brain metastasis model. These results indicate that IL-PROTAC can effectively inhibit the progression of LUAD brain metastases in vivo and has the potential to be used as a drug for the prevention and treatment of LUAD brain metastases.

[0022] The beneficial effects of this invention are as follows:

[0023] (1) This invention provides new targets and novel intervention strategies for the treatment of LUAD brain metastases.

[0024] This invention, by integrating omics sequencing data from patients with LUAD (lumbar angina pectoris) in situ and brain metastases, revealed that SLC15A1 expression in LUAD metastases was significantly higher than in in situ tumors, and its expression in tumor tissue was higher than in normal tissue, and was associated with poor patient prognosis. Further SLC15A1 knockdown experiments showed that reducing SLC15A1 expression significantly inhibited LUAD cell proliferation and invasion, and downregulated EMT-related signals. These results indicate that SLC15A1 plays a promoting role in the malignant progression and brain metastasis of LUAD, and can serve as an effective intervention target for the treatment of LUAD brain metastases. Compared with existing treatment strategies that mainly target classic driver genes such as EGFR, ALK, ROS1, RET, MET, and KRAS, this invention provides a novel therapeutic direction targeting SLC15A1, offering new drug development ideas for LUAD brain metastases patients lacking classic mutated genes or exhibiting drug resistance.

[0025] (2) The IL-PROTAC constructed in this invention can induce the degradation of SLC15A1 protein, and its mechanism of action is different from that of traditional inhibitors.

[0026] This invention constructs IL-PROTAC, a protein degrader targeting SLC15A1, based on PROTAC technology. This molecule uses IBF as the SLC15A1 recognition unit and is coupled with lenalidomide as an E3 ubiquitin ligase ligand via a linker. Compared to using IBF alone, IL-PROTAC not only acts on SLC15A1-related functions but also induces the degradation of SLC15A1 protein via the ubiquitin-proteasome system, thereby reducing the level of the target protein. In vitro experimental results show that IL-PROTAC can induce SLC15A1 protein degradation in LUAD cells in a time- and concentration-dependent manner. Further addition of the proteasome inhibitor MG132 inhibited the degradation of SLC15A1 by IL-PROTAC, indicating that IL-PROTAC-mediated SLC15A1 degradation depends on the ubiquitin-proteasome system. These results demonstrate that the IL-PROTAC of this invention is not simply a transport function inhibitor but a targeted protein degrader capable of reducing SLC15A1 protein levels.

[0027] (3) The inhibitory effect of IL-PROTAC of the present invention on the proliferation and invasion of LUAD cells is superior to that of IBF.

[0028] In vitro functional experiments showed that IL-PROTAC significantly inhibited the proliferation and invasion of LUAD cells. Compared with IBF, IL-PROTAC had a stronger inhibitory effect on LUAD cell proliferation and invasion, indicating that the formation of PROTAC molecules by coupling the IBF recognition unit with the E3 ubiquitin ligase ligand via a linker can produce an anti-tumor effect superior to the traditional inhibitor IBF. In vivo experimental results showed that in an orthotopic brain xenograft model, IL-PROTAC significantly reduced brain tumor burden and prolonged the survival of model animals. In a LUAD brain metastasis model, IL-PROTAC also delayed brain metastasis progression, inhibited tumor growth, and prolonged animal survival.

[0029] (4) The IL-PROTAC of the present invention can suppress MAPK signals and block EMT processes.

[0030] This invention further revealed through DNA methylation sequencing and pathway analysis that IL-PROTAC treatment significantly altered the methylation profile of LUAD, with differentially methylated sites enriched in genes related to the MAPK signaling pathway. IL-PROTAC treatment also significantly altered the methylation levels of key molecules in the MAPK signaling pathway. Subsequent in vitro and in vivo experiments further confirmed that this invention suggests IL-PROTAC can significantly inhibit MAPK signaling pathway activation and regulate the expression of EMT-related molecules, thereby inhibiting LUAD brain metastasis.

[0031] (5) The present invention has a different mechanism of action and application scenarios compared with the existing SLC15A1 related technologies.

[0032] Existing technologies primarily focus on inhibiting the transport function of SLC15A1 with anti-SLC15A1 antibodies or peptide transporters, mainly through antibody binding, cytotoxicity, or transport function blockade. This invention differs from these technologies by inducing targeted degradation of the SLC15A1 protein using PROTAC technology. Furthermore, current research lacks evidence regarding the crucial role of SLC15A1 in LUAD brain metastases, and there are no PROTAC protein degrading agents targeting SLC15A1 or their application in treating LUAD brain metastases. Therefore, this invention not only provides a novel SLC15A1-targeting protein degrading agent but also offers a novel therapeutic strategy for LUAD brain metastases. In addition, SLC15A1 is a transmembrane transporter. Existing PROTAC technologies largely focus on classic intracellular targets such as kinases, transcription factors, and epigenetic regulatory proteins, while the development of targeted degradation drugs for transmembrane transporters remains relatively limited. This study successfully constructed a PROTAC molecule that can induce the degradation of SLC15A1 protein by using IBF as the recognition unit and coupling it with an E3 ubiquitin ligase ligand via a linker, with SLC15A1 as the target protein. This provides a new technical approach and application basis for the targeted protein degradation of transmembrane transport proteins. Attached Figure Description

[0033] Figure 1 Screening and expression analysis of SLC15A1. A. Gene expression heatmap from transcriptome sequencing of tumor samples from primary and brain metastasis patients. B. Volcano plot of differentially expressed genes from transcriptome sequencing of tumor samples from primary and brain metastasis patients. C. Differences in SLC15A1 expression between primary and brain metastasis patients in the TCGA LUAD database. P < 0.05, t Tests were conducted to differentiate SLC15A1 expression in normal tissue samples and LUAD patient tumor samples from the D,E. CPTAC and TCGA databases. P < 0.0001, t F. Kaplan–Meier survival curve analysis of the prognostic difference between patients with high and low SLC15A1 expression in the TCGA LUAD database. Log-rank test. G. Immunofluorescence detection of SLC15A1 expression levels in normal astrocytes (HA1800) and LUAD cells (A549, H1975). Scale bar: 20 μm.

[0034] Figure 2Effects of SLC15A1 on the phenotype of LUAD tumor cells. A, B. RT-qPCR was used to detect changes in SLC15A1 expression in A549 (A) and H1975 (B) cells after SLC15A1 knockdown, with GAPDH used as an internal control. * P < 0.05,** P <0.01, t Tests. C,D. Western blot analysis was used to detect changes in the protein expression of SLC15A1 and EMT markers (ZO-1, Vimentin) in SLC15A1 knocked-down A549 (C) and H1975 (D) cells, with GAPDH used as an internal control. E,G. CCK-8 assays were used to detect changes in the proliferation levels of SLC15A1 knocked-down A549 (E) and H1975 (G) cells. **** P < 0.0001, t Tests. F,H. Transwell assays were used to detect changes in the invasive ability of SLC15A1 knocked-down A549 (F) and H1975 (H) cells. Scale bar: 100 μm.

[0035] Figure 3 Effects of IBF on the phenotype of LUAD tumor cells. A, B. CCK-8 assay was used to detect changes in the proliferation levels of A549 (A) and H1975 (B) cells treated with different concentrations of IBF. **** P < 0.0001, t The test, with Vehicle representing the solvent control. C,D. Transwell experiments statistically analyzed the differences in invasive ability between A549 (C) and H1975 (D) treated with different concentrations of IBF. No significant difference was found in ns. t The expression of SLC15A1 protein in A549 (E) and H1975 (F) cells treated with different concentrations of IBF was examined using Western blot experiments. Vinculin was used as an internal control.

[0036] Figure 4 Western blot was used to detect the expression differences of SLC15A1, CRBN, and MDM2 in normal astrocytes (HA1800) and LUAD cells (A549, H1975), with GAPDH used as an internal control.

[0037] Figure 5Synthetic route of IL-PROTAC, a protein degrader targeting SLC15A1. A. Synthesis of lenalidomide derivative A3. a: methyl 2-nitro-6-bromomethylbenzoate, K2CO3, acetonitrile, 85℃, 24 h; b: Fe, NH4OAc, acetone, room temperature, 3 h. B. Synthesis of ibuprofen carboxylic acid fragment B4. a: propionic acid, trifluoromethanesulfonic acid, 150℃, 1 h; b: trimethyl orthoformate, diacetic acid iodobenzene, NaOH, methanol, 50℃, 20 min; c: KOH, methanol, 65℃, 30 min. C. The lenalidomide-derived CRBN recruitment unit was coupled to the ibuprofen-derived SLC15A1 recognition unit via a flexible C6 alkyl bisamide linker derived from N-Boc-6-aminohexanoic acid to obtain the target compound IL-PROTAC (C3). a: N-Boc-6-aminohexanoic acid, DIC, DMAP, dichloromethane, room temperature, 6 hours; b: HCl / 1,4-dioxane, dichloromethane, room temperature, 1 hour; c: B4, TBTU, DIPEA, dichloromethane, room temperature, 2 hours.

[0038] Figure 6 IL-PROTAC Functional Validation. A, B. Western blot analysis of SLC15A1 protein levels in A549 (A) and H1975 (B) cells treated with different concentrations of IL-PROTAC, with GAPDH used as an internal control. C, D. Western blot analysis of SLC15A1 protein levels in A549 (C) and H1975 (D) cells treated with IL-PROTAC for different durations, with GAPDH used as an internal control. E, F. Western blot analysis of SLC15A1 protein levels in A549 (E) and H1975 (F) cells treated with IBF and IL-PROTAC, with GAPDH used as an internal control. G, H. Western blot analysis of SLC15A1 protein levels in A549 (G) and H1975 (H) cells treated with IBF, IL-PROTAC, and MG132, with GAPDH used as an internal control.

[0039] Figure 7 Effects of IL-PROTAC on the phenotype and in vivo tumorigenicity of LUAD cells. A, B. CCK-8 assay to detect changes in cell proliferation after IBF and IL-PROTAC treatment of A549 (A) and H1975 (B). * P < 0.05, ** P < 0.01, *** P < 0.001, tC. Transwell assay to detect changes in cell invasion ability of A549 and H1975 cells after treatment with IBF and IL-PROTAC. Scale bar: 100 μm. D, E. Statistical analysis of Transwell assay. No significant difference was observed in ns. P <0.001, **** P < 0.0001, t Tests. F, G. Western blot analysis of protein expression changes of SLC15A1 and EMT markers (ZO-1, Vimentin) in A549 and H1975 cells treated with IBF and IL-PROTAC; GAPDH was used as an internal control. H. Tumor fluorescence intensity in a brain tumor animal model. I. Kaplan-Meier survival curve analysis of animal model survival time. n = 6, * P <0.05,** P < 0.01, log-rank test. J. Changes in body weight in animal models. * P < 0.05, *** P < 0.001, One-way ANOVA test.

[0040] Figure 8 Methylation sequencing analysis of key signaling pathways regulated by IL-PROTAC. A. Methylation sequencing analysis of changes in genome-wide methylation levels in A549 cells after vehicle and IL-PROTAC treatment. B. Enrichment analysis of signaling pathways at differentially methylated sites. C. Enrichment analysis of gene sets at differentially expressed sites and MAPK signaling. D. Changes in methylation levels of key molecules in the MAPK signaling pathway.

[0041] Figure 9 Evaluation of the therapeutic effect of IL-PROTAC on an animal model of LUAD brain metastases. A. Tumor fluorescence intensity in different treatment groups in the LUAD brain metastasis animal model. B. Kaplan-Meier survival curve analysis of animal model survival time. n = 6, no significant difference in ns. *** P < 0.001, log-rank test. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0043] The experimental materials used in the examples were sourced from:

[0044] DMEM high-sugar basic nutrition medium: Gibco TM NEAA cell culture additive: Cyagen Biosciences; Penicillin-Streptomycin: Hyclone; Trypsin: Hyclone; CCK8 Kit: Beyotime Biotechnology; Anti-SLC15A1 antibody: Qinke Biotechnology; Anti-CRBN antibody, Anti-ZO-1 antibody, Anti-Vimentin Antibody, Anti-Vinculin antibody: Sanying Biotechnology; Anti-GAPDH antibody, Anti-MDM2 antibody: Sangon Biotech; Triton X-100 (CAS: 9002-93-1): Aladdin Bio-Reagent Co., Ltd.; Anesthetic: Solarbio Science & Technology Co., Ltd.; Isoflurane (used in animal imaging procedures): Reward Life Sciences Co., Ltd.; BALB / c-Nude female mice (5 weeks old): Spaford Biotechnology Co., Ltd.; D-fluorescein potassium salt: Yili Biotechnology Co., Ltd.; N,N-Diisopropylethylamine (DIPEA) (CAS: 7087-68-5), 3-Aminopiperidine-2,6-dione (CAS: 2353-4) 4-8), methyl 2-nitro-6-bromomethylbenzoate (CAS: 61940-21-4), isopropylbenzene (CAS: 98-82-8), butyric acid (CAS: 107-92-6), trifluoromethanesulfonic acid (CAS: 1493-13-6), trimethyl orthoformate (CAS: 149-73-5), potassium hydroxide (KOH) (CAS: 1310-58-3), N,N'-diisopropylcarbodiimide (DIC) (CAS: 693-13-0), sodium hydroxide (NaOH) (CAS: 1310-73-2), 4- Dimethylaminopyridine (DMAP) (CAS: 1122-58-3), TBTU (CAS: 125700-67-6), deuterated dimethyl sulfoxide (CAS: 2206-27-1), deuterated chloroform / CDCl3 (CAS: 865-49-6): Anaiji Chemical; Iron powder (CAS: 7439-89-6), ammonium acetate (CAS: 631-61-8), acetone (CAS: 67-64-1), acetonitrile (CAN) (CAS: 75-05-8), dichloromethane (DCM) (CAS: 75-09-2), stone Oil ether (CAS: 8032-32-4), ethyl acetate (CAS: 141-78-6): Tianjin Fuyu Fine Chemical; Dimethyl sulfoxide (DMSO) (CAS: 67-68-5): Bailingwei Chemical; N-Boc-6-aminohexanoic acid (CAS: 6404-29-1): Bid Pharmaceutical; Hydrochloric acid / 1,4-dioxane solution (CAS: 123-91-1): Shanghai Fenxi Biotechnology; Methanol (CAS: 67-56-1): Tianjin Zhiyuan Chemical; MG132 (CAS: 133407-82-6): Shanghai Taoshu Biotechnology.

[0045] Example 1

[0046] 1. Screening of candidate targets

[0047] To screen for candidate targets related to LUAD brain metastases, this embodiment first analyzed the transcriptome sequencing data of primary LUAD tumor tissue and brain metastases from published datasets (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE126548), and performed differential expression analysis using DESeq2. The results showed significant differences in gene expression between primary LUAD tumor tissue and brain metastases. Figure 1 (A, B). Further analysis of differentially expressed genes revealed that the expression level of SLC15A1 in brain metastasis samples was significantly higher than that in primary tumor samples.

[0048] Subsequently, this embodiment further utilized the TCGA LUAD database (https: / / portal.gdc.cancer.gov / projects / tcga-luad) to analyze the expression differences of SLC15A1 in in situ tumor samples and metastatic tumor samples. The results showed that SLC15A1 expression was significantly increased in metastatic tumor samples ( Figure 1 C).

[0049] Further comparison of its expression levels in normal tissues and patient tumor tissues revealed that SLC15A1 expression in LUAD tumor tissues was significantly higher than in normal tissues. Figure 1 D, E). Meanwhile, high expression of SLC15A1 is significantly associated with poor prognosis in LUAD patients (D, E). Figure 1 (F), suggesting that SLC15A1 may play a role as an oncogene that promotes the malignant progression of LUAD.

[0050] Furthermore, immunofluorescence assays showed that the expression level of SLC15A1 in LUAD tumor cells (A549, H1975, purchased from ATCC) was significantly higher than that in normal astrocytes (HA1800, purchased from ScienCell Research Laboratories). Figure 1 G).

[0051] In summary, these results reveal for the first time that SLC15A1 may be a key molecule in the development and progression of LUAD brain metastases and holds promise as a potential therapeutic target.

[0052] 2. Functional verification of SLC15A1

[0053] To further verify the functional characteristics of SLC15A1 in LUAD, this embodiment first constructed a lentiviral plasmid with stable SLC15A1 knockdown. This embodiment first designed two shRNA target sequences based on the human SLC15A1 mRNA sequence, and constructed the SLC15A1 knockdown vectors pLKO.1-shSLC15A1 (pLKO.1-shSLC15A1-1 and pLKO.1-shSLC15A1-2) using pLKO.1 as the lentiviral vector backbone, with the empty pLKO.1 plasmid as a control. The complementary oligonucleotides containing the SLC15A1 target sequence were annealed to form a double-stranded fragment, which was then ligated into the pLKO.1 vector digested with AgeI and EcoRI. Sanger sequencing was used to verify the correctness of the inserted sequence. During lentiviral packaging, pLKO.1-shSLC15A1 or pLKO.1 was co-transfected into HEK293T cells with packaging plasmid psPAX2 and envelope plasmid pMD2.G at a mass ratio of 3:2:1. Approximately 5 × 10⁶ cells were seeded 24 hours prior to transfection. 6 HEK293T cells were cultured in 10 cm cell culture dishes and transfected when the cell confluence was approximately 70%-80%. Each dish was treated with 4.5 μg pLKO.1-shSLC15A1 or pLKO.1 plasmid, 3.0 μg psPAX2, and 1.5 μg pMD2.G. Forty-eight hours after transfection, the viral supernatant was collected, filtered through a 0.45 μm filter, and used to infect A549 and H1975 cells. Before lentivirus transfection, the cells were in logarithmic growth phase. Cells were evenly seeded into six-well plates at a density of 4 × 10⁶ cells / well. 5 The confluence was approximately 70%. HEK293T and LUAD cells were cultured in DMEM high-glucose basal medium containing 10% FBS, 1% penicillin-streptomycin, and 1% NEAA cell culture supplement at 37°C and 5% CO2. The oligonucleotide sequences used to construct the two SCL15A1 knockdown sequences are as follows:

[0054] ShSLC15A1-1(Human): 5'- CGCCACAATGTCAACCTAATT-3' (SEQ ID NO: 1);

[0055] ShSLC15A1-2 (Human): 5'-GCGGAGATCGAAGCTCAATTT-3' (SEQ ID NO: 2).

[0056] RT-qPCR was used to detect changes in SLC15A1 expression in A549 and H1975 cells after SLC15A1 knockdown, with GAPDH used as an internal control. The results confirmed that SLC15A1 knockdown significantly reduced the expression level of SLC15A1 in both A549 and H1975 cells. Figure 2 The RT-qPCR primers used (A, B) are as follows:

[0057] GAPDH(Human)-FWD: 5'-GAAGGTGAAGGTCGGAGTC-3' (SEQ ID NO: 3);

[0058] GAPDH(Human)-REV: 5'-GAAGATGGGTGATGGGATTTC-3' (SEQ ID NO: 4);

[0059] SLC15A1(Human)-FWD: 5'- TCTTTGGTTATCCCCTGAGCA -3' (SEQ ID NO: 5);

[0060] SLC15A1(Human)-REV: 5'-GGCGGTGGACAGGTTATCATC-3' (SEQ ID NO: 6).

[0061] In addition, Western blot was used to detect changes in the expression of ZO-1 and Vimentin, markers of tumor metastasis and EMT signaling. The results showed that ZO-1 and Vimentin were significantly inhibited (…). Figure 2 (C, D). Subsequently, this embodiment used the CCK-8 assay to detect changes in the proliferation level of SLC15A1 knocked-down A549 and H1975 cells, and the Transwell assay to detect changes in the invasive ability of SLC15A1 knocked-down A549 and H1975 cells. The results showed that after SLC15A1 knockdown, the proliferation and invasive ability of tumor cells were significantly reduced (C, D). Figure 2 EH).

[0062] The above results suggest that SLC15A1 may play an important role in the progression and metastasis of LUAD by enhancing the malignant phenotype of LUAD cells through promoting the EMT process.

[0063] 3. Exploration of treatment strategies targeting SLC15A1

[0064] Based on the promoting effect of SLC15A1 in the malignant phenotypes associated with brain metastases in LUAD, this embodiment further explores a drug intervention strategy targeting SLC15A1. Previous studies have shown that IBF can act as a non-competitive inhibitor of SLC15A1. Therefore, in this embodiment, LUAD cells in the logarithmic growth phase were passaged, and then 4 × 10⁻⁶ cells were... 5LUAD cells were evenly seeded into six-well plates. When the cell density reached 70%, LUAD cells were treated with 0.5 μM and 1 μM IBF (dissolved in DMSO), respectively. After 0, 2, 4, and 6 days of treatment, the proliferation levels of A549 and H1975 cells treated with different IBF concentrations were detected using a CCK-8 assay. After 48 hours of treatment, the differences in invasive ability between A549 and H1975 cells treated with different IBF concentrations were statistically analyzed using a Transwell assay. Additionally, 0.1, 0.5, 1, and 10 μM IBF treatment groups were set up. After 48 hours of treatment, the expression changes of SLC15A1 protein in A549 and H1975 cells treated with different IBF concentrations were detected using a Western blot assay. The results showed that IBF could inhibit LUAD cell proliferation (…). Figure 3 A, B), but its inhibitory effect on LUAD cell invasion is limited ( Figure 3 C,D), and it cannot reduce the expression level of SLC15A1 protein (C ...). Figure 3 E,F).

[0065] The above results suggest that simply inhibiting SLC15A1 transport function is insufficient to fully block the biological processes involved in LUAD brain metastasis. Therefore, instead of using ibuprofen as a functional inhibitor alone, we further utilized IBF as an SLC15A1 recognition unit and coupled it with an E3 ubiquitin ligase ligand via a linker to construct a PROTAC protein degrader targeting SLC15A1. This induced the degradation of SLC15A1 protein via ubiquitin-protease, thereby intervening in the progression of LUAD brain metastasis.

[0066] 4. Construction of SLC15A1-targeted protein degrader (IL-PROTAC)

[0067] In this embodiment, Western blot was first used to detect the expression differences of SLC15A1, CRBN, and MDM2 in normal astrocytes (HA1800) and LUAD cells (A549, H1975). GAPDH was used as an internal control to analyze the expression of different E3 ubiquitinases (MDM2 and CRBN) in tumor cells and normal astrocytes. The results showed that the expression of CRBN in tumor cells was significantly higher than that in normal astrocytes (HA1800, LUAD cells (A549, H1975)). Figure 4 This suggests that using it as an E3 ubiquitinase molecule for PROTAC has a safer therapeutic window. Therefore, in this embodiment, lenalidomide, which has the potential to permeate the blood-brain barrier, is preferentially selected as the ligand for the E3 ubiquitinase CRBN.

[0068] In this embodiment, IBF was used as the recognition ligand for SLC15A1. By coupling an E3 ubiquitinase ligand via a linker, an IL-PROTAC capable of targeting SLC15A1 and inducing its protein degradation was prepared. The specific synthetic route of IL-PROTAC is as follows: Figure 5 As shown, the specific synthesis steps are as follows:

[0069] (1) Synthesis of lenalidomide

[0070] like Figure 5 As shown in Figure A, starting with 3-aminopiperidine-2,6-dione, a nucleophilic substitution reaction was carried out in acetonitrile with methyl 2-nitro-6-bromomethylbenzoate under alkaline conditions provided by potassium carbonate, generating a nitro-containing lenalidomide precursor intermediate A2. Subsequently, A2 underwent a nitro reduction reaction in the presence of iron powder and ammonium acetate to give a lenalidomide derivative A3 containing an aromatic amino group. The specific steps were as follows: Compound A1 (12.5 g, 75 mmol) was weighed and dissolved in acetonitrile (200 mL), and methyl 2-nitro-6-bromomethylbenzoate (23.7 g, 86 mmol) and potassium carbonate (14.4 g, 103 mmol) were added. Under N2 protection, the mixture was heated to reflux at 85 °C and stirred for 24 hours. After the reaction was complete, it was cooled to room temperature, post-treated, and recrystallized from dichloromethane / petroleum ether (V / V = 6:1) to obtain a white solid A2 (15.5 g, 68%). Weigh A2 (1.6 g, 5 mmol) and iron powder (1.23 g), add ammonium acetate solution to acetone as solvent, and stir at room temperature for 3 hours under N2 protection, monitoring the reaction progress by TLC. After the reaction is complete, quench the reaction with saturated sodium bicarbonate aqueous solution, dilute the reaction mixture with dichloromethane, and filter. Extract the filtrate with dichloromethane, wash twice with saturated NaCl solution, dry to anhydrous sodium sulfate, concentrate under reduced pressure, and purify by column chromatography to obtain white solid A3 (0.93 g, 65%).

[0071] (2) Synthesis of IBF

[0072] like Figure 5As shown in Figure B, isobutylbenzene, as the starting material, undergoes a Friedel-Crafts acylation reaction with propionic acid under the catalysis of trifluoromethanesulfonic acid to generate intermediate B2, which contains a ketone carbonyl group, namely 1-[4-(2-methylpropyl)phenyl]prop-1-one. Subsequently, B2 undergoes an oxidative rearrangement / methyl esterification reaction in methanol under the action of diacetic acid iodobenzene [PhI(OAc)2], trimethyl orthoformate (TMOF), and sodium hydroxide to generate ibuprofen methyl ester intermediate B3, namely methyl 2-[4-(2-methylpropyl)phenyl]propionate. Finally, B3 undergoes an ester hydrolysis reaction under the action of potassium hydroxide and is acidified to obtain B4, namely 2-(4-isobutylphenyl)propionic acid. The specific steps are as follows: weigh isobutylbenzene B1 (1.34 g, 10 mmol) and propionic acid (0.89 g, 12 mmol), and add trifluoromethanesulfonic acid (0.15 g, 1 mmol). Under N2 protection, the mixture was heated to 150 °C and stirred for 1 hour. After the reaction was complete, it was cooled to room temperature to obtain intermediate B2. A continuous reaction was then carried out, with diacetic acid iodobenzene [PhI(OAc)2], sodium hydroxide, and a suitable amount of methanol added to B2. After dissolution, trimethyl orthoformate (TMOF) was added, and the mixture was stirred at 50 °C for 20 minutes under N2 protection to obtain ibuprofen methyl ester intermediate B3. Potassium hydroxide and methanol were added to B3, and the mixture was heated to 65 °C and stirred for 30 minutes, with the reaction progress monitored by TLC. After the reaction was complete, the organic solvent was removed, a suitable amount of water was added to dissolve the residue, and the mixture was acidified with dilute hydrochloric acid to pH 1–2 to convert the product to a carboxylic acid form. The product was then extracted with dichloromethane, washed twice with saturated NaCl solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and recrystallized from petroleum ether to obtain a white solid B4 (1.0 g, 48%).

[0073] (3) Synthesis of IL-PROTAC

[0074] like Figure 5As shown in Figure C, the aromatic amino group of A3 undergoes an amidation reaction with the carboxyl terminus of N-Boc-6-aminohexanoic acid under the action of condensing agent DIC and catalyst DMAP, forming an amide intermediate C1 containing a Boc protecting group. Subsequently, C1 undergoes a Boc deprotection reaction under hydrochloric acid / 1,4-dioxane conditions to obtain an intermediate C2 containing a terminal primary amine. Finally, C2 and B4 undergo another amidation reaction under the action of condensing agent TBTU and organic base DIPEA to form the target product C3, namely the SLC15A1 targeted protein degradation agent IL-PROTAC. The specific steps are as follows: A3 (5.18 g, 20 mmol) and N-Boc-6-aminohexanoic acid (6.22 g, 24 mmol) are weighed and dissolved in dichloromethane (50 mL), followed by the addition of DIC (3.7 mL) and DMAP. The mixture is stirred at room temperature for 6 hours under N2 protection, and the reaction progress is monitored by TLC. After the reaction was complete, insoluble matter was removed by filtration. The filtrate was extracted with dichloromethane, washed twice with saturated NaCl solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography to obtain a white solid C1. C1 (2.36 g, 5 mmol) was weighed and dissolved in dichloromethane (25 mL). Hydrochloric acid / 1,4-dioxane solution was slowly added under ice bath conditions. The ice bath was then removed, and the mixture was stirred at room temperature for 1 hour under N2 protection, with TLC monitoring the reaction progress. After the reaction was complete, the solvent was removed under reduced pressure, and the mixture was precipitated, washed, or purified appropriately to obtain the primary amine intermediate C2 after Boc removal. C2 (0.372 g, 1 mmol) and B4 (0.248 g, 1.2 mmol) were weighed and dissolved in dichloromethane (15 mL). TBTU (0.385 g, 1.2 mmol) and DIPEA (0.348 mL) were then added. The mixture was stirred at room temperature for 2 hours under N2 protection, with TLC monitoring the reaction progress. After the reaction was completed, the insoluble matter was removed by filtration. The filtrate was extracted with dichloromethane, washed twice with saturated NaCl solution, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography to obtain a white solid C3 (0.38 g, 68%), which is the target product IL-PROTAC.

[0075] 5. IL-PROTAC Function Verification

[0076] After synthesizing and obtaining IL-PROTAC, this example further verifies its ability to induce SLC15A1 protein degradation in LUAD cells.

[0077] LUAD cells (A549 and H1975) in logarithmic growth phase were treated with different concentrations (0.1, 0.5, 1, 10, and 50 μM) of IL-PROTAC (dissolved in DMSO) for 48 hours. Western blot was then used to detect the expression level of SLC15A1 protein in LUAD cells. The results showed that, compared with the control group, SLC15A1 protein expression was significantly reduced in the IL-PROTAC-treated groups. Furthermore, the degradation of SLC15A1 by IL-PROTAC was concentration-dependent, and a hook effect common to PROTAC molecules was observed at higher concentrations. Figure 6 A, B).

[0078] Further time-gradient experiments were conducted. Specifically, H1975 and A549 cells in the logarithmic growth phase were treated with 0.5 μM and 1 μM IL-PROTAC for 0, 4, 8, 12, 24, 36, and 48 hours, respectively. Western blot analysis was performed to detect changes in SLC15A1 protein levels in H1975 and A549 cells at different treatment times. The results showed that SLC15A1 protein levels gradually decreased with prolonged IL-PROTAC treatment, suggesting that the degradation effect of IL-PROTAC on SLC15A1 is time-dependent. Figure 6 C,D).

[0079] LUAD cells (A549 and H1975) in logarithmic growth phase were treated with IBF (0.5, 1 μM) and IL-PROTAC (0.5, 1 μM) for 48 hours, respectively. Western blot analysis was used to detect changes in SLC15A1 protein levels in A549 and H1975 cells after IBF and IL-PROTAC treatment. The results showed that, compared to the non-competitive inhibitor IBF, IL-PROTAC significantly induced SLC15A1 protein degradation. Figure 6 E,F).

[0080] To further verify the mechanism by which IL-PROTAC induces SLC15A1 degradation, a blocking experiment was conducted using the proteasome inhibitor MG132. First, LUAD cells (A549 and H1975) in logarithmic growth phase were pretreated with MG132 (10 μM). After 4 hours, the medium was replaced with DMEM high-glucose medium containing IBF (1 μM) and IL-PROTAC (1 μM). Western blot analysis was performed to detect changes in SLC15A1 protein levels in A549 and H1975 cells. The results showed that MG132 treatment significantly restored the SLC15A1 protein levels reduced after IL-PROTAC treatment. Figure 6The results (G, H) indicate that IL-PROTAC-induced SLC15A1 degradation depends on the proteasome pathway. These results demonstrate that IL-PROTAC can induce targeted SLC15A1 degradation via the ubiquitin-proteasome system, unlike traditional inhibitors that only inhibit SLC15A1 function.

[0081] The study further compared the effects of the non-competitive SLC15A1 inhibitors IBF and IL-PROTAC on the proliferation and invasion of LUAD cells. Specifically, LUAD cells H1975 in logarithmic growth phase were treated with IBF (0.5 μM) and IL-PROTAC (0.5 μM), and LUAD cells A549 in logarithmic growth phase were treated with IBF (1.0 μM) and IL-PROTAC (1.0 μM). After 48 hours, the changes in cell proliferation after IBF and IL-PROTAC treatment of A549 and H1975 cells were detected by CCK-8 assay, the changes in cell invasion after IBF and IL-PROTAC treatment of A549 and H1975 cells were detected by Transwell assay, and the changes in protein expression of SLC15A1 and EMT markers (ZO-1, Vimentin) in A549 and H1975 cells after IBF and IL-PROTAC treatment were detected by Western blot. The results showed that IL-PROTAC significantly inhibited the proliferation and invasion of LUAD cells compared to IBF. Figure 7 AD). Meanwhile, IL-PROTAC inhibits EMT signaling more effectively than IBF, suggesting that it can block the distant metastasis of LUAD cells. Figure 7 FG).

[0082] The above results indicate that, compared with the functional inhibitor IBF, IL-PROTAC can more effectively inhibit the proliferation, invasion, and metastasis-related phenotypes of LUAD cells by inducing SLC15A1 protein degradation.

[0083] Finally, an orthotopic brain tumor xenograft model was constructed to verify the in vivo therapeutic effect of IL-PROTAC compared to IBF. First, A549 cells were transduced into a luciferase expression vector via lentiviral transduction. After selection with puromycin, A549-luc cells stably expressing luciferase were obtained, and their luciferase activity was verified by in vitro bioluminescence imaging. Subsequently, A549-luc cells in the logarithmic growth phase were trypsinized, centrifuged, collected, resuspended in sterile PBS, and their cell concentration adjusted for subsequent orthotopic brain seeding experiments. The cell concentration was adjusted to 5 × 10⁶ cells / cm². 5Cells per mouse. Cell suspension was kept on ice and gently mixed before injection to avoid cell sedimentation or aggregation. Five-week-old female BALB / c-Nude mice were used as experimental animals. Mice underwent in situ brain inoculation after one week of acclimatization. Mice were anesthetized and fixed on a small animal stereotaxic apparatus. The head skin was routinely disinfected and the skull exposed. Using the bregma as a reference point, a hole was drilled 0.2 mm posterior to and 2.2 mm to the left. A549-luc cell suspension was then slowly injected into the left striatum to a depth of 3.5 mm. After injection, the needle remained in place for several minutes to reduce reflux of the cell suspension, then the needle was slowly withdrawn and the incision sutured. After the mice recovered, they were returned to their cages for continued observation. On day 7 after modeling, brain tumor formation was confirmed by in vivo bioluminescence imaging. Based on the intensity of brain fluorescence signals, mice were randomly divided into Vehicle, IBF, and IL-PROTAC groups, with 10 mice in each group. The Vehicle group received the corresponding drug solvent, the IBF group received IBF, and the IL-PROTAC group received IL-PROTAC. Administration was via intraperitoneal injection at a dose of 20 mg / kg, administered every other day for a total of 7 doses. The IBF and IL-PROTAC in vivo dosing solutions were prepared fresh for each use. First, the drug was dissolved in DMSO to prepare a stock solution. Before each administration, the solution was diluted with a mixed solvent containing 5% DMSO, 45% PEG300, 5% Tween-80, and 45% physiological saline, and then prepared by shaking and sonication to a final concentration of 2 mg / mL. During the experiment, mouse weight and general condition were recorded weekly, and changes in brain tumor burden were dynamically monitored using in vivo bioluminescence imaging. Before imaging, mice were injected intraperitoneally with D-luciferin substrate. After signal stabilization, IVIS imaging was performed, and tumor growth was quantitatively analyzed using the total photon flux in the brain region. The experimental endpoint was defined as a mouse's weight loss reaching or exceeding 20% ​​of its initial body weight, or the appearance of significant exhaustion, significantly decreased activity, or abnormal neurological function. The results showed that IL-PROTAC could significantly inhibit tumor growth and prolong the survival of animal models of brain xenograft. Figure 7 HJ).

[0084] 6. Omics sequencing validates the IL-PROTAC signaling pathway regulating LUAD cell proliferation and invasion.

[0085] To verify the functional mechanism of IL-PROTAC, previous studies have confirmed that IBF is related to methylation regulation, and IL-PROTAC uses IBF as a recognition ligand for SLC15A1. Therefore, this embodiment also verifies the molecular mechanism by which IL-PROTAC participates in regulation through methylation sequencing.

[0086] First, A549 cells were cultured at a rate of 6 × 10⁻⁶.5 Cells were seeded per well in 6-well plates, with each well containing 3 mL of complete culture medium. PBS and IL-PROTAC (1 μM) were added for treatment, with each treatment lasting 48 hours and repeated three times per group. After treatment, cells were collected, and whole-genome methylation sequencing was performed using a 935K methylation microarray. After obtaining raw signal data via microarray hybridization and fluorescence signal scanning, probe site annotation and sequence matching were performed using hg38 as a reference genome. The signal distribution ratio of CpG sites in each functional region was statistically analyzed, and the methylation level of each CpG site was quantified, calculating the methylation β value (0–1). Based on the β value matrix, the limma algorithm was used for sample clustering analysis and differential methylation site analysis. KEGG pathway enrichment analysis was further performed on target genes associated with differential methylation sites to elucidate the biological functions and molecular pathways regulated by methylation modification. The results showed that IL-PROTAC not only induced SLC15A1 protein degradation but also caused changes in the DNA methylation profile of LUAD cells. Figure 8 A), and by inhibiting the activation of the MAPK signaling pathway ( Figure 8 B, C), among which, the methylation levels of key molecules in the MAPK signaling pathway changed significantly after IL-PROTAC treatment ( Figure 8 D), thereby reducing the proliferation, invasion and EMT process of LUAD cells, thus effectively inhibiting LUAD brain metastasis.

[0087] 7. Validating the therapeutic effect of IL-RPOTAC using a LUAD brain metastasis model.

[0088] To verify the in vivo therapeutic effect of IL-PROTAC on LUAD brain metastases, this embodiment also constructed an animal model of LUAD brain metastases and evaluated the anti-tumor effect of IL-PROTAC through in vivo bioluminescence imaging and survival analysis.

[0089] First, LUAD cells A549-luc, stably expressing luciferase, were cultured to the logarithmic growth phase. After digestion and centrifugation, the cells were collected and resuspended in sterile PBS to prepare a single-cell suspension. After cell counting, the cell concentration was adjusted to the predetermined inoculation concentration, ensuring that each mouse was inoculated with 5 × 10⁶ cells. 5Cells per mouse. Cell suspensions were kept on ice and gently mixed before injection to avoid cell sedimentation or aggregation. Five-week-old female BALB / c-Nude mice were used as experimental animals. After one week of acclimatization, mice were randomly divided into Vehicle, IBF, and IL-PROTAC groups (n=10 per group) based on body weight. The Vehicle group received the corresponding drug solvent, the IBF group received IBF, and the IL-PROTAC group received IL-PROTAC. Administration was intraperitoneal injection. The IBF and IL-PROTAC groups underwent pretreatment with the drug before tumor cell inoculation, administered every other day for a total of four times. Brain metastasis model construction was performed every other day after pretreatment. After modeling, administration continued every other day until in vivo imaging observation was completed. The brain metastasis model construction method was as follows: Mice were anesthetized and fixed in a supine position. Under aseptic conditions, A549-luc cell suspension was injected into the left ventricle through the chest wall, allowing tumor cells to enter the arterial circulation and form brain metastases. The needle tip position was determined during injection by observing blood return and injection resistance. After injection, the needle was removed and local pressure was applied to stop bleeding. Once the mice regained consciousness, they were returned to their cages for further observation. The in vivo administration solutions for IBF and IL-PROTAC were prepared fresh for each use: the drugs were first dissolved in DMSO to prepare the stock solution. The dosage and preparation method were consistent with the in situ brain tumor treatment experiment. During the experiment, the mice's weight and condition were monitored weekly, and changes in brain tumor signals were dynamically observed using in vivo bioluminescence imaging. The experimental endpoint was defined as a decrease in mouse weight to or exceeding 20% ​​of initial body weight, or the appearance of significant exhaustion. The results showed that compared to the Vehicle and IBF groups, the IL-PROTAC group exhibited significantly reduced brain bioluminescence signals, suggesting that IL-PROTAC can significantly inhibit brain tumor burden in the LUAD brain metastasis animal model. Simultaneously, IL-PROTAC treatment significantly prolonged the survival time of the brain metastasis model mice. Figure 9 (A, B). The above results indicate that IL-PROTAC can effectively inhibit the progression of LUAD brain metastases in vivo and has the potential to be used as a drug for the prevention and treatment of LUAD brain metastases.

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An SLC15A1 protein-targeting degrader, characterized in that, The degradation agent is obtained by coupling ibuprofen with the ligand of E3 ubiquitin ligase via a linker, using ibuprofen as the SLC15A1 recognition unit.

2. The SLC15A1 protein-targeting degrader according to claim 1, characterized in that, The linker is -NH-(CH2)5-CO-.

3. The SLC15A1 protein-targeting degrader according to claim 1, characterized in that, The E3 ubiquitin ligase is CRBN, and the ligand of the E3 ubiquitin ligase is lenalidomide.

4. The SLC15A1 protein-targeting degrader according to claim 1, characterized in that, The SLC15A1 protein-targeting degrader is a compound as shown in formula (II) or a pharmaceutical salt thereof: Equation (II).

5. The SLC15A1 protein-targeting degrader according to claim 4, characterized in that, The preparation method of the SLC15A1 protein-targeting degrader includes: Step 1: Lenalidomide and N-Boc-6-aminohexanoic acid undergo an amidation reaction under the action of a condensing agent and a catalyst to form an amide intermediate containing a tert-butyloxycarbonyl group; the condensing agent in Step 1 is DIC, and the catalyst is DMAP; Step 2: The amide intermediate is subjected to the removal of the tert-butyloxycarbonyl group under the conditions provided by hydrochloric acid / 1,4-dioxane solution to obtain an intermediate containing a terminal primary amine; Step 3: The intermediate containing the terminal primary amine undergoes an amidation reaction with ibuprofen under the action of a condensing agent and an organic base to obtain the SLC15A1 protein-targeting degradation agent IL-PROTAC; the condensing agent is TBTU.

6. The SLC15A1 protein-targeting degrader according to claim 5, characterized in that, In step 1, the molar ratio of lenalidomide to N-Boc-6-aminocaproic acid is 5:6; in step 3, the molar ratio of the intermediate containing the terminal primary amine to ibuprofen is 5:

6.

7. The SLC15A1 protein-targeting degrader according to claim 5, characterized in that, The organic base mentioned in step 3 is DIPEA.

8. The SLC15A1 protein-targeting degrader according to claim 5, characterized in that, All reactions were carried out at room temperature under a protective gas atmosphere.

9. The SLC15A1 protein-targeting degrader according to claim 8, characterized in that, The protective gas is nitrogen.

10. The use of the SLC15A1 protein-targeting degrader according to any one of claims 1-9 in the preparation of a drug for treating brain metastases of lung adenocarcinoma.