GLYCOSYLATION OF PROTEIN

DE602018090437T2Active Publication Date: 2026-04-08DANMARKS TEKNISKE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Filing Date
2018-11-16
Publication Date
2026-04-08

AI Technical Summary

Technical Problem

Current methods for producing recombinant human serum proteins like Alpha-1-antitrypsin (AAT) in mammalian cells result in non-human glycosylation patterns or immune responses, making them costly and unsafe for therapeutic use.

Method used

A CHO cell line is engineered with specific gene knockouts and insertions to produce proteins with a human-like glycosylation profile, specifically targeting genes for branching, sialylation, and core fucosylation, and introducing Beta-galactoside alpha-2,6-sialyltransferase 1 to achieve a predominant bi-antennary, non-core-fucosylated, and α2-6 linked sialic acid form.

Benefits of technology

The engineered CHO cell line produces recombinant proteins with a glycosylation profile similar to human plasma, enhancing safety and reducing production costs by eliminating the need for plasma-derived therapies.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

FIELD OF THE INVENTION

[0001] The present invention relates to the finding of methods to shift the glycosylation profile of recombinant produced serum glycoproteins to the predominant bi-antennary form found in human plasma. This is accomplished by providing a mammalian cell line according to the invention with a series of knock outs and / or knock in's that facilitate this shift, specifically a recombinant Chinese Hamster Ovarian (CHO) cell line having the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal4, St3Gal6, SPPL3, and FUT8 inactivated and / or downregulated by gene knock-out.BACKGROUND OF THE INVENTION

[0002] Recombinant glycoproteins and in particular human serum proteins, such as the glycoproteins from the family of serpins are produced for a range of applications. This included Alpha-1-antitrypsin (AAT), Plasma protease C1 inhibitor (C1Inh), Antithrombin-III (ATIII), Monocyte neutrophil elastase inhibitor (Serpin B1), Plasminogen activator inhibitor I (PAI1) that are produced for therapeutic applications in humans.

[0003] Alpha-1-antitrypsin (AAT) is used for treatment of people with AAT-deficiency. Such deficiency may result in lethal lung disease and liver disease. Over one million people have been estimated to be deficient of AAT globally. Currently, AAT is purified from human plasma. This treatment regimen is both expensive (USD 52,000 per year per patient), and not optimal with regards to safety, as possible pathogens present in plasma may not be efficiently cleared.

[0004] Many approaches have been pursued to produce recombinant human AAT. Efforts of producing AAT in non-mammalian cells such as E.coli, yeast and plants have resulted in either non-glycosylated AAT or non-human glycosylation patterns. Production of AAT in transgenic animals such as sheep has also been reported. However, an immune response to endogenous (sheep) AAT in the purified product was later observed. This clearly demonstrates one of the major challenges that transgenic animal-derived therapeutics is facing. Finally, AAT has also been produced in CHO and human cells with an aberrant glycoprofile.

[0005] Thus, there is a need in the art for glycoproteins with a more native human glycoprofile.

[0006] WO 2017 / 008982 A1 relates to a cell comprising a gene encoding a polypeptide of interest, and describes, e.g., a CHO-GS cell with knock-out of B3gnt2 / mgat4a / 4b / 5 / ST3gal4 / 6 genes and a CHO-GS cell with a knock-in of ST6Gal1 gene in a knock-out of mgat4a / 4b / 5 / ST3gal4 / 6 genes, as well as knocking-out the Fut8 gene which encodes the alpha6-fucosyltransferase for core fucosylation.

[0007] Yang et al. (NATURE BIOTECHNOLOGY 2015;33(8):842-844) describes CHO cell engineering by genomic gene knock-outs, for the production of diverse, homogeneous glycoproteins with desired glycosylation such as e.g. human-like α2,6-linked sialic acid capping. Stacked knock-out of mgat4A / 4B / 5 in combination with st3gal4 / 6 genes and additional knock-in of St6Gal1 produced homogeneous biantennary N-glycans capped by alpha2,6-NeuAc.OBJECT OF THE INVENTION

[0008] It is an object of embodiments of the invention to provide methods and tools for producing recombinant proteins with a glycan profile found naturally in humans.SUMMARY OF THE INVENTION

[0009] It has been found by the present inventor(s) that by specific modification of a mammalian host cell with the downregulation or inactivation of a series of genes in combination with the insertion of other specific gene(s), this mammalian host cell is made into a cell that will produce glycoproteins with a glycosylation profile that more resemble the glycosylation profile found for the same glycoproteins naturally in humans, such as in human plasma.

[0010] The invention is as set forth by the appended claims.

[0011] So, in a first aspect the present invention relates to a recombinant Chinese Hamster Ovarian (CHO) cell line having the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal4, St3Gal6, SPPL3, and FUT8 inactivated and / or downregulated by gene knock-out.

[0012] In some embodiments, all eight of the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, and FUT8 are inactivated and / or downregulated.

[0013] In some embodiments, all nine of the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, B3GNT2, and FUT8 are inactivated and / or downregulated.

[0014] In some embodiments, all nine of the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, GLUL and FUT8 are inactivated and / or downregulated.

[0015] In some embodiments, all ten of the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, B3GNT2, GLUL and FUT8 are inactivated and / or downregulated.

[0016] In some embodiments the gene encoding Beta-galactoside alpha-2,6-sialyltransferase 1 is inserted.

[0017] In a second aspect, the present invention relates to a method for the production of a recombinant protein of interest, the method comprising the steps of: a) culturing a population of recombinant CHO cells according to the first aspect in a suitable cell culture medium, wherein the cell has been further modified to express an exogenous human glycoprotein of interest, such as a therapeutic human protein; and b) harvesting said human protein of interest from the cell culture or cell culture medium. In some embodiments the protein of interest is produced with a glycan structure similar or identical to the glycan profile of said glycoprotein of interest found in human plasma.LEGENDS TO THE FIGURE

[0018] Fig. 1. Illustration of glycosylation profile with a fully sialylated bi-antennary structure without core fucosylation as found e.g. in human AAT from various sources, such as plasma-purified AAT. Fig. 2. Comparison of the glycoprofile of plasma-purified AAT and CHO-produced AAT. Wild-type CHO-produced AAT contains many different structures, with a core-fucosylated and partially to fully sialylated bi-antennary structure as the most dominant species, while plasma-purified contains almost exclusively a non-core-fucosylated fully sialylated bi-antennary glycostructure. In addition, CHO-derived sialic acids are linked by α2-3 linkages, while plasma sialic acids are linked by α2-6 linkages. Fig. 3. Glycoprofile of human AAT derived from the engineered cell lines described here. The described gene disruptions and gene insertion results in a non-core-fucosylated fully sialylated bi-antennary glycostructure with α2-6 linked sialic acids as the predominant species. Fig. 4. Isoelectric focusing gel of AAT derived from plasma (lane 1 and 2), the glycoengineered cell lines described here (lane 3 and 4), and wild-type CHO (lane 5 and 6). Migration patterns of plasma- and glycoengineered CHO-derived are identical. Fig. 5. Elastase inhibition assay probing the activity of Fig. 6. St6Gal1 vector map Fig. 7. SerpinA vector map Fig. 8. SerpinG vector map Fig. 9. SerpinC1 vector map Fig. 10. Combined St6Gal1 / SerpinA vector map Fig. 11. Combined St6Gal1 / SerpinG vector map Fig. 12. Growth and N-glycan structures from CHO-S WT and 10x KO cell lines. (A) Viable cell density and viability of batch cultures of CHO-S WT and two clonal cell lines with functional knockout of eight glycosyltransferases as well as GS and SPPL3. Error bars indicate the standard deviation of triplicates. (B) N-glycan analysis of total secreted proteins from CHO-S WT and the 10x KO clones A and B. Elution time is indicated on the x-axis and y-axis represents signal intensity normalized to highest peak (C) Proportion of non-fucosylated, biantennary N-glycans with terminal galactose (A2G2) in total secreted proteins from CHO-S WT and 10x KO clone A and B. Fig. 13. FITC-SNA lectin staining of selected poly- and monoclonal cell lines. (A) Fluorescent images of CHO-S WT and A1-1 cell line. Cells were stained for alpha-2,6-sialic acid linkage with FITC-SNA (green) and for nuclei with Hoechst (blue). The bottom right corner bar displays a length of 500 µm (B) Comparison of FITC-SNA positive cells. FITC-SNA lectin staining of CHO-S WT, two 50 µM MSX polyclonal cell lines and four selected clones. Bars indicate the proportion of cells with positive FITC signal due to SNA lectin binding on alpha-2,6-linked sialic acids on the cell surface. Error bars represent standard deviation of three individual measurements per sample. Fig. 14. Growth profiles, product titers and specific productivities of selected producing and non-producing clones. (A) Viable cell densities and cell viabilities of CHO-S WT, 10x KO B the rhA1AT- (A1-1 and A1-2) and rhC1INH- (C1-1 and C1-2) producing clonal cell lines measured in batch cultures. Error bars indicate range of duplicate parallel cultures. (B) rhA1AT and rhC1INH titer in supernatants during the batch culture experiment. Error bars indicate standard deviation of three individual measurements from two shake flasks per clone. (C) Specific productivities of the rhA1AT and rhC1INH-producing clonal cell lines in the batch culture experiment. Average specific productivity was calculated from day 2 - 5 and from day 6 - 9. Colored symbols represent average measured specific productivity for shake flask duplicates. Black lines shows the average specific productivity based on the three measurements of shake flask duplicates. Fig. 15. Characterization of purified rhA1AT and rhC1INH. (A) SDS-PAGE gel analysis of commercially available Cinryze (plC1INH) and Prolastin-C (plA1AT) as well as rhA1AT and rhC1INH purified from polyclonal CHO-S WT or from monoclonal cell lines derived from 10x KO B. Removal of N-glycans by PNGaseF was performed where indicated. PNGaseF migrating as a ~40 kDa band is indicated with an asterisk and impurities of plC1INH are indicated with arrows. (B) IEF gel analysis of same proteins as described for panel A. 2.5 µg purified protein was analysed per sample if not indicated otherwise. (C) N-glycan structures annotated in clones A1-1 and C1-1, respectively, as well as A2G2S2 proportions of purified rhA1AT and rhC1INH compared to plA1AT and plC1INH. (D) Left panel: In vitro assay measuring the inhibition of elastase activity at different concentrations of plA1AT and rhA1AT purified from clones A1-1 and A1-2. Error bars indicate range of duplicate measurements. Maximum proteolytic activity of porcine elastase was set to 100%. Right panel: In vitro activity assessment of plC1INH and rhC1INH purified from clones C1-1 and C1-2. As described in the assay, 1 IU / ml C1INH activity was set to 100%. Error bars indicate range of duplicate measurements. Fig. 16. N-glycan profiles, Overlay of CHO-S WT (dotted line) and Sppl3 KO (solid line) cell lines producing EPO and C1inh respectively. The effect of Sppl3 can be seen as a shift to larger N-glycans. DETAILED DISCLOSURE OF THE INVENTION

[0019] Glyco-analysis of human AAT from various sources revealed that plasma-purified AAT is glycosylated with a fully sialylated bi-antennary structure without core fucosylation (Figure 1 and 2). In contrast, CHO-produced AAT contains many different structures with a partially and fully sialylated bi-antennary structure with core fucosylation as the most dominant species (Figure 2).

[0020] The inventors of the present invention have found that a shift of the glycosylation profile of recombinant produced serum glycoproteins towards the predominant bi-antennary form found in human plasma, may be accomplished by knocking out or in any other way downregulating a selected a set of glycosylating enzymes. This will result in a 6, 7, 8, 9, 10 or 8-9 double knock out clone in which, glycoproteins, such as human serum proteins, such as human AAT are expressed. The following targets have been selected for this cell line: 1) Inactivation and / or downregulation of a series of enzymes Mgat4A, Mgat4B, and Mgat5 that that facilitate a decrease in branching. 2) Inactivation and / or downregulation of a series of enzymes St3Gal3, St3Gal4, and St3Gal6 that facilitate the removal of CHO specific alpha-2,3-sialylation. 3) Inactivation and / or downregulation of the enzyme SPPL3 that facilitate to increase glycosyltransferases half-life in the Golgi. 4) Inactivation and / or downregulation of the enzyme FUT8 that facilitate the removal of core-fucosylation. 5) An optional inactivation and / or downregulation of the enzyme B3GNT2 that may remove elongated antennas. 6) An optional inactivation and / or downregulation of the enzyme GLUL that may boost cell growth, and may be used for selection. 7) The insertion of a gene encoding Beta-galactoside alpha-2,6-sialyltransferase 1 (St6gal1), which gene direct a human type branching of sialic acids.

[0021] With these modifications, it would be accomplished to shift in the glycosylation profile to the predominant bi-antennary form found in human plasma of recombinant produced serum glycoproteins, such as human serum proteins, such as human AAT, such as in CHO cells.

[0022] A host cell with these modifications may then be modified by insertion of a gene expressing an exogenous human glycoprotein of interest, such as a therapeutic human protein, such as a human serum protein, such as Plasma protease C1 inhibitor (C1Inh), Antithrombin-III (ATIII) or Human alpha-1-antitrypsin (AAT).

[0023] The mammalian cells used according to the present inventions are Chinese Hamster Ovarian (CHO) cells, such as CHO-K1; or derivatives of any of these cells.

[0024] In some embodiments the cell line according to the present invention is modified to express a gene expressing an exogenous human glycoprotein of interest, such as a human serum protein selected from any one human serpin of table 1: Table 1:SerpinAlternative name(s)SERPINA1Antitrypsin, Alpha-1-antitrypsin or α1-antitrypsinSERPINA2Antitrypsin-related proteinSERPINA3AntichymotrypsinSERPINA4Kallistatin (PI4)SERPINA5Protein C inhibitor (PAI-3)SERPINA6Corticosteroid-binding globulinSERPINA7Thyroxine-binding globulinSERPINA8AngiotensinogenSERPINA9CenterinSERPINA10Protein Z-dependent proteinase inhibitorSERPINA11XP_170754.3SERPINA12VaspinSERPINA13XM_370772SERPINB1Monocyte neutrophil elastase inhibitorSERPINB2Plasminogen activator inhibitor-2 (PAI2)SERPINB3Squamous cell carcinoma antigen-1SERPINB4Squamous cell carcinoma antigen-2SERPINB5MaspinSERPINB6Proteinase inhibitor-6 (PI6)SERPINB7MegsinSERPINB8Cytoplasmic antiproteinase 8 (PI8)SERPINB9Cytoplasmic antiproteinase 9 (PI9)SERPINB10Bomapin (PI10)SERPINB11EpipinSERPINB12YukopinSERPINB13Headpin (PI13)SERPINC1AntithrombinSERPIND1Heparin cofactor IISERPINE1Plasminogen activator inhibitor I (PAI1)SERPINE2Protease nexin I (PI7)SERPINE3Hs.512272SERPINF1Pigment epithelium derived factorSERPINF2Alpha-2-antiplasminSERPING1C1 inhibitorSERPINH147kDa heat-shock proteinSERPINI1Neuroserpin (PI12)SERPINI2Myoepithelium-derived serine proteinase inhibitor (PI14)

[0025] In particular the present inventors aimed to produce rhA1AT and rhC1INH in CHO-S with N-glycan profiles similar to plA1AT and plC1INH. First, the heterogeneous N-glycan profile of CHO-S WT cells was changed to more homogeneous profiles in bespoke cell lines with predominant A2G2 N-glycan structures. Disrupting nine N-glycosylation-related genes increased the A2G2 proportion on total secreted protein from 3.5% in CHO-S WT-derived cells to ~80% in 10x KO cell lines. This supports the strategy to decrease N-glycan branching and alpha-2,3-sialylation by disrupting MGAT4A, MGAT4B, MGAT5, ST3GAL3, ST3GAL4 and ST3GAL6. The impact of gene disruptions on cell culture performance was assessed in batch cultures. Furthermore, the monoclonal cell lines with disruption in ten gene targets showed enhanced growth characteristics compared to CHO-S WT cells. This included a boosted cell growth in the GLUL-lacking 10x KO cell lines in L-glutamine-supplemented medium.

[0026] In contrast to the production platforms previously described, rhA1AT and rhC1INH produced in the 10x KO cell lines described herein are not only exceeding sialylation levels of plA1AT and plC1INH but also reveal human-like alpha-2,6-sialylation instead of alpha-2,3-sialylation. The increased sialylation of rhA1AT had no impact on in vitro activity.

[0027] The present inventors describes a strategy to successfully engineer the heterogeneous N-glycosylation profile of in particular CHO-S WT cells towards the specific A2G2S2 N-glycan structure with the purpose of producing serpins, such as rhA1AT and rhC1INH with N-glycan profiles similar to human plasma-derived products. Thus, the present invention shows the promise and potential of replacing cost-intensive and possibly unsafe plasma-derived augmentation therapy for AATD and C1INH-HAE patients by CHO- produced rhA1AT and rhC1INH. This strategy is in compliance with the Medical and Scientific Advisory Council (MASAC) recommendation of replacing plasma-derived products with recombinant products for treatment of diseases.Definitions

[0028] Alpha-1-antitrypsin (A1AT or AAT) refers to the protein identified as UniProtKB - P01009 (A1AT_HUMAN). Plasma protease C1 inhibitor (C1Inh) refers to the protein identified as UniProtKB - P05155 (IC1_HUMAN) Antithrombin-III (ATIII) refers to the protein identified as UniProtKB - P01008 (ANT3_HUMAN)

[0029] The term "inactivated and / or downregulated" refers to a modification of a mammalian host cell, wherein some specific genes are either knocked out, downregulated, or completely or partially inactivated in any other way, such as by miRNA post translational silencing. Preferably this inactivation is a complete inactivation with no measurable sign of expression of this particular gene being inactivated. Suitable techniques to silence / knockout are very well described in the art and known to the person skilled in the art, e.g. as described in WO2015092737. In one specific embodiment, "inactivated and / or downregulated" refers to a gene knockout of the relevant gene.

[0030] The term "MGAT4A" as used herein refers to the gene encoding Mannosyl (Alpha-1,3-)-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase, Isozyme A. This gene may also be referred to as UDP-N-Acetylglucosamine: Alpha-1,3-D-Mannoside Beta-1,4-N-Acetylglucosaminyltransferase Iva; Mannosyl (Alpha-1,3-)-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase, Isoenzyme A; N-Glycosyl-Oligosaccharide-Glycoprotein N-Acetylglucosaminyltransferase Iva; N-Acetylglucosaminyltransferase Iva; GlcNAc-T Iva; EC 2.4.1.145; GNT-IVA 3; UDP-N-Acetylglucosamine:Alpha1,3-D-Mannoside Beta1,4-N-Acetylglucosaminyltransferase; Alpha-1,3-Mannosyl-Glycoprotein 4-Beta-N-Acetylglucosaminyltransferase A; Alpha-1,3-Mannosyl-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase; UDP-GlcNAc:A-1,3-D-Mannoside B-1,4-Acetylglucosaminyltransferase IV; GNT-IV; and GnT-4a.

[0031] The term "MGAT4B" as used herein refers to the gene encoding Mannosyl (Alpha-1,3-)-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase, Isozyme B. This gene may also be referred to as UDP-N-Acetylglucosamine: Alpha-1,3-D-Mannoside Beta-1,4-N-Acetylglucosaminyltransferase IVb; Mannosyl (Alpha-1,3-)-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase, Isoenzyme B; N-Glycosyl-Oligosaccharide-Glycoprotein N-Acetylglucosaminyltransferase IVb; N-Acetylglucosaminyltransferase IVb; GlcNAc-T IVb; EC 2.4.1.145 ; GNT-IVB 3; UDP-N-Acetylglucosamine: Alpha-1,3-D-Mannoside Beta-1,4-N-Acetylglucosaminyltransferase IV ; Alpha-1,3-Mannosyl-Glycoprotein Beta-1,4-N-Acetylglucosaminyltransferase ; Alpha-1,3-Mannosyl-Glycoprotein 4-Beta-N-Acetylglucosaminyltransferase B; Aminyltransferase; and GNT-IV.

[0032] The term "MGAT5" as used herein refers to the gene encoding Mannosyl (Alpha-1,6-)-Glycoprotein Beta-1,6-N-Acetyl-Glucosaminyltransferase. This gene may also be referred to as Alpha-Mannoside Beta-1,6-N-Acetylglucosaminyltransferase ; Mannoside Acetylglucosaminyltransferase ; N-Acetylglucosaminyl-Transferase V ; EC 2.4.1.155 ; GlcNAc-T V ; GNT-V ; Alpha-1,6-Mannosylglycoprotein 6-Beta-N-Acetylglucosaminyltransferase A; GNT-VA ; and GGNT5.

[0033] The term "ST3GAL3" as used herein refers to the gene encoding ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 3. This gene may also be referred to as ST3Gal III ; Sialyltransferase 6 (N-Acetyllacosaminide Alpha 2,3-Sialyltransferase) ; Alpha 2,3-ST ; ST3GalIII; SIAT6 ; ST3N ; CMP-N-Acetylneuraminate-Beta-1,4-Galactoside Alpha-2,3-Sialyltransferase ; Gal Beta-1,3(4) GlcNAc Alpha-2,3 Sialyltransferase ; Gal Beta-1,3(4)GlcNAc Alpha-2,3 Sialyltransferase ; N-Acetyllactosaminide Alpha-2,3-Sialyltransferase ; Beta-Galactoside Alpha-2,3-Sialyltransferase ; Alpha 2,3-Sialyltransferase III ; Alpha-2,3-Sialyltransferase II ; Sialyltransferase 6 ; EC 2.4.99.6 ; ST3GALII ; EIEE15 ; and MRT12.

[0034] The term "ST3GAL4" as used herein refers to the gene encoding ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 4. This gene may also be referred to as Sialyltransferase 4C (Beta-Galactosidase Alpha-2,3-Sialytransferase) ; Gal-Beta-1,4-GalNAc-Alpha-2,3-Sialyltransferase ; Beta-Galactoside Alpha-2,3-Sialyltransferase 4; Alpha 2,3-Sialyltransferase IV; Alpha 2,3-ST 4 ; Gal-NAc6S ; ST3GalA.2 ; ST3Gal IV ; ST3GalIV ; NANTA3 ; SIAT4C ; CGS23 ; ST-4 ; STZ; CMP-N-Acetylneuraminate-Beta-Galactosamide-Alpha-2,3-Sialyltransferase ; Sialyltransferase 4C (Beta-Galactoside Alpha-2,3-Sialytransferase) ; Alpha-3-N-Acetylneuraminyltransferase ; Sialyltransferase 4C ; EC 2.4.99.9 ; EC 2.4.99.- ; EC 2.4.99 ; SIAT4-C ; SIAT4 ; SAT-3 ;and SAT3.

[0035] The term "ST3GAL6" as used herein refers to the gene encoding ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 6. This gene may also be referred to as CMP-NeuAc: Beta-Galactoside Alpha-2,3-Sialyltransferase VI ; Sialyltransferase 10 (Alpha-2,3-Sialyltransferase VI) ; ST3GALVI ; SIAT10 ; Type 2 Lactosamine Alpha-2,3-Sialyltransferase ; Alpha2,3-Sialyltransferase ST3Gal VI ; Sialyltransferase ; EC 2.4.99.9; EC 2.4.99.- ; ST3Gal VI ; and EC 2.4.99.

[0036] The term "B3GNT2" as used herein refers to the gene encoding UDP-GlcNAc:BetaGal Beta-1,3-N-Acetylglucosaminyltransferase 2. This gene may also be referred to as UDP-GlcNAc:BetaGal Beta-1,3-N-Acetylglucosaminyltransferase ; Beta3Gn-T1 ; Beta3Gn-T2 ; B3GNT1 ; BGnT-2 ; UDP-Galactose:Beta-N-Acetylglucosamine Beta-1,3-Galactosyltransferase 7 ; N-Acetyllactosaminide Beta-1,3-N-Acetylglucosaminyltransferase ; UDP-Gal:Beta-GlcNAc Beta-1,3-Galactosyltransferase 7 ; Beta-1,3-N-Acetylglucosaminyltransferase BGnT-1 ; Beta-1,3-N-Acetylglucosaminyltransferase BGnT-2 ; Beta-1,3-N-Acetylglucosaminyltransferase 1 ; Beta-1,3-N-Acetylglucosaminyltransferase 2 ; Beta-1,3-Galactosyltransferase 7 ; Beta-1,3-GalTase 7 ; Beta-1,3-Gn-T1 ; Beta-1,3-Gn-T2; Beta-3-Gx-T7 ; EC 2.4.1.149 ; Beta3Gal-T7 ; Beta3GalT7 ; BETA3GNT ; B3Gal-T7 ; 3-Gn-T1 ; 3-Gn-T2; B3GN-T2; B3GNT-2 ; B3GALT7 ; Beta-1 ; BGnT-1; B3GNT ; and BGNT2.

[0037] The term "GLUL" as used herein refers to the gene encoding glutamate-ammonia ligase also referred to as: Glutamate-Ammonia Ligase; Glutamate Decarboxylase; Glutamine Synthetase ; EC 6.3.1.2; GLNS ; GS; Glutamate-Ammonia Ligase (Glutamine Synthase) ; Cell Proliferation-Inducing Protein 59; Proliferation-Inducing Protein 43 ; Glutamate--Ammonia Ligase ; Glutamine Synthase ; EC 4.1.1.15 ; PIG43; and PIG59.

[0038] The term "SPPL3" as used herein refers to the gene encoding Signal Peptide Peptidase Like 3. This gene may also be referred to as Presenilin-Like Protein 4; Intramembrane Protease 2; Presenilin Homologous Protein 1; SPP-Like 3; IMP2 ; PSH1 ; PSL4 ; Signal Peptide Peptidase-Like 3 ; EC 3.4.23.- ; MDHV1887 ; PRO4332; and IMP-2.

[0039] The term "FUT8" as used herein refers to the gene encoding Fucosyltransferase 8. This gene may also be referred to as GDP-L-Fuc:N-Acetyl-Beta-D-Glucosaminide Alpha1,6-Fucosyltransferase ; Fucosyltransferase 8 (Alpha (1,6) Fucosyltransferase) ; GDP-Fucose--Glycoprotein Fucosyltransferase ; Glycoprotein 6-Alpha-L-Fucosyltransferase ; Alpha1-6FucT ; EC 2.4.1.68 4; Alpha (1,6) Fucosyltransferase ; Alpha-(1,6)-Fucosyltransferase

[0040] The term "ST6Gal1" as used herein refers to the gene encoding ST6 Beta-Galactoside Alpha- 2,6-Sialyltransferase 1. This gene may also be referred to as ST6Gal I; CMP-N-Acetylneuraminate-Beta-Galactosamide-Alpha-2,6-Sialyltransferase 1: ST6 N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 1; ST6 Beta-Galactosamide Alpha-2,6-Sialyltranferase 1; B-Cell Antigen CD75; Alpha 2,6-ST 1; EC 2.4.99.1; ST6GalI; SIAT1; CMP-N-Acetylneuraminate Beta-Galactosamide Alpha-2,6-Sialyltransferase; Sialyltransferase 1 (Beta-Galactoside Alpha-2,6-Sialyltransferase); Sialyltransferase 1 (Beta-Galactoside Alpha-2,6-Sialytransferase); Beta-Galactoside Alpha-2,6-Sialyltransferase 1; Sialyltransferase 1; and ST6N. Specific embodiments of the invention

[0041] As detailed above in a first aspect the present invention relates to a recombinant CHO cell line having a) the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, and FUT8 inactivated and / or downregulated by gene knock-out; and b) optionally a gene encoding Beta-galactoside alpha-2,6-sialyltransferase 1 inserted.

[0042] In some embodiments of the CHO cell according to present invention the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, and FUT8 are inactivated and / or downregulated by gene knock-out; and the gene encoding ST6Gal1 is inserted.

[0043] In some embodiments the CHO cell according to present invention has the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal4, St3Gal6, SPPL3, and FUT8 inactivated and / or downregulated by gene knock-out.

[0044] In some embodiments of the CHO cell according to present invention the endogenous gene B3GNT2 is present.

[0045] In some embodiments the CHO cell according to present invention further has the endogenous B3GNT2 inactivated and / or downregulated by gene knock-out. It is to be understood that this may be in addition to any combination of other genes being inactivated and / or downregulated.

[0046] In some embodiments the CHO cell according to present invention further has the endogenous GLUL is inactivated and / or downregulated by gene knock-out. It is to be understood that this may be in addition to any combination of other genes being inactivated and / or downregulated.

[0047] In some embodiments the mammalian cell according to present invention is an in vitro CHO cell line, such as CHO-K1, CHO-S, DG44; or derivatives of any of these cells.

[0048] In some embodiments the CHO cell according to present invention has been further modified to express an exogenous human glycoprotein of interest, such as a therapeutic human protein. In some embodiments said exogenous human glycoprotein of interest is a human serum protein, such as a human serpin, such as human serpin selected from the list consisting of SERPINA1, SERPINA2, SERPINA3, SERPINA4, SERPINA5, SERPINA6, SERPINA7, SERPINA8, SERPINA9, SERPINA10, SERPINA11, SERPINA12, SERPINA13, SERPINB1, SERPINB2, SERPINB3, SERPINB4, SERPINB5, SERPINB6, SERPINB7, SERPINB8, SERPINB9, SERPINB10, SERPINB11, SERPINB12, SERPINB13, SERPINC1, SERPIND1, SERPINE1, SERPINE2, SERPINE3, SERPINF1, SERPINF2, SERPING1, SERPINH1, SERPINI1, and SERPINI2.

[0049] In some embodiments the CHO cell according to present invention is a cell line producing said glycoprotein of interest with a primary n-glycan structure that is a fully sialylated bi-antennary structure without core fucosylation, such as with more than 80%, such as 82%, such as 84%, such as 86%, such as 88%, such as 90% of the glycoproteins of interest produced being in with a fully sialylated bi-antennary structure without core fucosylation.

[0050] In some embodiments the glycan structure is according to the structure A2G2S2 with the following pictorial representations: such as according to the structure:

[0051] In some embodiments the CHO cell according to present invention has been further modified to express an exogenous human glycoprotein of interest, which exogenous human glycoprotein of interest is selected from Plasma protease C1 inhibitor (C1Inh) glycosylated at one or more positions selected from Asn3, Asn47, Asn59, Asn216, Asn231, Asn250, and Asn330; Antithrombin-III (ATIII) glycosylated at one or more positions selected from Asn96, Asn135, Asn155 and Asn192; and Human alpha-1-antitrypsin (AAT) glycosylated at one or more, such as two or three of the positions Asn46, Asn83, and Asn247.EXAMPLE 1

[0052] We knocked out 9 genes in the CHO-S cell line employing CRISPR / Cas9: FUT8, MGAT4a, MGAT4b, MGAT5, ST3GAL3, ST3GAL4, ST3GAL6, B3gnt2, Sppl3. Furthermore, we introduced the human gene ST6GAL1 to introduce human type branching of sialic acids. The human genes SERPING or SERPINA were then introduced in this host cell line to achieve expression of the human serum proteins Plasma protease C1 inhibitor (C1Inh) or Human alpha-1-antitrypsin (AAT), respectively. With these modifications, it is accomplished to shift in the glycosylation profile to the predominant bi-antennary, non-core-fucosylated, and α2-6 linked sialic acid form found in human plasma of recombinant produced serum glycoproteins (figure 3). IEF migration patterns are identical between AAT derived from plasma and the glycoengineered cell line described here (figure 4). Activity of AAT is not affected (figure 5).

[0053] Plasmids 2632 (GFP_2A_Cas9) and 5920 (FUT8_681494) are described in Grav, L. M., Lee, J. S., Gerling, S., Kallehauge, T. B., Hansen, A. H., Kol, S., Lee, G. M., Pedersen, L. E. and Kildegaard, H. F. (2015), One-step generation of triple knockout CHO cell lines using CRISPR / Cas9 and fluorescent enrichment. Biotechnology Journal, 10: 1446-1456. doi:10.1002 / biot.201500027.

[0054] Plasmids 2928 (MGAT4A_411545), 2933 (MGAT4B_1280368), 2937 (MGAT5_327084), 2940 (ST3GAL4_964386), 2943 (ST3GAL6_1812502), 4408 (B3gnt2_NW_003613880.1_1273293), 4412 (St3gal3_NW_003613906.1_244730) and 4424 (Sppl3_NW_003613978.1_213040) were constructed as described in Ronda, C., Pedersen, L. E., Hansen, H. G., Kallehauge, T. B. et al., Accelerating genome editing in CHO cells using CRISPR / Cas9 and CRISPy, a web-based target finding tool. Biotechnol. Bioeng. 2014, 111, 1604-1616 with the following modification: sgRNA plasmid sgRNA1_C described in Ronda et al was used as template in the PCR reaction to generate the backbone of gRNA plasmids.

[0055] St6Gal1 vector map is shown in figure 6.

[0056] SerpinA vector map is shown in figure 7.

[0057] SerpinG vector map is shown in figure 8.

[0058] SerpinC1 vector map is shown in figure 9.EXAMPLE 2

[0059] We knocked out 10 genes in the CHO-S cell line employing CRISPR / Cas9: FUT8, MGAT4a, MGAT4b, MGAT5, ST3GAL3, ST3GAL4, ST3GAL6, B3gnt2, Sppl3 and GLUL. We have constructed plasmids harbouring both the human ST6GAL1, and SERPING or SERPINA genes to simultaneously introduce human type branching of sialic acids and achieve expression of Plasma protease C1 inhibitor (C1Inh), or Human alpha-1-antitrypsin (AAT), respectively.

[0060] Combined St6Gal1 / SerpinA vector map is shown in figure 10.

[0061] Combined St6Gal1 / SerpinG vector map is shown in figure 11.EXAMPLE 3

[0062] N-glycan analysis was performed with GlycoWorks RapiFluor-MS N-Glycan Kit (Waters, Milford, MA) according to the manufacturer's instruction. In this case 12 µl of 10x concentrated (MWCO filtered, Amicon Ultra-15, Merck, Darmstadt, Germany) secretome or purified protein sample were used for each. Labeled N-Glycans were analyzed by a LC-MS system using a Thermo Ultimate 3000 HPLC with fluorescence detector coupled on-line to a Thermo Velos Pro Iontrap MS. Separation gradient 30% to 43% buffer and MS was run in positive mode.EXAMPLE 4

[0063] sgRNA, GFP_2A_Cas9 and A1AT / C1INH_St6gal1_GLUL plasmid design. GFP_2A_Cas9 and single guide RNA (sgRNA) plasmids were constructed as previously described (Grav, L.M. et al., One-step generation of triple knockout CHO cell lines using CRISPR / Cas9 and fluorescent enrichment. Biotechnol. J. 2015, 10, 1446-1456). The sgRNA target design for MGAT4A, MGAT4B, MGAT5, ST3GAL3, ST3GAL4, ST3GAL6, B3GNT2, FUT8, SPPL3 and GLUL was performed using "CRISPy" (Ronda, C. et al., Accelerating genome editing in CHO cells using CRISPR Cas9 and CRISPy, a web-based target finding tool. Biotechnol. Bioeng. 2014, 111, 1604-1616). The target sites for the mentioned genes and the oligos for sgRNA cloning are listed in Table 2 and Table 3, respectively. Table 2: sgRNA target sequences. The bases in bold mark the PAM siteGene name of targethypothesized KO effectTarget sequence (5'→ 3')MGAT4Adecreased branchingMGAT4Bdecreased branchingMGAT5decreased branchingST3GAL3decreased sialylationST3GAL4decreased sialylationST3GAL6decreased sialylationB3GNT2decreased elongationFUT8no core-fucosylationSPPL3hyper-glycosylationGLUL*Gln-dependent growth*the GLUL sgRNA efficiency during KO-generation of the presented sequence was very low compared to other target sgRNAs and we recommend the usage of a different design. Table 3: Oligos for sgRNA expression vector cloning. Oligo NameOligo sequence (5' → 3')gRNA_MGAT4A_411545_f wdgRNA_MGAT4A_411545_r evgRNA_MGAT4B_1280368_ fwdgRNA_MGAT4B_1280368_ revgRNA_MGAT5_327084_fwdgRNA_MGAT5_327084_revgRNA_ST3GAL3_244730_fwdgRNA_ST3GAL3_244730_revgRNA_ST3GAL4_964386_fwdgRNA_ST3GAL4_964386_revgRNA_ST3GAL6_1812502 _fwdgRNA_ST3GAL6_1812502 _revgRNA_B3GNT2_1273293_fwdgRNA_B3GNT2_1273293_revgRNA_FUT8_681494_fwdgRNA_FUT8_681494_revgRNA_SPPL3_213040_fwdgRNA_SPPL3_213040_revgRNA_GLUL_941540_fwdgRNA_GLUL_941540_rev

[0064] Plasmids for co-expression of A1AT / C1INH and St6gal1 were constructed with uracil-specific excision reagent cloning method as previously described (Pristovšek, N. et al., Using Titer and Titer Normalized to Confluence Are Complementary Strategies for Obtaining Chinese Hamster Ovary Cell Lines with High Volumetric Productivity of Etanercept. Biotechnol. J. 2018, 13; and Lund, A.M. et al., A Versatile System for USER Cloning-Based Assembly of Expression Vectors for Mammalian Cell Engineering. PLOS ONE 2014, 9(5): e96693). The DNA sequences of the plasmids are listed in Table 4. Cell cultivation and transfection for genome editing.

[0065] CHO-S suspension cells were incubated in a humidified incubator at 120 rpm, 37°C, 5% CO2, passaged to 2-3 x 105 cells / mL every 2-3 days and transfected in 6-well plates (BD Biosciences, San Jose, CA) as described previously (Grav, L.M. et al., One-step generation of triple knockout CHO cell lines using CRISPR / Cas9 and fluorescent enrichment. Biotechnol. J. 2015, 10, 1446-1456). The GFP_2A_Cas9 / sgRNA plasmid ratios for each transfection was 1:1 of which the plasmid load of sgRNA was divided equally by the amount of different sgRNAs used per transfection (Table 5). To measure FACS sorting efficiency, pmaxGFP ®< vector (Lonza, Basel, Switzerland) transfection was performed as well. Cells were harvested for fluorescence-activated cell sorting (FACS) 48 h post transfection. Table 5: Indels generated in ten targeted genes by CRISPR / Cas9 multiplexing.Multiplexing round1234GeneMGAT 4AMGAT 4BMGA T5ST3GA L4ST3GA L6ST3GA L3B3GN T2GL ULSPPL 3FUT 810x KO clone A+2-1+1-5 / +1+1+1 / +2-1-13 / - 10 / -2+1+110x KO clone B+2-1+1-5 / +1+1+1 / +2-1-13 / -10 / -2+1-7 / -1 Single cell cloning of genome edited cells using FACS.

[0066] Before FACS, cells were filtered through a 40 µm cell strainer into a FACS-compatible tube.

[0067] Single fluorescent-positive (GFP) cells were sorted into 384-well plates (Corning, New York, NY) containing 30 µL CD CHO medium supplemented with 8 mM L-glutamine, 1.5% HEPES buffer and 1% Antibiotic-Antimycotic (Gibco, Waltham, MA) per well as described previously (Hansen, H.G. et al, Case study on human alpha1-antitrypsin: Recombinant protein titers obtained by commercial ELISA kits are inaccurate. Biotechnol. J. 2016, 11, 1648-1656). For cell sorting, fluorescent-positive cell populations were gated based on non-transfected WT CHO-S cells. Two weeks after cell sorting cell colonies were moved to 96-well flat-bottom plates (BD Biosciences) and expanded for deep sequencing analysis and batch cultivation.Deep sequencing analysis.

[0068] Confluent colonies from 96-well flat-bottom replicate plates were harvested for genomic DNA extraction. DNA extraction was performed using QuickExtract DNA extraction solution (Epicentre, Illumina, Madison, WI) according to the manufacturer's instruction. The library preparation was based on Illumina 16S Metagenomic Sequencing Library Preparation and deep sequencing was carried out on a MiSeq Benchtop Sequencer (Illumina, San Diego, CA). The protocol for amplifying the targeted genomic sequences, amplicon purification, adapter-PCR and following quality analysis was based on previously published work (Grav, L.M. et al., One-step generation of triple knockout CHO cell lines using CRISPR / Cas9 and fluorescent enrichment. Biotechnol. J. 2015, 10, 1446-1456). PCR primers are presented in Table 6. Table 6: Primer list for deep sequencing (MiSeq). The primers contain overhang sequences compatible with Illumina Nextera XT indexing (forward primeroverhang: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, reverse primer overhang: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG).primer namesequence (5' → 3')MiSeq_MGAT4A_411545_fwdMiSeq_MGAT4A_411545_revMiSeq_MGAT4B_1280368_ fwdMiSeq_MGAT4B_1280368_ revMiSeq_MGAT5_327084_fwdMiSeq_MGAT5_327084_revMiSeq_ST3GAL3_244730_fwdMiSeq_ST3GAL3_244730_revMiSeq_ST3GAL4_964386_fwdMiSeq_ST3GAL4_964386_revMiSeq_ST3GAL6_1812502 _fwdMiSeq_ST3GAL6_1812502 _revMiSeq_B3GNT2_1273293_fwdMiSeq_B3GNT2_1273293_ revMiSeq_FUT8_681494_fwdMiSeq_FUT8_681494_revMiSeq_SPPL3_213040_fwdMiSeq_SPPL3_213040_revMiSeq_GLUL_941540_fwd2TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAACCAGCACCCCTGGTTMiSeq_GLUL_941540_rev2 Transfection and expression in polyclonal cell lines by applying MSX-selection

[0069] Cells were seeded in 250 mL Corning vent cap shake flasks (Sigma-Aldrich) as duplicates with cell densities ~1 x 106 cells / mL in 60 mL CD CHO medium supplemented with 8 mM L-glutamine (Life Technologies) and transfected with 75 µg of A1AT-GLUL-St6gal plasmid or 75 µg of C1INH-GLUL-St6gal1 plasmid using FreeStyleTM MAX reagent together with OptiPRO SFM medium (Life Technologies) according to the manufacturer's recommendations. 1µL / mL anti-clumping agent was added 24 h after transfection. pmaxGFP ®< vector (Lonza) transfection was performed to measure transfection efficiencies. Two days after transfection, cells were transferred into 60 mL CD CHO medium lacking L-glutamine (Life Technologies) and supplemented with 1µL / mL anti-clumping agent and 0 µM, 10 µM, 30 µM or 50 µM MSX (EMD Millipore, Billerica, MA).

[0070] Cell densities and viabilities were determined once per day using the NucleoCounter NC-250 Cell Counter (ChemoMetec). The cells were passaged in fresh selection medium every 2-3 days until viability and doubling time reached stable values. Polyclonal cell lines (pools) were seeded in duplicates at ~1 x 106 cells / mL with corresponding MSX concentrations. Cell densities and viabilities were determined once per day and supernatants of the pools were harvested three days after seeding and pooled within duplicates for purification of rhA1AT and rhC1INH.Single cell cloning of cells from polyclonal cell pools using FACS

[0071] Non-stained single cells were sorted from pools as described above. For cell sorting, all viable cells were gated for sorting into 384-well plates with L-glutamine-free medium. Two weeks after cell sorting the clones were moved to 96-well flat-bottom plates (BD Biosciences) and expanded to shake flask format in CD CHO medium supplemented with 1µL / mL anti-clumping agent, 25 µM MSX and lacking L-glutamine.

[0072] Screening cell pools and single cell clones for human-like α-2,6-sialic acid linkage formation with lectin staining.

[0073] For lectin staining of cells, triplicates of 10,000 cells per sample were diluted in 200 µL of 0.22 µm pore size filtered CD CHO medium (Life Technologies) supplemented with 5 µg / mL Hoechst 33342 (Merck, Darmstadt, Germany) and 1 µg / mL Fluorescein isothiocyanate (FITC) labeled Sambucus nigra agglutinin (SNA) lectin (Biomol, Hamburg, Germany). After 60 min incubation in the dark at 37°C and 5% CO2 the cells were washed with 200 µL CD CHO medium and then washed twice with 200 µL phosphate buffered saline (PBS) (300g, 5 min, RT). The samples were resuspended in 200 ul PBS and transferred to 96-well plate for final centrifugation at 300 g for one minute. Percentage of FITC SNA positive cells was determined in a 96-well optical-bottom microplate (Greiner Bio-One, Frickenhausen, Germany) using a Celigo Imaging Cell Cytometer (Nexcelom Bioscience, Lawrence, MA). Cells were identified using the blue channel (Hoechst-positive cells), and the green channel (FITC SNA-positive cells) was used to detect cells with alpha-2,6-sialic acid linkage. A Hoechst / FITC SNA-stained CHO-S WT sample was gated to distinguish between FITC-positive and FITC-negative cells.Batch cultivation: cell growth analysis and N-glycosylation profiling.

[0074] For batch cultivation and N-glycan analysis, cells were seeded at 0.4 x 106 cells / mL in 250 mL Corning vent cap shake flasks (Sigma-Aldrich, St. Louis, MI) as duplicates in 60 mL CD CHO medium supplemented with 1 µL / mL anti-clumping agent (Life Technologies). CHO-S WT and non-producing parental 10x KO cell lines were additionally supplemented with 8 mM L-glutamine. rhA1AT / rhC1INH producing clones were cultivated in L-glutamine-free medium at all times and passaged in medium containing 25 µM MSX until the batch cultivation was initiated. Cell densities and viabilities were determined once per day using the NucleoCounter NC-250 Cell Counter (ChemoMetec) until the viability was <70%, at which point the culture was terminated. Supernatant samples with total secreted protein (secretome) from CHO-S WT and parental, non-producing 10x KO cell lines were taken five days after seeding and pooled within biological replicates. The volume for secretome samples was calculated to harbor 20 x 106 cells. For all shake flasks, additional supernatant samples were taken by centrifuging 1 mL of cell suspension for 5 minutes at 1000 g and storage of supernatant at - 80°C until further analysis.rhA1AT and rhC1INH purification

[0075] rhA1AT and rhC1INH were purified using CaptureSelect affinity resins (Thermo Fisher Scientific) according to the manufacturer's instructions. rhA1AT was further purified by size exclusion chromatography on a Superdex 200 increase 10 / 300GL column (GE Healthcare) equilibrated in PBS.Titer assessment of rhA1AT / rhC1INH producing clones

[0076] rhA1AT and rhC1INH titers were determined using biolayer interferometry on an Octet RED96 (Pall, Menlo Park, CA, USA) as described previously for A1AT (Noh, S.M. et al., Reduction of ammonia and lactate through the coupling of glutamine synthetase selection and downregulation of lactate dehydrogenase-A in CHO cells. Appl. Microbiol. Biotechnol. 2017, 101, 1035-1045). After hydration in PBS, streptavidin biosensors (18-5021, Fortebio, Pall) were functionalized with CaptureSelect biotin anti-A1AT conjugate or CaptureSelect biotin anti-C1INH conjugate (Thermo Fisher Scientific) at 5 µg / mL in PBS, and blocked in PBS containing 1 µg / mL biocytin (600 and 300 s incubation steps, respectively). Standards were prepared in spent CHO-S medium using plasma-derived A1AT (Athens Research & Technology) at 100, 50, 25, 12.5, 6.3, 3.1 and 1.6 µg / mL or C1INH (R&D systems) at 40, 20, 10, 5, 2.5, 1.25 and 0.625 µg / mL. Samples and standards were diluted two-fold and contained 0.1% BSA w / v, 0.1% tween-20 v / v, and 500 mM NaCl. When needed, samples were further diluted to fall within the range of the standard dilution series. After equilibration in spent CHO-S medium (120 s), samples and standards were measured for 300 s with a shaking speed of 1000 rpm at 30°C. Regeneration was performed with 50 mM TRIS, 2 M MgCl2, pH 7.5. Assays were performed in 96-well black microplates (Greiner Bio-One, Kremsmünster, Austria). Octet System Data Analysis 7.1 software was used to calculate binding rates and absolute A1AT and C1INH concentrations.SDS-PAGE, isoelectric focusing and PNGase treatment

[0077] SDS-PAGE was performed on Novex 4-12% Tris-Glycine mini gels and isoelectric focusing (IEF) was performed on Novex pH 3-10 IEF gels (Thermo Fisher Scientific) as per the manufacturer's instructions. Deglycosylation with PNGase F was performed according to the manufacturer's instructions (New England Biolabs, Ipswich, MA).Activity assays

[0078] A1AT inhibitory activity was determined using the EnzChek Elastase Assay Kit (Molecular Probes, Eugene, OR) according to the manufacturer's instructions. In short, A1AT (8.0, 4.0, 2.0, 1.0, 0.5, 0.25, 0.13, and 0.06 µM) was incubated with purified active porcine pancreatic elastase and fluorescently labelled substrate (DQ-elastin). Measurement of fluorescence was performed after 45 min at room temperature (Excitation: 485 nm, slit width 9.0 nm; Emission: 530 nm, slit width 13.5 nm).

[0079] C1INH inhibitory activity was determined using the Technochrom C1INH Assay Kit (TechnoClone, Vienna, Austria). In short, plasma containing C1INH activity (120%, 60%, 30%) and samples (~0.25 µM) were incubated with substrate-buffer mixture for 3 min at room temperature, after which 50% acetic acid was added. Extinction was measured at 405 nm.N-Glycan analysis

[0080] N-glycans were derivatized with GlycoWorks RapiFluor-MS N-Glycan Kit (Waters, Milford, MA) according to the manufacturer's instruction. Briefly; 12 µg purified protein or 12 µl of 10x concentrated (Amicon Ultra-15, Merck) secretome sample were used for each sample. Labeled N-Glycans were analyzed by LC-MS as described previously (Grav, L.M. et al., One-step generation of triple knockout CHO cell lines using CRISPR / Cas9 and fluorescent enrichment. Biotechnol. J. 2015, 10, 1446-1456) Separation gradient from 30% to 43% 50 mM ammonium formate buffer and MS were run in positive mode. Amount of N-Glycan was measured by integrating the peaks with Thermo Xcalibur software (Thermo Fisher Scientific, Waltham, MA) giving the normalized, relative amount of the glycans.ResultsGrowth profile and N-glycan profile of clonal 10x KO cell lines

[0081] The aim of our study was to produce rhA1AT and rhC1INH in CHO cells with N-glycan profiles similar to human plA1AT and plC1INH. Our approach was to engineer the heterogeneous N-glycan profile of CHO-S WT cells towards a homogeneous A2G2S2 N-glycan structure, which is the predominant N-glycan on plA1AT / plC1INH. To this end, we generated out-of-frame insertions or deletions (indels) in eight glycosyltransferases (MGAT4A, MGAT4B, MGAT5, ST3GAL3, ST3GAL4, ST3GAL6, B3GNT2, FUT8) as well as in the genes SPPL3 and GLUL (Table 5) over four successive rounds of multiplexed CRISPR / Cas9 gene editing. Two clones with indels in the targeted genes were subjected to growth analysis and N-glycan profiling.

[0082] Two clones (10x KO A and 10x KO B) with out-of-frame indels in all ten gene targets were obtained and both showed a pronounced increase in batch culture longevity when compared to the parental CHO-S WT cell line (Fig. 12A).

[0083] CHO-S WT reached maximal viable cell density of ~6 x 106 cells / mL on day five and cell viability declined rapidly to <50% on day 6. In contrast, the 10x KO A and 10x KO B clones had cell viabilities >75% until day 10 of the batch cultivation and reached higher maximal viable cell density than CHO-S WT.

[0084] N-glycan analysis of the CHO-S WT secretome resulted in more than 25 N-glycan structures (Fig. 12B) where the A2G2S2 structure with alpha-2,6-linked sialic acids, predominantly found on plA1AT and plC1INH, was not detected. The majority of CHO-S WT N-glycans contained core-fucosylation. The N-glycans produced by CHO-S WT cells appear diverse and comprise high-mannose structures as well as non-galactosylated, fully and partially sialylated di-, tri- and tetra-antennary structures (all with alpha-2,3-linked sialic acids). A2FG2S2 was found as the main N-glycan on total secreted proteins of CHO-S WT. In contrast, the N-glycan profiles of 10x KO A and 10x KO B are more homogeneous (Fig. 12B) with all structures lacking core-fucosylation. In addition, only relatively small amounts of CHO-specific alpha-2,3-linked sialylation were present.

[0085] After disruption of the targeted genes, the proportion of A2G2 within N-glycan structures of total secreted proteins was increased from 3.5% (CHO-S WT) to 79% in both 10x KO clones (Fig. 12C). We concluded that the 10x KO A and B clones were suitable host cell lines in our effort to generate humanized N-glycans.Introducing human-like sialylation in 10x KO cell lines

[0086] On the basis of A2G2 secretome N-glycan structures of clone 10x KO B, we aimed to develop clonal cell lines expressing St6gal1 and rhC1INH or St6gal1 and rhA1AT. We envisioned that such cell lines are capable to produce rhA1AT or rhC1INH with predominant A2G2S2 N-glycan structures as found on plA1AT and plC1INH. The functional GLUL-KO selection system was confirmed by MSX-dosage dependent recovery times of cell viabilities from transfected cell pools. Passaging of the different transfection pools was performed until viability and doubling times were stable. We then conducted FACS-based single cell cloning with the 50 µM MSX-selected cells. During the expansion of the generated clones, only clones exhibiting predominant FITC-SNA staining and detectable levels of rhA1AT / rhC1INH in supernatants on coomassie-stained SDS-PAGE gels were selected. Based on these criteria, two rhA1AT (A1-1 and A1-2) and two rhC1INH (C1-1 and C1-2) producing clones were selected for further characterization.

[0087] SNA lectins are reported to bind predominantly to sialic acids of N-glycans linked to the galactose residue in a human-like alpha-2,6-sialylation. Analyzing FITC-SNA-stained CHO-S WT, we found relatively low levels of alpha-2,6-sialylation (Fig. 13A). To determine the proportion of cells with human-like sialylation, FITC-SNA stained CHO-S WT samples were used to gate between FITC-positive and FITC-negative cells. Within the two 50 µM MSX-selected polyclonal cell lines, <30% of the cells were found to comprise alpha-2,6-linked sialic acids on N-glycans of cell surface proteins (Fig. 13B). In comparison, 82-90% of the cells in the populations of the selected four clones (A1-1, A1-2, C1-1 and C1-2) had the desired alpha-2,6-linked sialic acids on their N-glycans.

[0088] SDS-PAGE gel analysis revealed that purified rhA1AT and rhC1INH produced in the four clones seem to have hydrodynamic volumes (molecular weight) similar to plA1AT and plC1INH without detectable impurities as seen in plC1INH (Fig. 15A). rhA1AT and rhC1INH produced in CHO-S WT background did not co-migrate with plA1AT and plC1INH, respectively. However, after deglycosylation with PNGaseF, all recombinantly produced proteins aligned with corresponding bands of plA1AT and plC1INH with the exception of rhC1INH produced in a CHO-S WT background displayed an additional protein band at ~65 kDa.

[0089] To further characterize the CHO-produced rhA1AT and rhC1INH, we performed IEF gel analysis (Fig. 15B). rhA1AT from clones A1-1 and A1-2 manifested in two bands with isoelectric points (pI) around pH 4.5 similar to plA1AT. In contrast, rhA1AT produced in a CHO-S WT background displayed more than nine detectable isoforms with pI between pH 4 - 5.

[0090] IEF gel analysis of rhC1INH produced in a CHO-S WT background resulted in isoforms with pI ranging from pH ~4 - 5. A high degree of heterogeneity was also found in purified rhC1INH produced in clone C1-1. However, rhC1INH produced in clone C1-2 was less heterogeneous with pI at pH ~3.5 similar to plC1INH.

[0091] In N-glycan analysis of purified rhA1AT and rhC1INH from CHO-S WT cells we detected a higher degree of heterogeneity compared to N-glycan structures on rhA1AT and rhC1INH from polyclonal 10x KO cell pools. The polyclonal cell lines revealed two predominant sugar structures on both proteins (A2G2 and A2G2S2 N-glycans), whereas we could not detect the A2G2S2 structure on products from CHO-S WT. Moreover, the amount of predominant N-glycan structures on rhA1AT and rhC1INH was decreased from two (polyclonal pools) to one (monoclonal producers), identified as A2G2S2 N-glycan.

[0092] All four 10x KO-derived monoclonal cell lines produced rhA1AT and rhC1INH with higher proportion of A2G2S2 structures than plA1AT and plC1INH (Fig. 15C). The proportion of A2G2S2 in rhA1AT and rhC1INH was approximately 88 - 92% and 84%, respectively, and 82% for plA1AT and 66% for plC1INH .

[0093] Finally, we investigated the activity of purified rhA1AT and rhC1INH. rhA1AT activity was determined by its inhibitory function of elastase activity (Fig. 15D). Similar to plA1AT, a decrease in elastase activity was detected at A1AT concentrations >0.1 µM for rhA1AT from clones A1-1 and A1-2. In addition, 50% of elastase inhibition was reached at ~0.3 µM A1AT for plA1AT as well as rhA1AT. In vitro activity of purified rhC1INH produced by clones C1-1 and C1-2 was similar or higher compared to plC1INH.Example 5

[0094] 1 engineered CHO Cell line with KO of the Sppl3 gene and CHO-S wt cells were both transiently transfected using chemical transfection with plasmids encoding either a Erythropoietin or C1inhibitor gene fused to a HPC4-affinity purification tag. The transfected cells were grown for 72 hours in CD CHO + 8 mM L-gln using standard conditions as described previously, after which the supernatant was harvested, sterile filtered and stored at -80°C.

[0095] For protein purification, the supernatants were thawed and purified by affinity chromatography using a 1-mL anti-protein C affinity column for EPO and C1inhibitor, and the fractions containing the EPO and C1inhibitor respectively were pooled.

[0096] N-glycan analysis was performed on the purified samples, with GlycoWorks RapiFluor-MS N-Glycan Kit (Waters, Milford, MA) according to the manufacturer's instruction. In this case 12 µl of purified protein sample were used for each. Labeled N-Glycans were analyzed by a LC-MS system using a Thermo Ultimate 3000 HPLC with fluorescence detector coupled on-line to a Thermo Velos Pro Iontrap MS. Separation gradient 30% to 43% buffer and MS was run in positive mode.

Claims

1. A recombinant Chinese Hamster Ovarian (CHO) cell line having the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal4, St3Gal6, SPPL3, and FUT8 inactivated and / or downregulated by gene knock-out.

2. The recombinant CHO cell line according to claim 1, wherein the endogenous genes Mgat4A, Mgat4B, Mgat5, St3Gal3, St3Gal4, St3Gal6, SPPL3, and FUT8 are inactivated and / or downregulated by gene knock-out; and the gene ST6Gal1 is inserted.

3. The recombinant CHO cell line according to any one of claims 1-2, wherein the endogenous gene B3GNT2 is present.

4. The recombinant CHO cell line according to any one of claims 1-2, wherein the endogenous gene B3GNT2 is inactivated and / or downregulated by gene knock-out.

5. The recombinant CHO cell line according to any one of claims 1-4, wherein the endogenous gene GLUL is inactivated and / or downregulated by gene knock-out.

6. The recombinant CHO cell line according to any one of claims 1-5, which is a CHO-K1 or CHO-S cell line; or derivatives of any of these cells.

7. The recombinant CHO cell line according to any one of claims 1-6, where the cell has been further modified to express an exogenous human glycoprotein of interest, such as a therapeutic human protein.

8. The recombinant CHO cell line according to claim 7, where said exogenous human glycoprotein of interest is a human serum protein, such as a human serpin, such as human serpin selected from the list consisting of SERPINA1, SERPINA2, SERPINA3, SERPINA4, SERPINA5, SERPINA6, SERPINA7, SERPINA8, SERPINA9, SERPINA10, SERPINA11, SERPINA12, SERPINA13, SERPINB1, SERPINB2, SERPINB3, SERPINB4, SERPINB5, SERPINB6, SERPINB7, SERPINB8, SERPINB9, SERPINB10, SERPINB11, SERPINB12, SERPINB13, SERPINC1, SERPIND1, SERPINE1, SERPINE2, SERPINE3, SERPINF1, SERPINF2, SERPING1, SERPINH1, SERPINI1, and SERPINI2.

9. The recombinant CHO cell line according to any one of claims 7-8, which cell line produces said glycoprotein of interest with a primary n-glycan structure that is a fully sialylated bi-antennary structure without core fucosylation, such as with more than 80%, such as 82%, such as 84%, such as 86%, such as 88%, such as 90% of the glycoproteins of interest produced being with a fully sialylated bi-antennary structure without core fucosylation.

10. The recombinant CHO cell line according to claim 9, which glycan structure is according to the structure A2G2S2 with the following pictorial representations:

11. The recombinant CHO cell line according to claim 10, which glycan structure is according to the structure:

12. The recombinant CHO cell line according to any one of claims 7-11, which exogenous human glycoprotein of interest is selected from Plasma protease C1 inhibitor (C1Inh) glycosylated at one or more positions selected from Asn3, Asn47, Asn59, Asn216, Asn231, Asn250, and Asn330; Antithrombin-III (ATIII) glycosylated at one or more positions selected from Asn96, Asn135, Asn155 and Asn192; and Human alpha-1-antitrypsin (AAT) glycosylated at one or more, such as two or three, of the positions Asn46, Asn83, and Asn247.

13. A method for the production of a recombinant protein of interest, the method comprising the steps of: a) culturing a population of recombinant CHO cells according to any one of claims 7-12 in a suitable cell culture medium; and b) harvesting said human protein of interest from the cell culture or cell culture medium.

14. The method according to claim 13, wherein said protein of interest is produced with a glycan structure similar or identical to the glycan profile of said glycoprotein of interest found in human plasma.