SELECTION FOR THE DEVELOPABILITY OF POLYPEPTIDE MEDICINES IN EUKARYONTIC CELL DISPLAY SYSTEMS

DE602018091208T2Active Publication Date: 2026-05-06IONTAS LTD SAWSTON
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
IONTAS LTD SAWSTON
Filing Date
2018-12-05
Publication Date
2026-05-06

AI Technical Summary

Technical Problem

Existing methods fail to conveniently integrate developability screening into the early stages of polypeptide drug discovery, particularly for aspects such as solubility and avoidance of non-specific binding, leading to costly late-stage failures.

Method used

A method involving eukaryotic cell display systems to assess and enrich polypeptides based on surface presentation levels, which serves as a predictive indicator of developability characteristics like solubility, resistance to self-association, and non-specific binding.

Benefits of technology

Enables high-throughput screening and enrichment of polypeptides with better developability characteristics, reducing the risk of late-stage failures and improving the efficiency of drug discovery.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

FIELD OF THE INVENTION

[0001] The present invention relates to identification of candidate polypeptide drugs having desirable developability characteristics such as solubility, capability to be formulated at high concentrations, low propensity for non-specific binding, and optimal half-life. The invention further relates to screening of binders in drug discovery, including antibody discovery.BACKGROUND

[0002] Antibodies have proven to be a very successful class of drug with over 70 therapeutic antibodies approved to date and many more in the development pipeline. However, the production and formulation of polypeptide drugs such as antibodies is in many respects a more complex endeavour than for small molecule pharmaceuticals. A number of factors affect the practicality of developing polypeptide drugs such as antibodies, influencing whether a lead candidate antibody will be successfully developed into a drug that is not only efficacious but also manufacturable, stable and safe. Such factors include chemical stability (resistance to e.g., fragmentation, deamidation, oxidation and isomerisation), physical stability (e.g., conformational stability, propensity of the protein to unfold, aggregate and / or precipitate, colloidal stability), and solution properties (e.g., solubility, tendency to reversibly self-associate in solution, and viscosity at high concentrations). The ability of a polypeptide to be expressed at high yield in cell culture is also a relevant consideration, as the amount of polypeptide secreted from the host cells determines the yield of product that is recoverable from the culture medium. The immunogenicity of an antibody or polypeptide drug is also a consideration. All these factors can collectively be referred to as "developability" characteristics of the product. These are important considerations as they impact the product's cost and practicality of manufacture, safety profile, dosing schedule and mode of administration. Where developability problems are encountered, they can affect the utility or commercial success of antibodies, and may cause a lead molecule to fail during the development process. Aspects of antibody drug developability and methods to measure them have been reviewed 1-3< .

[0003] Production of stable, soluble protein at high concentration is desired for administration to patients. For example antibody concentrations of 50 mg / ml and greater are sought for subcutaneous administration where a relatively large dose has to be administered in a low volume. An ideal polypeptide for therapeutic use is highly soluble in aqueous buffered solution and thus able to be concentrated to high levels. Success in producing soluble protein at high concentration depends at least in part on the polypeptides' resistance to self-association which can otherwise lead to increased viscosity and / or precipitation. When the solubility limit of a molecule is reached, further increase in dissolved concentration is not possible and undesirable effects occur such as precipitation of the molecule out of solution. As the solubility limit is approached, a solution may become viscous and / or the dissolved polypeptide may self-associate in solution (reversibly or otherwise) - such effects complicate handling and formulation of the solution. Even worse, the formation of aggregates by poorly soluble and / or unstable polypeptides can present a heightened risk of immunogenicity when the product is administered to patients 4,5< . An anti-drug immune response (e.g., anti-drug antibodies) may neutralise the therapeutic effect, and hypersensitivity can result in morbidity or mortality.

[0004] The ability of a polypeptide to be expressed at high levels can affect the economics of production. During the early steps of antibody discovery, yields achieved from optimised transient expression in mammalian cell culture can reach 50 µg / ml or greater. Transient expression is a temporary expression system in which a plasmid encoding the product of interest is transfected into a cell and is expressed for a period of time, usually declining after 2 - 7 days as the plasmid is lost from the cell. To achieve stably expressing recombinant cells for drug manufacture, the encoding DNA must be stably integrated into the cell genome. Following creation of stable manufacturing cell lines, cells may be cultured for one or two weeks to obtain higher yields, which may be around 1 mg / ml or better.

[0005] Low yields from transient expression may indicate potential developability problems with a candidate drug. For example an anti-angiopoetin antibody ("Ang2") that was prone to aggregation was reported to give yields of only 10 µg / ml, whereas an optimised variant of the antibody yielded 260 µg / ml 6< . However, even when good yields are obtained from transient expression (e.g., > 50 µg / ml) and / or from stable cell lines (e.g., > 1 mg / ml), biophysical problems may emerge when a polypeptide is concentrated above 1 mg / ml. Dobson et al (2016 7< ) found that the anti-NGF antibody MEDI1912 had significant biophysical problems when compared with its parental antibody MEDI576 but this was not reflected in the levels of expression reported from transient culture which was around 200 µg / ml. Yields from expression in cell culture are thus only one aspect of developability and may not be predictive of other important aspects.

[0006] Over the last few decades, display technologies have permitted the creation of large diverse populations of antibodies and other proteins and peptides from which individual variants with desired target binding properties can be isolated. Desired binding properties include binding to an appropriate epitope on the target (e.g., to inhibit a receptor-ligand interaction) with an appropriate specificity (e.g., towards orthologues and paralogues) and with appropriate affinity. Display technologies can help find binders with desired properties by allowing some such aspects to be enriched during selection. For example, higher affinity antibodies can be selected by using limiting amounts of antigen to drive selection. Deselecting against binding to unwanted paralogues has also been described. In vitro binder display platforms, and their use in selecting for desired characteristics including some aspects of developability, have been reviewed 8< . Also known are in vivo methods of generating antibodies, including immunisation of laboratory animals such as mice. Many approved antibody drug molecules have been discovered by using an animal's immune system to create a panel of antibodies that is then screened in multi-well plates or by flow sorting for desirable properties (e.g., binding tumour associated antigen; cytokine neutralisation).

[0007] There is no guarantee that antibody genes isolated from "natural" sources, whether obtained directly from animals or built into combinatorial display systems such as yeast display or phage display, will encode antibodies that exhibit good developability characteristics. This applies to antibody genes obtained from naïve sources as well as to those generated in vivo following immunisation, there being no a priori reason to assume that such antibodies will have good developability properties. The immune system is directed toward creating high affinity antibodies rather than creating antibodies that lend themselves to industrial manufacture or formulation as pharmaceutical products. Antibodies generated either in vivo or in vitro will not necessarily have the capacity to be concentrated to levels that are suitable for pharmaceutical formulations. The average total concentration of IgG in human serum is 12 mg / ml, with any individual antibody being represented at a significantly lower concentration. There is also great variation in the proportions of individual antibodies, with differences in expression of 1000 fold being observed between individual B cells during an immune response 6< . Thus, irrespective of an antibody's origin (e.g., immunised animals / human donors, synthetic or semi-synthetic sources), its solubility at high concentration cannot be assumed.

[0008] Traditionally, the early phase of drug discovery focuses on identifying molecules having a desired mode of therapeutic action such as target binding properties, while assessment for developability is deferred to a later stage, often after a lead molecule or limited panel of molecules have been selected for pre-clinical development. An unfortunate consequence of this is that developability problems may only come to light at a relatively late stage in drug development, when significant time and money have already been expended. Such failures are expensive. While the biopharmaceutical industry recognises that failure of candidate drugs is a ubiquitous feature of drug discovery - a majority of potential drugs never reach the clinic - there is a desire for drugs to "fail early" to reduce wastage and enable resources to be diverted towards the rarer successes.

[0009] It has been shown that engineering antibodies with a focus on improving affinity can generate affinity enhanced variants with mutations that adversely affect biophysical properties such as the propensity for self-association. The anti-NGF antibody MEDI1912 is an example of this. MEDI1912 was reported to have a pM affinity for NGF 7< , having been affinity matured from a parental antibody MEDI578. However, compared with MEDI578 the affinity matured MEDI1912 antibody exhibited poor solubility, colloidal instability, aggregation at low concentrations and short half-life.

[0010] Efforts have been made to integrate selection or screening for some aspects of developability into in vitro selection platforms such as phage display. For single domain antibodies or dAbs, which possess only a VH or VL domain, thermal challenge can reduce the proportion of antibodies with lower melting temperature (Tm), prior to selection against antigen. Increase in Tm has been linked with an overall improvement of biophysical characteristics such as reversible unfolding, resistance to aggregation, solubility, expression and purification yields in bacteria. However, molecules with similar Tm can exhibit differences in biophysical properties - see Dobson et al 2016 7< and Example 3. ScFv molecules have also been engineered to have improved stability for inclusion in bispecific platforms 9-11< . Further, phage display libraries have been built (e.g. Tiller et al (2013) 12< which seek to introduce diversity into the library while avoiding inclusion of any potential post-translational modification sites (e.g. deamidation sites, isomerization sites, protease cleavage sites, and oxidation sites).

[0011] Doerner et al. review emerging technologies for the isolation of therapeutic antibodies with prescribed physicochemical and functional characteristics (Doerner et al. "Therapeutic antibody engineering by high efficiency cell screening" FEBS Letters 2013;588(2):278-287).

[0012] A number of algorithms have been created for in silico prediction of molecular behaviour, such algorithms facilitating comparison of developability characteristics of relatively large numbers of potential candidate drug molecules. Algorithms of this type can assist in pinpointing possible reasons underlying developability problems by identifying features of the amino acid sequence that may be responsible. It is recognised for example that hydrophobic patches in a sequence can cause molecular "stickiness", exhibiting as non-specific binding and / or self-aggregation, which is more likely to occur at high concentrations since polypeptides are in close association. Protein unfolding may expose hydrophobic residues that are buried within the molecule in its native conformation.

[0013] Where developability problems arise, whether predicted or simply encountered during the process of development, attempts can be made to address the difficulties using protein engineering. Dudgeon et al. 13< identified specific positions in antibody VH and VL domains at which the introduction of aspartate or glutamate residues improved biophysical properties. The resulting antibodies were said to be non-aggregating, well-expressed and heat-refoldable. The identified mutations were reported to enhance aggregation resistance by altering the local charge distribution at specific positions, independent of the rest of the antibody sequence, and so were presented as a general template for engineering human antibody variable domains with superior biophysical properties. In other cases, particular antibody sequences have been examined for individual features that may constrain developability. For instance, the anti-angiopoetin antibody "Ang2", which was identified from a B cell hybridoma campaign, was found to have low level expression in transient culture and to be prone to aggregation 6< . Analysis of its sequence identified an unpaired cysteine at position 49 in the light chain variable domain framework. 20 individual variants were made, assessed for aggregation and a version with improved solubility was identified where cysteine 49 was changed to threonine (C49T). In this case the baseline expression of the parental clone was very low and an improvement in yield was also observed in the C49T variant without compromising binding.

[0014] Another example is the "repair" of the affinity-improved MEDI912 antibody mentioned above, which stalled in development 7< . Through a combination of hydrogen:deuterium exchange and structural modelling, 3 non-paratopic hydrophobic residues in the VH domain were identified and these were reverted to residues found in the parental antibody. Tryptophan at position 30, phenylalanine at position 31 and leucine at position 56 were converted to serine, threonine and threonine respectively (represented as W30S, F31T and L56T where number indicates amino acid position within the antibody chain, first letter represents the original amino acid and last letter represents the replacement amino acid). The developability-improved version, referred to as MEDI1912-STT, showed reduced aggregation and was improved in a number of other aspects including reduced non-specific binding and increased half-life.

[0015] Bethea et al (2012) 14< described an anti-IL-13 antibody with poor biophysical properties including self-aggregation leading to precipitation at 13 mg / ml. An aromatic triad in the CDR3 of the heavy chain consisting of phenylalanine, histidine and tryptophan was identified as a potential problem. The authors described introduction of several mutations, including a single amino acid change (substitution of alanine for a tryptophan residue at position 100a) which improved solubility and reduced non-specific interactions. In this case the change also reduced target binding.

[0016] The examples of MEDI912-STT and the anti-IL-13 antibody, in which sequence optimisation was able to simultaneously reduce both non-specific binding and other undesirable behaviours such as self-aggregation, indicates that multiple developability parameters may be interconnected and may have common underlying causes. However, other cases have been reported where there is little evidence of self-interaction although non-specific interactions are seen 2,15< .

[0017] Non-specific interactions are a significant consideration in drug development since they can adversely affect the performance, specificity, in vivo distribution or half-life of drug molecules. It has been shown that the in vivo half-life of antibodies can vary significantly 16< between antibodies having the same Fc region, indicating an influence of the antibody variable domains on half-life. This in many cases has been attributed to non-specific interactions. If an administered drug is drawn into a "sink" of non-specific binding interactions with non-target components, it will be less available for binding to its target molecule and may have a reduced ability to reach or penetrate a target tissue or site of pathology. Even low affinity non-specific interactions can be significant, particularly if the target is highly abundant. For example, antibodies in circulation are exposed to a vast area of endothelial glycocalyx (estimated area of 350 m 2< ) reported to reach depths of 0.5 mm or greater. The negatively charged glycocalyx is composed of various glycosaminoglycans such as hyaluronic acid and proteoglycans such as heparin sulphate which together constitute a major component. It also presents absorbed plasma proteins 17,18< . Low affinity association with this matrix and other surfaces presented to antibodies in circulation may have a significant effect on pharmacokinetics.

[0018] Methods exist for screening for non-specific interaction and these are usually carried out on a clone by clone basis after individual binders of interest have been identified. Hotzel et al (2012) described a strategy to help identify antibodies which exhibit non-specific interactions by screening for binding to baculoviral particles in ELISA 16< . Also, Xu et al described a polyspecificity reagent binding assay (PSR MFI) using labelled protein mixtures with a yeast display platform to identify antibodies exhibiting low specificity 19< . A number of chromatographic methods have also been developed to help identify antibodies that are prone to non-specific interactions. These typically involve immobilising an interaction partner, compound or surface of interest on a matrix such as sepharose and then passing the test antibody molecule over the matrix and comparing the degrees of retention of test and control antibodies through fixed or changing wash conditions. Methods such as cross-interaction chromatography (CIC) 15< , hydrophobicity chromatography, and heparin have been used.

[0019] A further consideration for developability is the half-life of a therapeutic protein in vivo. To achieve optimal efficacy of many systemically administered drugs it is necessary to maintain their serum concentration at a particular level (or within a target range) for some duration of time. Polypeptide half-life and / or effective concentration in vivo can be influenced to an extent by non-specific binding interactions discussed above. Further, for antibodies and other molecules containing Fc regions, half-life can be strongly influenced by binding of the Fc region to FcRn, a receptor expressed in endothelial cells. Human IgGs have relatively long half-life compared with other circulating molecules and this has been attributed to their pH-dependent interactions with FcRn. Following pinocytosis and endosomal trafficking, a relatively high affinity interaction occurs between the antibody Fc and FcRn receptors which protect the antibodies from lysosomal degradation. At neutral pH the affinity between Fc and FcRn is low and upon recycling to the cell surface neutral pHs are encountered. Under these conditions the antibody is released back into circulation. Thus pH-dependant binding to FcRn receptors is an important property of IgG molecules. A crystal structure of FcRn in complex with rat IgG2a Fc 20< indicates FcRn binding to the C H 2 and C H 3 domains (at C H 2 residues 252-254 and 309 -311, and C H 3 residues 434 - 436) and helps explain the important pH dependent binding. Fc variants with improved half-lives have been generated through Fc engineering.

[0020] Suzuki et al (2010) have shown a positive correlation between low affinity at neutral pH and long in vivo half life 21< although it is clear that other factors can contribute. The anti-IL-12 antibodies briakinumab and ustekinumab have half-lives of 8 days and 22 days respectively despite having similar Fc domains. Using these antibodies and a series of cross-over variants Schoch et al (2015) 22< showed a good correlation between retained binding at neutral pH and in vivo half-life. They pointed to a large positively charged patch on the VL of briakinumab as causing increased electrostatic interactions with FcRn, thereby limiting FcRn-lgG dissociation at extracellular pH. Similar pH-dependent interactions are described in Kelly et al (2016) although they argue non-specific interactions with other proteins may also contribute to short half-life 23< .

[0021] Usually the primary aim in drug discovery using display libraries is to enrich the libraries for clones expressing binders that have a high affinity for binding to a target molecule of interest. Phage display libraries can be used to enrich binders from non-binders and to enrich higher affinity clones relative to lower affinity clones. The relative enrichment on the basis of affinity has allowed phage display to be used for affinity maturation of antibodies. Typically biotinylated antigen is used to permit recovery of antibody:antigen complexes together with the associated display package (e.g., using streptavidin coated magnetic beads). At lower concentrations of antigen, higher affinity antibodies within a population are more likely to form complexes than lower affinity antibodies resulting in a relative enrichment of these.

[0022] However, for display of binders on eukaryotic cells, the approach of using limiting antigen coupled with solid phase recovery on beads may be less effective than phage display at enriching for high affinity binders. Unlike monovalent phage display, the eukaryotic cell is a multivalent display package with many copies of the same binder on its surface. The concentration of binders presented within a cell population during selection is potentially relatively high compared with the antigen concentration and / or the affinities which one seeks to resolve. This may mask affinity effects and make it difficult to resolve differences in affinity of binders displayed on different clones in a mixed population, consequently reducing the enrichment factor achieved compared with approaches such as phage display.

[0023] Boder & Wittrup 24< described a method that claimed to increase stringency and permit selection for affinity in a eukaryotic cell display library, using limiting concentrations of fluorescently labelled monovalent antigen in conjunction with flow cytometry to select for affinity, measuring the amount of antibody bound per cell to control for differences in expression. In this system, stringency of binding was reportedly increased by reducing the concentration of target relative to the binders, whereby higher affinity binders were said to be detected based on the level of signal detected from the target since more molecules of the target bound to higher affinity binders than to lower affinity binders.

[0024] A number of publications have described selections where target binding and antibody expression were examined simultaneously. In this way the extent of antigen binding can be normalised based on the level of display achieved. US8,771,960 (DKFZ) described selection for higher affinity monoclonal antibodies using a fluorescence activated cell sorter (FACS) method in which an antibody library or a group of different antigen-specific hybridoma cells was stained with PE-labelled antigen and counterstained with FITC-labelled protein G. Cells with the greatest quotient PE staining:FITC staining were selected in the FACS, followed by expanding individual cells each producing an antibody having comparatively high affinity for the target antigen used for selection. The ratio of antibody-bound antigens to antibody non-bound-antigens was thus used as a direct measure of the antibody affinity for its antigen.

[0025] Chao et al (2006) 25< described genes encoding a repertoire of scFvs genetically fused with the yeast agglutinin Aga2p subunit. In the Aga2p yeast display system, the binder of interest (here, scFv) is fused to an Aga2p subunit which attaches to the Aga1p subunit present in the yeast cell wall via disulphide bonds. Yeast cells expressing a target-specific binding molecule can be identified by flow cytometry using directly or indirectly labelled target molecule. For example biotinylated target can be added to cells and binding to the scFv presented within the cell wall can be detected with streptavidin-phycoerythrin. Limiting concentrations of the target molecule made it possible to enrich clones expressing higher affinity binders since those clones captured more target molecules and so exhibited brighter fluorescence. To control for variation in scFv expression in different cells Chao et al (2006) 25< used a fluorescently labelled anti-tag antibody to measure antibody expression level on the surface of each cell allowing normalisation for variation in expression level. This approach therefore allowed yeast cells displaying high affinity binding molecules to be differentiated from those cells expressing high levels of a lower affinity antibody. The purpose of measuring antibody display in this case was therefore to normalise for expression differences and thereby facilitate affinity selections.

[0026] Methods have also been described wherein display level was used as an indicator of potential expression yield of the same protein in a secreted form. In seeking to identify highly expressing cellular clones during the creation of stable cell lines for antibody production WO2015128509 (Glenmark Pharmaceuticals) described an approach wherein an antibody is expressed in a secreted form but a proportion is "sampled" for presentation on the cell surface. This sampling arises as a result of a splicing event which bypasses a first stop codon and in a fraction of the antibody mRNA splices the antibody gene onto an exon encoding a transmembrane domain. In this system the display level of the antibody was reported to correlate directly to the amount of soluble antibody expressed.

[0027] A number of studies with yeast have reported links between the level of surface presentation of binders on yeast cells, thermal stability of binders, and / or yield of binders from cell culture. Shusta et al. 26< fused soluble single chain T cell receptor (scTCR) variants to Aga2p and reported that thermal stability of the various mutants were strongly correlated with their soluble secretion levels and with the quantity of scTCR displayed as a fusion to Aga2p on the yeast cell wall. They proposed that intracellular proteolysis of thermodynamically unstable mutants by the quality control apparatus of the endoplasmic reticulum (ER) dictated the efficiency of protein expression. Kowalski et al. 27,28< examined soluble expression of variants of the soluble polypeptide fibronectin type III (Fnlll) domain in yeast and also reported a correlation between the polypeptides' thermodynamic stability and their efficiency of secretion (and hence yield). Using a yeast display system, Hackel et al. 29< further investigated the effect of thermodynamic stability of Fnlll domains. Hackel et al. cultured yeast expressing a range of Aga2p-fused Fnlll variants mutated to reduce their thermal stability, and found a positive correlation between thermal stability and surface copy number. Thus, the more thermally unstable mutants exhibited reduced surface display levels.

[0028] WO2012 / 158739 described a two stage process for selecting polypeptides from libraries based on the Fnlll domain, involving antigen-based selection from an in vitro ribosome display library followed by conversion of selected binders to a yeast display library for further antigen-based selection. The in vitro ribosome display system generated polypeptides which were largely aggregated whereas inclusion of the yeast display selection reduced the number of highly aggregated polypeptides in the selected population, although the fraction of clones producing monomers remained low. The modest improvement in expression behaviour of emerging clones was attributed to the yeast system being less permissive for expression of misfolded (e.g., thermally unstable) proteins, so that such proteins were less available for selection from the yeast library. Again this work involved an Aga1p:Aga2p-Fnlll display system.

[0029] On the other hand, Julian et al 30< found that co-selecting for antigen binding and surface display of VH domains on yeast yielded antibodies with higher affinity but lower stability. The highest affinity VH domains were highly unstable. This study found only modest changes (1.6 fold) in display levels on yeast across a range of thermostabilities, and the authors reported that display level was unable to guide the selection of sets of mutations that improved both affinity and stability together.

[0030] A recent review of the relationship between antibody affinity, specificity, stability and solubility described how improvements in one property (e.g., affinity) can lead to deficits in other properties (e.g., stability) and how these trade-offs can be balanced to co-optimise multiple properties of antibodies 31< .

[0031] Extensive work on multiple fronts has thus sought to identify and understand potential links between different characteristics of polypeptides that influence developability. Nevertheless there remains a lack of polypeptide drug discovery methods that conveniently integrate developability screening into the early stages of selection of candidate drugs, especially for aspects such as drug solubility and avoidance of non-specific binding.SUMMARY

[0032] The invention is defined in the appended claims and relates to a method of distinguishing or ranking binders according to their solubility and / or resistance to self-association in solution, and / or enriching for binders exhibiting greater solubility and / or greater resistance to self-association in solution, comprising (i) providing a library of higher eukaryotic cell clones each containing DNA encoding a binder, (ii) culturing the clones in vitro under conditions for expression of the binders, wherein the binders are presented on the cell surface, (iii) determining surface presentation levels, measured in terms of number of displayed binders per cell, of the binders on the clones, by labelling the binders with an agent incorporating a detectable label, (iv) selecting one or more clones that exhibit higher surface presentation of binders compared with other clones, and (v) identifying binders encoded by the one or more selected clones as having good solubility and / or resistance to self-association in solution, and optionally providing the selected clones for use in one or more further screening steps, wherein the binders are transmembrane domain-containing polypeptides.

[0033] The present invention provides methods and products facilitating the detection of developability issues in polypeptides during the phase of discovery from display libraries, enabling avoidance of molecules with developability liabilities and the enrichment of pools of candidate drug molecules for those with better developability characteristics.

[0034] The present inventors have surprisingly discovered that the level at which a polypeptide is presented on the surface of a eukaryotic host cell is associated with particular developability characteristics of the polypeptide, including its properties in solution such as its solubility and its resistance to self-association in solution. A host cell that expresses a polypeptide from a recombinant gene and displays the polypeptide on its surface may be used to assess or screen for such developability characteristics of the polypeptide by determining its level of presentation on the cell surface. This lends itself to high throughput screening of multiple host cell clones in parallel, allowing comparison of relative surface presentation and selection of clones displaying polypeptides having better developability characteristics. The surface presentation level of polypeptides thus represents a predictive indicator of developability in methods of screening polypeptide binders, such as in antibody discovery. Furthermore this association between level of surface presentation and biophysical properties such as self-association allows binders with such optimal biophysical properties to be selected from libraries of binders, or enriched within such libraries. Conversely, binders with poorer biophysical properties (e.g., lower solubility) can be selected against or excluded from libraries of binders.

[0035] The inventors have also devised methods of screening polypeptides expressed in higher eukaryotic cells in vitro for aspects of developability relating to in vivo properties of polypeptide drugs, such as non-specific binding, half life and effective concentration in serum or in target organs and tissues.

[0036] Methods and uses according to the present invention have particular advantages during early stage screening, including screening of large and diverse libraries of binders such as antibodies. By integrating developability screening of candidate polypeptide drugs at the earliest stages of drug discovery, the invention reduces the risk of costly late-stage failures. Developability screening according to the present invention may also be used to select among a later-stage pool of candidate polypeptide drugs, optionally a "family" of antibodies sharing a common lineage, to enrich the pool for polypeptides having better developability and / or to inform decisions on lead molecule selection for drug development. Additionally, the techniques of the present invention may be used to identify improved variants of existing candidate polypeptide drugs, such as candidate drugs that have failed to meet one or more developability criteria or in which the improvement of one or more developability characteristics is desired. Thus, described herein are methods for the generation and rapid screening of derivative sequences that exhibit improved developability characteristics.

[0037] The polypeptide expression pathway in a mammalian cell begins with the translation machinery (ribosome, etc) on the endoplasmic reticulum, following which nascent polypeptides travel through the Golgi complex and are transported to the plasma membrane where they may be either secreted from the cell or retained at the cell surface (e.g., as membrane proteins). When a recombinantly-produced polypeptide is secreted it is immediately diluted into a large volume of culture medium and after several days / weeks of accumulation will be present at concentration of typically between 1-100 µg / ml. This is low compared with the desired concentration of a polypeptide drug in a medicament formulated for administration to a patient. In contrast with a secreted polypeptide, an expressed polypeptide that is retained at the cell surface can form high local concentrations on the cell surface. Retention of the expressed polypeptide on the cell surface massively reduces the volume available to the polypeptide and therefore provides an opportunity for high concentrations to be achieved. Concentrations may be especially high when the displayed polypeptide is expressed from a strong promoter such as the cytomegalovirus (CMV) promoter. Thus, the retention of polypeptide binders on the surface of mammalian and other eukaryotic cells in recombinant cell libraries results in binders being concentrated at locally high densities at the plasma membrane surface, especially when using host cells that strongly express recombinant genes where the encoded polypeptide represents a significant fraction of the total polypeptide synthesis. Applied across a panel of clones expressing a repertoire of polypeptides, inter-clonal variation in surface presentation levels of different polypeptides may reflect characteristics of the polypeptides such as their resistance to self-association. Polypeptides with a lower tendency to self-associate can concentrate to higher levels on the cell surface, assisted by their ability to resist aggregation when brought into close proximity. A eukaryotic cell display library in culture may thus function as an in vitro selection environment for binders exhibiting good developability characteristics. This is borne out by the evidence in the Examples presented herein.

[0038] In accordance with a first aspect of the present invention, the surface presentation level of polypeptide binders (e.g., antibodies) on the surface of cultured eukaryotic cell clones is used as a predictive indicator of developability characteristics of the binders, such as their solubility, resistance to self-associate in solution and / or capability to be concentrated in solution. Without wishing to be bound by theory, one element relating to solubility of a binder may be its hydrophilicity, with greater hydrophilicity (lower hydrophobicity) being associated with higher solubility, greater resistance to self-association in aqueous solution, and an ability to reach higher concentration in solution. Methods of the invention may thus be used to distinguish more hydrophilic binders (candidate polypeptide drugs) from less hydrophilic binders, based on their degree of surface presentation in eukaryotic cell display systems as described herein.

[0039] An aspect useful for understanding the invention involves a method comprising providing a library of higher eukaryotic (e.g., mammalian) cell clones each containing DNA encoding a binder, culturing the clones in vitro under conditions for expression of the binders, wherein the binders are presented on the cell surface, determining surface presentation levels of the binders on the plurality of clones, selecting one or more clones that exhibit higher surface presentation of binders compared with other clones, and identifying binders encoded by the one or more selected clones as having good developability characteristics.

[0040] The invention may be used to distinguish or rank binders according to their developability characteristics and / or to select one or more binders having good developability characteristics. Developability characteristics assessed in such a method may be solution properties of the binders, such as solubility, resistance to self-association, and / or capability to be concentrated in aqueous solution, as discussed in detail elsewhere herein. Selection of clones exhibiting higher surface presentation provides a selected population of cells enriched for clones exhibiting higher surface presentation of binders, which may optionally then be used in one or more further methods such as additional rounds of screening.

[0041] Methods of determining surface presentation levels are described in detail elsewhere herein and comprise labelling the binders with an agent incorporating a detectable (e.g., fluorescent) label. With antibodies and other binders that comprise an Fc region, it is convenient to label with an agent that binds the Fc region, e.g. the detection agent may be a labelled anti-IgG antibody. Methods may comprise determining surface presentation levels and observing a range of binder presentation levels in cells of the library. Examples of copy number range are found elsewhere herein.

[0042] Methods of the invention may involve assessment of non-specific binding during binder discovery in display libraries. It is advantageous to identify interactions with non-target molecules during initial binder discovery. Methods of the invention may be employed in screening populations of binders (e.g., antibodies) displayed on higher eukaryotic cells for optimal biophysical properties and low propensity for non-specific interaction with non-target molecules in vivo. Whereas it is routine to select candidate polypeptide drugs for desirable binding to a target molecule (e.g., the molecular target of the polypeptide drug, to which it binds in vivo and exerts a biological effect), problems with developability may be reduced if attention is also given to negatively selecting against candidate polypeptide drugs that exhibit undesirable binding to a non-target molecule (e.g., a component or class of molecules to which the binder shows non-specific binding, such as binding to negatively charged polymers like nucleic acids). The non-target molecule may be substituted for a target molecule in methods of selecting binders, except that binders that recognise the non-target molecule are then discarded rather than retained, thereby enriching for binders that do not recognise the non-target molecule.

[0043] Methods of the invention may involve selecting binders that exhibit lower tendency for non-specific binding, to enrich a pool of candidate drugs for those that exhibit less non-specific binding, and for comparing the predicted pharmacokinetic performance of different candidate drug products. Such methods may be used during drug discovery, optionally at early stages of screening, or to inform decisions on lead molecule selection for drug development.

[0044] An aspect useful for understanding the invention involves an in vitro screening method comprising; (i) providing a library of eukaryotic cell clones each containing DNA encoding a binder, (ii) culturing the clones in vitro under conditions for expression of the binders, wherein the binders are presented on the cell surface, (iii) exposing the binders to a matrix of non-target molecules, allowing binding, (iv) discarding cells that exhibit a greater level of binding to the matrix, (v) selecting cells that exhibit a lower level of binding to the matrix, to provide a selected population of cells enriched for clones expressing binders having a low propensity to bind the non-target molecules. Binders, and thereby the cells that display them, are thus separated according to their relative binding to the matrix. Cells that bind to the matrix are discarded while non-binding cells are collected.

[0045] The high valency of antibodies displayed on a cell surface will facilitate the detection of low affinity cross-reactivities. When a population of cells displaying binders is passed over a matrix, binding to the matrix may be manifested by delayed passage. Cells displaying binders with low interaction potential progress through the matrix more readily and can be collected, in contrast to clones displaying binders exhibiting non-specific interactions which emerge later. Passing the library of clones over the matrix thus achieves separation of clones over time as those displaying binders exhibiting a greater propensity to bind one or more components of the matrix will take longer to pass over the matrix or may not even emerge from the matrix at all. The method may comprise collecting cells that pass more quickly over the matrix and discarding cells that pass more slowly and / or remain bound to the matrix. The matrix will generally comprise a solid or semi-solid substrate on which the one or more non-target components are immobilised (e.g., beads, optionally packed within a column). A number of non-target molecules may be tested, such as heparin sulphate proteoglycans and other abundant components encountered in the bloodstream. The matrix may comprise one or more components of the glycocalyx, e.g., hyaluronic acid, heparin sulphate. Alternatively flow sorting or sorting on magnetic beads may be used, with non-target molecules with collection parameters based on the extent of binding to an interaction partner, compound or surface of interest. The method may thus be used to enrich for cells expressing binders that exhibit a low propensity to bind in vivo with non-target molecules in a mammalian subject to whom the binder is administered.

[0046] An aspect useful for understanding the invention involves screening of binders for binding to one or more non-target molecules in a method comprising (i) providing a library of eukaryotic cell clones each containing DNA encoding a binder, (ii) culturing the clones in vitro under conditions for expression of the binders, wherein the binders are presented on the cell surface, (iii) exposing the binders to one or more non-target molecules, allowing binding, (iv) discarding cells that exhibit a greater level of binding to one or more non-target molecules, and (v) selecting cells that exhibit a lower level of binding, to provide a selected population of cells enriched for clones expressing binders having a low propensity to bind the non-target molecules.

[0047] Such methods may be applied to cells (or a sample of cells) of a library of higher eukaryotic cells displaying binders, to enrich for cells expressing binders that exhibit a low propensity to bind the one or more non-target molecules.

[0048] To facilitate identification and / or separation of cells expressing binders that recognise the non-target molecule, the non-target molecule may be detectably labelled, e.g., with a fluorescent label. Use of fluorescence allows separation of the cells by flow sorting in a FACS, where non-stained (unlabelled) cells are distinguishable from stained (fluorescently labelled) cells and can be directed into a collected or discarded fraction accordingly. Conveniently, this may be combined with labelling to detect FcRn binding and / or to detect the presence and level of surface display of binders (e.g., using an anti-Fc antibody to bind binders that contain an Fc region) and / or to detect of target binding (e.g., using labelled antigen). Simultaneous labelling and sorting for combined properties is possible with the use of multiple distinct labels, e.g., fluorophores of different wavelength.

[0049] Further aspects useful for understanding the invention relate to screening polypeptides for pH dependent interactions with the FcRn receptor. An antibody (or other Fc-containing drug) may have interactions with FcRn that either increase or shorten its half life. As already noted, binders comprising Fc domains may interact with FcRn receptors on endothelial cells and be saved from degradation. Operation of the FcRn recycling pathway is pH dependent, requiring stronger binding within the low pH of the endosomal compartment to keep the polypeptide safely docked on the receptor, and lower affinity binding in the higher pH extracellular environment for release of the polypeptide back to the bloodstream. In some cases it me be desirable to increase binding to FcRn for reasons beyond controlling half-life. For example using "sweeping antibody" approaches 32< it is desirable for the administered antibody to engage well with FcRn at neutral pH to ensure there is preferential interaction compared with other natural antibodies in serum. The antibody in turn can deliver bound target molecules to the endosomal compartment where the bound target is released by the reduced pH and is subsequently degraded, e.g. within lysosomes.

[0050] One may wish to combine selection for multiple aspects of developability or with selection for binding to a target. To this end a selection may be performed by exposing the binders to the target, allowing recognition of the target by cognate binders, whereby clones displaying cognate binders become bound to the target. One or more clones displaying cognate binders is then selected. The target may carry a detectable (e.g., fluorescent) label to facilitate selection of clones displaying cognate binders. Conveniently, the method may comprise simultaneously determining surface presentation levels of the binders and levels of target binding by the binders, and co-selecting clones displaying cognate binders exhibiting higher surface presentation. The use of a fluorescence activated cell sorter (FACS) allows cells to be sorted according to their emitted fluorescence, and a parallel selection for surface presentation and target binding may be conducted by using different fluorescent labels to detect surface presentation vs bound target. Clones that exhibit surface presentation above a chosen threshold, and which also exhibit target binding, may thus be selected.

[0051] A further aspect useful for understanding the invention relates to improvements in selection of binders having high affinity for binding to a target of interest. The inventors noted that while high level presentation of binders on the cell surface can have advantages in a display library, it may undesirably limit the sensitivity or stringency of affinity-based selection for target binding. The inventors realised that limiting the presentation level of binders in a display library could facilitate selection for higher affinity binders.

[0052] In accordance with this aspect useful for understanding the invention, provided is a method comprising (a) providing an in vitro library of higher eukaryotic (e.g., mammalian) cell clones each containing DNA encoding a binder, wherein the encoded binder is expressed from a weakly active promoter and / or expressed on the cell surface at a copy number in the range of 100 - 60,000 per cell, (b) exposing the library to a target and allowing recognition of the target by cognate binders, whereby cells displaying cognate binders become bound to the target, and (c) isolating cells bound to the target to provide a selected population of cells displaying cognate binders. Thus a pool of clones is obtained that is enriched for clones encoding binders with higher affinity for the target. The method may further comprise (d) exposing the selected population of cells to one or more further rounds of selection on the target, optionally wherein the concentration of target is progressively reduced to increase stringency of selection, and / or (e) selecting one or more clones displaying a cognate binder having the desired level of binding to the target.

[0053] The concentration of target used may be pre-determined or may be judged empirically based on using a range of target concentrations and choosing an antigen concentration where the extent of cell binding is higher than found on control cells (e.g., cells which do not express binders, or which express a binder that does not recognise the target).

[0054] Flow sorting may be used to identify the population of clones within a library with a desired level of binding under different conditions of target concentration and / or level of binder display. Selected clones may be identified based on the extent of fluorescence bound to the cell. As the number of bound target molecules reduces (through lower target concentration and / or reduced levels of binder display) the ability to distinguish labelled cells from non-labelled cells diminishes particularly if non-labelled cells exhibit a significant baseline of autofluorescence. In that case the use of recoverable target molecules (e.g., biotinylated target) and magnetic beads (e.g., streptavidin coated beads) for separation of labelled cells may allow separation of cells with a significantly reduced extent of labelling from non-labelled cells, thereby allowing increased stringency to be used in selection.

[0055] The method may be used to identify a binder that recognises a target molecule with desired affinity, to select binders according to affinity and / or to enrich a pool of clones for those expressing higher affinity binders for the target. The target may be any molecule of interest, such as a human receptor, ligand, enzyme or other polypeptide.

[0056] An aspect useful for understanding the invention involveslibraries as defined under (a) above, and their use for selection of binders having a desired affinity for a target. Such libraries and methods of generating them are further described herein.

[0057] As outlined above, cell libraries may be used to distinguish binders based on different characteristics (developability and affinity) depending on the level at which the binders are expressed on the cell surface. During drug discovery one may naturally wish to select for both good affinity and good developability, in which case multiple aspects described herein may be combined. For example, one may select binders to a target of interest using cells displaying binders at a relatively low level and thereby obtain a population of cells enriched for clones displaying high affinity binders. Their encoding DNA may then be provided in clones expressing the binders at a higher level, to select binders for desired developability traits. These selections may be performed in either order (selection for affinity followed by selection for developability or the other way around) and multiple rounds of selection may be included (e.g., initial affinity selection, then developability selection, then further rounds of affinity selection).

[0058] Dual-purpose display libraries can be constructed that are adaptable for use in selecting for both affinity and developability, by placing surface expression of binders under an externally controlled switch or modulatable element. For instance, DNA encoding binders may be operably linked to a promoter whose expression can be modulated by addition of an inducer or suppressor to the cell culture medium. Expression is then controlled from outside the cell, enabling the operator of the method to upregulate or downregulate the level of expression at will. Thus, in the case of an inducible promoter, addition of an inducer by an external operator causes the promoter to be activated so it may be regarded as externally inducible, albeit the induction is ultimately exerted within the cell. A number of inducible promoter systems have been described, a classic example being tetracycline-inducible promoters 33< . Dual-purpose libraries in which expression of binder DNA is under external control (e.g. under control of an inducible promoter) have the advantage that changing the level of binder gene expression is rapid and straightforward, without a need to reclone the encoding DNA into a new population of cells.

[0059] Methods of binder display involving such libraries form part of the present invention. A method of identifying a binder that recognises a target may comprise: (i) providing a library of eukaryotic (e.g., mammalian) cell clones each containing DNA encoding a binder, wherein expression of the binder at the cell surface is externally modulatable (e.g., wherein surface expression of the binder is under control of an externally modulatable promoter), and wherein binders are presented on the cell surface, (ii) culturing cells of the library under conditions for low presentation on the cell surface (e.g., where the promoter is weakly active), (iii) exposing the library to the target, allowing recognition of the target by cognate binders, whereby cells displaying cognate binders become bound to the target, (iv) selecting cells displaying cognate binders, thereby providing a selected population of cells, (v) culturing the selected population of cells under conditions for increased presentation on the cell surface (e.g., where the promoter is more strongly active, optionally maximally active), (vi) determining surface presentation levels of the binders on the plurality of clones, by labelling the binders with an agent incorporating a detectable (e.g., fluorescent) label, and (vii) selecting one or more clones that exhibit higher surface presentation of binders compared with other clones.

[0060] Binders having good developability characteristics (and the clones expressing them) are thus identified, selected and / or enriched for by selecting / enriching for binders (and hence clones) exhibiting higher surface presentation. The method can thus provide a pool of clones enriched for clones expressing binders that have good developability characteristics.

[0061] Such a method effectively combines multiple aspects that are described in detail elsewhere herein, namely the selection of binders to a target and the selection of cells based on surface presentation of binders. Features of these aspects as described elsewhere herein may be employed in the combined method, including e.g., the choice of target concentration for stringent selection, levels of surface presentation of binders, and methods of selecting cells.

[0062] The modulatable promoter may be an inducible promoter. Depending on the type of inducible promoter system used, low level or basal expression may be obtained in the absence of inducer (e.g., a tetracycline such as tetracycline or doxycycline) in the culture medium. Alternatively, a low concentration of inducer may be added. Expression from the promoter may be titred by addition of inducer or by increasing the concentration of inducer in the culture medium, preferably to obtain maximal promoter activity. An alternative to an inducible promoter is a repressible promoter, where the default state of the promoter is active, its activity being dampened or blocked by addition of a suppressor to the culture medium.

[0063] It will often be convenient to begin with the library in its basal expression state, and to conduct initial round(s) of selection on the target before upregulating activity of the promoter to increase cell surface presentation of binders and select for developability. However, in some cases it may be desirable to select for developability first, with the promoter activated, and then to suppress activity of the promoter or to allow its activity to decline (e.g., by removing the inducer from the culture medium), before conducting selection for affinity. This may be more convenient if using a repressible promoter. Thus, with reference to the numbered method steps set out above, one may conduct steps (ii)-(iv) followed by steps (v)-(vii), or one may conduct steps (v)-(vii) followed by steps (ii)-(iv).

[0064] An aspect useful for understanding the invention further involves libraries for use in the above method, an example of which is an in vitro display library of eukaryotic (e.g., mammalian) cell clones containing DNA encoding a repertoire of binders, wherein expression of the binder (and hence its presentation on the cell surface) is under control of a tetracycline-inducible promoter. Preferably the encoding DNA is integrated at a fixed locus in the cellular DNA. Such a library may be produced by a method comprising: providing donor DNA molecules encoding the binders, and eukaryotic (e.g., mammalian) cells, introducing the donor DNA into the cells, thereby creating recombinant cells containing donor DNA integrated in the cellular DNA, wherein expression of the donor DNA is placed under control of a tetracycline-inducible promoter for presentation on the cell surface, and culturing the recombinant cells to produce clones, thereby providing a library of cell clones containing donor DNA encoding the repertoire of binders.

[0065] Optionally, integration of donor DNA is achieved by providing a site-specific nuclease within the cells, wherein the nuclease cleaves a recognition sequence in cellular DNA to create an integration site at which the donor DNA becomes integrated into the cellular DNA, integration occurring through DNA repair mechanisms endogenous to the cells.

[0066] Preferably the tetracycline-inducible promoter is on the donor DNA molecule encoding the binder, although it may be separately integrated if desired. Generally, the donor DNA and / or the cellular DNA of recombinant cells will contain DNA encoding the binder downstream of the promoter for expression. Following library construction, expression of donor DNA can be induced from the promoter and cells can be cultured under conditions for presentation of the binders on the cell surface.

[0067] Cells in which expression of binder DNA is placed under control of an inducible promoter also provide an opportunity to assess the rate at which cell surface presentation of binders on expressing clones reaches a certain level, and to compare rate across a plurality of clones by comparing presentation level after a short period of induction. This may be predetermined (e.g., 4 hours or 8 hours or 12 hours) or may be empirically derived by observing the appearance of binder presentation following induction. Cell surface presentation can be plotted over time, starting from the time point at which expression from the inducible promoter is initiated, to observe the rate of increase in expression and surface presentation. Polypeptide expression will typically increase over time until it reaches a stable or equilibrium level on the cell surface. By determining and comparing cell surface presentation between clones at an early stage, before the final expression level has been reached, initial indications of aspects of developability may already be seen. These developability aspects may include the capability of the polypeptide to be concentrated in solution, its solubility, resistance to self-association in solution, and / or other developability characteristics discussed herein, in addition to the yield recoverable from expression.

[0068] The rate of turnover, degradation or internalisation of binders displayed on higher eukaryotic cells can also be used as an indicator of such developability characteristics. This may optionally be assessed under conditions where the displayed binder is not being continuously replenished with newly expressed binder (so manifesting as depletion of binder from the cell surface, i.e., reduced level of surface presentation). One may label the binders, wash away unbound label and observe the rate at which labelled binder is depleted from the cell surface over time due to degradation and / or internalisation. Higher levels of depletion of binder may be observed on some clones relative to others. Selecting clones with the higher levels of surface presentation will select those clones with the better developability characteristics (e.g., higher solubility, better resistance to self-association in solution, lower non-specific binding).

[0069] Within a library of cells it may be observed that some clones exhibit a greater rate of increase in surface presentation than others. This may be used as an early indication of the developability potential of a polypeptide allowing selection of clones with optimal properties from the library.

[0070] In accordance with methods of the invention generally, once one has selected clones or selected a population of cells enriched in clones having desired characteristics, the selected clones or population may then be used in one or more further screening methods, examples of which are provided herein. Selected clones may be cultured, either together or individually. Methods may be combined so that clones are screened for multiple characteristics, including target binding and various developability characteristics described herein.

[0071] Methods of the invention may be used to assess the behaviour of antibodies at high concentrations in the earliest stages of antibody discovery. In preferred embodiments, the propensity for self-interaction of antibodies or other polypeptide binders at high concentrations is detected by screening libraries of clones using library selection techniques such as flow sorting, bead-based selection or chromatography.

[0072] Following selection of one or more clones containing DNA encoding a desired binder in any aspect of the present invention, nucleic acid encoding the binder may be recovered and / or the sequence of the nucleic acid encoding the binder may be determined. Nucleic acid (e.g., DNA) encoding the binder may be provided in isolated form, e.g., in a recombinant vector.

[0073] DNA encoding a binder of interest may be expressed in a host cell in vitro, optionally under conditions for expression of the binder in soluble form. Thus, the host cell may secrete the binder, facilitating its recovery from cell culture medium. The yield of binder (e.g., from a stably transfected host cell) may be at least 0.5 mg / ml, at least 1 mg / ml, at least 2 mg / ml or at least 5 mg / ml for example. The binder may be purified and / or concentrated to provide an aqueous solution of the binder. Advantageously, a binder may be provided in solution at a concentration of at least 1 mg / ml, optionally at least 10 mg / ml, at least 50 mg / ml or at least 100 mg / ml. In some embodiments, the binder is provided in solution at a concentration of between 50 mg / ml and 200 mg / ml, e.g., between 50 mg / ml and 100 mg / ml.

[0074] Binders that are identified or selected using methods according to the invention are themselves also useful for understanding the invention herein, including those described in the Examples (including, without limitation, binders comprising the disclosed sequences such as the antibody VH and / or VL domain sequences set out herein) as well as further binders that are obtained as a result of conducting the methods of the invention. A binder of interest may be formulated into a composition comprising a pharmaceutically acceptable excipient. Described herein are such compositions and their clinical use, including binders for use in methods of treatment of the human or animal body by therapy. The method may comprise administration of a composition containing the binder by subcutaneous administration. A composition comprising the binder in solution may be provided in a pre-filled syringe for injection, optionally within a kit comprising one or more additional components such as a needle and / or product information leaflet comprising directions for administration of the composition by injection, e.g., subcutaneous injection.

[0075] Eukaryotic cells in the context of the present invention are higher eukaryotic cells, such as mammalian cells. Mammalian cells are commonly used for large-scale expression of polypeptide drug products (e.g., antibodies) intended for clinical use. Consequently there are advantages to using mammalian cells when assessing characteristics of candidate polypeptides in drug discovery. A polypeptide binder may be expressed in its final intended molecular format during the early stages of discovery in mammalian cells. For example, where the desired clinical product is a full-length antibody (e.g., IgG), mammalian cells expressing full-length antibodies (e.g., IgG) may be used in methods of the invention.

[0076] The present invention may be used to best advantage in cell populations where there is a constant number (preferably one) of integrated binder genes per genome to avoid copy number effects or heterogeneity arising from differences in the number or identity of binder genes being expressed in different clones in a population. Additionally, the binder-encoding DNA is preferably integrated at the same locus in the cellular DNA of all clones, to avoid the complication of extrinsic effects on expression from variation in the position of integration of the encoding DNA, which may otherwise arise from genomic regions differing in their transcriptional activity. This has the benefit of transcriptional normalisation of binder expression. Thus, preferably the invention employs a plurality (e.g., a large library) of mammalian cell clones each containing DNA encoding a different binder sequence, wherein the encoding DNA is at a fixed locus in the cellular DNA and wherein the encoded binder is presented on the cell surface. Nevertheless, benefits of the invention may still be obtained using clones in which the encoding DNA is randomly integrated in the cellular DNA or provided on a plasmid for transient expression (e.g. Example 11). Integration of binder-encoding DNA at a single or limited number of loci will also enable better control of expression if required e.g., using inducible promoters, and preferably the binder-encoding DNA is present once per cell or once per chromosomal copy in a diploid genome. Thus, clones of a library each preferably express only one or two members of a repertoire of binders.

[0077] Various features of the invention are further described below. Headings used throughout this specification are to assist navigation only and should not be interpreted as definitive. Embodiments described in different sections may be combined as appropriate.DETAILED DESCRIPTION

[0078] Headings and sub-headings within this document are included purely to assist navigation and should not be construed as limiting. Multiple aspects and embodiments of the invention may be combined, and methods of selecting polypeptide drugs based for developability will desirably encompass sequential and / or parallel combinations of individual features and steps described herein.Developability

[0079] It is desirable to integrate screening for multiple developability characteristics into the process of drug discovery to provide insight into developability at an early stage and to allow developability risks to be reduced. Binders (and their encoding cell clones) may be identified and selected for one or more desired developability characteristics as detailed here. It will be understood that screening or selection for developability in the present invention generally refers to predicted developability, where what is being assessed is a surrogate marker indicative of developability traits, enabling high throughput selection and integration of developability selection in early-stage discovery. The invention allows developability risks to be identified and reduced through enrichment for binders having more favourable developability traits. Developability characteristic(s) of individual polypeptides may then be directly confirmed by methods such as those described below. Identifying a binder as having a certain characteristic may thus comprise concluding that the binder is predicted to have that characteristic, based on data obtained from a method of the invention.

[0080] Identifying a binder as a candidate binder for development, or identifying a binder as having good developability characteristics, may comprise generating a report identifying the binder as having good developability characteristics. Identifying a pool of binders as being enriched for binders having good developability characteristics may comprise generating a report identifying the pool as being enriched for binders having good developability characteristics. Similarly, identifying selected cells as expressing binders (or as being enriched for clones expressing binders) that have good developability characteristics may comprise generating a report identifying the cells (e.g., selected cell population) as expressing binders (or being enriched for expression of binders) that have good developability characteristics. A report may be a written report, which may be provided in electronic form and / or in print. The report may provide quantitative and / or qualitative information on developability including, for example, data from one or more methods described herein.Solubility, concentration and self-association in solution

[0081] A recombinantly expressed polypeptide will usually need to be purified from the cell culture and formulated at a higher concentration, e.g., for use as a medicament. For example the protein may be expressed in transient cell culture at 100 µg / ml or in stable cell culture at 1 mg / ml, with a requirement to provide the protein to patients at a higher concentration e.g., at 50 mg / ml or greater for subcutaneous administration.

[0082] A number of straightforward techniques for expression, purification and quantitation of soluble binders such as antibodies will be known to those skilled in the art e.g., Walker et al (2008) 34< , Janson et al (2012) 35< . The concentration of a purified polypeptide binder in solution can be determined in a number of ways. For example the solution's absorbance of light at a wavelength of 280 nm can be measured and the value used to determine the concentration based on the extinction coefficient of the polypeptide. Alternatively the test sample may be compared to a standard protein of known concentration, for which various colourimetric and fluorescent assays are known to those skilled in the art.

[0083] A desired developability characteristic is high solubility in aqueous solution. A polypeptide may desirably be soluble at 10 mg / ml, 20 mg / ml, 50 mg / ml, 75 mg / ml, 100 mg / ml, 150 mg / ml, 200 mg / ml or greater. The solution may be an aqueous buffered solution such as PBS. The solubility limit of the polypeptide may be greater than 10 mg / ml, > 20 mg / ml, > 50 mg / ml, > 75 mg / ml, > 100 mg / ml, > 150 mg / ml or > 200 mg / ml. It is advantageous to provide the polypeptide in solution at a concentration substantially below its solubility limit, to minimise self-interaction of the molecule and other undesirable effects that may occur as the solubility limit is approached more closely. Self-association of the polypeptide can lead to undesirable outcomes in terms of product quality and stability, including increased viscosity or phase separation. When the solubility limit of a molecule is reached, further increase in dissolved concentration is not possible and undesirable effects such as precipitation of the molecule will occur. In some embodiments, solubility limit of a selected polypeptide binder (e.g., an improved variant) is between 10 mg / ml and 200 mg / ml, e.g., between 50 mg / ml and 100 mg / ml.

[0084] It may be possible to drive a polypeptide solution to the point of precipitation and then, following filtration or centrifugation determine the concentration of the remaining soluble material, to determine its solubility limit. This can also be referred to as the maximal solubility of the protein. There are however more sensitive ways to measure the onset of self-association, which may occur at a concentration lower than that required for precipitation. For example at a critical concentration monomeric molecules will begin to form dimers and higher order soluble aggregates. Such aggregates can be detected in various ways. The "critical concentration" is defined as the concentration at which self-interaction is evident using one or more of these methods. A desired developability characteristic of a binder is that its critical concentration is high, so that medicinal formulations of the binder in solution are comfortably below the critical concentration. The critical concentration is preferably greater than 10 mg / ml, > 20 mg / ml, > 50 mg / ml, > 75 mg / ml, > 100 mg / ml, > 150 mg / ml or > 200 mg / ml. In some embodiments, critical concentration of a selected polypeptide binder (e.g., an improved variant) is between 10 mg / ml and 200 mg / ml, e.g., between 50 mg / ml and 100 mg / ml.

[0085] Some of the consequences of self-interaction, such as precipitation, may occur over an extended time and this is relevant to the shelf life of the product. The buffer composition, pH and temperature may also be influential. Parameters such as concentration may thus be determined under a set of reference conditions, e.g., at 4°C with a standard buffer such as PBS at pH 7.4. Resistance of a polypeptide to self-interaction may be confirmed after an extended duration of time, e.g., by testing after (and optionally at additional points during) a 4 week period of storage under these conditions. The polypeptide may optionally resist self-interaction under such conditions for at least six months, confirming that the solution is below its critical concentration.

[0086] A polypeptide with poor developability characteristics in this respect would be one where signs of self-aggregation are apparent even at lower concentrations in solution, such as 1 mg / ml or less in standard buffer such as PBS, e.g., at 4°C. An ideal polypeptide will have a critical concentration of 100 mg / ml or greater, i.e., it will resist such self-interaction allowing it to be concentrated to 100 mg / ml. Between these extremes there may be cases where an improved polypeptide selected using the methods outlined herein exhibits a critical concentration which is improved by 1.5 fold or more over a starting polypeptide. Thus "improvement" can be defined in relation to a starting polypeptide, such as in methods described elsewhere herein where variants are being compared with a parent binder. Differences can also be compared between binders from different clones more generally, such as between different derivatives or variants of a parent binder, or across a population of clones in a library, whether a naïve library or an enriched population derived from another method (optionally a population of clones derived from the output of phage display selection or an antibody population derived from immunisation). Clones encoding binders which present at higher levels on the cell surface using the present invention may be compared to clones encoding polypeptides with lower levels of surface presentation within the same population which have been deselected. The biophysical behaviour of a polypeptide from a selected clone can be compared to the polypeptide derived from a deselected clone exhibiting lower levels of surface presentation from the same population. An antibody or other binder benefitting from discovery using the present invention will be one where it can be shown by any method that higher concentration levels can be achieved before the onset of self-interaction or where the degree of self-interaction is reduced within a given assay compared to a comparator polypeptide. For example a starting polypeptide with evidence of self-aggregation at 10 mg / ml could be improved to 15 mg / ml or greater. Alternatively an optimal polypeptide selected from a library may resist self-aggregation at 10 mg / ml while other polypeptides derived from rejected clones in the same population may exhibit self-interaction at 10 mg / ml or less. In each case we refer to parental polypeptide or the polypeptide derived from rejected clones as the "comparator polypeptide".

[0087] As a control for self-association and other biophysical properties selected for in the present invention, an antibody with known desirable properties could be used and the relative performance of the parental antibody and its improved derivative (or a selected library member versus a deselected member) compared to this. The National Institute of Standards and Technology have used an antibody NIST RM 8671 as a "gold standard" reference antibody which has been extensively characterised by over 100 collaborators with the comparison published as part of a three part volume published by the American Chemical Society 36< . The NIST RM 8671 antibody was shown to have minimal self-interaction (Saro D et al, Developability Assessment of a proposed NIST monoclonal antibody 37< ). Alternatively the antibody adalimumab has been shown to exhibit minimal self and cross-interaction and has been used as a control in some studies e.g., by Jain et al (2017) 2< and Sun et al (2013) 38< . The critical concentration or solubility of a binder, especially an antibody, as described herein may be compared with one or more such reference antibodies for benchmarking purposes.

[0088] Self-interaction can be determined in a number of ways allowing a direct and quantifiable comparison between an antibody selected for a high level of surface presentation compared to an antibody deselected based on a lower display level. Size exclusion chromatography (SEC), e.g., high pressure liquid chromatography (HPLC), allows the separation of monomer and multimeric forms (including dimer and higher order forms) of the polypeptide. The proportion of material in the dimer and / or multimer form can be quantitated and the extent of multimer formation can be compared between binders (e.g., between a parent binder and an improved variant) may be detected as an increased retention time and / or a broader elution peak following passage over the column. The HPLC-SEC profile may be determined at a single concentration and the proportion of multimer and / or retention time compared. Any detectable, reproducible reduction in retention time or peak width will be deemed an improvement. A reduction of the multimer peaks to 60% of their value in the parental clone will be deemed an improvement. Alternatively the critical concentration where a threshold of multimerisation occurs can be determined for each clone by testing a range of concentrations and determining a concentration where this threshold of multimerisation (e.g., 5%) occurs. Alternatively the increase in multimerisation can be plotted over time and the rate of multimer accumulation compared 2< . In each case an increase in the critical concentration represents an improvement. The magnitude of improvement in the critical concentration may be e.g., at least 1.5 fold or at least 2 fold.

[0089] Improvement in solubility limit, or improvement in critical concentration, is optionally between 1.5 fold and 50 fold, e.g., between 1.5 fold and 15 fold, between 1.5 fold and 10 fold, or between 2 fold and 10 fold.

[0090] Methods of determining self-association of a polypeptide include self-interaction chromatography (SIC). In this technique, a binder such as an antibody is immobilised on a matrix and a solution of the same binder is passed over the matrix. An extended retention time compared to control antibodies indicates self-interaction 38< (or interaction with the matrix). Alternatively a high throughput approach can be used in which different binders are immobilised on a biolayer interferometry chip (BLI) and tested for self-interaction by immersing a solution of its soluble form yielding a signal related to the amount of soluble binder that binds. This "Antibody Clone Self-Interaction using Biolayer Interferometry" (CSI-BLI) approach was shown to have good correlation with more laborious approaches such as SIC and required less material. In each case the retention time of the test binder (in the case of SIC) and the signal achieved in the case of (CSI-BLI) can be compared with the parental binder and a control binder known to resist self-aggregation (such as a benchmark antibody mentioned above).

[0091] In affinity capture self-interaction nanoparticle spectroscopy (AC-SINS), test antibodies are presented on a cell surface and their potential for avid self-interactions with antibodies presented on other beads is assessed 39-41< The reduction in inter-particle distance ensuing from interaction can be detected as an increase in plasmon wavelength of gold colloidal solutions. AC-SINS is a preferred technique for determining critical concentration, as it is a sensitive and straightforward assay. In preferred embodiments, improvements in developability of binders are detectable as an increase in critical concentration of the polypeptide in solution, where critical concentration is measurable by determining change in plasmon wavelength in an AC-SINS assay.

[0092] Self-association can also be measured by static and dynamic light scattering (DLS) 42,43< , in which the hydrodynamic radius and percent polydispersity of molecules in a sample can be calculated providing information on the size and shape of molecules in solution. With DLS mutual diffusion coefficient is evaluated in relation to antibody concentration as a measure of self-association. Other methods for measuring self-interaction such as analytical ultracentrifugation 44< membrane osmometry 45< and neutron scattering 46< can be used.

[0093] Methods of the invention may comprise selecting one or more clones that exhibit higher surface presentation of binders compared with other clones, and identifying binders encoded by the one or more selected clones as having good solubility and / or resistance to self-association in solution, wherein the binder or binders have a critical concentration that is increased by at least 10 %, at least 25 %, or at least 50 % as compared with binders encoded by one or more other clones in the population or as compared with a parent binder of which the selected binder is a variant, and / or wherein the binder or binders have a critical concentration that is increased by at least 1.5 x, at least 2 x, at least 3 x, at least 5 x, at least 10 x, at least 20 x or at least 100 x as compared with binders encoded by one or more other clones in the population or as compared with a parent binder of which the selected binder is a variant.

[0094] As discussed, methods herein can be used to exclude (or diminish frequency or prevalence of) binders with poor developability characteristics, and favour the selection of (by increasing frequency or prevalence of, enriching) those with better developability characteristics. Such methods are not limited to merely identifying and avoiding "problem" binders. The sensitivity of the techniques described herein allows their use in distinguishing the best (e.g., most soluble) candidates among multiple binders that exhibit good solubility. The invention can also be used to apply selective pressure in favour of maintained or enhanced developability during affinity-based selection.

[0095] A comparator polypeptide may be any binder from a non-selected population of clones (or clones exhibiting binder presentation level at less than the determined threshold level). A comparator polypeptide may have a solubility limit of at least 5 mg / ml, at least 10 mg / ml, at least 20 mg / ml, at least 30 mg / ml, at least 40 mg / ml or at least 50 mg / ml, e.g. as determined by any method described herein. A comparator polypeptide may optionally have a critical concentration of at least 5 mg / ml, at least 10 mg / ml, at least 20 mg / ml, at least 30 mg / ml, at least 40 mg / ml or at least 50 mg / ml, e.g. as determined by any method described herein. A binder from a selected clone may exhibit at least 10 %, at least 20 %, at least 30 %, at least 40 %, at least 50 %, at least 60 %, at least 70 %, at least 80 %, at least 90 % or at least 100 % improvement in a developability characteristic, e.g., solubility limit or critical concentration, compared with a comparator polypeptide (e.g., a clone from the non-selected population, or parent binder). The binder from a selected clone may exhibit at least 1.5 fold improvement in a developability characteristic compared with a comparator polypeptide, e.g., increased solubility limit or increased critical concentration. Comparator polypeptides may optionally have a critical concentration of at least 10 mg / ml, at least 20 mg / ml, at least 30 mg / ml, at least 40 mg / ml or at least 50 mg / ml. It will be understood when comparing properties of a polypeptide against a comparator polypeptide, the comparison is made under identical conditions as is standard with the use of controls in the art.

[0096] The method may comprise confirming the improvement in critical concentration, e.g., by experimentally measuring the critical concentration by determining change in plasmon wavelength in an AC-SINS assay. Standard buffer conditions for determining parameters such as solubility limit and critical concentration include PBS pH 7.4 at 4°C. Parameters may be measured immediately after freshly synthesised polypeptide is formulated into said aqueous buffered solution. Alternatively parameters may be measured after a period of storage, e.g., a storage time of 1 hour, 1 week, 2 weeks, 28 days or 6 months under the standard buffer conditions.

[0097] One may wish to determine parameters after exposure to higher temperature, in which case the temperature may be increased, e.g., to 25°C, 37°C or 50°C, for the duration of storage before returning the solution to 4 °C for measurement.Non-specific binding

[0098] Non-specific binding, "polyreactivity", "polyspecificity" or "low specificity" may refer to interaction of a binder with a plurality of non-target molecules in addition to its cognate target, e.g., the polypeptide may bind non-specifically to hydrophobic, negatively charged or positively charged surfaces. A polyreactive polypeptide may be described as showing "stickiness", reflecting its binding to non-target molecules though interactions of this type, in addition to the specific recognition between the binder polypeptide and its target. In many cases, non-specific binding manifests as a low affinity interaction, but it may nevertheless be problematic where the non-target molecule is abundant. Polyreactivity may be attributable to clustered hydrophobic or charged amino acid residues on the surface of the binder polypeptide - in the case of antibodies this may be on the heavy and / or light variable domain - leading to a class of non-specific interactions with other (non-target) molecules. For example, a polypeptide may exhibit binding to hydrophobic surfaces, which may occur if the polypeptide displays one or more hydrophobic patches on its surface or if hydrophobic patches are exposed through unfolding of the polypeptide in solution. Alternatively, a polypeptide may exhibit binding to negatively charged surfaces or molecules carrying a net negative charge (at neutral pH), such as the negatively charged backbone of DNA, or other negatively charged polymers such as heparin or heparan sulphate. Regardless of the underlying molecular motifs responsible for these non-specific interactions, polyreactivity is generally an undesirable feature for a candidate polypeptide drug. Polyreactivity of polypeptide drugs is linked with poor pharmacokinetics such as short half-life in vivo and / or poor tissue uptake of the drug from circulation.

[0099] In aspects of the present invention, cells expressing binders (e.g.. a library, or a sample of cells from a library) are exposed to one or more non-target molecules or "polyreactivity probes". This can be used to distinguish cellular clones within a population presenting a binder which interacts with said polyreactivity probe from those cellular clones with absent or lower binding to such probes. A polyreactivity probe may comprise any one or more of nucleic acid (e.g., DNA), streptavidin, heparin, heparan sulphate, chondroitin sulphate, carboxyl dextran, other sulphated proteoglycans, insulin, lipopolysaccharide, baculovirus, KLH, FcRn, laminin, collagen, trigger factor, Hsp70, Hsp90 or other heat shock protein or chaperone protein, hyaluronic acid or other glycocalyx component. The non-target molecule may be presented in isolated form or as a mixed preparation, e.g., membrane preparations from mammalian cells (e.g., CHO cells) can be used to test for polyreactivity. The non-target molecule may be one which is found in vivo, e.g., in mammals, e.g., in human. It may be found in the extracellular matrix or bloodstream, and / or on cell surfaces. Synthetic surrogates for the non-target molecules may also be prepared and used as polyreactivity probes.

[0100] The polyreactivity probe will be selected to screen for a particular mode of non-specific binding, e.g., to detect non-specific binding to negatively charged surfaces, one may select a polyreactivity probe carrying a net negative charge at neutral pH, such as heparin sulphate, DNA or streptavidin, and / or a molecule bearing an extended negatively charged surface region such as. FcRn. Suitable polyreactivity probes may be identified based on their calculated isoelectric point (pl). The pl is a measurement of protein charge and is defined as the pH at which the protein carries no net electrical charge. A polyreactivity probe with a pl of less than 6 may be chosen for detecting binders showing non-specific binding to negatively charged surfaces. Examples are known to the skilled person and include streptavidin, nucleic acid and sulphated proteoglycans such as heparin sulphate or carboxyl dextran. Conversely, to detect non-specific binding to positively charged surfaces one may select a polyreactivity probe having a positively charged surface region and / or a basic pl (e.g., pl greater than 8). Such a probe may also be used to detect binders having negatively charged surface patches which could result in undesirable electrostatic repulsion from negatively charged cell surfaces in vivo. To probe for polyreactivity through hydrophobic attraction one may select a polyreactivity probe having one or more hydrophobic regions on its surface, e.g., Hsp70 or Hsp90.

[0101] A number of methods are available to screen individual clones for low specificity. Cross-interaction chromatography (CIC) 47< is a method wherein a target molecule or mixture, often a polyclonal antibody preparation, is immobilised on a chromatographic matrix and the retention time of various antibodies measured. Delayed retention either through interaction with the immobilised molecule or the resin itself is an indication of low specificity. This approach has been used in a number of studies to characterise recombinant antibodies e.g. 2,15,38< . Size exclusion chromatography, as described above, may also be used to determine interaction of a binder with a matrix. In the present context it will be understood that the non-target molecule(s) of interest occupy the place of the "target" in these methods, being the molecular component against which interaction of the binder is being tested.

[0102] Interaction with alternative matrices or target molecules has also been used in characterisation of antibodies and other polypeptides. For example cells may be screened for their binding to abundant molecules present in the glycocalyx e.g. heparan sulphate proteoglycans (HSPGs) which are composed of a core protein with heparan sulphate (HS) glycosaminoglycan (GAG) chains attached. Given the large surface area and quantity of such molecules in the glycocalyx, this is a particularly appropriate class of molecules to test. Heparin affinity chromatography involves passing a sample over a matrix containing immobillised heparin 48< . Pre-prepared resins are available from a number of sources (Heparin Sepharose (Pharmacia), Bio-Gel Heparin (Bio-Rad, Vienna, Austria) Eupergit Heparin (Riihm Pharma, Weiterstadt, Germany) and Toyopearl Heparin 650 M (TosoHaas, Stuttgart, Germany). Binding substances will be retained or delayed in their passage. Non-binding substances will pass through or be removed upon washing. Bound material is removed using altered buffer conditions, e.g., increasing salt concentrations. This method can be used for screening soluble antibodies and determining the extent to which they interact with heparin. Hydrophobic interaction chromatography could also be used to characterise antibodies by their tendency to interact with hydrophobic matrices 49,50< . Where the one or more non-target molecules are presented on a matrix, binding of binders to the matrix may be manifested as increased binding of cells to the matrix, e.g., retardation of cells passing over the matrix, or binding to beads (e.g., magnetic beads) coated with the non-target molecule(s). Binders that show greater binding to the one or more non-target molecules may thus be separated by removing (discarding, or not selecting) a fraction of cells showing greater binding, whereas those cells showing less binding may be recovered and optionally selected for use in further steps.

[0103] As discussed above comparator polypeptides and control polypeptides can be used to confirm improvement arising from the present invention. Improvement may be determined by identifying a concentration at which non-specific interactions are apparent, the concentration optionally being defined under standard conditions. Alternatively the extent of non-specific interaction may be determined at a fixed concentration. Methods of assaying non-specific binding may generate a "stickiness measure" for the binder, providing a quantitative measure of non-specific binding that may be compared against other binders. Thus the "stickiness measure" for any given assay will be the difference between the value for the test polypeptide compared to a control polypeptide known to have very low non-specific interactions. For example the approved antibody adalimumab 2,38< or the antibody NIST RM 8671 have minimal self-interactions or association with other polyclonal IgG molecules as estimated by self-interaction chromatography (SIC) and cross-interaction chromatography (CIC) methods. (Saro D et al, Developability Assessment of a proposed NIST monoclonal antibody 37< ). An approved polypeptide according to the present invention is one where an improvement in "stickiness measure" is observed compared to a comparator clone. A comparator clone may be the starting clone which is being improved or may be a clone which is deselected by the use of the invention.

[0104] A number of methods including these chromatographic methods are typically used to characterise individual antibodies and generate a "stickiness measure". Chromatography matrices can be used to separate cells on the basis of their interaction with immobilised molecules. For example lectins immobilised onto cyanogen bromide activated sepharose has been used to separate T cell populations 51< . Such a system could be modified to separate antibody-expressing cells based on their interaction with immobilised target such as polyclonal antibodies, heparin sulphate or other test molecules. Where there is interaction with the immobilised target or support matrix, cells bearing such antibodies would be retained or delayed relative to non-interacting cells. Loading or washing buffers could be modified to achieve the desired stringency when used for separating cells displaying antibodies with differing binding tendencies.

[0105] It is also possible to use non-chromatographic methods to identify and quantitate low specificity within individual antibodies. For example Hotzel et al (2012) use binding of antibodies to baculoviral particles in ELISA to identify antibodies which exhibit non-specific interactions 16< . In a similar way other test molecules (eg heparin sulphate) could be immobilised or presented on beads to test for interactions with individual antibodies. Non-chromatographic methods such as these could be adapted to identify clones which exhibit low specificity from libraries displayed on higher eukaryotes.

[0106] Mixtures of detergent solubilised membrane proteins have been prepared, biotinylated and used to identify clones within yeast libraries displaying antibodies with low specificity 19< . The presences of detergent may be tolerated using yeast libraries but are unlikely to be suitable for display systems based on higher eukaryotes such as mammalian cells. Test molecules or mixtures used to identify low specificity interactions could be labelled with fluorophores or molecules such as biotin which facilitate labelling or recovery of the molecule and its complexes on streptavidin coated surfaces. For example molecules such as fluorophore labelled chondroitin sulphate or heparin sulphate (eg from AMS Cat No. AMS.CSR.FACS-A1, C1 or D1 or E1 or AMS.CSR.FAHS-P1) could be used to separate clones in flow sorting according to the extent of interaction with the labelled test molecules. High avidity expression of polypeptides on the cell surface add to the sensitivity of the approach, particularly if a multivalent target molecule is used. Clones within a library could be separated by flow cytometry based on the binding of fluorescent molecules. These test molecules could be used in conjunction with other labelled molecules to select in advance, simultaneously or subsequently for other desirable properties such as binding to target, or other binding / avoidance of other molecules of interest such as Fc receptors. Other methods include AC-SINS as mentioned above. In this technique, test binders are presented on a cell surface and their potential for interactions with one or more non-target components presented on other cells or on beads is assessed 39< . The reduction in inter-particle distance ensuing from interaction can be detected as an increase in plasmon wavelength of gold colloidal solutions.

[0107] Cells expressing binders may be exposed to the one or more non-target molecules wherein a mixture of clones (e.g., a library, or sample therefrom) are together in one vessel - this is convenient with methods such as FACS for example, or with chromatographic techniques. In other cases the cells expressing binders may be exposed to the one or more non-target molecules in separate vessels, e.g., one clone per vessel, and the resulting interactions or binding levels can then be individually measured and compared - this may be more convenient with methods that measure interparticle distance, such as AC-SINS, or when relatively small numbers of binder-expressing clones are being compared.

[0108] Thus a fluorescently labelled polyreactivity probe can be mixed with a population of cells and detection or separation methods used to distinguish cellular clones which express polyreactive binders (as identified by binding to the polyreactivity probe), from binder-expressing clones which do not. Cellular clones which fail to bind the labelled probe can be separated by flow sorting, magnetic bead separation and other separation methods to achieve enrichment over clones expressing polyreactive antibodies. Example 6 demonstrates that it is not only possible to achieve sufficient discrimination between polyreactive clones and non-polyreactive clones within a population, but that this can be performed using straightforward practical steps that allow their separation.Identifying developable variants of candidate drugs

[0109] While the invention may be used at all stages of drug discovery, including early stage selection of binders (e.g from naive libraries or selected populations derived from immunisation or other display approaches), and later on for comparing qualities of a short-listed panel of candidate molecules, it also finds use in situations where a binder of interest has already been identified but is then discovered to require improvement in one or more developability characteristics. Binders identified from any source may be found to exhibit less than ideal developability characteristics, and in such cases it may be preferable to refine the sequence of the existing molecule rather than to begin again from scratch with a new drug discovery program to find an alternative molecule.

[0110] Methods of the invention may be used to identify variants of a binder, wherein the binder has been identified as requiring improvement in one or more developability characteristics (e.g., self-association, solubility, non-specific binding, and / or others as discussed), and wherein invention is used to predict whether or not one or more variants will exhibit improved developability. The selection methods of the invention may thus be performed on populations of cells that display variants of a "parent" binder. While these may be referred to as a library, and will in some cases display a large and diverse population of variant binders, the number of clones for comparison in some cases may be relatively small, e.g., up to 10. Methods of the invention may thus comprise providing a library or plurality of clones wherein binders are presented on the cell surface, wherein the clones are produced by generated variant sequences of a parent binder sequence and introducing DNA encoding the variants into cells so that the DNA is integrated into the cellular DNA. Suitable methods and techniques are detailed in other sections of this document.

[0111] The "parent" binder, from which the variants are generated, may be one that has been identified as requiring improvement due to poor performance in on or more developability assays. Alternatively it may simply be desired to investigate whether its developability is improvable through sequence variation. Various aspects of developability are discussed herein and a parent molecule may be identified as requiring improvement in any of these. The parent molecule may be found to have a solubility limit (maximum solubility) of less than 50 mg / ml, less than 20 mg / ml, less than 10 mg / ml, less than 5 mg / ml or less than 1 mg / ml for example. The parent molecule may be found to have a critical concentration of less than 50 mg / ml, less than 20 mg / ml, less than 10 mg / ml, less than 5 mg / ml or less than 1 mg / ml for example. The parent may exhibit undesirable aggregation in solution and / or may be unable to be concentrated above 1 mg / ml in solution without aggregating and / or precipitating. The parent may show non-specific binding to one or more non-target molecules. The parent may be identified as requiring improvement in binding to and / or dissociating from FcRn.

[0112] Optionally, bioinformatics assessment of the parent polypeptide sequence is performed to identify potential features of the sequence where mutation is predicted to reduce the identified developability issues and thus improve performance. Thus, one or more amino acid positions may be identified that are predicted to be associated with developability (e.g., solubility, self-association, non-specific binding).

[0113] Such bioinformatics assessment can be used to inform the mutation strategy. Thus, variants of the parent polypeptide sequence can be generated, optionally including mutation of the one or more amino acid positions identified in the bioinformatics assessment. Mutation may thus be performed at one or more amino acid residues of the polypeptide sequence of the parent binder that are predicted to promote self-association, aggregation and / or non-specific binding, and / or to reduce solubility. Mutation generates DNA encoding one or more variants of the parent sequence, which may be introduced into higher eukaryotic cells to generate a population of cells encoding the variant binders (methods for which are described herein). Cells may be cultured under conditions for expression of the binders, wherein the binders are presented on the cell surface. A plurality of cells expressing the binders may be used as a library as described herein and selections may be performed to identify clones having higher surface presentation of binders, as an indicator of improved developability characteristics.

[0114] In various examples as described herein, sequence analysis is used to identify potential problematic residues. Alternatively, random sequence variation can be used. Methods of generating variants and derivative libraries are described elsewhere herein. Individual variants can be produced and assessed for improved biophysical characteristics. The ability to create large libraries of many such variants and select directly for improved characteristics such as resistance to self-aggregation would greatly facilitate the discovery of antibodies and other binders with optimal solubility properties. Since changes that benefit solubility can simultaneously diminish target binding, particularly if paratopic residues are involved 14< , methods of the invention may combine selection for developability with selection for retained target binding. Such selections are optionally performed simultaneously, and methods for simultaneously or sequentially screening for affinity and solubility are described.

[0115] Methods of the invention comprising selection based on the level of surface presentation of binders may be used to identify variants having improved solution properties, as discussed. For example, a method of improving the developability characteristics of a "parent" binder (e.g., antibody) may comprise introducing mutations in the amino acid sequence of the binder to generate variants, introducing DNA encoding the variants into eukaryotic (e.g., mammalian) cells to provide a plurality of cell clones each containing DNA encoding a derivative antibody, introducing DNA encoding the parent binder into eukaryotic (e.g., mammalian) cells to provide a cell clone containing DNA encoding the parent, culturing the clones in vitro under conditions for presentation of the binders on the cell surface, determining surface presentation levels of the binders on the plurality of clones, selecting one or more clones that exhibit higher surface presentation of a derivative antibody compared with the clone expressing the parent, and identifying one or more variant binders encoded by the one or more selected clones as having improved developability characteristics compared with the parent antibody.

[0116] There is a relationship between propensity for self-interaction and propensity for non-target interaction. It has been found that a small number of amino acid changes (1-3) can have a beneficial effect on both aspects 6,7,14< . In other cases there may be limited self-interaction with evidence of low specificity. In either case, methods of the invention comprising selection for binders that exhibit lower non-specific binding may also be used. Thus, as discussed elsewhere herein, the system may be used to identify undesired non-specific interactions with other molecules, also referred to as "low specificity " and "polyspecificity". The present invention has the benefit of conducting such screening in the context of expression on higher eukaryotic cells, such as mammalian cells, with modifications such as glycosylation that more closely reflects that found in production cell lines typically used for production of the product used in the clinic. High presentation levels of the polypeptide on the cell will increase the avidity of any interaction thereby serving to increase the sensitivity of the system in detecting low affinity undesired interactions. Furthermore, the surface of the higher eukaryote itself (or the environment of the endoplasmic reticulum and Golgi apparatus) can act as a matrix where the binder may be exposed, at relatively high concentrations, to a diversity of polypeptides allowing a binder with low specificity to interact with non-target molecules on the same or neighbouring cells. This in turn will lead to lower presentation levels. This may also lead to aggregation of the presenting cell with other cells in the population. The resulting cellular aggregates can be removed (e.g. by filtration or sedimentation) leading to depletion of such clones from the population. Removal of aggregated cells could also be used to reduce the representation of self-interacting clones.

[0117] In a further application, a host cell expressing unwanted targets from endogenous or exogenous genes could be used to deplete cross-reactive clones. For example endothelial cells expressing components of the glycocalyx or mammalian cells transfected with a gene of interest. Clones which bind to the target may be depleted based on low surface expression or cellular aggregation.

[0118] The value of the biophysical measurement at a single concentration of polypeptide may be compared between the starting clone and an improved clone generated using the invention. Alternatively the concentration at which a unwanted biophysical parameter is measured may be compared. Methods may comprise selecting variants exhibiting improvement in one or more desired developability characteristics, e.g., greater solubility, lower propensity for self-association in solution, lower non-specific binding to non-target molecules, higher critical concentration, etc.. A fold difference or % difference may be measurable and example values are provided elsewhere herein. Comparison will usually be made to the parent binder. However, comparison between a variant polypeptide from a clone selected by the present invention and a comparator polypeptide deselected by the present invention could also be used to confirm and quantitate improvement when the present invention is used to select for other biophysical properties described herein.Methods of generating variants and derivative libraries

[0119] Following any selection method described herein, DNA encoding displayed binders can be recovered from one or more selected cells, optionally mutated to generate variants, and / or sub-cloned e.g., to allow additional rounds of selection within a second display system. This could be another eukaryotic display system that results in a different level of surface presentation or could be an entirely different display system such as phage display. The second system may use secreted expression and / or may allow direct functional selection as previously described - see refs 52-54< and WO2015 / 166272. Alternatively the input DNA encoding binders could be a population of binders from an unselected library or a population derived from immunisation or another display technology such as yeast or phage display.

[0120] Accordingly, following production of a library, one or more library clones may be selected and used to produce a further, second generation library. When a library has been generated by introducing DNA into eukaryotic cells as described herein, the library may be cultured to express the binders, and one or more clones expressing binders of interest may be recovered, for example by selecting binders against a target as described elsewhere herein. These clones may subsequently be used to generate a derivative library containing DNA encoding a second repertoire of binders.

[0121] In other instances it is desirable to generate variants of a parent binder, in order to provide a plurality of variants from which to select variants exhibiting improved developability characteristics.

[0122] To generate the derivative library, donor DNA of the one or more recovered clones is mutated to provide the second repertoire of binders. Similarly, to generate variants, DNA encoding the parent binder is mutated. Mutations may be addition, substitution or deletion of one or more nucleotides. Mutation will change the sequence of the encoded binder by addition, substitution or deletion of one or more amino acids. Mutation may be focussed on one or more regions, such as one or more CDRs of an antibody molecule, providing a repertoire of binders of a common structural class which differ in one or more regions of diversity, as described elsewhere herein.

[0123] In general, manipulation and / or modification of nucleic acid sequences may be undertaken at the DNA or RNA level. Reference to DNA herein may thus be generalised to include equivalent other nucleic acid (e.g., RNA), unless the context requires otherwise. Provision, isolation or mutation of binder-encoding RNA is thus an alternative to the provision, isolation or mutation of binder encoding DNA. RNA is optionally used to generate cDNA.

[0124] Generating a derivative library may comprise isolating nucleic acid encoding the binder (e.g., isolating donor DNA, or its encoded RNA) from the one or more recovered clones, introducing mutation into the nucleic acid (e.g., DNA) to provide a derivative population of donor DNA molecules encoding a second repertoire of binders, and introducing the derivative population of donor DNA molecules into cells to create a derivative library of cells containing DNA encoding the second repertoire of binders.

[0125] Isolation of the binder-encoding nucleic acid (e.g., the donor DNA) may involve obtaining and / or identifying the DNA or RNA from the clone. Such methods may encompass amplifying the DNA encoding a binder from a recovered clone, e.g., by PCR and introducing mutations. DNA may be sequenced and mutated DNA synthesised.

[0126] Mutation may alternatively be introduced into the donor DNA in the one or more recovered clones by inducing mutation of the DNA within the clones. The derivative library may thus be created from one or more clones without requiring isolation of the DNA, e.g., through endogenous mutation in avian DT40 cells. Alternatively the gene encoding the binder may be present within the genome and mutagenesis carried out by introduction of oligonucleotides with short homology arms. It has been shown that transfection efficiencies of up to 45% have been achieved using single stranded oligonucleotides of 80 bp to repair a defective GFP gene (Igoucheva, O., Alexeev, V., Yoon, K., 2001. Targeted gene correction by small single-stranded oligonucleotides in mammalian cells. Gene Ther. 8 (5), 391-399 55< , Liang, et al (2017). Enhanced CRISPR / Cas9-mediated precise genome editing by improved design and delivery of gRNA, Cas9 nuclease, and donor DNA. J. Biotechnology, 241, 136-146 56< ).

[0127] Antibody display lends itself especially well to the creation of derivative libraries. Once antibody genes are isolated, it is possible to use a variety of mutagenesis approaches (e.g., error prone PCR, oligonucleotide-directed mutagenesis, chain shuffling) to create display libraries of related clones from which improved variants can be selected. For example, with chain-shuffling the DNA encoding the population of selected VH clone, oligoclonal mix or population can be sub-cloned into a vector encoding a suitable antibody format and encoding a suitably formatted repertoire of VL chains 57< . Alternatively and again using the example of VHs, the VH clone, oligomix or population could be introduced into a population of eukaryotic cells which encode and express a population of appropriately formatted light chain partners (e.g., a VL-CL chain for association with an IgG or Fab formatted heavy chain). The VH population could arise from any of the sources discussed above including B cells of immunised animals or scFv genes from selected phage populations. In the latter example cloning of selected VHs into a repertoire of light chains could combine chain shuffling and re-formatting (e.g., into IgG format) in one step.Cell surface presentation of binders

[0128] Retention of binders at the cell surface is a feature of display libraries as it provides a physical association between the binder and the encoding DNA, facilitating retrieval of the DNA following physical isolation of cells expressing binders with desired properties. Surface presentation (or simply "presentation") of binders may also be referred to as display or surface expression of binders. The level of surface presentation of a binder reflects its expression level and its retained presentation level following extended exposure to high concentrations on the surface of the cell. In methods described herein, the relative level of surface presentation of binders is compared across clones expressing different binders and is used to identify binders that have a lower propensity for self-association, greater solubility and that can be formulated into aqueous buffered solutions at concentrations suitable for pharmaceutical use. Thus presentation level can be used to select clones with desired properties. Surface presentation of binders on display libraries thus represents an in-built feature that can be used for selection of developability characteristics.

[0129] Various means of immobilisation at the cell surface can be employed. According to the invention, binders comprise or are linked to a membrane anchor which is a transmembrane domain, for extracellular display of the binder. This may involve direct fusion of the binder to a membrane localisation signal such as a GPI recognition sequence or to a transmembrane domain such as the transmembrane domain of the PDGF receptor. 58<

[0130] Other methods of achieving retention of binder on the cell surface, useful for understanding the invention, include indirect association of a binder with another cell surface retained molecule expressed within the same cell. This associated molecule could itself be part of a heterodimeric binder, such as tethered antibody heavy chain in association with a light chain partner that is not directly tethered. WO2015 / 166272 describes a variety of techniques for retaining expressed binders on their host cells, including methods useful for understanding the invention that allow a combination of secreted expression and membrane display. Thus, a proportion of the expressed binder may be retained at the cell surface while other copies of the same binder are secreted in soluble form from the same cell. Cells may retain a majority of binder (e.g., 80 % or more, or 90 % or more) presented on the cell surface, with the minority being secreted into the culture medium. Optionally, the binder is only retained at the cell surface and is not secreted in soluble form.

[0131] As illustrated in Example 1, the heavy chain of an antibody may be fused to the PDGFR TM domain and expressed together with its cognate light chain for surface presentation of full length immunoglobulins, e.g., IgG. The gene encoding the binder or polypeptide subunit thereof (e.g., antibody heavy chain) within the cell may comprise DNA encoding a leader sequence for secretion, via the endoplasmic reticulum (ER), to the cell surface. The binder-encoding gene comprises DNA encoding a membrane anchor such as a transmembrane domain, e.g., a TM domain of a mammalian (e.g., human) protein. Alternatively, in aspects useful for understanding the invention, it may comprise DNA encoding an attachment signal for a post-translational membrane anchor such as a glycosylphosphatidylinositol (GPI) anchor. The C-terminal region of polypeptide binders is usually chosen for membrane anchor attachment or fusion of TM domains.

[0132] Methods of influencing the level of cell surface expression include controlling the level at which the binder is expressed from its encoding DNA, e.g., using promoters, and methods for this are described elsewhere herein. Surface expression level can alternatively be controlled by influencing the extent to which DNA encoding an expressed binder is spliced to an exon encoding a transmembrane domain, for instance as described in WO2015128509 (Glenmark Pharmaceuticals). This approach is also exemplified herein - see Example 8a and Example 8b, which describe expression systems that may be usefully employed in methods of the invention where varying levels of surface presentation of binders is desired.

[0133] In embodiments of the invention, binders are expressed in the cell and transported to the plasma membrane where they are retained at the cell surface as membrane proteins, e.g., a binder may comprise one or more polypeptides having at least one transmembrane domain. For example, where the polypeptide binder comprises an antibody heavy chain (or part thereof) and an antibody light chain (or part thereof), and comprises a transmembrane domain linked to the heavy and / or light chain, the binder is synthesised within the ER and budded off into the Golgi apparatus, from where it is transported to the cell surface in an intracellular vesicle which fuses with the plasma membrane, whereupon the binder is retained by virtue of its transmembrane domain and is presented extracellularly. Integration of the binder into the membrane thus occurs within the cell, prior to transportation to the cell surface. Where applicable, assembly of multi-subunit binders (e.g., antibodies comprising separate heavy and light chains, or parts thereof) would also typically occur within the cell.

[0134] The level of cell surface presentation is measured in terms of copy number (number of displayed binders per cell). A number of methods are available, including comparison to calibration beads and Scatchard plots of ligand concentration and receptor occupancy 59-61< . With the knowledge of the cell radius and certain assumptions about the available volume or surface area this can be used to estimate concentration or density respectively (Example 3). At the level of generality with which the present invention is concerned, copy number is related to the concentration achieved with higher concentrations found as the presentation level increases. The relationship between copy number and concentration on the cell surface is also affected by cell size. Presentation of the same number of binders on a small cell and a large cell will give rise to different concentrations since the antibodies will occupy a greater volume on the bigger cell (see example 3 comparing cell size and concentration achieved).

[0135] A great number of recombinant expression systems are available and the absolute number of displayed binders on the cell surface will vary between different systems. The skilled person will be able to calibrate methods of the invention as appropriate for the range of presentation levels observed when using different cells (e.g., of different sizes), different promoters, different induction mechanisms, different splicing mechanisms, transport efficiencies, etc.. The following guidance is however provided by way of example.

[0136] With a weakly active promoter, binders may be presented on the cell surface at a copy number in the range of 100 - 100,000 per cell. The number of binders per cell may be at least 100, at least 1,000 or at least 10,000. The number of binders per cell may be up to 1,000, up to 10,000 or up to 100,000. In preferred embodiments, copy number is about 80,000 or less, about 60,000 per cell or less, about 50,000 per cell or less, or about 40,000 per cell or less. To facilitate detection, copy number may be at least 100, at least 1,000, or at least 10,000 per cell. Copy number may thus for example be in the range of 1,000 - 60,000 per cell. It may be about 10,000, about 50,000 or about 60,000.

[0137] With a strongly active promoter, binders may be presented on the cell surface at a copy number in the range of 100,000 - 10,000,000 per cell. The number of binders per cell may be at least 100,000 or at least 1,000,000. The number of binders per cell may be up to 1,000,000 or up to 10,000,000. It may be about 1,000,000.

[0138] Of course, there will be variation in the exact number of binders on different cells even for a single clone, although such variation in copy number between cells of a clone is minor compared with the inter-clonal copy number variation which is exploited by the selection and enrichment methods described herein. The example numbers and ranges represent approximate averages (means). The copy number may be the average (mean) copy number for cells in a population. Lower copy numbers are preferred when selecting for affinity, in order to increase the stringency of binding and enrich for high affinity clones, whereas higher copy numbers are preferred when selecting for developability, e.g., solution properties of the binders.

[0139] Copy number within a library of binder-expressing cells may range from relatively low (e.g., 10,000, 50,000, 100,000 or 250,000 copies per cell) to relatively high (e.g., 1,000,000 copies per cell). Copy numbers cited herein are a guide only, and are based on copy numbers observed in libraries of HEK cells in suspension culture, which have a radius in the order of 10 µm. A polypeptide presented at a given density on the surface of a large cell will be at higher copy number than when presented at the same density on a small cell, so the absolute copy number observed in libraries generated from larger or smaller cells may vary accordingly. See Example 3b.

[0140] When conducting the methods of the invention, one will usually be interested in relative presentation levels as compared between clones, in which case it is not the absolute number of binders (absolute copy number per cell) that matters but rather the ability to rank or distinguish clones according to the different levels at which binders are displayed at the cell surface.

[0141] Surface presentation levels can be determined for a representative sample of clones from a library, and used to estimate the average (mode, mean or median) and spread (range) of surface presentation level present in clones of the library.

[0142] The way to measure relative differences in binder presentation between cells is to expose the cells to an agent carrying a detectable (e.g., fluorescent) label, allow binding of the agent to the binders, and detect the relative quantities of label on cells, wherein a stronger signal from the detectable label (e.g., more fluorescence units) indicates a higher presentation level of binder on the cell. When the detectable label is fluorescent, sorting may be performed using a fluorescence activated cell sorter (FACS). Alternatively, or additionally with FACS, selection with magnetic beads can be used.

[0143] One will generally select an agent that binds to a constant region of the binders so that all binders can be equally labelled independent of their sequence. With antibodies and other binders that comprise an Fc region, it is convenient to label with an agent that binds the Fc region. For example, where the binders are IgG antibodies, cells may be contacted with a detectable agent that binds to the IgG Fc region, e.g., a labelled anti-IgG antibody. Adaptations of the method can be made where appropriate, e.g., where a library comprises binders that vary in the sequence of their Fc regions, an agent that binds a non-diverse part of the Fc or other region of the binder molecule can be employed. Peptide expression tags (e.g., hemagglutinin (HA), c-Myc) may be incorporated into a binder polypeptide (e.g., incorporated into an antibody scaffold), making it possible to detect displayed binders by detecting an agent bound to the tag. This has been described previously in the context of selecting correctly assembled antibodies in order to normalise the antigen-binding signal based on the antibody expression level 24,62< . Agents for detection of surface presentation level of binders may be used alone, i.e., without co-detection of or co-selection for other features such as antigen-binding or target specificity. Thus, in some embodiments, the step of detecting binder presentation level using an agent that binds a constant region of the binders does not include detecting binders using labelled target. In other embodiments, multiparametric selections may be performed. A wide range of surface presentation levels may be exhibited by binder-expressing clones of a library, reflecting a high level of inter-clonal variation. Surface presentation level can be plotted against the frequency with which that presentation level was observed, for a representative sample of cells from the library, e.g., following detection by FACS. Some embodiments of this are described in Example 10 with reference to and illustrated in Figure 31. The median surface presentation level or the modal surface presentation level detected for the sample, and the spread of presentation levels and their deviation from the median or mode can be observed and / or calculated. Modal surface presentation can conveniently be visualised as the highest peak in a plot of surface presentation level against cell count.

[0144] The spread of surface presentation levels observed in a population of clones may be represented by the degree of variance from the modal value (mode). A population of clones may show wide variation in the level of surface presentation between clones, especially where the binders exhibit a large degree of variation in structure (e.g., different primary sequences), so that some clones display binders at much higher density than others. In some populations of clones the inter-clonal variation in the level of surface presentation may be lower, but nevertheless the present methods may be used to set a threshold presentation level and to distinguish higher presenting clones from lower presenting clones. One statistical measure of spread is the interquartile range, which is the difference between the upper quartile (75 th< percentile) and lower quartile (25th percentile). The copy number at the 75 th< percentile (represented as the lower boundary of the upper quartile) may differ from that at the 25 th< percentile (represented by the upper boundary of the lower quartile) by at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 4.5-fold or at least 5 fold.

[0145] In some embodiments, the range of surface presentation levels, and the fold-difference in surface presentation between the reference points mentioned above, may be observed to decrease with each round of selection for surface presentation level, as the population of cells is progressively enriched for clones with high surface presentation of binders. In some embodiments, the mode may be observed to progressively increase with each enrichment for higher surface presentation. Following selection, methods of determining or observing increase in surface presentation level in a population of binders may comprise determining or observing an increase in the average (e.g., median or modal) copy number as measured e.g., by FACS or similar method described herein. A selected population (or a clone thereof) may be observed to have an average surface presentation level that is higher than that of the unselected population or of a clone expressing a comparator polypeptide, e.g., than that of a clone expressing the parental binder from which the population was derived. For example the modal or median copy number for the selected clone or selected population may be at least 5%, at least 10%, at least 20% or at least 25% higher than that of the comparator or parent - and that clone may be selected on the basis of that improvement in surface presentation level.

[0146] To select clones expressing higher surface presentation of binders, or to select a population of clones enriched for clones encoding binders exhibiting higher surface presentation, cells can be sorted into a collected fraction and a discarded fraction according to the level of surface presentation of binders on the cells. Cells having surface presentation above a pre-determined threshold are sorted into the collected fraction and cells having surface presentation below the pre-determined threshold are sorted into the discarded fraction. Surface presentation is optionally the sole basis on which the selection / enrichment is performed during this step. This can be facilitated by using a detectable agent that labels all binders, optionally in the absence of detecting target recognition by the binders.

[0147] By discarding a fraction of cells exhibiting the lower surface presentation of binders, clones expressing binders having poor developability characteristics are depleted from the population. Selection of all or a fraction of the remaining cells provides a selected population of cells enriched for clones expressing binders having higher surface presentation of binders compared with other clones. The selected cells, clones or population can thus be identified as having better developability characteristics compared with the starting population or library and compared with the non-selected cells, clones or population.

[0148] As noted above, the absolute number of binders on a cell surface will vary, and the skilled person will determine the threshold suitable for the system in use. For example, the threshold may be pre-determined to select a particular percentage of clones within the population expressing the highest surface presentation of binders, e.g., based on an initial test sample of the library. The threshold may be set to select e.g., the top 50 % of cells, the top 30 %, top 25 %, top 20 %, top 15 %, top 10 % or top 5%.

[0149] Having determined surface presentation levels for a representative sample of cells from a library, and having observed or calculated the mode, median, spread and / or interquartile range of copy number for the sample, an appropriate threshold copy number can be set. For use of FACS, this will correspond to threshold fluorescence intensity per cell, e.g., if the FACS threshold for collection of cells is set to collect cells of the library having a median fluorescence intensity corresponding to the mode of the sample, then cells having that level of fluorescence or above will be collected. For even greater enrichment of surface presentation levels, the FACS threshold for collection of cells may be set to collect cells of the library having a fluorescence intensity corresponding to that of the 75 th< percentile of cells in the sample.

[0150] The threshold may represent a number of binders presented per cell of at least about 100,000, at least about 500,000 or at least about 1,000,000.Selection and enrichment

[0151] Selecting clones, selecting cells or selecting a population may comprise physically separating the clones, cells or population from other clones or cells or from a wider population or library. The selected clones, cells or population may be provided in isolated form.

[0152] Where selection comprises physical separation of multiple cells or clones, this will typically comprise generating a collected fraction and a discarded fraction. The collected fraction will be enriched for clones displaying binders with characteristics that have been selected for in the method. Enrichment means that the relative abundance of these clones in the population is increased. Enrichment is relative to the pool of cells or clones before the selection step, e.g., the library or starting population. By discarding a fraction of cells during selection (e.g., cells exhibiting lower surface presentation of binders, cells with lower affinity, etc.) clones expressing binders having less desirable characteristics (e.g., poor developability characteristics) are excluded. Thus, the relative abundance of cells / binders with less desirable characteristics is reduced in the population as a result of the selection step. All or a fraction of the selected cells (collected fraction) may be taken forward into further selection methods if desired, and optionally one or more clones are selected for individual culture in isolation. Optionally one or more selected cells or binders or a selected population may be used for creation of a derivative library as described elsewhere herein.

[0153] In selecting a collected fraction of clones, the operator of the method may take a set percentage or fraction of the "top" or "best" clones. Embodiments of this principle have been discussed in detail with reference to selection for high surface presentation. It is to be understood that the same principles apply when selecting for other characteristics, such as binding to a target or non-target molecule. Thus, when selecting for clones expressing binders that recognise a target (e.g., affinity selections), the operator may select a set percentage or fraction of clones exhibiting the highest binding to target (e.g., as measured by quantity of detectable label bound to the clones in a method using labelled target). When selecting for clones expressing binders that show reduced (or absent) non-specific binding to a non-target molecule, the operator may select a set percentage or fraction of clones exhibiting the lowest binding to the non-target molecule (e.g., as measured by quantity of detectable label bound to the clones in a method using labelled non-target molecule, such as any of the various polyreactivity probes mentioned herein). In general, when selecting positively for "good" characteristics (e.g., surface presentation level, affinity for target), one will be selecting for clones exhibiting higher levels of that characteristic relative to other clones, whereas when selecting against "bad" characteristics (e.g., non-specific binding), one will be selecting clones exhibiting lower levels of that characteristic relative to other clones.

[0154] As discussed elsewhere herein, selection thresholds may be determined by the operator according to the situation in hand and may be guided by an initial assessment of a sample of the population (e.g., representative sample of clones from a library). The threshold may be set to enrich for clones with the highest level of signal, e.g., the top 50 % of cells, the top 30 %, top 25 %, top 20 %, top 15 %, top 10 % or top 5 % in the case of a desired characteristic (e.g., based on quantity of detectable label bound, representing level of surface presentation or level of target binding, or based on inter-particle distance as determined by AC-SINS, or based on monomeric proportion in solution). The selected top % of clones become the collected fraction while others are discarded. In selections against undesirable characteristics, e.g., based on quantity of detectable label bound to a polyreactivity probe, or extent of retardation on a matrix to detect non-specific binding, the threshold may be set to enrich for clones with the lowest level of signal, e.g., to select a percentage of clones (e.g., 50 %, 30 %, 25 %, 20 %, 15%, 10 % or 5 %) exhibiting the lowest quantity of detectable label bound, or the lowest degree of retardation on a matrix. The example % for collection are of course guidelines only, and numerical exactness is unimportant provided that the operator adheres to the principles of the method.Quantifying and measuring differences

[0155] Various methods of the invention involve comparing properties of binders and / or their encoding clones, e.g., for properties such as presentation level, binding, concentration (e.g., critical concentration), solubility limit, and so on. Methods may comprise identifying binders that are better as compared with other binders in a population (e.g., as compared with one or more others or as compared with the population average (mean)), and / or that are improved in one or more characteristics relative to a parent molecule from which they are derived. Comparison may also be made to a benchmark binder - - in the example of antibodies this may be the NIST RM 8671 antibody (Saro D et al, Developability Assessment of a proposed NIST monoclonal antibody 37< ). Desirable properties for selection and improvement are discussed elsewhere herein and include greater solubility, greater critical concentration, lower non-specific binding, and / or higher affinity for target. Relative terms such as "greater" or "lesser", "higher level" or "lower level", "better" or "poorer", "more" or "less" generally refer to differences observed in the relevant experimental context that allow binders or clones to be distinguished based on their properties. Differences may be statistically significant. Differences may optionally be quantified in % terms, e.g., a difference of at least 10 %, at least 25 %, or at least 50 %. Alternatively fold-difference can be considered, e.g., at least 1.5 x, at least 2 x, at least 3 x, at least 5 x, at least 10 x, at least 20 x or at least 100 x.Target binding

[0156] Binders may be selected for binding to a target molecule of interest, which may optionally be another polypeptide such as a receptor, enzyme and / or a disease-associated polypeptide such as a tumour-associated antigen. Other target molecule classes include nucleic acids, carbohydrates, lipids and small molecules. Exemplary binders and targets are detailed elsewhere herein. A classic example is a library of antibody molecules, which may be screened for binding to a target antigen of interest. Other examples include screening a library of TCRs against a target MHC:peptide complex or screening a library of MHC:peptide complexes against a target TCR.

[0157] Selecting for clones that encode binders that recognise a target (cognate binders) may comprise contacting a display library as described herein with the target, thereby exposing binders to the target, allowing recognition of the target by cognate binders (if present), and detecting whether the target is recognised by a cognate binder. One or more clones displaying cognate binders may then be selected.

[0158] The target may be provided in soluble form. The target may be labelled to facilitate detection, e.g., it may carry a fluorescent label or it may be biotinylated. Cells expressing a target-specific binder may be identified using a directly or indirectly labelled target molecule, where the binder captures the labelled molecule. For example, cells that are bound, via the binder:target interaction, to a fluorescently labelled target can be detected and sorted by flow cytometry to isolate the desired cells. Selections involving cytometry require target molecules which are directly fluorescently labelled or are labelled with molecules which can be detected with secondary reagents, e.g., biotinylated target can be added to cells and binding to the cell surface can be detected with fluorescently labelled streptavidin such as streptavidin-phycoerythrin. A further possibility is to immobilise the target molecule or secondary reagents which bind to the target on a solid surface, such as magnetic beads or agarose beads, to allow enrichment of cells which bind the target. For example cells that bind, via the binder: target interaction, to a biotinylated target can be isolated on a substrate coated with streptavidin, e.g., streptavidin-coated beads. Magnetic beads are convenient for capture of cells which have bound to biotinylated antigen, by magnetic recovery of the beads. The optimal target concentration may be pre-determined or may be determined empirically by using a range of concentrations and comparing to background controls.

[0159] Methods of selecting for binding to a target may comprise sorting cells into a collected fraction and a discarded fraction according to the level of bound target on the cells, whereby cells having bound target above a pre-determined threshold are sorted into the collected fraction and cells having bound target below the pre-determined threshold are sorted into the discarded fraction. The threshold may be set relative to negative control cells that do not display cognate binders. In FACS a negative control peak will typically be observed when sorting cells displaying cognate and non-cognate binders. The threshold may be set so that all cells displaying fluorescence at a level that is statistically significantly higher than the negative control are sorted into the collected fraction, or a higher threshold may be chosen to achieve greater confidence in selection of cognate binders and greater enrichment for clones displaying cognate binders. As already discussed with reference to determination of cell surface presentation of binders, calibration may be performed using a sample of cells to determine suitable threshold values. Enrichment of binders from non-binders can be achieved. Methods of enriching for higher affinity binders are further described elsewhere herein.

[0160] Selection against a target may be incorporated as an additional step before or following, or included within, other methods of the invention. Construction of a library of variants by mutagenesis of a starting domain to improve aspects of developability such as solubility or low specificity or optimal FcRn binding, may in some library members compromise binding to target (e.g. if mutagenesis of contact CDRs is carried out). For example, clones selected for binder presentation level may subsequently be selected against a target. Simultaneous determination of surface presentation level and target binding is also possible, using co-selection of clones displaying cognate binders at high surface presentation levels. Such methods may comprise the use of an agent incorporating a detectable label for determining binder presentation level as described elsewhere herein, and may further comprise exposing the binders to the target wherein the target is labelled with a second agent incorporating a second detectable label to enable detection of target binding. Where fluorescent labels are used, FACS may be used to sort the cells simultaneously for both binder presentation and target recognition. Labels may be chosen that fluoresce at different wavelengths to enable their different signals to be distinguished. Thus, methods of the present invention may comprise co-detection of binder presentation level and target binding level, using different detectable labels for each. In other embodiments, target binding is detected in the absence of determining binder presentation levels on the cells, e.g., the step of detecting binders using labelled target does not include detecting binder presentation level using an agent that binds a constant region of the binders.

[0161] Following detection of target recognition by a cognate binder, cells of a selected clone containing DNA encoding the cognate binder may be recovered. DNA encoding the binder may then be identified, amplified and / or provided in isolated form, thereby obtaining DNA encoding a binder that recognises the target.Multiple selections

[0162] The idea of performing multiple selections in parallel can be extended to co-sorting of cells based on any two or more characteristics described herein. In the discussion above, simultaneous co-selection of cells is performed by simultaneously determining surface presentation levels of the binders and levels of target binding by the binders, and co-selecting clones displaying cognate binders exhibiting higher surface presentation. Other methods of the invention can also be employed in parallel. Methods may comprise simultaneously determining any two or more of: (i) surface presentation levels (ii) levels of non-specific binding to non-target molecules (iii) levels of target binding, (iv) level of FcRn binding, and co-selecting clones accordingly. FACS enables parallel selection to be performed using multiple labels emitting fluorescence at different wavelengths.

[0163] Advantages and synergies may be obtained by performing multiple types of selections in series or in parallel, e.g., combining selection for solubility with selection against non-specific binding. Each selection that is applied to the population of clones in the library generates an evolutionary pressure in favour of variants that meet that selection criterion (e.g., high surface presentation level). Repeated selection for a single parameter may drive evolution towards this characteristic (e.g., high solubility) at the expense of other qualities (e.g., affinity for target binding) which are at risk of being depleted or lost 31< . This can occur for example when mutations that increase solubility also reduce affinity. Judicious combination of selection methods may steer the evolution of the population towards clones that express polypeptides with multiple desired characteristics, allowing the identification of polypeptides that perform optimally (or at least acceptably) across the full range of requirements demanded of the polypeptide drug.

[0164] Selection against non-specific binding may be performed before or after selection for increased surface presentation level. For example, one may perform a method of distinguishing or ranking binders according to their solubility and / or resistance to self-association in solution, and / or enriching for binders exhibiting greater solubility and / or greater resistance to self-association in solution, resulting in a selected a population of clones, and then screen the selected population for clones expressing binders that exhibit a low propensity to bind one or more non-target molecules, thereby identifying one or more clones that express binders which also have low non-specific binding.

[0165] In some embodiments, screening for non-specific binding can be integrated simultaneously with screening for surface presentation level. For example, dual exposure of cells to (i) an agent for binding all presented binders, carrying a detectable label (e.g., fluorescently labelled anti-Fc) and (ii) one or more non-target molecules (e.g., heparin or other molecule to which non-specific binding is to be avoided) carrying a different detectable label (e.g., of different fluorescent wavelength) can be performed. Dual staining of the clones allows clones to be distinguished on the basis of both surface presentation level and non-specific or off-target binding. Sorting thresholds may be set to collect cells exhibiting greater surface presentation levels and lower binding to the non-target molecule. This will eliminate, or at least reduce the prevalence of, antibodies with poor developability in selected clones.

[0166] Similarly, selection against binding to non-target molecules (e.g., heparin or other molecule to which non-specific binding is to be avoided) can be combined with selection for FcRn binding in methods described herein.

[0167] In some situations, selecting for one characteristic (e.g., selecting for high level of surface presentation) will enrich for binders that have multiple beneficial qualities, as a result of the inter-linking of certain aspects of developability. For instance, some clones may express polyreactive binders that interact with non-target molecules (e.g., proteoglycans) on the cell surface - e.g., they may bind non-specifically to heparin. In a higher eukaryotic cell display system, the binder-expressing cell clones themselves may express the same or similar non-target molecules (e.g., proteoglycans endogenous to the cell), a resulting effect being that a surface-displayed binder interacts non-specifically with one or more molecules on the cell on which it is displayed. This may lead to the binder being internalised within the cell, thus exhibiting a lower level of surface presentation, resulting in de-selection of its expressing clone. In such a case, selecting clones that display higher levels of surface presentation of binders will enrich or select in parallel for clones expressing binders that have better developability qualities on multiple fronts, e.g., being both more soluble and less prone to non-specific binding.

[0168] A different example of this is that by enriching for binders that have a lower propensity for self-aggregation, methods may promote selection of binders that will show a lower degree of immunogenicity in vivo, by excluding from selection those binders that would tend to form immunogenic aggregates if used in pharmaceutical formulations.

[0169] On top of this, as noted, further dimensions of parallel selection can be incorporated by including further labelled detection agents, e.g., labelled FcRn, labelled target, other labelled polyreactivity probe. The ready availability of a range of different labels (e.g., fluorophores of different wavelengths), and the ability of FACS machines to conduct multiplex detection and sorting, can assist the design of such parallel selections.Affinity selection

[0170] In selecting binders to a target it is often useful to be able to select binders based on affinity, allowing enrichment for clones expressing binders having a high affinity for target binding.

[0171] Affinity is commonly expressed as K D , the equilibrium dissociation constant. K D is the ratio of k(off) / k(on) for the interaction between a binder and its target (e.g., between the antibody and its antigen). The K D value relates to the concentration of binder and so the lower the K D value (lower concentration) the higher the affinity of the binder. A binder that specifically recognises its target, in the manner of an antibody recognising its antigen, may be referred to as a cognate binder. Recognition of a target by a cognate binder is desirably a high affinity interaction. K D of binder:target interaction may be less than 1 µM, preferably less than 10 nM.

[0172] Methods of the invention may comprise enriching populations of cells for those encoding (and presenting) higher affinity binders to a target. Stringency of selection can be enhanced by using eukaryotic cells on which binders are presented at relatively low copy number, to drive selection for affinity. Methods of selecting binders that bind to a target of interest may employ libraries of higher eukaryotic cell clones each containing DNA encoding a binder, wherein the binder is presented on the cell surface, wherein the encoded binder is expressed from a weakly active promoter and / or expressed on the cell surface at a relatively low copy number. This may be from expression driven from a weakly active promoter or as a result of transcript instability or non-optimal splicing, translation, transport to the surface, or retention on the cell surface.

[0173] The presentation of a dense suspension of higher eukaryotic cells (e.g. 10 7< / ml with a high level of surface presentation (e.g. 6 x 10 5< binding sites / cell presents a relatively high concentration of antibody (10 nM in this example). In that situation, even when a low concentration of antigen is used in an attempt to drive the stringency of a selection e.g. 0.1nM, the high concentration of antibody will drive association limiting the relative enrichment between high and low affinity clones (see Example 8a and Example 8b). An input concentration of binder of 1nM or less would be preferred. Even if cell density was lower, there is a potential problem of target rebinding in the presence of a high density of immobilised binder. This problem is particularly well recognised and documented in surface based affinity measurement such as surface plasmon resonance (BIAcore manual) and would have the effect of reducing differential binding between a high and a low affinity clone. Thus copy number may for example be in the range of 100 - 100,000 per cell. In preferred embodiments, copy number is about 60,000 per cell or less, optionally about 50,000 per cell or less, or about 40,000 per cell or less. To facilitate detection, copy number may be at least 100, at least 1,000, or at least 10,000 per cell. Copy number may thus for example be in the range of 1,000 - 60,000 per cell. Copy number and methods of determining copy number in the context of surface presentation of binders are discussed elsewhere herein.

[0174] The library is exposed to the target (e.g., by adding the target to a suspension of cells expressing binders of the library), contacting the binders with the target and thus allowing recognition of the target by cognate binders, if present. Cells displaying cognate binders become bound to the target. By using a limited concentration of target, higher affinity binders are preferentially bound by the target. Cells displaying binders that do not recognise the target or which recognise the target with lower affinity will not bind the target or will display fewer molecules of target per cell, compared with cells displaying higher affinity binders. Cells bound to the target can then be isolated, thereby selecting a population of cells that is enriched for cells displaying cognate binders.

[0175] The selection procedure can optionally be repeated using decreasing concentrations of target, to progressively increase stringency of selection and increase the degree of enrichment for higher affinity clones. Mutation may be introduced in binders of a selected population to generate variants, prior to further enrichment for high affinity binders. Generation of derivative libraries is described elsewhere herein.

[0176] The concentration of target used may be below the K D of interaction of the binders that are sought to be isolated by the method.

[0177] One or more clones having a desired affinity for the target can then be selected, and optionally the encoding DNA can then be recovered and the binder expressed from individually cultured recombinant cells, as described elsewhere herein.

[0178] To achieve the low level of surface presentation on cells, binder genes may be expressed at low level, for example operably linked to a weakly active promoter or as a result of transcript instability or non-optimal splicing, translation, transport to the surface, or retention on the cell surface. Inducible promoters and other controllable expression systems are described in detail elsewhere herein. See for instance Example 8a or Example 8b.Libraries

[0179] A collection of cell clones, each containing recombinant DNA encoding a binder, together form a library. Diversity of the library is a function of the number of different binders encoded by the clones. In drug discovery it is advantageous to provide large, diverse libraries to maximise the potential for identifying a binder that meets all desired criteria. Each clone of a library may be generated by integrating DNA encoding a binder into cellular DNA to form a recombinant cell, as described elsewhere herein. DNA may be introduced into many cells in parallel to generate a population of recombinant cells, each encoding at least one binder from a diverse repertoire. Following integration of donor DNA into the cellular DNA, the resulting recombinant cells are cultured to allow their replication, generating a clone of cells from each initially-produced recombinant cell. Each clone is thus derived from one original cell into which donor DNA was integrated (e.g., at an integration site created by a site-specific nuclease or by other methods as described herein). A library in the context of the present invention may contain at least 100, 10 3< , 10 4< , 10 5< , 10 8< , 10 7< , 10 8< , 10 9< or 10 10< clones.

[0180] A library in the context of the present invention may have any one or more of the following features: Diversity. A library may encode and / or express at least 100, 10 3< , 10 4< , 10 5< 10 6< , 10 7< , 10 8< or 10 9< different binders. Binders of varying sequence make up the repertoire.

[0181] Uniform integration. A library may consist of clones containing donor DNA integrated at a fixed locus, or at a limited number of fixed loci in the cellular DNA. Each clone in the library therefore preferably contains donor DNA at the fixed locus or at least one of the fixed loci. Preferably clones contain donor DNA integrated at one or two fixed loci in the cellular DNA. As explained elsewhere herein, the integration site can be at a recognition sequence for a site-specific nuclease. Integration of donor DNA to produce recombinant DNA is described in detail elsewhere herein and can generate different results depending on the number of integration sites. Where there is a single potential integration site in cells used to generate the library, the library will be a library of clones containing donor DNA integrated at the single fixed locus. All clones of the library therefore contain the binder genes at the same position in the cellular DNA. Alternatively where there are multiple potential integration sites, the library may be a library of clones containing donor DNA integrated at multiple and / or different fixed loci. Preferably, each clone of a library contains donor DNA integrated at a first and / or a second fixed locus. For example a library may comprise clones in which donor DNA is integrated at a first fixed locus, clones in which donor DNA is integrated at a second fixed locus, and clones in which donor DNA is integrated at both the first and second fixed loci. In preferred embodiments there are only one or two fixed loci in the clones in a library, although it is possible to integrate donor DNA at multiple loci if desired for particular applications. Therefore in some libraries each clone may contain donor DNA integrated at any one or more of several fixed loci, e.g., three, four, five or six fixed loci.

[0182] For libraries containing binder subunits integrated at separate sites, clones of the library may contain DNA encoding a first binder subunit integrated at a first fixed locus and DNA encoding a second binder subunit integrated at a second fixed locus, wherein the clones express multimeric binders comprising the first and second subunits.

[0183] Uniform transcription. Relative levels of transcription of the binders between different clones of the library is kept within controlled limits due to donor DNA being integrated at a controlled number of loci, and at the same locus in the different clones (fixed locus). Relatively uniform transcription of binder genes leads to comparable levels of expression of binders on or from clones in a library. Binders displayed on the surface of cells of the library may be identical to (having the same amino acid sequence as) other binders displayed on the same cell. The library may consist of clones of cells which each display a single member of the repertoire of binders, or of clones displaying a plurality of members of the repertoire of binders per cell. Alternatively a library may comprise some clones that display a single member of the repertoire of binders, and some clones that display a plurality of members (e.g., two) of the repertoire of binders. Preferably clones of a library express one or two members of the repertoire of binders.

[0184] For example, a library of eukaryotic cell clones in the context of the present invention may express a repertoire of at least 10 3< , 10 4< , 10 5< 10 6< , 10 7< , 10 8< or 10 9< different binders, e.g., IgG, Fab, scFv or scFv-Fc antibody fragments, each cell containing donor DNA integrated in the cellular DNA. The donor DNA encodes the binder and may further comprise a genetic element for selection of cells into which the donor DNA is integrated. Cells of the library may contain DNA encoding an exogenous site-specific nuclease.

[0185] Binders displayed on the surface of cells of the library may be identical to (having the same amino acid sequence as) other binders displayed on the same cell. The library may consist of clones of cells which each display a single member of the repertoire of binders, or of clones displaying a plurality of members of the repertoire of binders per cell. Alternatively a library may comprise some clones that display a single member of the repertoire of binders, and some clones that display a plurality of members (e.g., two) of the repertoire of binders. Accordingly, a library in the context of the present invention may comprise clones encoding more than one member of the repertoire of binders, wherein the donor DNA is integrated at duplicate fixed loci or multiple independent fixed loci.

[0186] It is easiest to identify the corresponding encoding DNA for a binder if the corresponding clone expresses only one binder. Typically, a molecule of donor DNA will encode a single binder. The binder may be multimeric so that a molecule of donor DNA includes multiple genes or open reading frames corresponding to the various subunits of the multimeric binder.

[0187] As noted, a library in the context of the present invention may encode at least 100, 10 3< , 10 4< , 10 5< or 10 6< , 10 7< , 10 8< , 10 9< or 10 10< different binders. Where the binders are multimeric, diversity may be provided by one or more subunits of the binder. Multimeric binders may combine one or more variable subunits with one or more constant subunits, where the constant subunits are the same (or of more limited diversity) across all clones of the library. In generating libraries of multimeric binders, combinatorial diversity is possible where a first repertoire of binder subunits may pair with any of a second repertoire of binder subunits.

[0188] These and other features of libraries in the context of the present invention are further described elsewhere herein, and examples of suitable libraries and methods for their construction and use are also set out in WO2015 / 166272 (lontas Limited). Suitable loci may be identified for targeted integration of encoding DNA into cell chromosomes, and several examples are known in the art. The AAVS locus may be used as exemplified herein. Other suitable integration sites include the ROSA26, HPRT and FUT8 loci (e.g., within CHO cells). Although targeted integration can have advantages, random integration is a suitable alternative and may be used in many situations. Apart from nuclease-mediated targeted integration, methods of generating libraries of surface-expressed polypeptides include transfecting eukaryotic cells with vectors encoding the polypeptides, e.g., using lentivirus, adenovirus, adeno associated virus, or transposons, or using genomically embedded recombinase sites such as Flp, Bxb2 recombinase, or endogenous cryptic recombinase sites such as phi recombinase sites. Libraries created by these or any other technique may be employed in the methods described herein. Described herein is the library either in pure form, as a population of library clones in the absence of other eukaryotic cells, or mixed with other eukaryotic cells. Other cells may be eukaryotic cells of the same type (e.g., the same cell line) or different cells. Further advantages may be obtained by combining two or more libraries in the context of the present invention, or combining a library with a second library or second population of cells, either to facilitate or broaden screening or for other uses as are described herein or which will be apparent to the skilled person.

[0189] A library in the context of the invention, one or more clones obtained from the library, or host cells into which DNA encoding a binder from the library has been introduced, may be provided in a cell culture medium. The cells may be cultured and then concentrated to form a cell pellet for convenient transport or storage.

[0190] Libraries will usually be provided in vitro. The library may be in a container such as a cell culture flask containing cells of the library suspended in a culture medium, or a container comprising a pellet or concentrated suspension of eukaryotic cells comprising the library. The library may constitute at least 75 %, 80 %, 85 % or 90 % of the eukaryotic cells in the container. Selection steps may be performed on libraries in mixed culture, thus facilitating a high throughput.

[0191] As an alternative to co-culturing a mixture of clones of a library, it may sometimes be convenient to individually culture clones, each in their own separate flask or other vessel. Individual cultures may be used where a relatively small number of clones is being compared, such as where a parent binder has been mutated to generate one or more variants (e.g., up to 10 variants) and the invention is being used to compare the qualities of the variants relative to the parent and / or each other.

[0192] The selection methods described herein may be applied to naïve libraries, i.e., libraries that have not undergone affinity-based selection. Methods may thus be used to enrich a library for clones that have higher solubility and / or lower non-specific binding (conversely depleting the library in clones that exhibit low solubility and / or higher non-specific binding), prior to performing any affinity-based selection. Such a library, which has been "pre-selected" for more developable clones, is then highly suitable for performing affinity-based selection using a target of interest. Clones obtained in the affinity-selection step are more likely to exhibit good solubility, high critical concentration, low non-specific binding and / or other developable qualities, compared with clones selected from a library which had not been pre-screened for developability.Eukaryotic cells

[0193] Eukaryotic cells according to the present invention are higher eukaryotic cells, defined here as cells with a genome greater than that of Saccharomyces cerevisiae which has a genome size of 12 x 10 6< base pairs (bp). The higher eukaryotic cells may for example have a genome size of greater than 2 x 10 7< base pairs. This includes, for example, mammalian, avian, insect or plant cells. Eukaryotic cells of the present invention preferably lack a cell wall. Preferably they are not yeast cells or other fungal cells. Preferably the cells are mammalian cells, e.g., mouse or human. The cells may be primary cells or may be cell lines. Chinese hamster ovary (CHO) cells are commonly used for antibody and protein expression but any alternative stable cell line may be used in the invention. HEK293 cells are used in several Examples herein.

[0194] The display of binders using higher eukaryotes, such as mammalian cells, has advantages since the manufacture of antibodies for research, diagnostic and therapeutic application is typically carried out in these cells. Conducting drug discovery on mammalian cells exhibiting the same expression environment and the same post-translation modifications will give a better indication of potential issues or benefits for downstream manufacturing allowing early identification of clones with optimal expression properties. Bacterial and yeast cells in contrast do not fully recapitulate the glycosylation, expression and secretion machinery of higher eukaryotes. Thus display on mammalian cells could help identify clones with better presentation levels or stability properties with implications for future research use or downstream manufacturing. The ability to display large libraries of antibodies on the surface of mammalian cells will allow the screening of millions of clones directly for binding and presentation properties with the potential to use manufacturing cell lines during the discovery phase of antibody development.

[0195] The CHO cell line was originally isolated in 1957 63< and derivatives of this cell line have become the production cell line for the majority of therapeutic antibodies 64< . For example, Herceptin (the anti-HER-2 antibody approved for treating breast cancer) is produced at more than one metric ton per year by expression in CHO cells. Compared with human cells, CHO cells have an advantage for producing products for administration to humans because they do not propagate most human pathogenic viruses. In addition, they allow integration of foreign DNA into their genomes and grow quickly and robustly. The properties of antibodies and other polypeptide binders, including biophysical properties, stability pharmacokinetics and immunogenicity, can be affected by their post-translational modifications such as glycosylation 65< , which are acquired within the secretory pathway of cells such as the endoplasmic reticulum (ER) and Golgi apparatus. Here monosaccharide units such as mannose (Man), galactose (Gal), fucose (Fuc), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine (GalNAc) and sialic acids are covalently attached to specific amino acids. "O-linked" or "N-linked" glycosylation refers to either glycans attached to the oxygen atom of serine or threonine residues or glycans attached to the amide nitrogen atom of asparagine residues. Complexity in the glycosylation can be introduced by the glycosylation being either linear or branched and the atomic positions and conformation of the glycosidic linkage (e.g. α or β) at various position within the monosaccharide unit. The precise nature of antibody glycosylation profiles can be affected by the host cell line used for expression 65< . It is therefore an advantage during antibody and therapeutic protein screening to produce the recombinant protein in a host cell line which is as close as possible to the final production cell line. This ensures that the post-translational modifications of the polypeptides to be screened, and therefore their properties, are identical, or as similar as possible, to those that will be acquired during their large-scale manufacture. Since the majority of human therapeutic antibodies are produced in CHO cells it therefore an advantage to perform higher eukaryotic display in a CHO host cell line. Example 12 demonstrates developability-based selection of candidate polypeptide drugs in a CHO cell library.

[0196] In methods and uses of the present invention generally, the plurality of cell clones may be a library of at least 1000 clones, optionally cultured together in the same culture medium within a single vessel. It may be a naive library, i.e., one that encodes a repertoire of binders that has not previously undergone selection for binding to a target. This will often be the case in early stage discovery, although it may be desirable to use a library encoding a repertoire of binders that are the result of one or more previous rounds of selection for binding to a target. For example, the selection output of a phage display library may be introduced into the eukaroytic cell library.

[0197] The invention is described in the present specification with particular reference to mammalian cells, and mammalian cells were used to illustrate the invention in the Examples. However, unless the context requires otherwise, it should be understood that other higher eukaryotic cells may be used instead. For example, insect or chicken cells may be used.Binders

[0198] A "binder" in accordance with the present invention is a binding molecule, representing a specific binding partner for another molecule. Typical examples of specific binding partners are antibody-antigen and receptor-ligand. Many principles of the invention extend to polypeptides that may not classically be regarded as "binders", such as enzymes, co-factors, clotting factors and their inhibitors, complement factors and their inhibitors and so forth. In many cases such polypeptides represent candidate clinical drugs which it is desirable to produce at large scale and / or to provide at high concentrations. Their developabililty qualities are therefore a significant consideration. For example, factor VIII is used in haemophilia but has considerable developability issues. Aspects of the invention relating to developability can be applied to all such polypeptides. Thus, unless the context requires otherwise, the invention should not be interpreted as being limited to classical specific binding molecules like antibodies, and should be understood as extending generally to polypeptides that are designed to interact with one or more other molecules. According to the invention, the binders are transmembrane-containing polypeptides.

[0199] The present invention is concerned with binders that are polypeptides, i.e., polymers of amino acids, expressed from encoding DNA in a cell and optionally subject to post-translational modifications such as cleavage, glycosylation and so on. Binders may comprise short peptides of around e.g., 10 to 30 amino acids. Binders may also be longer polypeptides and may optionally comprise multiple subunits.

[0200] Binders preferably comprise polypeptides of mammalian, e.g., human, origin. The binders may comprise human antibodies (optionally chimaeric antigen receptors (CARs) comprising human antibodies), human TCRs or other receptors, or other human polypeptides. Binders may be soluble peptides or polypeptides (e.g., cytokines, chemokines, complement proteins or complement regulators, enzymes (including enzymes for industrial use), blood clotting factors e.g., factor VIII). Binders may be mammalian (e.g., human) membrane proteins, or may be soluble mammalian (e.g., human) proteins / peptides that have been engineered to comprise one or more TM domains. Binders may be native, naturally occurring polypeptides, or (frequently) will be synthetic variants. For example, a library of human factor VIII polypeptides may comprise binders having at least 70 % amino acid sequence identity with human factor VIII (e.g., at least 80 %, or at least 90 %).

[0201] The repertoire of binders encoded by a library will usually share a common structure and have one or more regions of diversity. The library therefore enables selection of a member of a desired structural class of molecules, such as a peptide or a scFv antibody molecule. In a library or population of binders according to the present invention, the binder polypeptides may thus share a common structure (e.g., a related secondary and / or tertiary structure, optionally including a region of highly similar or identical amino acid sequence - a "constant region") and may have one or more regions of amino acid sequence diversity - a "variable region".

[0202] This can be illustrated by considering a repertoire of antibodies. These may be antibodies of a common structural class, e.g., IgG, Fab, scFv-Fc or scFv, differing in one or more regions of their sequence. Antibodies typically have sequence variability in their complementarity determining regions (CDRs), which are the regions primarily involved in antigen recognition. A repertoire of binders in the present invention may be a repertoire of antibody molecules which differ in one or more CDRs, for example there may be sequence diversity in all six CDRs, or in one or more particular CDRs such as the heavy chain CDR3 and / or light chain CDR3.

[0203] Antibodies and other binders are described in more detail elsewhere herein. The potential of the present invention however extends beyond antibody display to include display of libraries of peptides or engineered proteins, including receptors, ligands, individual protein domains and alternative protein scaffolds 66-68< . Examples are polypeptides that have monomeric binding domains such as DARPins and lipocalins, affibodies and adhirons. The invention can also be used with complex multimeric binders. For example T cell receptors (TCRs) are expressed on T cells and have evolved to recognise peptide presented in complex with MHC molecules on antigen presenting cells. Libraries encoding and expressing a repertoire of TCRs may be generated, and may be screened to identify binding to MHC peptide complexes.

[0204] For multimeric binders, donor DNA encoding the binder may be provided as one or more DNA molecules. For example, where individual antibody VH and VL domains are to be separately expressed, these may be encoded on separate molecules of donor DNA. The donor DNA integrates into the cellular DNA at multiple integration sites, e.g., the binder gene for the VH at one locus and the binder gene for the VL at a second locus. Methods of introducing donor DNA encoding separate binder subunits are described in more detail elsewhere herein and in WO2015 / 166272 (lontas Limited). Alternatively, both subunits or parts of a multimeric binder may be encoded on the same molecule of donor DNA which integrates at a fixed locus.

[0205] A binder may be an antibody or a non-antibody protein that comprises an antigen-binding site. An antigen binding site may be provided by means of arrangement of peptide loops on non-antibody protein scaffolds such as fibronectin or cytochrome B etc., or by randomising or mutating amino acid residues of a loop within a protein scaffold to confer binding to a desired target. (Haan & Maggos (2004) BioCentury, 12(5): A1-A6 69,70< , Protein scaffolds for antibody mimics are disclosed in WO / 0034784 in which the inventors describe proteins (antibody mimics) that include a fibronectin type III domain having at least one randomised loop. A suitable scaffold into which to graft one or more peptide loops, e.g., a set of antibody VH CDR loops, may be provided by any domain member of the immunoglobulin gene superfamily. The scaffold may be a human or non-human protein.

[0206] Use of antigen binding sites in non-antibody protein scaffolds has been reviewed previously (Wess, L. In: BioCentury, The Bernstein Report on BioBusiness, 12(42), A1-A7, 2004). Typical are proteins having a stable backbone and one or more variable loops, in which the amino acid sequence of the loop or loops is specifically or randomly mutated to create an antigen-binding site having for binding the target antigen. Such proteins include the IgG-binding domains of protein A from S. aureus, transferrin, tetranectin, fibronectin (e.g. 10th fibronectin type III domain) and lipocalins. Other approaches include small constrained peptide e.g., based on" knottin" and cyclotides scaffolds 71< . Given their small size and complexity particularly in relation to correct formation of disulphide bond, there may be advantages to the use of eukaryotic cells for the selection of novel binders based on these scaffolds. Given the common functions of these peptides in nature, libraries of binders based on these scaffolds may be advantageous in generating small high affinity binders with particular application in blocking ion channels and proteases. WO2017 / 118761 (lontas Limited) described libraries of binding members that each comprise a fusion protein which contains a donor diversity scaffold domain, such as a cysteine rich protein, inserted within a recipient diversity scaffold domain such as an antibody constant or variable domain. Such binders and libraries as described in WO2017 / 118761 may be used in the present invention. Thus, in some embodiments, binders according to the present invention are "knotbodies" comprising a cysteine rich protein inserted within an antibody variable domain. See Example 15 herein.

[0207] In addition to antibody sequences and / or an antigen-binding site, a binder may comprise other amino acids, e.g., forming a peptide or polypeptide, such as a folded domain, or to impart to the molecule another functional characteristic in addition to ability to bind antigen. A binder may carry a detectable label, or may be conjugated to a toxin or a targeting moiety or enzyme (e.g., via a peptidyl bond or linker). For example, a binder may comprise a catalytic site (e.g., in an enzyme domain) as well as an antigen binding site, wherein the antigen binding site binds to the antigen and thus targets the catalytic site to the antigen. The catalytic site may inhibit biological function of the antigen, e.g., by cleavage.

[0208] Optionally, the binders of the library are a population of polypeptides for which the thermal stability (e.g., as determined by the melting temperature) is not predictive of the binders' solubility or resistance to self-association in solution. This non-correlation between thermal stability and solubility / resistance to self-association in solution may apply when considering all binders in the library that have a solubility or critical concentration of at least 10 mg / ml (methods for determining which are described elsewhere herein). It may apply when considering all binders having a surface presentation of at least 10 3< , at least 10 4< per cell, at least 10 5< per cell or at least 10 6< per cell (methods for determining which are described elsewhere herein, e.g., FACS gating). Optionally, it may apply when considering the total population of surface-expressed binders in the library.Antibodies

[0209] Antibodies are preferred binders. They may be whole antibodies or immunoglobulins (Ig), which have four polypeptide chains - two identical heavy chains and two identical light chains. The heavy and light chains form pairs, each having a VH-VL domain pair that contains an antigen binding site. The heavy and light chains also comprise constant regions: light chain CL, and heavy chain CH1, CH2, CH3 and sometimes CH4. The two heavy chains are joined by disulphide bridges at a flexible hinge region. An antibody molecule may comprise a VH and / or a VL domain.

[0210] The most common native format of an antibody molecule is an IgG which is a heterotetramer consisting of two identical heavy chains and two identical light chains. The heavy and light chains are made up of modular domains with a conserved secondary structure consisting of a four-stranded antiparallel beta-sheet and a three-stranded anti-parallel beta-sheet, stabilised by a single disulphide bond. Antibody heavy chains each have an N terminal variable domain (VH) and 3 relatively conserved "constant" immunoglobulin domains (CH1, CH2, CH3) while the light chains have one N terminal variable domain (VL) and one constant domains (CL). Disulphide bonds stabilise individual domains and form covalent linkages to join the four chains in a stable complex. The VL and CL of the light chain associates with VH and CH1 of the heavy chain and these elements can be expressed alone to form a Fab fragment. The CH2 and CH3 domains (also called the "Fc domain") associate with another CH2:CH3 pair to give a tetrameric Y shaped molecule with the variable domains from the heavy and light chains at the tips of the "Y". The CH2 and CH3 domains are responsible for the interactions with effector cells and complement components within the immune system. Recombinant antibodies have previously been expressed in IgG format or as Fabs (consisting of a dimer of VH:CH1 and a light chain). In addition the artificial construct called a single chain Fv (scFv) could be used consisting of DNA encoding VH and VL fragments fused genetically with DNA encoding a flexible linker.

[0211] IgG is one of the preferred classes of antibody for therapeutic use. An advantage of using higher eukaryotic, especially mammalian, cells is that one can work with antibodies in IgG format. This enables drug discovery and screening to be performed directly in the production cell type used for IgG manufacture.

[0212] Binders may be human antibody molecules. Thus, where constant domains are present these are preferably human constant domains.

[0213] Binders may be antibody fragments or smaller antibody molecule formats, such as single chain antibody molecules. For example, the antibody molecules may be scFv molecules, consisting of a VH domain and a VL domain joined by a linker peptide. In the scFv molecule, the VH and VL domains form a VH-VL pair in which the complementarity determining regions of the VH and VL come together to form an antigen binding site.

[0214] Other antibody fragments that comprise an antibody antigen-binding site include, but are not limited to, (i) the Fab fragment consisting of VL, VH, CL and CH1 domains; (ii) the Fd fragment consisting of the VH and CH1 domains; (iii) the Fv fragment consisting of the VL and VH domains of a single antibody; (iv) the dAb fragment 72-74< , which consists of a VH or a VL domain; (v) isolated CDR regions; (vi) F(ab')2 fragments, a bivalent fragment comprising two linked Fab fragments (vii) scFv, wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site 75,76< (viii) bispecific single chain Fv dimers (PCT / US92 / 09965) and (ix) "diabodies", multivalent or multispecific fragments constructed by gene fusion (WO94 / 13804, 77< ). Fv, scFv or diabody molecules may be stabilised by the incorporation of disulphide bridges linking the VH and VL domains 78< .

[0215] Various other antibody molecules including one or more antibody antigen-binding sites have been engineered, including for example Fab 2 , Fab 3 , diabodies, triabodies, tetrabodies and minibodies (small immune proteins). Antibody molecules and methods for their construction and use have been described 79< .

[0216] Other examples of binding fragments are Fab', which differs from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region, and Fab'-SH, which is a Fab' fragment in which the cysteine residue(s) of the constant domains bear a free thiol group.

[0217] A dAb (domain antibody) is a small monomeric antigen-binding fragment of an antibody, namely the variable region of an antibody heavy or light chain. VH dAbs occur naturally in camelids (e.g., camel, llama) and may be produced by immunizing a camelid with a target antigen, isolating antigen-specific B cells and directly cloning dAb genes from individual B cells. dAbs are also producible in cell culture. Their small size, good solubility and temperature stability makes them particularly physiologically useful and suitable for selection and affinity maturation. Camelid VH dAbs are being developed for therapeutic use under the name "nanobodies ™< ".

[0218] Synthetic antibody molecules may be created by expression from genes generated by means of oligonucleotides synthesized and assembled within suitable expression vectors, for example as described by Knappik et al. or Krebs et al 80,81< .

[0219] Bispecific or bifunctional antibodies form a second generation of monoclonal antibodies in which two different variable regions are combined in the same molecule 63< . Their use has been demonstrated both in the diagnostic field and in the therapy field from their capacity to recruit new effector functions or to target several molecules on the surface of tumour cells. Where bispecific antibodies are to be used, these may be conventional bispecific antibodies, which can be manufactured in a variety of ways , e.g., prepared chemically or from hybrid hybridomas, or may be any of the bispecific antibody fragments mentioned above 82< . These antibodies can be obtained by chemical methods 83,84< or somatic methods 85,86< ) but likewise and preferentially by genetic engineering techniques which allow the heterodimerisation to be forced and thus facilitate the process of purification of the antibody sought 87< . Examples of bispecific antibodies include those of the BiTE ™< technology in which the binding domains of two antibodies with different specificity can be used and directly linked via short flexible peptides. This combines two antibodies on a short single polypeptide chain. Diabodies and scFv can be constructed without an Fc region, using only variable domains, potentially reducing the effects of anti-idiotypic reaction.

[0220] In some embodiments of the present invention, binders are bispecific antibodies and their encoding clones comprise two different antibody heavy chains and optionally either two different antibody light chains or preferably a common light chain. Successful heterodimer pairing between the heavy chains leads to cell surface presentation of bispecific antibody, each antibody comprising the heterodimeric pair of heavy chains, and optionally each heavy chain being paired with a light chain, optionally a common light chain (i.e., the light chains paired with each heavy chain have the same amino acid sequence). Where an Fc region is included, the invention may be used to assess Fc sequence variants that may improve heterodimerisation. In previous studies where the Fc region has been engineered to improve heterodimerisation, the developability profile has been compromised by the changes 67< . The present invention provides an opportunity to screen such variants for developability (eg solubility and polyspecificity) alongside their heterodimerisation potential.

[0221] Bispecific antibodies can be constructed as entire IgG, as bispecific Fab'2, as Fab'PEG, as diabodies or else as bispecific scFv. Further, two bispecific antibodies can be linked using routine methods known in the art to form tetravalent antibodies.

[0222] Bispecific diabodies, as opposed to bispecific whole antibodies, may also be particularly useful. Diabodies (and many other polypeptides, such as antibody fragments) of appropriate binding specificities can be readily selected. If one arm of the diabody is to be kept constant, for instance, with a specificity directed against an antigen of interest, then a library can be made where the other arm is varied and an antibody of appropriate specificity selected. Bispecific whole antibodies may be made by alternative engineering methods as described in Ridgeway et al. (Protein Eng., 9, 616-621, (1996)).

[0223] Alternative formats of bispecific antibodies include mAb 2< ("mAb squared") molecules comprising immunoglobulins which loop regions of the CH3 have been engineered to provide an antigen binding site (see, e.g., WO2006072620, WO2008003103, WO2008003116). The modified CH3 region is termed an Fcab. One binding specificity is provided by the antibody antigen-binding site of the Fv regions, and a different binding specificity (or further valency) is provided by the binding site in the Fcab.

[0224] A library in the context of the invention may be used to select an antibody that binds one or more antigens of interest. Selection from libraries is described in detail elsewhere herein. Following selection, the antibody may be engineered into a different format and / or to contain additional features. For example, the selected antibody may be converted to a different format, such as one of the antibody formats described above. The selected antibodies, and antibodies comprising the VH and / or VL CDRs of the selected antibody molecules, are an aspect useful for understanding the present invention. Antibodies and their encoding nucleic acid may be provided in isolated form.

[0225] Antibody fragments can be obtained starting from an antibody molecule by methods such as digestion by enzymes e.g. pepsin or papain and / or by cleavage of the disulphide bridges by chemical reduction. In another manner, the antibody fragments can be obtained by techniques of genetic recombination well known to the person skilled in the art or else by peptide synthesis by means of, for example, automatic peptide synthesisers, or by nucleic acid synthesis and expression.

[0226] It is possible to take monoclonal and other antibodies and use techniques of recombinant DNA technology to produce other antibodies or chimaeric molecules that bind the target antigen. Such techniques may involve introducing nucleic acid (e.g., DNA) encoding the immunoglobulin variable region, or the CDRs, of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP-A-184187, GB 2188638A or EP-A-239400, and a large body of subsequent literature.

[0227] Antibody molecules may be selected from a library and then modified, for example the in vivo half-life of an antibody molecule can be increased by chemical modification, for example PEGylation, or by incorporation in a liposome.

[0228] Binders may comprise antibody variable domains that exhibit sequence diversity, optionally in one or more complementarity determining regions. Binders may also, or alternatively, comprise antibody constant regions or Fc regions, which optionally exhibit sequence diversity. Features of Fc regions are discussed further below.Fc regions

[0229] A binder may be a polypeptide comprising an Fc region. The binders may be antibodies, knotbodies or other polypeptides, optionally fusion proteins, comprising an Fc region. The Fc region may be or may comprise the constant region of the binders, i.e., having a highly similar or identical amino acid sequence as compared between binders of a library. In some cases constant domains of the antibody (e.g. the Fc region, or CL or CH1 domains) may be or may comprise variable amino acid sequences, thus exhibiting sequence diversity across the repertoire of binders in a library. Sequence diversity may optionally be in CH3 domains of the Fc. For example, binders may comprise Fcabs or mAb 2< in which the binding loops of the Fcabs are diverse within the library. mAb 2< may comprise diverse Fcab regions and either non-variant or diverse antigen binding sites of the Fv regions. Amino acid sequence diversity of binders may be restricted to the Fc region, optionally restricted to the CH3 domain.

[0230] Using the display libraries of the present invention, libraries of Fc domains may be screened for altered function and for developability criteria, optionally simultaneously.

[0231] Various engineering approaches have been taken to engineer the interaction of Fc domains with its interaction partners. For example the "knobs into holes" approach modifies two paired Fc sequences such that their co-expression from a cell (or their expression in co-cultured cells) leads to mainly heterodimer formation between the two variant Fcs domains, which is advantageous in the generation of bispecific antibodies. Unfortunately such mutations can have an effect on developability 88< . The present invention may be used to assess Fc variants, including Fc domains containing candidate "knobs into holes" mutations, for developabililty potential.

[0232] Fc engineering has also been used to alter affinity or specificity with Fc gamma receptors e.g., to create "null variants" with reduced Fc gamma receptor interaction. Mutation of antibody constant domain and selection of variants with desired binding qualities can degrade stability and manufacturability. Again, the present invention may be used to assess libraries of variant Fc domains to enrich for those with improved properties.

[0233] Modifications have also been made to increase or decrease the interaction of Fc with FcRn for the purpose of positively or negatively modifying half life 89< . For example a triplet of mutations of M252Y / S254T / T256E (so-called "YTE mutation") have increased IgG half-life prolonging half-life and reducing dosing frequency and cost.

[0234] It is recognised that introduction of mutations in the Fc domain can also have a detrimental effect on biophysical properties of the variant leading to aggregation and poor developability. For example Borrock et al (2017) review mutations which affect interaction with FcRn and mutations affecting interaction with other Fc receptors. They describe an antibody which combines mutations which increase half-life (M252Y, S254T, T256E, the so called the "YTE mutation") and others diminish interaction of CH2 domain with Fc gamma receptors (L234F, L235E, P331S, the so-called TM mutant) 90< . Compared with wild type this TM-YTE mutant had lowered thermostability, greater conformational flexibility, increased self-association, poorer solubility and poorer aggregation profiles. By selecting candidate mutations they were able to create a new FQQ-YTE variant (L234F / L235Q / K322Q / M252Y / S254T / T256E) which had significantly improved conformational and colloidal stability, while retaining extended half-life and lack of antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity activity.

[0235] The present invention offers an opportunity to screen large numbers of variants simultaneously for altered binding properties of Fc domains alongside developability criteria such as self-aggregation or low specificity. Thus, in various embodiments of the invention the binders may comprise Fc regions exhibiting sequence diversity, e.g., in one or more amino acid residues of the CH3 domain. Binders that exhibit sequence diversity in one or more variable regions (e.g., antibody heavy chain variable and / or light chain variable domain) outside the Fc domain, and which optionally have a constant Fc domain of invariant sequence, may also be screened to identify effects of the variable region sequence on the FcRn interaction (see Example 9). Such effects may be indirect e.g., affecting conformation of the molecule or otherwise influencing binding more remotely, in the absence of direct binding of the variable region to the receptor.

[0236] Screening for FcRn binding characteristics of polypeptides may be integrated into drug discovery. Methods may comprise selecting for optimal pH dependent FcRn interactions within libraries of sequence variants. Described herein are methods of identifying or selecting for binders having an extended or reduced in vivo half life resulting from the nature of their interaction with FcRn.

[0237] An aspect useful for understanding the invention involves a method comprising: providing a plurality of eukaryotic (e.g., mammalian) cell clones each containing DNA encoding a binder comprising an Fc domain, culturing the clones in vitro under conditions for presentation of the binders on the cell surface, exposing the clones to FcRn receptor at low pH (e.g. about pH 6.0) or neutral pH (e.g. about pH7.4) allowing recognition of FcRn by the Fc domains, eluting at higher pH (e.g., about pH 7.4) and selecting one or more clones expressing binders that exhibit higher affinity binding at about pH 6.0 compared with binding at higher pH (e.g. about pH 7.4).

[0238] The selected clones can be obtained from the eluted fraction. Binders from the eluted clones may be identified as having an extended half life in vivo.

[0239] Alternatively binders which are retained following a switch to a higher pH may be collected if retained binding at higher pH is desired, for example for reduced half-life or for use with "sweeping antibody" approaches 32< . In such cases the method useful for understanding the invention may comprise: providing a plurality of eukaryotic (e.g., mammalian) cell clones each containing DNA encoding a binder comprising an Fc domain, culturing the clones in vitro under conditions for presentation of the binders on the cell surface, exposing the clones to FcRn receptor at low pH (e.g. about pH 6.0) allowing recognition of FcRn by the Fc domains, washing at higher pH (e.g., about pH 7.4) and selecting one or more clones expressing binders that exhibit lower or similar affinity binding at about pH 6.0 compared with binding at higher pH (e.g. about pH 7.4).

[0240] The selected clones can be obtained from the retained fraction that is not eluted at the higher pH wash. Such clones can be eluted at more extreme pH, above pH 7.4 or below pH 6. Higher affinity binding at the lower pH (e.g., about pH 6.0) can be selected for by reducing the concentration of FcRn used at that pH during selection thereby increasing the stringency of the selection.

[0241] Binders exhibiting a greater difference in affinity between the two pHs may be preferentially selected, as these may show the greatest half life extension. Conversely if shorter half life is sought, one would select clones expressing binders where there is a smaller differential in affinity for FcRn between the two pHs (or no significant difference). The method may thus be adapted to select either for shorter or longer half life. Populations of clones are thus enriched for clones expressing binders with the desired half life.

[0242] Binding to biotinylated FcRn may be carried out at pH 6.0 to ensure binding is occurring, then eluted samples collected following washing with buffers of increasing pH. Alternatively selection for retention or loss of fluorescent label could be carried out using flow sorting. FcRn-based affinity chromatography methods in conjunction with pH gradient elution have been described 91< for characterising antibodies. Such methods useful for understanding the invention could be used with libraries of antibody variants displayed on cells where clones with desired pH dependent binding properties could be collected and the antibody genes recovered.

[0243] Some embodiments of the invention use anti-Fc detection agents to determine the level of surface presentation of the binders. Such agents may still be used in connection with binders having Fc sequence diversity provided that the diversity does not affect binding of the detectable agent, for example if it can be ensured that the detection agent binds a region of the Fc where the binders share a common sequence. In alternative embodiments, the binders comprise Fc regions that do not exhibit sequence diversity.Cell culture and binder expression

[0244] To provide a repertoire of binders for screening against a target of interest and / or for developability characteristics, a library may be cultured to express the binders from the encoding DNA. As discussed, binders contain a transmembrane domain for extracellular display. Culturing cells for expression of binders will generally involve incubating the cells in a suitable culture medium, optionally in suspension culture, and at a temperature conducive to growth of the cells (e.g., 37 degrees C for mammalian cells). Expression of the polypeptide binder from the encoding DNA is initiated under control of the promoter (and optionally other elements such as enhancers) and surface presentation of the binder will begin to be observed after a duration, and should be detectable within e.g., 12 hours although a longer duration (e.g., 24 h or 48 h) may be required for binder presentation to reach a final or equilibrium concentration on the cell surface.Promoters

[0245] In cells according to the present invention, DNA encoding a binder is operably linked to a promoter for expression. A heterologous promoter may be used, meaning that it is not the promoter associated with the encoding DNA in nature, e.g., DNA encoding an antibody may be operably linked to a promoter other than the promoter from the immunoglobulin locus. It will generally be convenient to integrate the promoter into the cellular DNA, optionally in cis (on the same donor DNA as the sequence encoding the binder) although an alternative is to express the integrated binder DNA from a promoter endogenous to the host cell.

[0246] Where expression of the DNA encoding the binders is under control of a strong promoter, e.g., a constitutive promoter or an inducible promoter from which expression has been maximally induced, high levels of binder presentation may be achieved. Conversely, where expression of DNA encoding the binders is under control of a weakly active promoter, e.g., a weak promoter or an inducible promoter from which expression has been minimally induced or which exhibits only a basal level of activity, low levels of binder presentation may be achieved. Strength of a promoter can be quantified using a reporter gene and determining the level of expression of the reporter, e.g., expression of GFP can be detected as fluorescence, which may be quantified. A weakly active or weak promoter may for example show about 1 - 10 % of the activity of a fully active or constitutive promoter, e.g., as compared with the CMV promoter.

[0247] A convenient method to control cell surface presentation of binders is to provide an inducible promoter operably linked to the binder-encoding DNA in the cells. Tetracycline-inducible promoters are suitable, and a variety of these are available. Gossen et al. described a first generation rtTA protein (EP0804565 and Gossen et al., 1995 92< ). The VP16 activation domain was fused with a mutant Tet repressor from Escherichia coli to generate the transcriptional transactivator "rtTA", which requires certain tetracycline (Tc) derivatives for specific DNA binding. Doxycycline is an inducer in this system, and its addition to cultured cells in which gene expression is under control of the rtTA can undergo a 1000x increase in expression from the inducible promoter. A second generation "TetO / CMV" promoter named pTight or Ptet-14 was designed with optimised 7 TetO spacing and a truncated minimal CMV promoter, which exhibits reduced basal expression levels (Clontech: pTRE-Tight Vectors. Clontechniques 2003, 18(3):13-14). The promoter sequence is: TTCGTCTTCACACGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTA CTCCCTATCAGTGATAGAGAACGATGTCGAGTTTACTCCCTATCAGTGATAGAGAA CGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCC TATCAGTGATAGAGAACGTATGTCGAGTTTATCCCTATCAGTGATAGAGAACGTAT GTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGGTAGGCGTGTACG GTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCC

[0248] This inducible promoter, or a variety of other modulatable promoters, may be used to control binder presentation levels in the present invention. Any inducible system could be employed where a DNA binding domain is fused to a protein domain capable of binding an inducer molecule which results in a protein conformational change or a change in affinity for a DNA recognition sequence. This will result in either derepression or activation of transcription leading to protein expression. For example, in the case of the T-Rex or cumate switch systems, the binding of inducer to a repressor protein results in loss of DNA binding and derepression of transcription. Alternatively binding of an inducer to a DNA binding domain fused to a transcription activation domain fusion protein would result in DNA binding and the recruitment of transcription factors as is the case for the Tet-on 92,114< or the GAL4 GeneSwitch systems 121< .

[0249] The tetracycline-inducible promoter systems mentioned above may be convertable to a more tuneable homogeneous and titratable induction by reduction in the number of TetO repeat sequences to between one and six 118< or by modification of the rTA protein. Example 8b describes a third generation inducible tet promoter system, which achieved an improved range of expression. Details are illustrated in Figure 37. Alternative inducible expression systems could also be employed including the cumate switch 119< , T-Rex 120< or GAL4 systems 121< .Recovery of binders and encoding nucleic acid

[0250] Following selection of a binder or clone of interest from the library, a common next step will be to isolate, identify and / or amplify the nucleic acid (e.g., DNA or RNA) encoding the binder. Optionally, it may be desired to modify the nucleic acid encoding the binder, for example to restructure the binder and / or to insert the encoding sequence into a different vector. Nucleic acid (DNA or RNA) encoding a displayed binder can be recovered from the selected cell, cloned into an expression vector and the encoded polypeptide expressed either in a secreted form or for display. This can be done on individual clones.

[0251] When the population of donor DNA molecules that is used to create the library contains multiple copies of the same sequence, two or more clones may be obtained that contain DNA encoding the same binder. It can also be the case that a clone may contain donor DNA encoding more than one different binder, for example if there is more than one recognition sequence for the site-specific nuclease, as detailed elsewhere herein. Thus, the diversity of the library, in terms of the number of different binders encoded or expressed, may be different from the number of clones obtained.

[0252] Clones in the library preferably contain donor DNA encoding one or two members of the repertoire of binders and / or preferably express only one or two members of the repertoire of binders. A limited number of different binders per cell is an advantage when it comes to identifying the clone and / or DNA encoding a particular binder identified when screening the library against a given target. This is simplest when clones encode a single member of the repertoire of binders. However it is also straightforward to identify the relevant encoding DNA for a desired binder if a clone selected from a library encodes a small number of different binders, for example a clone may encode two members of the repertoire of binders. As discussed elsewhere herein, clones encoding one or two binders are particularly convenient to generate by selecting a recognition sequence for the site-specific nuclease that occurs once per chromosomal copy in a diploid genome, as diploid cells contain duplicate fixed loci, one on each chromosomal copy, and the donor DNA may integrate at one or both fixed loci. Thus, clones of the library may each express only one or two members of the repertoire of binders.

[0253] Where the binder is an antibody molecule, a method may comprise isolating DNA encoding the antibody molecule from cells of a clone, amplifying DNA encoding at least one antibody variable region, preferably both the VH and VL domain, and inserting DNA into a vector to provide a vector encoding the antibody molecule. A multimeric antibody molecule bearing a constant domain may be converted to a single chain antibody molecule for expression in a soluble secreted form. Antibodies may be presented in different formats but whatever format an antibody is selected in, once the antibody gene is isolated it is possible to reconfigure it in a number of different formats. Once VH or VL domains are isolated, they can be re-cloned into expression vectors encompassing the required partner domains

[0254] DNA encoding a selected binder may be integrated into a host cell chromosome for expression. Expression of recombinant protein typically involves introducing into a cell the gene encoding the desired protein under the control of a promoter which is expressed in that cell. For example the gene may be under the control of a cytomegalovirus enhancer / promoter and may be introduced into a mammalian cell such as the commonly used human embryonic kidney 293 (HEK293) cell or the Chinese Hamster Ovary (CHO) cell. Standard methods for introducing expression constructs into host cells are well known. For production of secreted, soluble protein the encoded gene is preceded by a leader sequence which directs the encoded protein to the endoplasmic reticulum. In the absence of a transmembrane domain the encoded gene is secreted into the culture medium from which it may be purified and concentrated.

[0255] Following any method of the invention, a desired binder may be provided in isolated form in solution, e.g., after secretion from a host cell stably transfected for expression of the binder. Properties of the soluble binder may then be tested to confirm its performance, e.g., to assess developability traits such as solubility, self-association, non-specific binding, FcRn interaction, and others, or to assess affinity. Suitable assays for determining each of these features are provided in the relevant sections of this document, and may be performed to confirm that a binder exhibits the desired property and / or shows an improvement in the relevant characteristic, e.g., that it is improved compared with a parent molecule.Pharmaceutical formulation of binders

[0256] Binders obtained using methods of the invention may be provided in purified and / or isolated form, and may be formulated into compositions comprising one or more additional components. Compositions may contain suitable carriers, excipients, and other agents that are incorporated into formulations to provide improved transfer, delivery, tolerance, etc. Example formulations are described in Remington's Pharmaceutical Sciences. Binders intended for in vivo use may be formulated for the desired route of administration to a patient, e.g., in a liquid (optionally aqueous solution) for injection. Various delivery systems are known and can be used to administer a pharmaceutical composition comprising the binder. Methods of administration include intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The composition may be administered by any convenient route, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.

[0257] The binder, or composition comprising it, may be contained in a medical container such as a phial, syringe, IV container or an injection device. In an example, a kit is provided comprising the binder, packaging and instructions for use in a therapeutic method. The method may comprise subcutaneous administration to a patient.

[0258] The binder may be formulated into a composition, optionally an aqueous buffered solution, comprising the binder at a concentration of at least (or above): 50 mg / ml, 60 mg / ml, 70 mg / ml, 80 mg / ml, 90 mg / ml or 100 mg / ml. The binder may be at a concentration of between 50 - 200 mg / ml, e.g., between 50 - 150 mg / ml, e.g., between 50 and 100 mg / ml.

[0259] A number of methods for concentrating expressed recombinant protein are known to those skilled in the art but may include column chromatography (e.g., affinity chromatography, ion exchange chromatography) and ultrafiltration 27< .

[0260] Those skilled in the art will recognise, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein.

[0261] Also described herein are the aspects and embodiments described above with the term "comprising" replaced by the term "consisting of" and the aspects and embodiments described above with the term "comprising" replaced by the term "consisting essentially of".

[0262] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art which this invention belongs. Although any compositions and methods similar or equivalent to those described herein, within the scope of the invention as defined by the appended claims, can be used in the practice or testing of the methods of the disclosure, exemplary compositions and methods are described herein.

[0263] As used herein and in the claims, the singular forms "a", "and", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to a "peptide chain" is a reference to one or more peptide chains. "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example "A and / or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0264] The invention will now be illustrated further, with reference to the drawings, which are as follows: Figure 1. pINT17-BSD, a dual promoter antibody IgG expression cassette for surface expression pINT17-BSD, a schematic map is shown depicting the key features (1-7500 bp) pINT17-BSD-D1.3, a dual promoter antibody expression cassette for surface expression of the anti-lysozyme antibody D1.3. The full annotated nucleic acid sequence is shown. Features: AAVS left homology arm 9-812 Blasticidin resistance gene 853-1254 pEF promoter 1522-2705 BM40 leader 2745-2799 Humanised D1.3 VL 2799-3130 Human C kappa 3138-3443 BGH poly A 3468-3682 CMV promoter 3701-4273 Mouse VH leader with intron 4299-4426 Humanised D1.3 VH 4432-4779 Optimised human IgG1 CH1-CH3 4780-5775 Myc tag 5776-5805 PDGFR anchor 5806-5961 BGH polyA 6011-6225 AAVS right homology arm 6288-7124 f1 replication origin 7282-7695 pUC replication origin 7916-8590 Kanamycin resistance gene 9310-10104 Figure 2. Expression of IgG on cell surface. Analysis was focused on viable cells using forward scatter and staining in the FL3 channel. Cells positive for staining in the FL3 channel (representing non-viable cells which took up 7-AAD) were excluded. HEK293 cells were transfected with pINT17-antibodies in presence of the AAVS TALENs. Stable populations were selected with Blasticidin. 14 days post-transfection, cells were stained with anti-Fc PE (FL2). Panels depicting fluorescence intensity (anti-Fc-PE, x-axis) plot against cell count (y-axis) and include the CNTO607 (a), MEDI1912 (b) and Ang2mAb (c) pairs. For all panels the plots include stained HEK293 cells (dotted line), parental antibody (dashed line), improved mutant (solid black line). Figure 3. Preparative size exclusion chromatography of MEDI-1912 and MEDI-1912-STT. Antibodies were expressed by transient transfection of Expi293 cells followed by protein A affinity purification and dialysis. Purified MEDI-1912 (0.5 ml, 1.1 mg / ml) or MEDI-1912 -STT (0.5 ml, 1.7 mg / ml) were loaded onto a Superdex 200 10 / 300 column connected to an AKTA Pure system using a PBS (pH 7.4) running buffer. The elution volume (ml) us plotted on the x axis against the absorbance at 280 nm (mAU) on the y-axis. The elution volume (Ve) for MEDI-1912 and MEDI-1912-STT was 10.3 ml and 11.7 ml respectively. MEDI-1912 shows an earlier elution volume indicating self-interaction. Figure 4. DNA and protein sequence of MED-1912 variable heavy (VH) chain. Primers employed for library creation are labelled above the nucleic acid sequence. Figure 5. FACS separation of mixed cell displayed antibody populations based on antibody expression. An equal mix of MEDI-1912 and MEDI-1912_STT IgG genes were targeted via nuclease-directed integration into the AAVS locus of HEK293 cells. This mixed cell population, 15 days post-transfection, was separated on the basis of antibody expression by FACS using a BD Influx sorter. Cells were stained with anti-Fc labelled with phycoerythrin (PE) and NGF-biotin / streptavidin labelled with allophycocyanin (APC). Analysis was focused on viable cells using forward scatter and staining. Cells positive for staining in the λem=450 / 40, λexc=355 channel (representing non-viable cells which took up 7-AAD) were excluded. a. Histogram plot of fluorescence intensity for anti-Fc-PE against cell counts for the mixed input population (dashed line), and monoclonal HEK293 cell lines displaying MEDI-1912 (grey line) and MEDI-1912_STT (black line). b. The dot-plot shows fluorescence intensity for anti-Fc-PE (x-axis), representing antibody expression level, plotted against fluorescence intensity for antigen binding (NGF-biotin / NGF-biotin / streptavidin-APC) on the y-axis. The gates chosen to separate the high and low antibody expression populations are labelled P5 and P6 and are shown as black boxes on the dot-plot. The total event count was 3.9 x 10 6< cells and the number of cells sorted in the P5 and P6 gates was 2.5 x 10 5< and 2.8 x 10 5< cell respectively. Figure 6. Enrichment of antibodies selected by mammalian cell display level. Cells sorted in gates 5 and 6 (Figure 5) were expanded, genomic DNA prepared and antibody VH genes isolated by PCR. The two antibody populations were analysed by Nextgen sequencing to determine the proportion of MEDI-1912 and MEDI-1912_STT in the two gated populations. The histogram shows the percentage frequency of MEDI-1912 (hatched bars) and MEDI-1912_STT (solid black bars) in the low antibody expression population (Gate 6) and the high antibody expression population (Gate 5). Figure 7. FACS separation of the MEDI-1912 library antibody populations based on antibody expression. A library of MEDI-1912 IgG genes, where NNS oligonucleotide-directed mutagenesis was used to randomly mutate the codon encoding W30, F31 and L56, were targeted via nuclease-directed integration into the AAVS locus of HEK293 cells. This mixed cell population, 15 days post-transfection, was separated on the basis of antibody expression and antigen binding by FACS using a BD Influx sorter. Cells were stained with anti-Fc labelled with phycoerythrin (PE) and NGF-biotin / streptavidin labelled with allophycocyanin (APC). Analysis was focused on viable cells using forward scatter and staining. Cells positive for staining in the λem=450 / 40, λexc=355 channel (representing non-viable cells which took up 7-AAD) were excluded. The dot-plot shows fluorescence intensity for anti-Fc-PE (x-axis), representing antibody expression level, plotted against fluorescence intensity for antigen binding (NGF-biotin / NGF-biotin / streptavidin-APC) on the y-axis for the parental MEDI-1912 displaying monoclonal cell line (a), the MEDI-1912_STT displaying monoclonal cell line (b) and the MEDI-1912 amino-acid position 30, 31 and 56 random library (c). The gates chosen for analysis are labelled P5 and P6 and are shown as boxes on the dot-plot. Figure 8. Sequence distribution of selected MEDI-1912 variants. Histogram plots of amino acid identity frequency at MEDI-1912 VH positions 30, 31 and 56 for the MEDI-1912 VH library after mammalian display and FACS gated on Fc expression and NGF binding (P5 gate, Figure 7). Amino acid (single letter code) is plotted on the x-axis against frequency (percentage occurrence) on the y-axis for the adjacent amino acids 30, hatched bars and 31, black bars (a) and amino acid 56 (b). Leucine in position 56 was excluded from the analysis. Figure 9. Alignment of Bococizumab mouse parental antibody 5A10 VH (A) and VL (B) with the humanized intermediate antibody 5A10-i and Bococizumab. CDRs are indicated by bars above the sequence and residues to be mutated are highlighted in bold and underlined. Paratopic residues (amino acids that contribute to direct binding to PCSK9) are highlighted in italic and underlined. Dots indicate identity with the parental mouse mAb 5A10. Figure 10. Antibody mammalian display expression of Bococizumab and the parental humanized intermediate antibody 5A10-i Targeting vector pINT17 encoding Bococizumab or 5A10-i) IgG were integrated into the AAVS locus of Hek293 cells via TALE nuclease. Cell (10 6< ) were stained with anti-Fc-PE at 1, 8 or 21 days post transfection (dpt) and 106 cells analysed by flow cytometry with an iQue Intellicyte flow cytometer. Dead cells were excluded from the analysis. Histogram plots show fluorescence intensity (anti-Fc-PE) against cell count for the Bococizumab and 5A10-i cell display populations at 1, 8 and 21 days post transfection (dpt) with a staining of wild-type HEK293 cells included as a negative control. Figure 11. Alignment of Bococizumab VH with human germ-line sequences (IMGT). Bococizumab VH (Query_1) was subject to an Ig Basic Local Alignment Search (IgBLAST) against the human VDJ database. The results are presented as an alignment to the query sequence encompassing framework region 1 (FR1), complimentarity determining region 1 (CDR1), FR2, CDR2 and FR3 in order of percentage identity (second column). The human germ-line is shown in column 1. Residue identity to the Bococizumab VH sequence (.) and differences (single amino acid code) is shown in the multiple alignment. Figure 12. DNA sequences encoding the Bococizumab VH variants and VL plus stop codon template. Variations compared with the original "wild-type" Bococizumab (row f) are highlighted in bold and underlined. The flanking 5' and 3' VH restriction sites (Ncol and Xhol) or VL restriction sites (Nhel and Notl) are underlined. The VL stop codon are highlighted in bold and underlined. Figure 13. Analytical flow cytometry analysis post-MACS purification of the Bococizumab libraries Hek293 cells transfected with the Bococizumab library were MACS purified 7 dpt with either anti-Fc or PCSK9i. (a) Flow cytometry dot plots are shown of anti-Fc expression (FL2, x-axis) plotted against PCSK9 binding (FL4, y-axis) for the post-MACS purified libraries, HEK293 cells and the unsorted library, Bococizumab and 5A10i transfectants, 9dpt. (b) Histogram of fluorescence intensity (anti-Fc, FL2, x-axis) plotted against cell count. Plots are (from top to bottom) the HEK293 control, Bococizumab, 5A10i, Bococizumab Library, anti-PCSK9 MACS purified Bococizumab Library, and anti-Fc MACS purified Bococizumab Library. Figure 14. BD Influx sorter dot plots of Bococizumab libraries previously MACS purified based on antigen binding or anti-Fc. A library of Bococizumab IgG genes were targeted via nuclease-directed integration into the AAVS locus of HEK293 cells. This mixed cell population was first MACS purified based on PCSK9 binding (a) or anti-Fc (b). 16 days post-transfection the MACS enriched libraries were separated on the basis of antibody expression and antigen binding by FACS using a BD Influx sorter. Cells were stained with anti-Fc labelled with phycoerythrin (PE) and PCSK9-biotin / streptavidin labelled with allophycocyanin (APC). Analysis was focused on viable cells using forward scatter and staining. Cells positive for staining in the λem=450 / 40, λexc=355 channel (representing non-viable cells which took up 7-AAD) were excluded. The dot-plot shows fluorescence intensity for anti-Fc-PE (x-axis), representing antibody expression level, plotted against fluorescence intensity for antigen binding (PCSK9-biotin / streptavidin-APC) on the y-axis. The gate chosen for analysis are labelled P5 and P6 are shown as boxes on the dot-plot. Figure 15. Bococizumab VH distribution after mammalian display selection. Random unselected input clones (84), antigen sorted (75) and Fc selected (85) were sequenced and the VH identity determined. A histogram plot shows the VH germ-line identity on the x-axis plotted against the percentage occurrence for the input (white filled bars), antigen MACS followed by antigen and anti-Fc FACS selected (black filled bars) and anti-Fc MACS followed by antigen and anti-Fc FACS selected (grey filled bars) mammalian cell display selected populations. Figure 16. Bococizumab VL sequence analysis after mammalian display selection. Random un-selected input clones (84), antigen sorted (75) and Fc selected (85) were sequenced and the VL sequence determined. The average pl and aliphatic index was calculated for the 3 mutated codons. This showed a reduction in both pl and aliphatic index for the mammalian display selected antibodies. Figure 17. Table listing the mammalian display Bococizumab clones, enriched for antigen binding by MACS followed by FACS enrichment for both antibody display level (anti-Fc) and antigen binding. Clones were sequenced and the VH CDR1 and CDR2 and VL CDR2 and CDR3 single letter amino acid sequences are shown with variations from the original Bococizumab sequence highlighted in bold and red. Targeted amino acids which retained the Bococizumab sequence are underlined. Binding of antibodies, including the original parental antibodies Bococizumab and 5A10-i, to antigen in a capture ELISA was performed and the binding signal in fluorescence units is shown in column 2. The AC-SINS assay was performed as described previously by Liu et al, 2014 30< and column 3 shows the maximal absorbance wavelength shift compared to a no antibody PBS control (nm). The selected human VH germ-line is also indicated in column 6 by letter as detailed in Example 5: a: VH Y33A - IGHV1-3*01 b: VH Y33D-IGHV1-8*01 c: VH S52N, F54S, R57S - IGHV1-46*01 d: VH Y33A, S52N, F54S, R57S (a. and c. mutants combined) e: VH Y33D, S52N, F54S, R57S (b. and c. mutants combined) f: Bococizumab "wild-type" sequence Figure 18.. HPLC-SEC of anti- PCSK9 IgG1 antibodies. Antibodies were expressed by transient transfection of Expi-293 cells, affinity purified by protein A chromatography and dialysed. Samples (2µl at 1 mg / ml ) were loaded onto an Agilent AdvancedBio SEC 300A, 2.7um, 4.6x300mm column (Agilent Technologies, Cat. No. PL1580-5301) at a flow rate of 0.35ml / min using an Agilent 1100 HPLC instrument. A plot of retention time against absorbance is shown for selected antibodies. From black to progressively lighter shades of grey are: 5A10-i, 884_01_G01 (identified by mammalian cell display), Bococizumab and Alirocumab. Figure 19. Gel filtration analysis Nivolumab (a) and Vesencumab (b). Antibodies were expressed by transient transfection of Expi293 cells followed by protein A affinity purification and dialysis. Purified Nivolumab (0.5 ml, 1.3 mg / ml) or Vesencumab (0.5 ml, 1.2 mg / ml) were loaded onto a Superdex 200 10 / 300 column connected to an AKTA Pure system using a PBS (pH 7.4) running buffer. The elution volume (ml) us plotted on the x axis against the absorbance at 280 nm (mAU) on the y-axis. The elution volume (Ve) for Nivolumab and Vesencumab was 12.0 ml and 13.7 ml respectively. Figure 20. Stability determination of Nivolumab (a)and Vesencumab (b) after storage at 4oC, 2 weeks. Vesencumab and Nivolumab were purified by size exclusion chromatography (see Figure 19) and their concentrations adjusted to 0.5 mg / ml in PBS (pH7.4). The antibodies were then stored at 4°C for 2 weeks. Dynamic light scattering measurements were performed at 20oC using a Zetasizer APS (Malvern Instruments, Malvern, UK) according to the manufacturer instructions. The hydrodynamic radius was evaluated with the Einstein-Stokes equation and plotted against scatter intensity. A single mono-disperse peak was observed for Nivolumab (a) in comparison to multiple aggregate peaks for Vesencumab (b). Figure 21. Human serum binding to IgG on cell surface. Analysis was focused on viable cells using forward scatter and staining in the FL3 channel. Cells positive for staining in the FL3 channel (representing non-viable cells which took up 7-AAD) were excluded. Cells were transfected with plNT17-Nivolumab or plNT17-Vesencumab in presence of the AAVS TALENs. Stable populations were selected with Blasticidin. 20 days post-transfection, cells were stained with anti-Fc PE (FL2) and human serum (H4522, Sigma) labelled with Dylight 633 (325-0000, Innova). Panels are untransfected HEK293 cells (a), plNT17-Nivolumab (b) or pINT17-Vesencumab (c) transfected HEK293 cells. Figure 22. Relationship between affinity, concentration of antigen and concentration of antibody a Concentration of complex using 0.1nM antigen with differing concentrations of antibody of either K D 10nM (dashed line) or 0.1nM (solid line). bi Relative selectivity of binding to 0.1nM antigen for higher affinity antibody (K D 0.1nM) versus lower affinity (K D 10nM) at different antibody concentrations Even with low ("stringent") antigen concentrations, there is relatively little selectivity at high antibody concentrations but this increases as the antigen concentration drops. Figure 23. Splice acceptor / donor variants to control antibody display level. The nucleic acid sequence from the Hindlll site to the 5' intron, including the splice donor region is shown for the pINT17-J9, J10, J29 and J30 variants. The original human "wild-type" sequence is J9 and the nucleotides varying from J9, at the splice junction, for J10, J29 and J30 are underlined. Figure 24. pINT17-J30, a dual promoter antibody IgG expression cassette for reduced display surface expression. The annotated nucleic acid sequence is shown between the Xhol (4804) and Sbfl (8387) restriction sites. Features: IgG1 CH1-3 4805-5808 Splice junction 5801-5802 Intron 5802-7104 M1 exon 7105-7239 BGH pA 7264-7478 AAVS right homology arm 7544-8381 3' β-globin insulator 8421-8492 Figure 25. Reduced surface expression of IgG on the cell surface using alternative transmembrane domain and splice variants. Analysis was focused on viable cells using forward scatter and staining in the FL3 channel. Cells positive for staining in the FL3 channel (representing non-viable cells which took up 7-AAD) were excluded. Cells were transfected with plNT17 targeting vectors in presence of the AAVS TALENs. Stable populations were selected with Blasticidin. 27 days post-transfection, cells were stained with anti-Fc PE (FL2). Flow cytometry dot-plot panels include pINT17-J9-Nivolumab (a), pINT17-J10-Nivolumab (b), pINT17-J29-Nivolumab (c), pINT17-J30-Nivolumab (d) and pINT17-BSD-Nivolumab (e). Figure 26. Quantitation of IgG display level on the cell surface for antibodies expressed from the pINT17-BSD or pINT17-J30 targeting vectors Calibration beads FL2 staining was performed as described in the manufacturer instructions for the Quantum Simply Cellular anti-mouse IgG beads (catalogue number 815, Bangs Laboratories Inc) stained with mouse IgG - PE label. (a) Labelled histogram plot shows staining of the calibration bead set with peaks labelled 1, 2, 3 and 4 representing bead copy numbers of 12257, 72745, 283360, 886417 respectively. The blank peak represents bead with no capture antibody. (b) Calibration graph showing median fluorescence intensity (x-axis) plotted against copy number (y-axis). Cells-lines displaying 337_1_C08 (c) and Nivolumab (d) from either the pINT17-BSD or pINT17-J30 expression cassette were stained with anti-Fc-PE (5 µl, 0.1 mg / ml; 10 5< cells). Analysis was focused on viable cells using forward scatter and staining in the FL3 channel. Cells positive for staining in the FL3 channel (representing non-viable cells which took up 7-AAD) were excluded. Histogram plots show fluorescence intensity against cell count for the pINT17-BSD with PDGFR TM (labelled and solid black line), pINT17-J30 (labelled and dotted line) and wild-type HEK293 cell lines (grey solid line) for cells displaying 337_1_C08 (c) and Nivolumab (d) respectively. Figure 27. Separation of antibodies with different affinities for their target by mammalian display is enabled by a reduction in cell display copy number. Hek293 cells displaying Nivolumab and 337_1_C08 antibodies were labelled with 50nM cell tracker green and 50nM cell tracker red respectively. (a) demonstrates the display using the J30 splice variant and (b) demonstrates the display using PDGFR transmembrane domain encoded by the pINT17-BSD vector. Labelled cells were mixed equally and MACS sorted based on antigen binding. Sorted cells were analysed using the intellicyt flow cytometer. Dot plots represents Nivolumab on x-axis (FL1) and 337_1_C08 on y-axis (FL4). Panel i, ii, iii and iv represents 10nM, 1nM, 0.1nM and no antigen respectively employed for MACS purification. Figure 28. pINT18-Tet1, an inducible promoter antibody IgG expression vector for reduced display surface expression. The annotated nucleic acid sequence is shown between the AsiS1 (5) and Sbfl (7672) restriction sites. The vector backbone exterior to the AsiSI and Sbfl sites (7673 - 10922 and 1-4) encompassing the origins of replication and kanamycin resistance gene is identical to pINT17-BSD (Figure 1). Key features: AAVS left homology arm 9-812 Blasticidin resistance gene 853-1254 CMV promoter 1540-2112 Reverse Tet activator (tTA) CDS 2164-3168 SV40 pA 3178-3395 tetO heptamer 3679-3932 Minimal CMV promoter (PminCMV) 3946-4005 BM40 leader 4016-4066 Anti-PD1 MK3475 VL 4068-4413 Human C kappa 4421-4738 Furin cleavage site 4745-4756 P2A peptide 4757-4816 Mouse VH leader with intron 4829-4960 Anti-PD1 MK3475 VH 4962-5321 Optimised human IgG1 CH1-CH3 5322-6317 Myc tag 6318-6347 PDGFR anchor 6348-6503 BGH polyA 6553-6767 AAVS right homology arm 6829-7666 3' β-globin insulator 7706-7777 f1 replication origin 7824-8237 pUC replication origin 8458-9132 Kanamycin resistance gene 9852-10646 Figure 29. Inducible mammalian display expression Histogram representing staining results from a HEK293 cell line co-transfected with pINT18-Tet1-377_1_C08 and TALE nucleases and a stable cell population selected for 20 days in the presence of blasticidin. The sample was split into 5 x 10 5< cells / ml in 20mls and induced with either 20ng / ml, 2ng / ml and 0ng / ml Doxycycline. 24 hours post induction, a flow staining was carried out using 1 x 10 6< cells from each doxycycline induced sample. Cells were stained using anti-Fc-PE and TOPRO-3 viability stain. The histogram shows the fluorescence intensity on the FL2 channel (anti-Fc-PE) plotted against cell count. HEK293 WT control (grey solid line), HEK293-pINT18-Tet1-377_1_C08 stable cell line induced with 0 ng / ml doxycycline (black dashed line), 2 ng / ml doxycycline (black dotted line) and 20 ng / ml doxycycline (black solid line). Figure 30. Binding of cell displayed antibodies to FcRn. HEK293 cells expressing Briakinumab and Ustenkinumab were stained with biotinylated FcRn (50nM) preconjugated with streptavidin PE (11nM) using different buffers: a. Hek293 WT b. Streptavidin PE-control c. Cells stained with buffer pH6.0 d. Cells stained with buffer pH7.4 Figure 31. FACS separation of HEK293 cell displayed anti-Mesothelin IgG by display level. A population of anti-Mesothelin antibody genes were integrated into the human AAVS locus of HEK293 cells by nuclease mediated gene transfer. The polyclonal population of HEK293 cell displayed antibodies were separated by FACS according to antibody display level by staining with anti- human Fc-PE. 16 days post-transfection the MACS enriched libraries were separated on the basis of antibody expression by FACS using a BD Influx sorter. Cells were stained with anti-Fc labelled with phycoerythrin (PE). Analysis was focused on viable cells using forward scatter and staining. Cells positive for staining in the λem=450 / 40, λexc=355 channel (representing non-viable cells which took up DAPI) were excluded. The histogram shows fluorescence intensity for anti-Fc-PE (x-axis), representing antibody expression level, plotted against cell count on the y-axis. The gate chosen for analysis are labelled P4, P6 and P5 representing the low, medium and high display level populations respectively. Figure 32. HPLC-SEC of two anti-mesothelin IgG1 antibody clones originating from the high display level group (solid line) and low display level group (dotted line) respectively. Figure 33. DNA binding and depletion of DNA binders using MACS. (A) Overlay of HEK293 cells (solid grey), or HEK293 cells displaying ustekinumab (dashed), briakinumab (long dashed) and amatuximab (dotted) stained with biotinylated DNA detected with streptavidin PE; (B) Dot plot representing the mixture of three antibody cell populations displaying ustekinumab (unlabelled, Q4), amatuximab (labelled with CellTace Far red, X-axis) and briakinumab (labelled with CellTrace CFSE, Y-axis) stained with DNA before MACS sorting; (C) Dot plot of flow-through showing the depletion of DNA binders. Figure 34. Dual staining with Heparin-FITC (x-axis) and anti-human Fc APC (y-axis). (a) Dot plot showing overlay of ustekinumab (grey) and briakinumab (black). (b) Dot plot showing overlay of ustekinumab (grey) and ganitumab (black). Gate within the overlay plots indicates the cells to be high expressers and non-binders to heparin. Figure 35. Dual staining with chaperones conjugated with DyLight 633 (x-axis) and anti-human Fc PE (y-axis). (a) Dot plot showing overlay of ustekinumab (grey) and briakinumab (black) double-stained with Hsp70-DyLight 633 and anti-human Fc PE. (b) Dot plot showing overlay of ustekinumab (grey) and briakinumab (black) double-stained with Hsp90-DyLight 633 and anti-human Fc PE. Gate within the overlay plots indicates the cells to be high expressers and non-binders to chaperones (Hsp70 and Hsp90). (c and d) Overlay histogram plot shows lenzilumab and brentuximab binding Hsp70 and Hsp90 respectively. Figure 36. Histogram plots for antibodies stained with anti-human Fc PE and various polyreactivity probes. Stable monoclonal HEK293 cell lines, displaying a selection of antibodies, were created by nuclease mediated gene integration. Histograms plots of cell count (y-axis) against fluorescence intensity (x-axis) are shown for different antibodies displayed on the surface of HEK293 cells with the following probes: (a) anti-human Fc-PE, (b) biotinylated DNA detected using streptavidin PE, (c) Heparin-FITC, (d) Streptavidin PE, (e) Hsp70-DyLight 633, (f) Hsp90-DyLight 633 and (g) FcRn pre-conjugated with streptavidin PE. Figure 37. pINT17-Tet-D1.3, an inducible antibody IgG mammalian display expression vector. The full annotated nucleic acid sequence is shown between the AAVS homology arms and promoter-less blasticidin gene from the Bglll to BstZ171 restriction sites. Numbering is from the Bglll restriction site. Key features are listed below. BGH poly A 223-9 (reverse strand) Human C kappa 544-236 (reverse strand) D1.3 VL 877-549 (reverse strand) Human VL leader with intron 1168-883 (reverse strand) TRE3G promoter 1230-1618 CMV promoter 1237-1809 VH leader with intron 1644-1782 D1.3 VH 1783-2127 IgG1 CH1-3 2125-3120 Myc tag 3121-3150 PDGFR anchor 3151-3306 BGH poly A 3356-3570 pEF promoter 3621-4955 rtTA-3G 5063-5809 SV40 poly A 5832-6274 Figure 38. Inducible IgG mammalian display cell lines. 1549_02_D06 (1), 1535_01_E03 (2), and 337_1_C08 (3), bococizumab (4), 884_01_G01 (5), 5A10i (6) and alirocumab (7). 27 dpt the cell lines were induced by the addition of 0 (a), 2 (b), 4 (c) or 100 (d) ng / ml doxycycline. 24 hours post induction the cells were stained with anti- Fc-PE. Histograms of fluorescence intensity (anti-Fc, FL2, x-axis) plotted against cell count. Figure 39. Inducible IgG mammalian display cell lines: cell surface IgG turn-over pINT17-Tet harbouring the VH and VL of anti-PD1 antibodies: 1549_02_D06 (1), 1535_01_E03 (2), and 337_1_C08 (3) and the anti- PCSK9 antibodies bococizumab (4), 884_01_G01 (5), 5A10i (6) and alirocumab (7) was used to create stable HEK293 cell lines by AAVS TALE nuclease mediated gene integration and blasticidin selection. 27 dpt the cell lines were induced by the addition of 100 ng / ml doxycycline. 48 hours post induction the cells were stained with anti- Fc-PE. Histograms of fluorescence intensity (anti-Fc, FL2, x-axis) are shown plotted against cell count. Figure 40. Cell lines displaying the anti-PD1 antibodies 1549_02_D06 (K D = 2.9 nM for PD-1) and 337_1_C08 (K D = 74 nM for PD-1) were induced with (a) 0, (b) 2, (c) 4 and (d) 100 ng / ml doxycycline respectively. Dot plots of fluorescence in the FL1 channel (y-axis) against forward side-scatter (FSC, x-axis) are shown. Labelled cells displaying 1549_02_D06 are shown in the upper quadrant in each dot plot and unlabelled cells displaying 337_1_C08 are shown in the lower quadrant. Panels i, ii, iii and iv represent 0.1, 1, 10 nM concentration of PD-1-biotin respectively employed for MACS purification. Panel iv represents the input pre-MACS population. The percentage of each cell population is shown within each quadrant. Figure 41. Overlay dot plot of double-stained population of ustekinumab (grey) and briakinumab (black). Dual staining with 50 nM FcRn-Avi tag pre-conjugated with streptavidin PE (x-axis) and anti-human Fc APC (y-axis). The gate within the plot represents ustekinumab as the FcRn non-binder which can be FACS sorted from the FcRn binder. Figure 42. Germ-line analysis of the anti- mesothelin variable heavy (VH) domain antibody populations. The chart plots frequency of occurrence in the input and low, medium and high mammalian display gated populations for each VH germ-line. Figure 43. Germ-line analysis of the anti- mesothelin variable light kappa (VLκ) domain antibody populations. The chart plots frequency of occurrence in the input and low, medium and high mammalian display gated populations for each VLκ germ-line. Figure 44. Germ-line analysis of the anti- mesothelin variable light lambda (VLλ) domain antibody populations. The chart plots frequency of occurrence in the input and low, medium and high mammalian display gated populations for each VLλ germ-line. Figure 45. HPLC-SEC of anti- mesothelin IgG1 antibodies. Antibodies were expressed by transient transfection of Expi-293 cells, affinity purified by protein A chromatography and dialysed. Samples (2 µl at 1 mg / ml) were loaded onto an Agilent AdvancedBio SEC 300A, 2.7um, 4.6x300mm column (Agilent Technologies, Cat. No. PL1580-5301) at a flow rate of 0.35ml / min using an Agilent 1100 HPLC instrument. A plot of absorbance at 215 nm against retention time is shown for selected anti-Mesothelin antibodies: 932_01_A03 (black line), originating from the high display level group and 930_01_A12 (alternating dot and dash) 930_01_B02 (long dash), 930_01_C12 (short dash line) originating from the low display level group. Figure 46. Alignment of the human and CHO AAVS intron 1 TALE-nuclease (TALEN) target binding sites. The CHO AAVS intron 1 DNA sequence was obtained from the ENSEMBL annotated CHO-K1 glutamine synthetase (GS) knockout cell line, accession: CHOK1GS_HDv1:scaffold_52:2374828:2406177:1. Numbering is referenced to human PPP1R12C intron 1 start. Bold indicates the left and right arms of the human TALEN target sites. Asterisks indicate homology between the human and CHO sequence and dash (-) indicates a deletion. Underline and italic indicate the ends of the AAVS left and right homology arms within the plNT17 targeting vector. This alignment was used to design CHO AAVS homology arms within the pINT17-CHO targeting vector and, for comparison, CRISPR / Cas9 guide RNAs. Sense or anti-sense CRISPR guide RNA recognition sites numbered 1 to 3 are shown above or below the sequence respectively. Figure 47. CHO AAVS homology arms within the vector pINT17-BSD-CHO, a dual promoter antibody IgG expression cassette for surface expression on CHO cells. An annotated DNA sequence is shown for the left and right CHO AAVS homology arms within the vector. All remaining features, including those not shown in this figure, encompassing the dual promoter antibody expression cassette, are as described for the vector pINT17-BSD (Figure 1) and are listed below Features: CHO AAVS left homology arm 9-899 Blasticidin resistance gene 942-1343 pEF promoter 1611-2794 BM40 leader 2834-2885 Humanised D1.3 VL 2888-3219 Human C kappa 3227-3532 BGH poly A 3468-3682 CMV promoter 3790-4362 Mouse VH leader with intron 4388-4515 Humanised D1.3 VH 4521-4868 Optimised human IgG1 CH1-CH3 4869-5864 Myc tag 5865-5894 PDGFR anchor 5895-6050 BGH polyA 6100-6314 CHO AAVS left homology arm 6376-7266 f1 replication origin 7424-7837 pUC replication origin 8058-8732 Kanamycin resistance gene 9452-10246 Figure 48. Display of antibodies on the surface of CHO cells by TALEN or CRISPR / Cas9 nuclease mediated gene integration. Histograms of fluorescence intensity (anti-Fc, FL2, x-axis) plotted against cell count. Plots are (from top to bottom) the CHO control, pINT17-BSD-CHO V2-Nivolumab minus nuclease, pINT17-BSD-CHO V1- Nivolumab minus nuclease, pINT17-BSD-CHO V1- Nivolumab plus CHO TALENs, pINT17-BSD-CHO V1- Nivolumab plus CRISPR3, pINT17-BSD-CHO V1- Nivolumab plus CRISPR2, pINT17-BSD-CHO V1- Nivolumab plus CRISPR1. Figure 49. Display levels of antibodies on the surface of CHO. Histograms of fluorescence intensity (anti-Fc, FL2, x-axis) plotted against cell count for CHO cells (filled plot) (a) Bococizumab (solid line) and 884_01_G01 (dashed line). (b) MEDI-1912 (solid line) and MEDI-1912-STT (dashed line). Figure 50. Creation of a "developability enhanced" population using mammalian display for subsequent binding selection a. Sequences of anti-PD1 337_1_C08 VH (i) and VL (ii) chains. Nucleotide sequences are shown with translation single letter amino acid code above the codons. CDRs are annotated (under-lined) and CDR3 amino-acids subject to site-directed mutagenesis highlighted in bold. b. The anti-PD1 antibody VH and VL CDR3 mammalian display library was separated by FACS on the basis of high, medium and low antibody cell display levels and the analysed by analytical flow cytometry by staining with anti-Fc-PE. Histogram plots of cell count (y-axis) against Fc expression (x-axis) are shown (from top to bottom) the high (i), medium (ii) and low (iii) anti-PD1 populations. For reference, the starting anti-Fc MACS population (iv), the "wild-type" 337_1_C08 parental clone (v) and HEK293 cells with no displayed antibody (vi) are shown. Figure 51. pINT17-Bi-CMV-Emicizumab, a bi-directional CMV and elongation factor (pEF) promoter containing plasmid for cell surface expression of the bi-specific "knobs-into-holes", common light chain IgG Emicizumab. This is a tri-cistronic targeting vector with three promoters driving the expression of three genes: the anti- FIXa heavy chain, the anti-FX heavy chain and common light chain. The full annotated nucleic acid sequence is shown between the AAVS homology arms from the Bglll to BstZ171 restriction sites. Numbering is from the Bglll restriction site. Key features are listed below. BGH poly A 222-8 (reverse strand) Human C kappa 546-232 (reverse strand) Emicizumab VL 876-547 (reverse strand) Human VL leader with intron 1143-884 (reverse strand) Minimal CMV promoter 1230-1167 (reverse strand) CMV promoter 1237-1809 Mouse VH leader with intron 1835-1973 Emicizumab anti-FIXa VH 1974-2339 Emicizumab anti-FIXa CH1-3 2340-3317 Myc tag 3318-3347 PDGFR anchor 3348-3503 BGH poly A 3553-3767 pEF promoter 3818-5152 Human VH leader with intron 5260-5401 Emicizumab anti-FX VH 5402-5758 Emicizumab anti-FX CH1-3 5759-6733 Myc tag 6734-6763 PDGFR anchor 6764-6916 SV40 poly A 6942-7384 Figure 52. Binding of FIXa and FX to the bi-specific antibody Emicizumab displayed on the surface of HEK293 cells pINT17-Bi-CMV-Emicizumab or pINT17-BSD-anti-FIXa was used to transfect HEK293 cells in the presence of plasmids encoding the AAVS TALENs. 24 hours post transfection the cells were analysed antibody display and the ability to bind the antigens FIXa or FX. The histogram plots depict cell count against fluorescence intensity when stained with, from left to right: anti-Fc-APC, FX-biotin or FIXa-biotin, pre-conjugated with streptavidin-PE or streptavidin-PE alone for HEK293 cells displaying (a) Bi-specific Emicizumab (black dash line), (b) anti-FIXa IgG (solid blck line), (c) HEK293 cells. Figure 53. Alignment of Emicizumab VL with parental Emicizumab VLs. CDRs are indicated by bars above the sequence. Dots indicate identity with the final Emicizumab VL. Residues contributing to the positive charge patch are highlighted in bold. Figure 54. Relationship between display of knotbodies on the surface of HEK293 cells and their biophysical properties (a) HEK293 cells were transfected with plNT17-knotbodies in presence of the AAVS TALENs. Stable populations were selected with Blasticidin. 7 days post-transfection, cells were stained with anti-Fc PE (FL2) and analysed by flow cytometry. The histogram depicts cell count (y-axis) plot against fluorescence intensity (anti-Fc-PE, x-axis) and include the KB_A12 EETI-II (black solid line), KB_A12 Hstx1 (dotted line) and KB_A12 ProTxlll (dashed line). The traces of KB_A12 Hstx1 (dotted line) and KB_A12 ProTxlll (dashed line) over-lap and appear merged. Knotbodies were expressed by transient transfection of Expi293 cells and purified by Protein A affinity chromatography. The knotbodies were analysed by HPLC-SEC as described above and plots of absorbance against elution volume are shown for (b) KB_A12 EETI-II, (c) Trastuzumab and (d) KB_A12 ProTx-III. Figure 55. Mutant libraries of knotbodies contain clones with improved display levels compared with the parental knotbodies. HEK293 cells displaying knotbodies were stained with anti-Fc-PE and analysed by flow cytometry. Histogram plots of cell count against fluorescence intensity are shown for the three libraries (after anti- Fc MACS purification) compared to their relevant parental knobody control displaying cell line. (From Left to Right): (a) KB_A12 ProTxlll Library Set A (dotted line) with KB_A12 ProTxlll Control (filled line), (b) KB_A12 ProTxlll Library Set B (dotted line) with KB_A12 ProTxlll Control (filled line), (c) KB_A12 HsTx1 library (dotted line) with KB_A12 HsTx1 Control (filled line). EXAMPLESExample 1. Construction of targeting vectors for soluble expression and cell surface displayed IgG formatted antibodies

[0265] To enable the display of binder molecules, including antibodies, on the surface of higher eukaryotic cells and their subsequent genetic selection, vectors may be used to target the binder gene to a particular location in the host genome. The vector may encode a selectable marker, to enable selection of stable cell lines and this selectable marker may encode genes conferring resistance to blasticidin, G418 / Geneticin, hygromycin, puromycin or zeocin. The targeting vector may contain an exogenous promoter to drive expression of the gene encoding the selectable marker. Alternatively, the transgene may be integrated into the cellular DNA at a location downstream of an endogenous promoter to enable the preferential selection of the correctly integrated transgenes. The targeting vector will also encode homology arms to allow homologous recombination to the relevant chromosomal locus and promoters to drive expression of the binder molecule and polyadenylation (pA) sites. The binder molecule gene will be fused to DNA encoding a leader sequence to allow secretion, via the endoplasmic reticulum (ER), to the cell surface and a membrane anchor such as a transmembrane domain or glycosylphosphatidylinositol (GPI) anchor.

[0266] A schematic map of the targeting vector used here is shown in Figure 1a and the full annotated DNA sequence is shown in Figure 1b. The plasmid includes the AAVS homology arms, flanking the expression cassette, to allow homologous recombination of the transgene into the human AAVS site. The AAVS locus was originally identified as a common integration site of the adeno-associated virus and is a "safe harbour" locus for insertion and expression of heterologous genes in human cells 93< . After nuclease mediated cleavage within the AAVS site, the AAVS homology arms in the targeting vector promote the integration of the expression cassette by homologous recombination. The blasticidin gene lacks a promoter within the vector, but is preceded by a splice acceptor that creates an in-frame fusion with the upstream exon from the AAVS locus. The details of the antibody heavy and light chain expression cassette are described below and in Figure 1.

[0267] The targeting vector pINT17-BSD (Figure 1a and 1b) was constructed by polymerase chain reaction (PCR) amplification of selected fragments from vectors previously described (WO2015166272A2) with the addition of restriction sites to enable their subsequent assembly. The origins of the various elements of pINT17-BSD are now described. DNA encoding the AAVS-left homology arm, splice acceptor, blasticidin resistance gene, poly-adenylation site and the elongation factor 1 alpha promoter (pEF1α) originated from the pD2 plasmid (WO2015166272A2) by PCR amplification (1511 bp) with the addition of the 5' AsiSI and 3' Bglll restriction enzymes. DNA encoding the Myc-tag and PDGFR transmembrane domain was PCR amplified from the pD2 plasmid with the addition of a 5' IgG1 CH3 homology sequence and 3'-Hindlll site. DNA encoding the light chain BM40 leader, variable light chain (VL) of the anti- lysozyme antibody D1.3 94< , the human constant light (CL), bovine growth hormone (BGH) pA, the immediate early cytomegalovirus promoter (CMV promoter), a mouse heavy chain leader split by an intron, variable heavy chain (VH) of the anti- lysozyme antibody D1.3 and the IgG1 antibody constant heavy domain 1 to 3 (IgG1 CH1-3) was PCR amplified from the previously described pINT3 plasmid (WO2015166272A2) with a 5' Bglll site and 3' addition of DNA encoding the Myc-tag. The two fragments encoding the 4446 bp region of pINT17-BSD from Bglll to Hindlll were combined by PCR assembly to add the PDGR transmembrane domain directly to the CH3 terminus. The region from Hindlll to Sbfl, encoding the AAVS right homology arm was PCR amplified (1168 bp) from the pD2 plasmid (WO2015166272A2) with the addition of the Hindlll and Sbfl restriction sites. The vector backbone encompassing the f1 and pUC origin of replications and Kanamycin resistance gene from the Sbfl to AsiSI sites originated from pSF-EF1alpha (Oxford Genetics OG43). The example shown in figure 1b encodes the VL and VH of a human anti-lysozyme antibody but this can be conveniently substituted for other specificities using standard molecular biology techniques (for example using the flanking restriction enzymes to replace the VL and VH genes).Example 2. Comparison of surface presentation level of parental and developability enhanced clones for 3 pairs of antibodies

[0268] We examined three antibody pairs where the original parental antibody possesses a poor developability profile and their re-engineered daughter molecules, which were altered to improve their self-interaction and cross-interaction properties. The panel included CNTO607, a monoclonal antibody against interleukin IL-13, and its modified counterpart CNTO607 W100A 14< . CNTO607 is poorly soluble at neutral pH, precipitates in PBS buffer at high concentrations and displays self-interaction as measured in an affinity-capture self- interaction nanoparticle spectroscopy (AC-SINS) assay 39< . Structure determination of CNTO697 revealed a hydrophobic patch in the heavy chain CDR3. The VH CDR3 mutation W100A improved both its antibody solubility and cross- interaction chromatography (CIC) profile 47< . CIC measures binding to human serum polyclonal antibodies immobilized on a column matrix. A second example is a monoclonal antibody, named Ang2mAb, which targets Angiopoietin 2, a soluble ligand for the Tie2 receptor and regulator of pathological angiogenesis. However, Ang2mAb was reported to exhibit both poor expression and aggregation. A combination of structural modelling and experimental screening of 19 variants led to the engineering of the better expressing Ang2mAb C49T 6< , which mutated an unpaired cysteine residue. Finally, we included MEDI-1912, an anti-nerve growth factor (NGF) antibody that inhibits signaling via the TrkA and p75 receptors 7< . MEDI-1912 could potentially be used in the treatment of chronic pain, but shows precipitation and aggregation in solution and a poor pharmacokinetic profile. MEDI-1912 binds to NGF with pico-molar affinity and was affinity matured from a "grand-parental" antibody named MEDI-578 which was well-behaved in terms of self-aggregation. By hydrogen / deuterium exchange - mass spectrometry (HDX-MS) and molecular modelling, a hydrophobic patch was identified on the VH domain caused by residues within VH CDR1 and CDR2. This allowed the prediction of the amino acids responsible for self-association and consequent aggregation. This in turn enabled the design of a triple mutant (MEDI-1912_STT) with mutations W30S, F31T and L56T that interrupted the self-interaction interface whilst retaining potency and affinity for NGF 7< .

[0269] Synthetic DNA encoding the CNTO607, CNTO607-W100A, Ang2mAb, Ang2mAb-C49T, MEDI-1912 and MEDI-1912_STT heavy and light variable domains (see Table 1) for sequences) were cloned into the mammalian display vector pINT17-BSD (see Example 1 for vector maps and sequences), DNA sequence confirmed and transfection quality plasmid DNA prepared. Suspension adapted HEK293 cells were seeded at 5 x 10 6< cells per ml in HEK FreeStyle 293 expression media one day before transfection. PEl-transfection was performed when the cells reached a density of 1 x 10 6< cells / ml in 10 ml. plNT17-harboring antibody genes (1 ug), left and right TALEN plasmids (5 ug each) were mixed and diluted in unsupplemented HEK FreeStyle 293 expression media (1ml). Polyethylenimine (PEI), linear, 25000 Da MW (10 ul, 1 mg / ml, Polysciences ) was added, incubated for 10 minutes at room-temperature. The plasmid DNA / PEI mix was then added to HEK293 suspension cells (1 x 10 6< cells / ml in 10 ml HEK FreeStyle 293 expression media). Blasticidin selection was started 48 hours after transfection at a concentration of 7 µg / ml. The population was kept under selection for the duration of the experiment. After 15 days post-transfection (dpt) cells were stained with anti-human Fc PE (Biolegend). The monoclonal cell lines displaying antibodies were then stained by the following protocol. HEK293 cell lines displaying antibodies or wild-type HEK293 cells (one million cells) were pelleted (200g, 3 minutes in an Eppendorf tube (1.5 ml). The pellet was resuspended in PBS (1 ml) and centrifuged (600 g, 2.5 min). The pellet was resuspended in 1% BSA, PBS (100 µl) containing anti-Fc PE (5 µl, Biolegend). The mix was incubated, shielded from light, at 4°C for 30 min. 0.1% BSA, PBS (900 µl) was added and cells pelleted (600 g, 2.5 min). The cells were resuspended in 0.1% BSA, PBS (1 ml) and this wash step was repeated once. The cells were resuspended in 0.1% BSA, PBS (200 µl) with 7-AAD (5 µl per million cells). Labelled cells (50 µl) were analysed using the Intellicyte iQue screener. Flow cytometry analysis ( Figure 2) showed increased antibody display levels for the improved display levels for the improved daughter molecules for all three antibody pairs compared with the original problematic parental molecules. Table 1. Protein sequence of VH and VL genes of test antibodies. Amino acid sequences in single letter code are shown of the variable antibody heavy and light chains. The variable domains are underlined. Variant residues between antibody pairs are highlighted in bold. ChainProtein SequenceAng2 VHAng2 VLAng2 VL C49TCNT607 VHCNT607 VH W100ACNT607 VLMEDI-1912 VHMEDI1912 VH STTMEDI-1912 VLVesencumab VHVesencumab VL Example 3a. The relationship between cell surface presentation level and self-interaction at high concentrations

[0270] To examine the properties of the antibodies described in Example 2, antibody expression and purification was performed. Synthetic DNA encoding CNTO607, CNTO607-W100A, Ang2mAb, Ang2mAb-C49T, MEDI-1912 and MEDI-1912_STT heavy and light variable domains (see Table 1 for sequences) were cloned into a dual promoter IgG soluble expression vector based on pINT3 (WO2015166272A2) and correct cloning confirmed by DNA sequencing.

[0271] Plasmid DNA was prepared and this was used to transfect Expi293 cells (30 ml final culture volume scale) using the transfection reagent ExpiFectamine according to the manufacturer instructions (A14525, ThermoFisher Scientific). Cells were seeded at a density of 2 x 106 cells / ml in 25.5 ml of Expi293 Expression Medium 24 hours prior to transfection. Plasmid DNA (30 µg) was diluted in Opti-MEM Medium (1.5 ml) and ExpiFectamine 293 Reagent (80 µl) was diluted in Opti-MEM Medium (1.5 ml) and incubated for 5 minutes at room temperature. The diluted plasmid DNA (30 µg in 1.5 ml Opti-MEM Medium) was then added to the diluted ExpiFectamine 293 Reagent (80 µl ExpiFectamine in 1.5 ml Opti-MEM Medium) and incubated for 20 minutes at room temperature. The cells were incubated at 37°C, 5 % CO2, 5 % humidity and agitated at 130 rpm (25mm orbital throw, ISF1-X, Climo-Shaker, Kuhner). Following 5 days of expression, culture supernatant was harvested by centrifugation (2000 g, 20 min).

[0272] The culture supernatants in 50 ml centrifuge tubes were pH adjusted by the addition of 1 / 10 volume of PBS (pH7.4) and Protein A sepharose FF resin (300 µl, Generon, PC-A100) added and incubated by agitation for 1 hour at room-temperature. The 50 ml tubes were centrifuged at 2000 g for 5 mins to collect the beads and supernatant discarded leaving approximately 1 ml behind of bead slurry. This slurry was resuspended loaded onto a column with a frit (Proteus "1 step batch" midi spin column. Generon, GEN-1SB08), centrifuged (50g, 1 min at 4°C) and flow through discarded The column was washed with 2xPBS (2 x 10 ml) followed by centrifugation (50g, 1 min at 4°C) after each wash step. Antibody was eluted using elution buffer (900 ul, 0.2M Glycine pH 2.6) which was added to the column matrix and the eluate immediately neutralized using neutralisation buffer (300 ul, 1M Tris-HCl, pH 8). Antibodies were then eluted from the Protein A sepharose column by centrifugation (50g, 1 min at 4°C) directly into the neutralisation buffer. The antibodies were buffer exchanged by transfer to a GeBAflex maxi tube (8 kDa molecular weight cut-off, Generon, D045) and dialysed in 4 litres of PBS and incubation for at least 3-18 hours at 4°C. This dialysis step was repeated with a second 4L PBS dialysis step. The antibody yield and concentration was determined by measurement of the absorbance at 280nm and calculating using the Beer-Lambert Law using an estimated extinction coefficient of 1.4 to approximate the concentration.

[0273] The yield of polypeptide generated by transient expression may be considered as an indicator of developability potential. Although comparison of the expression yields in transient transfection between the 3 pairs of antibodies from example 2 showed lower expression of the parental antibody, the significant difference in developability potential was not apparent simply by comparing yield in transient transfection (Table 2). For example, the expression yield of the parental CNTO607 antibody was 34 mg / L whereas the solubility improved CNTO607-W100A antibody expression yield was 55 mg / L. Similarly, the expression yields of parental antibodies MEDI-1912 was 33 compared with 53mg / l for the improved version. The yield of Ang2mAb was 13 mg / L compared with 34 mg / L for the engineered off-spring Ang C49T.

[0274] The melting temperature of a polypeptide is sometimes taken as a surrogate to predict "developability" and in some instances antibodies have been selected for improved melting temperature in the expectation of generating more developable antibodies 9-11< . The melting temperature (Tm) and temperature of the onset of aggregation (Tagg) were determined using Prometheus NT.4B (Nanotemper) according to the manufacturer instructions. Small capillaries were used to take up approximately 8-10 µl of antibody solution at 0.5 mg / ml. The capillaries were then clipped in place for fluorescent scanning by the Prometheus instrument for thermal melt analysis. The Prometheus fitting software was used to determine the temperature for the onset of melting and the temperature for the onset of scattering. The melting temperature (Tm) and the aggregation temperature (Tagg) of the antibodies were similar (see Table 2), both between the antibody pair sets and compared to the clinically approved positive control anti- PD1 antibody, Nivolumab. This data indicates that the melting and aggregation temperatures of this antibody set are not predictive of their biophysical profiles of self-interaction and non-specific cross-interaction.

[0275] During preparative size exclusion chromatography MEDI-1912 displayed an earlier elution profile compared with MEDI-1912_STT (Figure 3), indicating that it exists as a higher molecular weight species and is prone to self-interaction. The remaining antibodies eluted with a similar profile to Nivolumab. To enable measurement of antibody self-interaction by dynamic light scattering (DLS), the size purified antibodies were concentrated by ultra-filtration. The antibody concentration achieved for each antibody pair is shown in Table 2. This revealed that it was not possible to concentrate the parental antibodies MEDI-1912 and CNTO607 beyond 1.4 mg / ml and 1.8 mg / ml respectively before antibody precipitation occurred which blocked the ultra-filtration membrane. In contrast, it was possible to concentrate the solubility enhanced daughter molecules MEDI-1912_STT and CNTO607_W100A to 29 and 30 mg / ml respectively with no evidence of precipitation. No precipitation was observed for the concentrated Ang2mAb pair. Dynamic light scattering (DLS) detected higher order aggregated species for the parental antibodies MEDI-1912 and CNTO607 (Table 2), but not for the daughter molecules MEDI-1912_STT and CNTO607_W100A, as judged from the calculated polydispersity index (PDI) and the cumulant (or z-average) size. For example, PDI for the parental CNTO607 and MEDI-1912 were 0.22 and 0.15 respectively, whereas the PDI for the daughter molecules was 0.1 and 0.12 respectively indicating a more homogenous, mono-disperse state (Table 2). Similarly, the average particle size of the parental MEDI-1912 was 22 nm respectively, whereas the average particle size for the daughter molecule MEDI-1912-STT was 13 nm indicating a lower order aggregation state (Table 2). Thus significant self-interaction is occurring resulting in detectable self-interaction at lower concentrations and precipitation at higher concentrations. Table 2. IgG biophysical properties. The melting temperature (T m ) and temperature of the onset of aggregation (T agg ) were determined using Prometheus NT.4B (Nanotemper) according to the manufacturer instructions. The expression yield in terms of amount of antibody expressed (mg) per liter of culture volume was determined by transient transfection of Expi293 cells at 30 ml scale (ThermoFisher) followed by affinity purification (Protein A) and the yield of purified antibody determined from the absorbance at 280 nm and estimated antibody extinction coefficient of 1.4. Antibodies were further purification by size-exclusion chromatography on a Superdex 200 10 / 300 using the AKTA Pure system with PBS (pH 7.4) running buffer. Dynamic light scattering measurement were performed with a Nano S DLS (Malvern Instruments, Malvern, UK) on samples and polydispersity index (PDI) and the cumulant (or z-average) size (Zav) calculated using the zetasizer software (Malvern Instruments, Malvern, UK). Clone ID Antibody T m (°C) T agg (°C) Expression Yield (mg / L) C-Max (mg / ml) Zav (nm) PDI 1CNTO607 -parental62.675.633.61.816.20.222CNTO607 (W100A)61.475.455.2>3014.80.13MEDI-1912-parental71.573.233.21.421.50.154MEDI-1912 (STT)70.874.852.8>2912.50.055Ang2mAb-parental63.865.013.4>2113.10.126Ang2mAb C49T66.565.234.4>1812.70.0914Nivolumab67.667.3102.8>50ndnd

[0276] This example demonstrates a very clear relationship between the mammalian cell display level of an antibody and its biophysical properties for three different antibody pairs. Parental antibodies specific to IL-13 (CNTO607), Angiopoietin2 (Ang2mAb) and Nerve growth factor (MEDI-1912), with documented problems regarding self-interaction, cross-interaction and poor pharmaco-kinetics (MEDI-1912) all resulted in lower cell display levels compared with their solubility enhanced daughter molecules (Figure 2).Example 3b. Supporting theory on antibody concentration at the cell surface

[0277] This Example presents underlying reasoning that may assist in understanding the inventors' proposal that strong polypeptide expression in a eukaryotic cell can potentially achieve high local concentrations when the polypeptide is retained on the cell surface.

[0278] In the work described here, suspension adapted HEK293 cells are used for antibody display. The HEK293 cell line is of mammalian (human) origin. The cells are approximately spherical with a radius of 10 microns 95< . If we treat the suspension HEK293 cell as a sphere we can calculate the volume occupied by an antibody on its surface. (We assume for the sake of this example that all areas of the cell surface are equally accessible for antibody display. Higher local concentrations of antibody would be achieved if this were not the case.) The radius (r) of a sphere can be calculated from the formula 4 / 3πr 3< = 4.18 r 3< . Taking an antibody to be of height 150 angstroms (Å) (= 15 nm), it will be present in a larger sphere of volume 4.18(r + 150 Å) 3< . Thus the antibody volume is the difference between this and the volume of the cell.

[0279] The volume of a cell of 10 micron radius is: 4.18 × 10 − 15 m 3 4180 × 10 − 15 litre .

[0280] The volume of the larger sphere including the antibody is: 4.198 × 10 − 15 m 3 4198 × 10 − 15 litre .

[0281] Thus the displayed antibody occupies a volume of 0.018 × 10 − 15 m 3 18 × 10 − 15 litre .

[0282] In a similar way we can calculate the difference in volume for different sized cells.

[0283] Knowing the number of antibodies / cell, the molecular weight and the volume occupied we can then calculate the concentration achieved at the cell surface. Using Avogadro's constant we know that 6 x 10 23< antibody molecules / I will have a concentration of 150,000 mg / ml. Thus 6 x 10 18< antibody molecules / ml will have a concentration of 1.5 mg / ml (10 µM). By this approach the concentrations shown in Table 3 are calculated. Cell radius 5 micron 10 micron 15 micron 20 micron Cell volume (x 10 -15< litres)522.5418014107.533440volume occupied by cell plus antibody (x 10 -15< litres)527.241981415033515volume occupied by antibody (x 10 -15< litres)4.718.842.375No. Abs / litre (x 10 18< ) if 10 6< displayed / cell21253.223.6413.3Concentration (mg / ml) assuming 10 6< displayed antibodies53 13.2 5.9 3.3 Concentration (microM) assuming 10 6< displayed antibodies354883922Copy number providing 1mg / ml19,000 75,000 170,000 300,000 Table 3.

[0284] In these calculations the number of antibodies on the cell surface is taken to be 10 6< copies / cell. Methods of experimentally determining copy number are detailed elsewhere herein and illustrated in Example 7.

[0285] We see from Table 3 that display of 10 6< antibodies / cell on a cell of 10 micron radius (such as a HEK293 cell in suspension culture) is estimated to give a concentration in excess of 10 mg / ml. At such concentrations, problems of protein self-interaction can potentially occur. Antibodies with a tendency to aggregate may thus have a reduced representation on the cell surface due to reduced passage through the endoplasmic reticulum 96< and increased degradation. As a result, a lower level of display would be observed for an antibody prone to self-aggregation compared with a non self-interacting antibody.Example 4. Enriching "developability enhanced" anti-NGF antibodies on the basis of surface presentation level

[0286] In Example 3 the relationship between the biophysical properties of an antibody, particularly self-aggregation and their mammalian cell display levels was described. This was illustrated by taking three antibody pairs where the original parental antibody had poor biophysical properties in terms of self and cross-interaction and these properties were improved by changing selected amino acids to create daughter molecules with improved biophysical properties. In all three cases the daughter molecules with improved biophysical properties display on the surface of HEK293 cells at increased levels compared with the problematic parental antibodies. In this example we demonstrate that it is possible to enrich for antibodies with superior biophysical properties from a mixed population of clones by mammalian display. The parental anti-NGF MEDI-1912, which has self-interaction properties and poor pharmaco-kinetics in a mouse model 7< , and the improved daughter MEDI-1912_STT were chosen for this study. A model experiment was carried out where we created a mixed population of HEK293 cells displaying MEDI-1912 or MEDI-1912_STT by transfecting HEK293 cells with equal quantities of mammalian display plasmid (example 1) encoding the parental and modified antibodies along with plasmids encoding the TALE nuclease pair which directed the donor plasmid to the AAVS locus, as previously described (WO2015166272A2) Following drug selection fluorescence activated cell sorting (FACS) was carried out and cell were selected based on high antibody presentation level, isolation of the selected antibody genes and sequence analysis we demonstrate the selected enrichment of antibodies with improved biophysical properties from a mixed population.

[0287] pINT17-MEDI-1912 and pINT17-MEDI-1912_STT (see Example 2 for description) were mixed at a 1:1 ratio and this mix was integrated into the genome of HEK293 cells using nuclease-mediated gene targeting into HEK293 cells. Mid-log-phase HEK293 suspension cells (grown to a cell density of 1 x 10 6< cells / ml) were harvested by centrifugation at 200g for 10 min and resuspended in MaxCyte electroporation buffer at a density of 1x10 8< cells / ml. Plasmid DNA mix consisting of pINT17-MEDI-1912 (1 µg), pINT17-MEDI-1912_STT (1 µg), AAVS directed TALEN vector pair (10 µg each) was added to HEK293 cells (100 µl, 1x 10 7< cells total in MaxCyte electroporation buffer) and transferred into a OC100 electroporation cuvette and electroporated using a MaxCyte STX electroporation system. Following electroporation, cells were recovered at 37°C for 20 min, diluted in HEK FreeStyle 293 expression media and maintained at 120rpm, 37°C under 5% CO2. Blasticidin selection was started 48 hours after transfection at a concentration of 7 µg / ml. The population was kept under selection for the duration of the experiment. 15 days post-transfection cells were stained as described in Example 2 except that DAPI stain replaced the 7-AAD stain, NGF-biotin / Streptavidin-APC stain was employed to detect antigen binding and the quantities scaled up to stain 10 million cells. The MEDI-1912 / MEDI-1912_STT mixed HEK293 mammalian display population was analysed for antibody presentation level by flow-cytometry (Figure 5a) and this revealed two main cell populations displaying different antibody levels. The two populations correlated with the monoclonal MEDI-1912 and MEDI-1912_STT antibody display levels as shown in the overlay plot (Figure 5a). The mixed population was sorted by FACS into two populations: antibody presentation level low and high presentation level groups (Gates 5 and 6 respectively, Figure 5b).

[0288] Genomic DNA was prepared from the FACS sorted cell populations (Gates 5 and 6, Figure 5b). DNA encoding the IgG insert was amplified by nested PCR using KOD Hot Start DNA polymerase (Merck Millipore). Outer PCR was performed with the following genome-specific primers: Forw: CCGGAACTCTGCCCTCTAAC and Rev: TCCTGGGATACCCCGAAGAG. PCR product from the outer PCR was used as a template to amplify the integrated IgG insert with following primers; Forw: GAGGGCCTGGATCTTCTTTCTC and Rev: GAAGTAGTCCTTGACCAGGCAG using KOD polymerase (71086, Merck) according to manufacturer conditions. PCR products were bar-coded by following the manufacturer instructions (20015964, Illumina) and sequenced with the Illumina MiSeq sequencing platform. Approximately one million reads were analysed and this revealed that population sorted for high antibody presentation level (Gate 5, Figure 5b) was enriched for the MEDI-1922_STT antibody (96%, Figure 6). The population sorted for low antibody presentation was enriched for the parental MEDI-1912 antibody (85%, Figure 6). This example demonstrates the selected enrichment of antibodies with improved biophysical properties by mammalian display, from a mixed population, by selecting clones on the basis of antibody cell surface display levels. This was exemplified by the enrichment of MEDI-1912_STT, with superior biophysical properties compared to its parental antibody MEDI-1912 from a mixed population of stable cell-lines.

[0289] We demonstrate that it is possible to enrich for an antibody with superior biophysical properties in a mixed population and we show that it is possible to identify improved antibodies from a large library of variants based only on presentation levels by mammalian display. As discussed residues W30, F31 and L56 on the VH MEDI1912 have potential to form a hydrophobic patch on the surface of this antibody 7< .

[0290] These residues were chosen for randomization and a VH library was constructed by PCR assembly mutagenesis from a synthetic DNA template (see Figure 4 for amino acid and nucleic acid sequences and position of primers). Three PCR products were amplified from the VH template using KOD polymerase (71086-3, Merck) according the manufacturer instructions): a. VH1 (95 bp) amplified with primers MEDI-1912-F3 (CCATGGCCCAGGTTCAGCTG) and MEDI1912_W30NNS_F31NNS b. VH2 (102 bp) amplified with primers MEDI-1912-F (GGCGCCTTTACATGGGTCCGACAG) and MEDI-1912_L56NNS c. VH3 (213 bp) amplified with primers MEDI-1912-F2 (ACCAATCTGGCCCAGAACTTCCAG) and MEDI-1912-R (ACTCGAGACGGTGACCATTGTG)

[0291] The three PCR products (VH1, VH2 and VH3) listed above were combined (10 ng each) and assembled in a PCR reaction with outer primers MEDI-1912-F3 and MEDI-1912-R using KOD polymerase (71086-3, Merck) according the manufacturer instructions). The PCR product was digested with Ncol and Xhol and ligated with Nco1 / Not 1 digested pINT17-MEDI-1912 (the pINT17 mammalian display vector (fig 1) encoding the VL of MEDI1912), (100 ng). This ligation mix was then was purified using the mini-Elute PCR purification kit (Qiagen) and purified ligation mix was transformed into 50µl E.cloni 10G elite electrocompetent cells (60061-1, Lucigen). Cells were pulsed using a 0.1cm cuvette, recovered with 2ml recovery medium and grown for 1h at 37°C, 250rpm. In order to calculate the library size, cells were diluted 1 in 1000 and plated 10µl and 100µl in a 10cm diameter 2TY-Kanamycin plates. The remaining cells were spun down and plated in 2 x 10cm diameter 2TY-Kanamycin plates and incubated at 37°C overnight. Colonies were counted from the 10ul plate and a library size of 1.1 x 10 6< was calculated. Since a library constructed by randomizing three residues using NNS codons encodes 32,768 variants, the experimental library size exceeded the theoretical library size by 34-fold. The transformant plates were scraped, the cell density measured by reading the absorbance at 600nm (OD600), the equivalent of 2 OD units of culture (2x OD600) used to inoculate 50 ml Circlegrow culture, culture grown 3 to 4 hours at 37°C in a 250 ml baffled flask, approximately 400x OD600 units harvested and midiprep plasmid DNA prepared (pINT17-MEDI-1912-library).

[0292] The pINT17-MEDI-1912-library was used for nuclease mediated gene targeting into HEK293 cells. Mid-log-phase HEK293 suspension cells (grown to a cell density of 1 x 10 6< cells / ml) were harvested by centrifugation at 200g for 10 min and resuspended in MaxCyte electroporation buffer at a density of 1x10 8< cells / ml. Plasmid DNA mix consisting of pINT17-MEDI-1912-library (8 µg), AAVS directed TALEN vector pair (40 µg each) was added to HEK293 cells (400 µl, 4 x 10 7< cells total in MaxCyte electroporation buffer) and transferred into a OC400 electroporation cuvette and electroporated using a MaxCyte STX electroporation system. Following electroporation, cells were recovered at 37°C for 20 min, diluted in HEK FreeStyle 293 expression media and maintained at 120rpm, 37°C under 5% CO2. Blasticidin selection was started 48 hours after transfection at a concentration of 7 µg / ml. The population was kept under selection for the duration of the experiment. 15 days post-transfection cells were analysed were stained as described in Example 3. Flow cytometry analysis of the HEK293 displayed MEDI-1912-library (Figure 7c) indicated that the library possessed cells within the mixed population that displayed equivalent antibody display levels as the MEDI-1912_STT monoclonal cell line (Figure 7b) and higher display levels than the parental MEDI-1912 monoclonal cell line (Figure 7a). This suggested that clones were present in the MEDI-1912 population that were equivalent to MEDI-1912_STT in terms of display level.

[0293] The library population was sorted by FACS according to antibody presentation level (Figure 7c), antibody genes were recovered from the P5 and P6 gated populations and the VH gene sequenced by "next generation sequencing" (NextGen) as described above. Figure 8 shows amino acid identity histogram plots for residues 30, 31 and 56 for the mammalian display selected population. This showed an enrichment of amino acids S, T, P at position 31, enrichment of amino acids S, P, N at position 32 and an enrichment of amino acids R, S, T and P at position 56.

[0294] To enable a biophysical characterization of the mammalian display selected antibodies, VH genes were PCR amplified from the genomic DNA of the selected population (Gates P5 and P6 Figure 7), as described in Example 3. VH inserts were cloned into pINT17-MEDI-1912, Ncol and Xhol cut vector harbouring the MEDI-1912 VL, as described above and the ligation mix used to transform E. coli DH10B cells. 188 transformants were picked, plasmid DNA prepared and these were DNA sequenced to identify the identity of the codons at positions 30, 31 and 56. Selected clones, based on the frequency of occurrence by NextGen sequencing (Figure 8), were then picked for expression by transient transfection and affinity purification as described in Example 2. Antibodies were concentrated prior to analysis by dynamic light scattering (DLS) by ultra-filtration. All the antibodies were able to be concentrated to between 8-fold and 29-fold greater than the parental MEDI-1912 antibody (Table 4 ), with no evidence of precipitation at these concentrations, indicating that the selected antibodies had higher solubility than the parental antibody. DLS also showed that the selected antibodies had lower average particle size (Z-Ave) and less polydispersity (PDI) than the parental antibody MEDI-1912 (Table 4 ). Four selected clones (P5_C06, P5_F01, P6_C08 and P6_F02) showed superior or equivalent mono-dispersity compared to the previously reported improved clone MEDI-1912_STT. The improved variants, selected by random sub-library creation and mammalian display selection, on average changed the original hydrophobic residues to hydrophilic residues. Table 4. Selected MEDI-1912 variant biophysical properties. Antibodies were expressed by transient transfection of Expi293 cells at 30 ml scale (ThermoFisher) followed by affinity purification (Protein A). Antibodies were further purification by size-exclusion chromatography on a Superdex 200 10 / 300 using the AKTA Pure system with PBS (pH 7.4) running buffer. Antibodies were concentrated by centrifugal filtration and the concentration obtained are shown (C) in milligrams per ml (mg / ml). Dynamic light scattering measurement were performed with a Nano S DLS (Malvern Instruments, Malvern, UK) on samples and polydispersity index (PDI) and the cumulant (or z-average) size (Zav) calculated using the zetasizer software (Malvern Instruments, Malvern, UK). Amino acid identity is shown in single letter code for positions 30, 31 and 32.IDaa30aa31aa56C (mg / ml)Z-Ave (d.nm)PDIP5_C06TSR52.113.810.06P5_C11PPN42.324.770.135P5_F01THT48.413.480.037P5_F07NTL43.918.860.108P5_F12DHL38.315.50.113P5_G12HSL31.816.440.103P6_B08TPL40.815.050.075P6_C08STA30.712.730.054P6_C11SLL15.231.970.207P6_E07RPL33.919.540.177P6_F02RSY39.112.960.036MEDI-1912_STTSTT53.1140.048MEDI-1912WFL1.823.20.148

[0295] This example demonstrates that it is possible transform an antibody with poor biophysical properties to one with improved properties in terms of solubility and low self interaction by mammalian display selection. This was achieved by the random mutagenesis of selected residues and the creation of a large random antibody variant library displayed on the surface of HEK293 cells. Current state of the art techniques to assess an antibody developability profile (e.g. solubility) require large scale expression and purification at the multi-mg scale to enable complete biophysical and PK measurements. In this example using differences in polypeptide presentation level, as judged by differences in mean fluorescence intensity (MFI) we demonstrate that it is possible to create millions of variants and select for antibodies which are subsequently shown to have improved biophysical properties. This process could be applied where novel antibodies are being selected from a naïve library or a library pre-selected in another system such as phage display. Alternatively, the present invention could also be applied during the affinity maturation or humanization of an antibody where a library of variants is created and displayed on the surface of mammalian cells.Example 5. Construction of variant library and selection of developability enhanced anti-PSK9 clones

[0296] Bococizumab is an anti- proprotein convertase substilisin / kexin type 9 (PCSK9) mAb that was in development by Pfizer to reduce low-density lipoprotein cholesterol (LDL-C) in serum. The mechanism of action of Bococizumab is to inhibit the PCSK9 mediated degradation of LDL receptor (LDLR) and thereby decrease serum LDL-cholesterol (LDL-C) 97< . This antibody was withdrawn from development in November 2016 with Pfizer announcing "it was not likely to provide value for patients, physicians or shareholders". It has been reported that the biophysical properties of bococizumab are not optimal 2< and this may be a reason for its clinical failure. For example, Bococizumab displayed both self-aggregation and cross-interaction in a variety of assays 2< . In contrast, the FDA approved anti-PCSK9 Alirocumab (Regeneron) antibody did not display the same levels of self-aggregation and cross-interaction in the same assays.

[0297] Bococizumab was originally discovered by immunization of PCSK9 knockout mice and screening monoclonal antibodies (mAbs) producing hybridoma clones for their ability to inhibit PCSK9 activity 98< . The mouse mAb 5A10 (US patent: US 8399646 B2) was then humanized by cloning DNA encoding the complementarity determining regions (CDRs) from the variable heavy (VH) and variable light (VL) domains into a human framework 99< with an amino acid substitution in VH CDR1 and VH CDR2 to give the humanized mAb 5A10-i. This humanized antibody 5A10-i was further affinity matured, as described previously 100< , to give Bococizimab. A sequence alignment for the VH and VL domains for the parental mouse mAb 5A10, the humanized intermediate antibody 5A10-i and Bococizumab is shown in Figure 9. The affinities (equilibrium dissociation contants or K D ) of 5A10, 5A10-i and Bococizimab for PCSK9 are 1 nM, 1.5 nM and 7 pM respectively as determined by surface plasmon resonance (SPR) or KinExA (US patent: US 8399646 B2). The crystal structure of Bococizimab Fab fragment complexed with PCSK9 has been determined 98< and this has shown the antibody binds to the catalytic domain of PSK9 through both light and heavy chains, with the main contribution through VH CDR3.

[0298] After nuclease-mediated antibody gene integration into HEK293 cells and display on the cell surface we have observed reduced cell surface presentation of Bococizumab, compared with the humanized intermediate version 5A10-i from which it was derived (Figure 10). The aim of this example is to demonstrate that, from a library of variants, a variant of Bococizumab can be selected by mammalian display with good presentation level indicating improved biophysical properties of stability, reduced self-aggregation and reduced cross-interaction properties or "stickiness" with retained target antigen binding. It is important to first identify regions or "patches" of the antibody which may contribute to its poor biophysical properties. For example, it is known that contiguous hydrophobic amino-acid residues within a polypeptide sequence can give rise to poor expression levels of that protein 101< . Also hydrophobic patches on antibodies can give rise to poor biophysical properties. 6,7,14< Similarly, positive charge patches on the antibody surface from clustered lysine or arginine residues can also give rise to cross-interaction by non-specific binding to the neonatal Fc receptor (FcRn) 22< or cell expressed negatively charged molecules such as heparin sulphate 23< .

[0299] The process of creating an improved binder using the present invention begins with the identification of residues within a sequence as candidates for changing within a library. These positions can act as sites for randomization using more than one alternative amino acid or could be sites for substitution with a single amino acid. Mutagenesis may be carried out using approaches known to those skilled in the art, such as oligonucleotide-directed mutagenesis ( 102< Molecular Cloning: a Laboratory Manual: 3rd edition, Russell et al., 2001, Cold Spring Harbor Laboratory Press, and references therein). In this case of Bococizumab the three dimensional structure was available, this was analysed and candidate amino acid residues were identified for mutagenesis. Structural modelling may be used as an alternative to help identify target amino acids for mutagenesis.

[0300] The facility to create and screen millions of variants within the present invention means that a thorough search of sequence variants can be conducted even in the absence of any 3D structural information or model e.g. by looking at linear sequences. This could be done by analysing linear sequence for features such as hydrophobicity or charge clustering. As an alternative, mutational scans focussed on individual amino acids can be carried out in order to guide larger scale, combinatorial mutagenic campaigns during affinity maturation campaigns 103< . By the same approach individual amino acids may be substituted with alternative sets of amino acids to identify individual residues with potential for improving biophysical properties. These may subsequently form the basis for combinatorial mutagenesis wherein multiple positions are changed simultaneously. In the case of antibody genes an alignment with germline sequences may help identify optimal amino acid changes for improving expression. This approach was taken for non-paratopic amino-acid residues on the VH. Residues that contributed to hydrophobic or charge patches were Y33 within VH CDR1, F54 and R57 within VH CDR2 (Figure 9). A multiple alignment with human VH germ-line sequences is shown in Figure 11. Based on this alignment the non-paratopic bococizumab VH amino acids contributing to hydrophobic or charge patches were reverted to germ-line sequences listed below: a. VH Y33A (reversion to germline IGHV1-3*01) b. VH Y33D (reversion to germline IGHV1-8*01) c. VH S52N, F54S, R57S (triple mutant reversion to germline IGHV1-46*01) d. VH Y33A, S52N, F54S, R57S (a. and c. mutants combined) e. VH Y33D, S52N, F54S, R57S (b. and c. mutants combined)

[0301] For paratopic residues, random mutant libraries were created to enable selection for both presentation and retained antigen binding (Figure 9). Candidate problematic residues within the VL were: Y53, L94 and W95. From the co-crystal structure of Bococizumab with PCSK9 these residues either directly interact with the target antigen or indirectly contribute to binding through allosteric interactions (for example VL CDR3 residue W95 appears to pack against VH CDR3 residues and may maintain the ...

Claims

1. A method of distinguishing or ranking binders according to their solubility and / or resistance to self-association in solution, and / or enriching for binders exhibiting greater solubility and / or greater resistance to self-association in solution, comprising (i) providing a library of higher eukaryotic cell clones each containing DNA encoding a binder, (ii) culturing the clones in vitro under conditions for expression of the binders, wherein the binders are presented on the cell surface, (iii) determining surface presentation levels, measured in terms of number of displayed binders per cell, of the binders on the clones, by labelling the binders with an agent incorporating a detectable label, (iv) selecting one or more clones that exhibit higher surface presentation of binders compared with other clones, and (v) identifying binders encoded by the one or more selected clones as having good solubility and / or resistance to self-association in solution, and optionally providing the selected clones for use in one or more further screening steps, wherein the binders are transmembrane domain-containing polypeptides.

2. A method according to claim 1, wherein the detectable label is a fluorescent label.

3. A method according to claim 1 or 2, wherein the agent binds to a constant region of the binders, optionally wherein the binders comprise an Fc region and the agent binds to the Fc region.

4. A method according to any of claims 1 to 3, comprising sorting cells into a collected fraction and a discarded fraction according to the level of surface presentation of binders on the cells, whereby cells displaying surface presentation above a pre-determined threshold are sorted into the collected fraction and cells displaying surface presentation below the pre-determined threshold are sorted into the discarded fraction.

5. A method according to claim 4, wherein discarded fraction comprises cells expressing comparator polypeptides that have a critical concentration of at least 10 mg / ml and wherein the collected fraction comprises cells expressing binders that have a critical concentration at least 1.5-fold higher than the comparator polypeptides in the discarded fraction.

6. A method according to claim 4 or claim 5, wherein sorting is performed by a fluorescence activated cell sorter (FACS).

7. A method according to any of claims 1 to 6, wherein step (ii) comprises culturing the clones of the library as a mixture in one vessel.

8. A method according to any of claims 1 to 6, wherein step (ii) comprises culturing each clone of the library in a separate vessel.

9. A method according to any one of the preceding claims, wherein the binders are sequence variants of a parent binder.

10. A method according to claim 9, wherein the parent binder has been identified as requiring improvement in solubility or resistance to self-association in solution.

11. A method according to claim 9 or claim 10, wherein the method comprises generating sequence variants of the parent binder and integrating DNA encoding the sequence variants into cellular DNA of higher eukaryotic cells to provide the library of cell clones containing DNA encoding the binders, optionally wherein the method comprises analysing the polypeptide sequence of the parent, identifying one or more amino acid residues that are predicted to promote self-association and / or reduce solubility, and generating mutation at the one or more amino acid residues.

12. A method according to any of claims 9 to 11, wherein the parent binder has a critical concentration of less than 50 mg / ml in phosphate buffered saline solution (PBS) and / or has a solubility limit of less than 50 mg / ml in phosphate buffered saline solution (PBS), and / or wherein the method comprises identifying binders encoded by the one or more selected clones as having a critical concentration and / or a solubility limit at least 1.5 fold higher than that of the parent binder.

13. A method according to any one of the preceding claims, comprising (i) simultaneously determining surface presentation levels of the binders and levels of target binding by the binders, and co-selecting clones displaying cognate binders exhibiting higher surface presentation compared with other clones; or (ii) simultaneously determining surface presentation levels of the binders and levels of non-specific binding to non-target molecules, and co-selecting clones displaying binders exhibiting higher surface presentation and lower non-specific binding compared with other clones; or (iii) simultaneously determining levels of target binding and levels of non-specific binding to non-target molecules by the binders, and co-selecting clones displaying cognate binders exhibiting lower non-specific binding compared with other clones.

14. A method according to any one of the preceding claims, comprising determining the sequence of the DNA encoding the binder from the one or more selected clones, and providing isolated nucleic acid encoding the binder.