Low-grade endometrial interstitial sarcoma diagnostic kit

Abstract

The utility model is suitable for the technical field of diagnostic kits, and provides a low-grade endometrial interstitial sarcoma diagnostic kit. The low-grade endometrial interstitial sarcoma diagnostic kit comprises a kit body and a kit cover, the kit body comprises a first unit and a second unit; the first unit is provided with a test tube box containing RNase-Free water, a test tube box containing 2 * qPCR Mix and a test tube box containing a 5 * all in one reverse transcription reagent; the second unit is provided with a test tube box containing an internal standard primer, a test tube box containing a JAZF1-SUZ12 primer and a test tube box containing a positive cDNA standard substance. According to the utility model, the JAZF1-SUZ12 fusion gene can be detected, and the JAZF1-SUZ12 fusion variation has specificity and exclusiveness in the LGESS, so that the JAZF1-SUZ12 fusion gene detection kit has very high value for differential diagnosis of the LGESS; an RT-qPCR method is adopted, whether the fusion gene exists in a patient sample or not is judged according to whether a positive signal exists in a reaction tube or not and a ct value of qPCR or not, the method is rapid, simple and convenient, and no operation is needed after the PCR reaction.

Description

Technical Field

[0001] The utility model relates to a diagnostic kit, in particular to a diagnostic kit for low-grade endometrial stromal sarcoma. Background Art

[0002] Endometrial stromal tumor (EST) is a type of female genital tract tumor with a significantly lower incidence than leiomyoma, but the clinical manifestations of patients are similar to those of general gynecological diseases, which is very easy to be misdiagnosed or missed. The "4th edition of the WHO Histological Classification of Tumors of Female Reproductive Organs" released by WHO in 2014 combines the histological characteristics, clinical prognosis, molecular genetics and other data of EST to divide EST into four types: endometrial stromal nodules (ESN), low-grade endometrial stromal sarcoma (LGESS), high-grade endometrial stromal sarcoma (HGESS) and undifferentiated uterine sarcoma (UUS).

[0003] LGESS is a slow-growing malignant tumor and the most common subtype of ESS, which is prone to occur in young and perimenopausal women. Currently, morphology and immunohistochemistry are the standards for distinguishing LGESS from other subtypes of tumors. However, it is very difficult to distinguish LGESS from cellular uterine leiomyoma. The latter is composed of consistent abundant cells and has slightly irregular tumor borders, and these morphological characteristics are highly similar to LGESS. In addition, in some cases, it is also very difficult to distinguish LGESS from HGESS based solely on histological features. Immunohistochemical detection (including CD10 and smooth muscle-derived markers such as desmin, smooth muscle actin (SMA), and H-caldesmon) has a certain auxiliary diagnostic value. However, it is particularly important to emphasize that CD10 is not a reliable indicator of endometrial stromal differentiation. About 40% of cellular leiomyoma express CD10, while LGESS with other histological differentiation often does not express CD10. In addition, the proportion of various myogenic markers expressed in LGESS (H-caldesmon 15%+, desmin 32%+, and SMA 63%+) is not low. Therefore, relying solely on morphology and immunohistochemistry can easily lead to misdiagnosis, especially in minimally invasive specimens.

[0004] The fusion gene of JAZF1 is specific and exclusive in LGESS. Studies have shown that most LGESSs have t(7;17)(p21;q15), which leads to the fusion of JAZF1 and SUZ12 genes. The new 2021 NCCN Guidelines for Uterine Tumors point out that this mutation is the most common mutation in LGESS patients, which can be seen in more than 50% of LGESS patients, so it has a very high value for differential diagnosis.

[0005] Defects and shortcomings of the existing technology:

[0006] At present, the clinical diagnosis of LGESS mainly relies on morphology and immunohistochemistry, but the morphological characteristics of cell-rich uterine leiomyoma are highly similar to LGESS. In addition, in some cases, it is also very difficult to distinguish LGESS from HGESS based solely on histological features. Although immunohistochemical testing has a certain auxiliary diagnostic value, there is overlap between the immunophenotype of some LGESS and leiomyoma. Therefore, relying solely on morphology and immunohistochemistry can easily lead to misdiagnosis, especially in minimally invasive specimens. Utility Model Content

[0007] The purpose of the embodiment of the utility model is to provide a diagnostic kit for low-grade endometrial stromal sarcoma, aiming to solve the technical problems raised in the above-mentioned background technology.

[0008] To achieve the above objectives, the utility model provides the following technical solutions.

[0009] The diagnostic kit for low-grade endometrial stromal sarcoma of the embodiment of the utility model comprises a kit body and a box cover;

[0010] The reagent kit body comprises a first unit and a second unit;

[0011] The first unit has a test tube box containing RNase-Free water, a test tube box containing 2×qPCR Mix, and a test tube box containing 5×all ​​inone reverse transcription reagent;

[0012] The second unit has a test tube box containing an internal standard primer, a test tube box containing JAZF1-SUZ12 primers, and a test tube box containing a positive cDNA standard.

[0013] In some embodiments of the present invention, the sequences of the internal standard primers in the test tube box containing the internal standard primers are Actin-F: GAGCACAGAGCCTCGCCTTT, and Actin-R: TCATCATCCATGGTGAGCTGG.

[0014] In some embodiments of the present invention, the JAZF1-SUZ12 primers in the test tube box containing JAZF1-SUZ12 primers are JAZF-F2: CCCATCACCCCCTCCTCTTCATTC; SUZ12-R2: GCTATGAGATTCTTGCTCTCCTTTCATTTTCTCTAC.

[0015] In some embodiments of the present invention, the sequence of the positive control product in the test tube box containing the positive cDNA standard product is:

[0016] AGATTCATGACAGATGCTGCCCGCCGAGAGCAGGAGTCCCTAAAGAAGAAGATCAGCCGAAGCTCTCGCTGACTCTGTCCAGCTCAGTGTCTCGAGGGAATGTGTCCACTCCCCCACGCCACAGCAGTGGAAGCCTTACTCCCCCCGTGACCCCACCCATCACCCCCTCCTCTTCATTCCGCAGCAGCACTCCGACAAGCCAACACAGATCTAT AGATTTCTTCGAACTCGGAATCTCATAGCACCAATATTTTTGCACAGAACTCTTACTTACATGTCTCATCGAAACTCCAGAACAAACATCAAAAGGAAAACATTTAAAGTTGATGATATGTTATCAAAAGTAGAGAAAATGAAAGGAGAGCAAGAATCTCATAGCTTGTCAGCTCATTTGCAGCTTACGTTTACTGGTTTCTTCCACAAAAATG.

[0017] In some embodiments of the present invention, each test tube of the first unit and the second unit has a label for indicating information about the reagent contained in each test tube.

[0018] In some embodiments of the present invention, one side of the box cover is rotatably connected to one side of the reagent box body via a hinge connection.

[0019] In some embodiments of the present invention, the other side edge of the box cover is buckled and connected to the other side edge of the reagent box body via a snap connector.

[0020] Compared with the prior art, the beneficial effects of the low-grade endometrial stromal sarcoma diagnostic kit of the utility model are:

[0021] First, the utility model can detect the JAZF1-SUZ12 fusion gene. The JAZF1-SUZ12 fusion mutation is specific and exclusive in LGESS and has a very high value for the differential diagnosis of LGESS.

[0022] Second, the RT-qPCR method is used to determine whether the fusion gene exists in the patient sample based on whether there is a positive signal in the reaction tube and the ct value of qPCR. This method is fast, simple and convenient, and no operation is required after the PCR reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention.

[0024] Figure 1 This is a first-view stereoscopic structural diagram of the low-grade endometrial stromal sarcoma diagnostic kit of the utility model;

[0025] Figure 2 This is a second-angle stereoscopic structural diagram of the low-grade endometrial stromal sarcoma diagnostic kit of the utility model;

[0026] Figure 3 It is a top view of the diagnostic kit for low-grade endometrial stromal sarcoma of the utility model.

[0027] The reference numerals are as follows:

[0028] 1. Kit body; 2. Box cover; 3. First unit; 4. Second unit; 5. Test tube box containing RNase-Free water; 6. Test tube box containing 2×qPCR Mix; 7. Test tube box containing 5×all ​​in one reverse transcription reagent; 8. Test tube box containing internal standard primers; 9. Test tube box containing JAZF1-SUZ12 primers; 10. Test tube box containing positive cDNA standards; 11. Snap connector; 12. Hinge connector. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the utility model more clear, the utility model is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described here are only used to explain the utility model and are not used to limit the utility model.

[0030] The specific implementation of the present utility model is described in detail below in conjunction with specific embodiments.

[0031] like Figure 1-Figure 3 As shown, in one embodiment of the present utility model, a diagnostic kit for low-grade endometrial stromal sarcoma is provided, comprising a kit body 1 and a box cover 2;

[0032] The reagent kit body comprises a first unit 3 and a second unit 4;

[0033] The first unit 3 has a test tube box 5 containing RNase-Free water, a test tube box 6 containing 2×qPCR Mix, and a test tube box 7 containing 5×allin one reverse transcription reagent;

[0034] The second unit 4 has a test tube box 8 containing an internal standard primer (Actin primer), a test tube box 9 containing JAZF1-SUZ12 primers, and a test tube box 10 containing a positive cDNA standard.

[0035] Further, in a preferred embodiment of the present invention, each test tube has a label for indicating information about the reagent contained in each test tube;

[0036] Furthermore, one side of the box cover 2 is rotatably connected to one side of the reagent box body 1 via a hinge connector 12 , and the other side of the box cover 2 is buckled and connected to the other side of the reagent box body 1 via a snap connector 11 .

[0037] The sequences of the internal standard primers are Actin-F: GAGCACAGAGCCTCGCCTTT and Actin-R: TCATCATCCATGGTGAGCTGG.

[0038] The primers for JAZF1-SUZ12 were JAZF-F2: CCCATCACCCCCTCCTCTTCATTC;

[0039] SUZ12-R2:GCTATGAGATTCTTGCTCTCCTTTCATTTTCTCTAC.

[0040] The sequence of the positive control is:

[0041] AGATTCATGACAGATGCTGCCCGCCGAGAGCAGGAGTCCCTAAAGAAGAAGATCAGCCGAAGCTCTCGCTGACTCTGTCCAGCTCAGTGTCTCGAGGGAATGTGTCCACTCCCCCACGCCACAGCAGTGGAAGCCTTACTCCCCCCGTGACCCCACCCATCACCCCCTCCTCTTCATTCCGCAGCAGCACTCCGACAAGCCAACACAGATCTAT AGATTTCTTCGAACTCGGAATCTCATAGCACCAATATTTTTCACAGAACTCTTACTTACATGTCTCATCGAAACTCCAGAACAAACATCAAAAGGAAAACATTTAAAGTTGATGATATGTTATCAAAAGTAGAGAAAATGAAAGGAGAGCAAGAATCTCATAGCTTGTCAGCTCATTTGCAGCTTACGTTTACTGGTTTCTTCCACAAAAATG.

[0042] The method of using the kit of the utility model:

[0043] (a) Extraction of total RNA from samples:

[0044] For samples from different sources, total RNA was extracted using appropriate methods, and its concentration and A260 / 280 ratio were measured by UV spectrophotometer. The concentration should be no less than 50 ng / ul, and the A260 / 280 ratio should be between 1.9 and 2.2. The extracted total RNA was stored at -70°C or below with RNase-Free water for reverse transcription into cDNA.

[0045] (b) Reverse transcription:

[0046] Take the reverse transcription reagent out of the refrigerator and melt it at room temperature, shake and mix for a few seconds, and centrifuge for a few seconds.

[0047] Reverse transcription reaction system (20ul):

[0048] Reagents volume Total RNA of samples X ul (input amount is 300ng) 5×allin one reverse transcription reagent 2ul RNase-Free water 18-X ul ;

[0049] Prepare the reverse transcription system according to the table above, vortex to mix for a few seconds, and centrifuge for a few seconds.

[0050] Reverse transcription procedure:

[0051] 25℃10min;

[0052] 42°C for 15 min (can be extended to 50 min if RNA quality is poor);

[0053] 85℃5min;

[0054] Dilution of reverse transcription product:

[0055] Add 20ul RNase-Free water to all reverse transcription products, shake and mix, and use for subsequent detection or store at -20℃.

[0056] (c) qPCR detection

[0057] Reaction solution preparation:

[0058] Take out the required reagents from the refrigerator and thaw at room temperature, prepare two tubes of PCR mix, the system is as follows, the reaction number n is determined according to the number of samples to be tested (n = number of samples to be tested + 1 negative control (water) + 1 positive control + loss):

[0059] PCR reaction solution JAZF1-SUZ12 PCR Mix Actin PCR Mix Enzyme-free water 3n 3n 2×qPCR Mix 10n 10n JAZF1-SUZ12 Primer Mix 2n 0 Actin Primer Mix 0 2n

[0060] The prepared PCR mix was mixed by oscillation for a few seconds, centrifuged instantly, and 15ul of each reaction was dispensed into eight-piece PCR tubes and stored below -18°C. Use within 4 hours or immediately.

[0061] Add sample:

[0062] The sample to be added is 5u1 of the diluted cDNA or negative / positive control described above. The sample addition method is as follows (each grid represents a PCR reaction tube):

[0063] 5ul sample 1cDNA+15ul JAZF1-SUZ12 PCR Mix 5ul sample 1cDNA + 15ul actin PCR Mix 5ul sample 2cDNA+15u1 JAZF1-SUZ12 PCR Mix 5ul sample 2cDNA + 15ul actin PCR Mix …… …… 5ul sample n cDNA + 15ul JAZF1-SUZ12 PCR Mix 5ul sample n cDNA + 15ul actin PCR Mix 5ul negative control (water) + 15ul JAZF1-SUZ12 PCR Mix 5ul negative control (water) + 15ul actin PCR Mix 5ul positive standard + 15ul JAZF1-SUZ12 PCR Mix 5ul positive standard + 15ul actin PCR Mix

[0064] After adding the sample, close the lid tightly, shake to mix for a few seconds, centrifuge for a few seconds, and prepare for qPCR.

[0065] qPCR machine:

[0066] Select SYBR GREEN dye method for PCR method and SYBR for fluorescence channel.

[0067] The PCR program is:

[0068] (d) Result determination method and reference value:

[0069] ① The negative control (water) should have no obvious amplification curve or ct value greater than 37, the positive control JAZF1-SUZ12 gene ct value should be less than 30, and the positive control actin well should have no obvious amplification curve or ct value greater than 37. If the negative control and positive control results are normal, the qPCR process is judged to be normal, and the sample results can be further observed. If the negative control and positive control results are abnormal, the qPCR process is judged to be abnormal, the experimental results are invalid, and the qPCR should be repeated.

[0070] ② Under the condition that the negative and positive control results are normal, observe the ct value of the sample internal reference gene. The actinct value of the internal reference gene should be less than 35, otherwise it is considered that the RNA is unqualified or the reverse transcription fails, the sample result is invalid, and the sample needs to be re-extracted RNA or reverse transcribed.

[0071] ③ When the ct value of the sample internal reference gene actin is less than 35, it is necessary to observe the ct value of the sample detection gene JAZF1-SUZ12. If the ct value is less than 33, it is determined that the JAZF1-SUZ12 fusion gene is detected. If the ct value is greater than 33 or there is no obvious amplification curve, it is determined that the JAZF1-SUZ12 fusion gene is not detected.

[0072] The clinical trial data of the kit of the utility model are as follows:

[0073] The kit of the utility model was used and the above-mentioned method was used to detect 28 patients with LGESS and 23 patients with other subtypes of uterine tumors (12 patients with HGESS and 11 patients with uterine leiomyoma) from Tianjin Central Hospital of Obstetrics and Gynecology. The diagnostic results are as follows:

[0074] LGESS (n=28) Other uterine tumors (n=23) P-value JAZF1-SUZ12 detection results (15)28 (0))223 0.0001

[0075] As can be seen from the above table, the detection rate of JAZF1-SUZ12 fusion gene in LGESS is about 53.6%, which is consistent with the literature records, but it is not detected in other types of uterine tumors, thus enabling differential diagnosis of LGESS and other uterine tumor subtypes.

[0076] In summary, the utility model is to detect the JAZF1-SUZ12 fusion gene, which is specific and exclusive in LGESS and has a very high value for the differential diagnosis of LGESS. The RT-qPCR method used is fast, simple and convenient, and no operation is required after the PCR reaction.

[0077] The above solutions are only an illustration of a preferred example, but are not limited thereto. When implementing the present utility model, appropriate replacement and / or modification can be performed according to user needs.

[0078] The number of devices and processing scales described here are used to simplify the description of the utility model. Applications, modifications and variations of the utility model are obvious to those skilled in the art.

[0079] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and the embodiments. It can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily realized. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described here.

Claims

1. A diagnostic kit for low-grade endometrial stromal sarcoma, characterized in that: It comprises a reagent box body (1) and a box cover (2); The reagent kit body comprises a first unit (3) and a second unit (4); The first unit (3) has a test tube box (5) containing RNase-Free water, a test tube box (6) containing 2×qPCR Mix, and a test tube box (7) containing 5×all ​​in one reverse transcription reagent; The second unit (4) has a test tube box (8) containing an internal standard primer, a test tube box (9) containing JAZF1-SUZ12 primers, and a test tube box (10) containing a positive cDNA standard.

2. The diagnostic kit for low-grade endometrial stromal sarcoma according to claim 1, characterized in that: The sequences of the internal standard primers in the test tube box (8) containing the internal standard primers are Actin-F: GAGCACAGAGCCTCGCCTTT, and Actin-R: TCATCATCCATGGTGAGCTGG.

3. The diagnostic kit for low-grade endometrial stromal sarcoma according to claim 2, characterized in that: The JAZF1-SUZ12 primers in the test tube kit (9) containing JAZF1-SUZ12 primers are JAZF-F2: CCCATCACCCCCTCCTCTTCATTC; SUZ12-R2: GCTATGAGATTCTTGCTCTCCTTTCATTTTCTCTAC.

4. The diagnostic kit for low-grade endometrial stromal sarcoma according to claim 3, characterized in that: The sequence of the positive control product in the test tube box (10) containing the positive cDNA standard product is: AGATTCATGACAGATGCTGCCCGCCGAGAGCAGGAGTCCCTAAAGAAGAAGATCAGCCGAAGCTCTCGCTGACTCTGTCCAGCTCAGTGTCTCGAGGGAATGTGTCCACTCCCCCACGCCACAGCAGTGGAAGCCTTACTCCCCCCGTGACCCCACCCATCACCCCCTCCTCTTCATTCCGCAGCAGCACTCCGACAAGCCAACACAGATCTAT AGATTTCTTCGAACTCGGAATCTCATAGCACCAATATTTTTGCACAGAACTCTTACTTACATGTCTCATCGAAACTCCAGAACAAACATCAAAAGGAAAACATTTAAAGTTGATGATATGTTATCAAAAGTAGAGAAAATGAAAGGAGAGCAAGAATCTCATAGCTTGTCAGCTCATTTGCAGCTTACGTTTACTGGTTTCTTCCACAAAAATG.

5. The diagnostic kit for low-grade endometrial stromal sarcoma according to any one of claims 2 to 4, characterized in that: Each of the test tubes in the first unit (3) and the second unit (4) has a label.

6. The diagnostic kit for low-grade endometrial stromal sarcoma according to claim 5, characterized in that: One side of the box cover (2) is rotatably connected to one side of the reagent box body (1) via a hinge connection (12).

7. The diagnostic kit for low-grade endometrial stromal sarcoma according to claim 6, characterized in that: The other side edge of the box cover (2) is buckled and connected to the other side edge of the reagent box body (1) via a snap connector (11).

Images