RNA molecules encoding rsv-f and vaccines containing them

Abstract

The present disclosure relates to RNA molecules encoding a respiratory syncytial virus (RSV). The present disclosure further relates to compositions comprising the RNA molecules formulated in a lipid nanoparticle (RNA-LNP). The present disclosure further relates to the use of the RNA molecules, RNA-LNPs and compositions for the treatment and / or prevention of RSV infection-induced acute respiratory tract illness, including pneumonia and bronchitis.

Description

[0001]RNA MOLECULES CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefits of and U.S. Provisional Application No.63 / 585,254, filed September 26, 2023 and U.S. Provisional Application No.63 / 381,238, filed October 27, 2022. The entire content of each of the foregoing applications is incorporated herein by reference. REFERENCE TO SEQUENCE LISTING This application is being filed electronically via EFS-Web and includes an electronically submitted sequence listing in .xml format. The .xml file contains a sequence listing entitled "PC072895A Sequence Listing.xml" created on September 25, 2023 and having a size of 145 KB. The sequence listing contained in this .xml file is part of the specification and is incorporated herein by reference in its entirety. BACKGROUND Respiratory syncytial virus (RSV) is a respiratory virus that infects the lungs and breathing passages. RSV is the leading cause of serious viral lower respiratory tract illness in infants worldwide and an important cause of respiratory illness in the elderly. Two RSV protein subunit vaccines were approved in 2023, ABRYSVO (Pfizer) and AREXVY (GSK). However, no RNA vaccine has been approved for preventing RSV infection. RSV is a member of the Pneumoviridae family. Its genome consists of a single-stranded, negative-sense RNA molecule that encodes 11 proteins, including nine structural proteins (three glycoproteins and six internal proteins) and two non-structural proteins. The structural proteins include three transmembrane surface glycoproteins: the attachment protein G, fusion protein F, and the small hydrophobic SH protein. There are two subtypes of RSV, A and B. They differ primarily in the G glycoprotein, while the sequence of the F glycoprotein is more conserved between the two subtypes. The mature F glycoprotein has three general domains: ectodomain (ED), transmembrane domain (TM), and a cytoplasmic tail (CT). CT contains a single palmitoylated cysteine residue. The F glycoprotein of human RSV is initially translated from the mRNA as a single 574- amino acid polypeptide precursor (referred to “F0” or “F0 precursor”), which contains a signal peptide sequence (amino acids 1-25) at the N-terminus. Upon translation the signal peptide is removed by a signal peptidase in the endoplasmic reticulum. The remaining portion of the F0 precursor (i.e., residues 26-574) may be further cleaved at two polybasic sites (a.a.109 / 110 and 136 / 137) by cellular proteases (in particular furin), removing a 27-amino acid intervening sequence designated pep27 (amino acids 110-136) and generating two linked fragments designated F1 (C-terminal portion; amino acids 137-574) and F2 (N-terminal portion; amino acids 26-109). F1 contains a hydrophobic fusion peptide at its N-terminus and two heptad-repeat regions (HRA and HRB). HRA is near the fusion peptide, and HRB is near the TM domain. The F1 and F2 fragments are linked together through two disulfide bonds. Either the uncleaved F0 protein without the signal peptide sequence or a F1-F2 heterodimer can form a RSV F protomer. Three such protomers assemble to form the final RSV F protein complex, which is a homotrimer of the three protomers. The F proteins of subtypes A and B are about 90 percent identical in amino acid sequence. An example sequence of the F0 precursor polypeptide for the A subtype is provided in SEQ ID NO: 1 (A2 strain; GenBank GI: 138251; Swiss Prot P03420), and for the B subtype is provided in SEQ ID NO: 2 (18537 strain; GenBank GI: 138250; Swiss Prot P13843). SEQ ID NO: 1 and SEQ ID NO: 2 are both 574 amino acid sequences. The signal peptide sequence for SEQ ID NO: 1 and SEQ ID NO: 2 has also been reported as amino acids 1-25 (GenBank and UniProt). In both sequences the TM domain is from approximately amino acids 530 to 550 but has alternatively been reported as 525-548. The cytoplasmic tail begins at either amino acid 548 or 550 and ends at amino acid 574, with the palmitoylated cysteine residue located at amino acid 550. RSV F protein is a primary antigen explored for RSV vaccines. The RSV F protein trimer mediates fusion between the virion membrane and the host cellular membrane and also promotes the formation of syncytia. In the virion prior to fusion with the membrane of the host cell, the largest population of F molecules forms a lollipop-shaped structure, with the TM domain anchored in the viral envelope [Dormitzer, P.R., Grandi, G., Rappuoli, R., Nature Reviews Microbiol, 10, 807, 2012.]. This conformation is referred to as the pre-fusion conformation. Pre-fusion RSV F is recognized by monoclonal antibodies (mAbs) D25, AM22, and MPE8, without discrimination between oligomeric states. Pre-fusion F trimers are specifically recognized by mAb AM14 [Gilman MS, Moin SM, Mas V et al., PLoS Pathogens,11(7), 2015]. During RSV entry into cells, the F protein rearranges from the pre-fusion state (which may be referred to herein as “pre-F”), through an intermediate extended structure, to a post-fusion state (“post-F”). During this rearrangement, the C-terminal coiled-coil of the pre-fusion molecule dissociates into its three constituent strands, which then wrap around the globular head and join three additional helices to form the post-fusion six helix bundle. If a pre-fusion RSV F trimer is subjected to increasingly harsh chemical or physical conditions, such as elevated temperature, it undergoes structural changes. Initially, there is loss of trimeric structure (at least locally within the molecule), and then rearrangement to the post-fusion form, and then denaturation of the domains. To prevent viral entry, F-specific neutralizing antibodies presumably must bind the pre- fusion conformation of F on the virion, or potentially the extended intermediate, before the viral envelope fuses with a cellular membrane. Thus, the pre-fusion form of the F protein is considered the preferred conformation as the desired vaccine antigen [Ngwuta, J.O., Chen, M., Modjarrad, K., Joyce, M.G., Kanekiyo, M., Kumar, A., Yassine, H.M., Moin, S.M., Killikelly, A.M., Chuang, G.Y., Druz, A., Georgiev, I.S., Rundlet, E.J., Sastry, M., Stewart-Jones, G.B., Yang. Y., Zhang, B., Nason, M.C., Capella, C., Peeples, M., Ledgerwood, J. E., Mclellan, J.S., Kwong, P.D., Graham, B.S., Science Translat. Med., 14, 7, 309 (2015)]. Upon extraction from a membrane with surfactants such as Triton X-100, Triton X-114, NP-40, Brij-35, Brij-58, Tween 20, Tween 80, Octyl glucoside, Octyl thioglucoside, SDS, CHAPS, CHAPSO, or expression as an ectodomain, physical or chemical stress, or storage, the F glycoprotein readily converts to the post-fusion form [McLellan JS, Chen M, Leung S et al. Structure of RSV fusion glycoprotein trimer bound to a pre- fusion-specific neutralizing antibody. Science 340, 1113–1117 (2013); Chaiwatpongsakorn, S., Epand, R.F., Collins, P.L., Epand R.M., Peeples, M.E., J Virol. 85(8):3968-77 (2011); Yunus, A.S., Jackson T.P., Crisafi, K., Burimski, I., Kilgore, N.R., Zoumplis, D., Allaway, G.P., Wild, C.T., Salzwedel, K. Virology.2010 Jan 20;396(2):226-37]. Therefore, the preparation of prefusion F as a vaccine antigen has remained a challenge. Since the neutralizing and protective antibodies function by interfering with virus entry, it is postulated that an F antigen that does not elicit pre- fusion specific antibodies is not expected to be as effective as an F antigen that elicits pre-fusion specific antibodies. Therefore, it is considered more desirable to utilize an F protein vaccine that contains a F protein immunogen in the pre-fusion form. Mutants of the RSV F protein have been provided to increase pre-fusion stability (see for example PCT application No WO2017 / 109629) and are promising vaccine candidates. RSV vaccines that incorporate F protein antigen have been under development. Clinical studies have shown that some F protein subunit-based vaccine candidates are safe and immunogenic, though improvements in protective efficacy and durability of protection are desirable. Accordingly, improved immunogenic compositions to protect against RSV infection are needed. SUMMARY The present disclosure provides the unmet need for improved immunogenic compositions against RSV infection, among other things, as provided herein. In one aspect, the present disclosure provides immunogenic compositions and methods for preventing, treating or ameliorating an infection, disease or condition in a subject comprising the administration of RNA molecules, e.g., immunogenic RNA polynucleotide encoding an amino acid sequence, e.g., an immunogenic antigen, comprising a Respiratory syncytial virus (RSV) protein, an immunogenic variant thereof, or an immunogenic fragment of the RSV protein or the immunogenic variant thereof, e.g., an antigenic peptide or protein. Thus, the immunogenic antigen comprises an epitope of a RSV protein for inducing an immune response against RSV, in the subject. RNA polynucleotide encoding an immunogenic antigen is administered to provide (following expression of the polynucleotide by appropriate target cells) antigen for induction, e.g., stimulation, priming, and / or expansion, of an immune response, e.g., antibodies and / or immune effector cells. In one aspect, the immune response to be induced according to the present disclosure is both B cell-mediated immune response, e.g., an antibody-mediated immune response as well as T-cell-mediated immune response. In one aspect, the immune response is an anti-RSV immune response. The immunogenic compositions described herein comprise RNA molecules comprising RNA (as the active principle) that may be translated into one or more proteins in a recipient’s cells. In addition to wild type, codon-optimized or mutant sequences encoding the antigen sequence, the RNA molecules may contain one or more structural elements optimized for maximal efficacy of the RNA with respect to stability and translational efficiency (5′ cap, 5′ UTR, subgenomic promoter, 3′ UTR, poly-A-tail). In one aspect, the RNA molecules contain all of these elements. The RNA molecules described herein may be complexed with lipids and / or proteins to generate RNA-particles (e.g., lipid nanoparticles (LNPs)) for administration. In one aspect, the RNA molecules described herein are complexed with lipids to generate RNA-lipid nanoparticles (e.g. RNA-LNPs) for administration. In one aspect, the RNA molecules described herein are complexed with proteins for administration. In one aspect, the RNA molecules described herein are complexed with lipids and proteins for administration. If a combination of different RNA molecules is used, the RNA molecules may be complexed together or complexed separately with lipids and / or proteins to generate RNA-particles for administration. The present disclosure provides for RNA molecules and RNA-LNPs that include at least one open reading frame (ORF) encoding a RSV antigen. In some aspects, the RSV antigen is a RSV polypeptide. In some aspects, the RSV polypeptide is RSV F protein. In some aspects, the RSV F protein is a full-length, truncated, fragment or variant thereof. In some aspects, the RSV F protein comprises at least one mutation. The present disclosure provides for RNA molecules and RNA-LNPs that include at least one ORF encoding an RSV polypeptide of Table 1. In some aspects, the RSV polypeptide comprises an amino acid sequence selected from SEQ ID NO: 1 to 6 or 71 to 74. In some aspects, the RSV polypeptide has, has at least, or has at most 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98% or 99% or higher identity to any of the amino acid sequences of Table 1, for example, any of SEQ ID NO: 1 to 6 or 71 to 74. In some aspects, the RSV polypeptide consists of any of the amino acid sequences of Table 1, for example, any of SEQ ID NO: 1 to 6 or 71 to 74. The present disclosure provides for RNA molecules and RNA-LNPs comprising at least one ORF transcribed from at least one DNA nucleic acid of Table 2. In some aspects, the RNA molecule is transcribed from a nucleic acid sequence selected from SEQ ID NO: 7 to 10 or 59 to 62. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that has, has at least, or has at most 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98% or 99% or higher identity to any of the nucleic acid sequences of Table 2, for example, any of SEQ ID NO: 7 to 10 or 59 to 62. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that consists of any of the nucleic acid sequences of Table 2, for example, any of SEQ ID NO: 7 to 10 or 59 to 62. The present disclosure further provides for RNA molecules and RNA-LNPs comprising at least one ORF comprising an RNA nucleic acid sequence of Table 3. In some aspects, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NO: 11 to 16 or 63 to 70. In some aspects, the RNA molecule comprises a nucleic acid sequence that has, has at least, or has at most 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98% or 99% identity to any of the nucleic acid sequences of Table 3, for example, any of SEQ ID NO: 11 to 16 or 63 to 70. In some aspects, the RNA molecule comprises a nucleic acid sequence that consists of any of the nucleic acid sequences of Table 3, for example, any of SEQ ID NO: 11 to 16 or 63 to 70. In some aspects, each uridine of any of SEQ ID NO: 11 to 16 is replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA). The present disclosure further provides for RNA molecules and RNA-LNPs that include a 5’ untranslated region (5’-UTR) and / or a 3’ untranslated region (3’-UTR). In some aspects, the RNA molecule includes a 5’ untranslated region (5’-UTR). In some aspects, the 5’ UTR comprises a sequence selected from any of SEQ ID NO: 17 to 19. In some aspects, the 5′ UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98% or 99% or higher identity to any of SEQ ID NO: 17 to 19. In some aspects, the 5′ UTR comprises a sequence selected from any of SEQ ID NO: 17 to 19. In some aspects, the 5′ UTR comprises a sequence consisting of any of SEQ ID NO: 17 to 19. In some aspects, the RNA molecules and RNA-LNPs include a 3’ untranslated region (3’- UTR). In some aspects, the 3’ UTR comprises a sequence selected from any of SEQ ID NO: 20 to 25. In some aspects, the 3′ UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95, 96%, 97%, 98% or 99% or higher identity to any of SEQ ID NO: 20 to 25. In some aspects, the 3′ UTR comprises a sequence selected from any of SEQ ID NO: 20 to 25. In some aspects, the 3′ UTR comprises a sequence consisting of any of SEQ ID NO: 20 to 25. The present disclosure further provides for RNA molecules and RNA-LNPs that include a 5’ cap moiety. In some aspects, the 5′ cap moiety is (3′OMe) - m27,3′-OGppp (m12′-O)ApG. The present disclosure further provides for RNA molecules and RNA-LNPs that include a 3’ poly-A tail. In some aspects, the poly-A tail comprises a sequence having SEQ ID NO: 26. In some aspects, the RNA molecule includes a 5’ UTR and 3’ UTR. In some aspects, the RNA molecule includes a 5’ cap, 5’ UTR, and 3’ UTR. In some aspects, the RNA molecule includes a 5’ cap, 5’ UTR, 3’ UTR, and poly-A tail. In some aspects, the RNA molecule includes a 5’ UTR, 3’ UTR, and poly-A tail. In some aspects, 1, 2, 3, or more of the foregoing elements can be excluded from the RNA molecule. In some aspects, each uridine of any of the 5′ UTR, 3′ UTR, and poly-A tail is replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA). In some aspects, the poly-A tail length may contain +1 / -1 A. In some aspects, the uridine is N1-methylpseudouridine (Ψ). The present disclosure provides for RNA molecules as described in Table 5. In some aspects, the RNA molecule comprises a 5′ UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 11, a 3′ UTR of SEQ ID NO: 21 and / or a poly-A tail of SEQ ID NO: 26. In another aspect, the RNA molecule comprises a 5′ UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 12, a 3′ UTR of SEQ ID NO: 21 and / or a poly-A tail of SEQ ID NO: 26. In another aspect, the RNA molecule comprises a 5′ UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 63, a 3′ UTR of SEQ ID NO: 21 and / or a poly-A tail of SEQ ID NO: 26. In another aspect, the RNA molecule comprises a 5′ UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 65, a 3′ UTR of SEQ ID NO: 21 and / or a poly-A tail of SEQ ID NO: 26. In another aspect, the RNA molecule comprises a 5′ UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 67, a 3′ UTR of SEQ ID NO: 21 and / or a poly-A tail of SEQ ID NO: 26. In another aspect, the RNA molecule comprises a 5′ UTR of SEQ ID NO: 18, a RSV ORF of SEQ ID NO: 69, a 3′ UTR of SEQ ID NO: 21 and / or a poly-A tail of SEQ ID NO: 26. In some aspects, the RSV ORF further comprises a stop codon described herein. In some aspects, the poly-A tail length may contain +1 / -1 A or +2 / -2 A. In some aspects, each uridine of the RNA molecule is replaced by N1-methylpseudouridine (Ψ) (e.g., modified RNA; modRNA). The present disclosure further provides for RNA molecules that include at least one open reading frame that was generated from codon-optimized DNA. In some aspects, the open reading frame comprises a G / C content of at least, at most, exactly, or between (inclusive or exclusive) any two of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75%, e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, is or is about 50% to 75%, or is or is or about 55% to 70%. In some aspects, the G / C content is or is about 58%, is or is about 66%, or is or is about 62%. The present disclosure further provides RNA molecules comprising stabilized RNA. The present disclosure further provides for RNA molecules that include RNA having at least one modified nucleotide (e.g., modified RNA; modRNA). In some aspects, the modified nucleotide is pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5- methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl- pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio- pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl- pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2′-O-methyl uridine. In some aspects, the modified nucleotide is N1-methylpseudouridine (Ψ). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified nucleotides can be excluded from the RNA molecule. The present disclosure further provides for RNA molecules that are messenger-RNA (mRNA) or self-replicating RNA. In some aspects, the RNA is a mRNA. The present disclosure further provides for immunogenic compositions including the RNA molecules described herein. The RNA molecules may be formulated in, encapsulated in, complex with, bound to or adsorbed on a lipid nanoparticle (LNP) (e.g., RSV RNA-LNPs) in such immunogenic compositions. In some aspects, the lipid nanoparticle includes at least one of a cationic lipid, a polymer conjugated lipid (e.g., a PEGylated lipid), and at least one structural lipid (e.g., a neutral lipid and a steroid or steroid analog). In some aspects, 1, 2, 3, or more of the foregoing lipids can be excluded from the lipid nanoparticle. In some aspects, the lipid nanoparticle includes a cationic lipid. In some aspects, the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC- 0315). In some aspects, the lipid nanoparticle includes a polymer conjugated lipid. In some aspects, the lipid nanoparticle includes a PEGylated lipid, also referred to as a PEG-lipid. In some aspects, the PEGylated lipid is PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramides (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, glycol-lipids including PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxy polyethylene glycol)2000)carbamoyl]-1,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerol (PEG-DAG) such as 1- (monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), a PEGylated phosphatidylethanolamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG) such as 4- O-(2’,3′- di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S- DMG), a PEGylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as co- methoxy(polyethoxy)ethyl-N-(2,3di(tetradecanoxy)propyl)carbamate or 2,3- di(tetradecanoxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing PEGylated lipids can be excluded from the RNA molecule. In some aspects, the PEGylated lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC- 0159). In some aspects, the lipid nanoparticle includes at least one structural lipid, such as a neutral lipid. In some aspects, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyl-oleoyl-phosphatidylethanolamine (POPE), dioleoyl- phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE- mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1- trans PE, 1-stearoyl-2-oleoylphosphatidyethanolamine (SOPE), and / or 1,2-dielaidoyl-sn-glycero- 3-phosphoethanolamine (transDOPE). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing structural lipids can be excluded from the RNA molecule. In some aspects, the neutral lipid is 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC). In some aspects, the lipid nanoparticle includes a second structural lipid, such as a steroid or steroid analog. In some aspects, the steroid or steroid analog is cholesterol. In some aspects, the lipid nanoparticle has a mean diameter of about 1 to about 500 nm, e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 1 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 370 nm, 380 nm, 390 nm, 400 nm, 410 nm, 420 nm, 430 nm, 440 nm, 450 nm, 460 nm, 470 nm, 480 nm, 490 nm, or 500 nm. In some aspects, the RNA-LNP immunogenic composition is a liquid RNA-LNP composition comprising an RNA molecule / polynucleotide encoding a RSV polypeptide as disclosed herein at a concentration of at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably of or of about 0.01 to 0.09 mg / mL, encapsulated in LNPs with a lipid composition comprising a cationic lipid at a concentration of or of about 0.8 to 0.95 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL), a PEGylated lipid at a concentration of or of about 0.05 to 0.15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL), a first structural lipid at a concentration of or of about 0.1 to 0.25 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL), and a second structural lipid at a concentration of or of about 0.3 to 0.45 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL). In some aspects, the liquid composition further comprises a buffer composition comprising a first buffer at a concentration of or of about 0.1 to 0.3 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL), a second buffer at a concentration of or of about 1.25 to 1.4 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL), and a stabilizing agent at a concentration of or of about 95 to 110 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing elements can be excluded from the liquid RNA-LNP composition. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing element concentrations can be excluded from the liquid RNA-LNP composition. In specific aspects, the liquid RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a RSV polypeptide as disclosed herein at a concentration of at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably of or of about 0.01 to 0.09 mg / mL, encapsulated in LNPs with a lipid composition comprising ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2- hexyldecanoate) (ALC-0315) at a concentration of or of about 0.8 to 0.95 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL), 2-[(polyethylene glycol)- 2000]-N,N-ditetradecylacetamide (ALC-0159) at a concentration of or of about 0.05 to 0.15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL), 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC) at a concentration of or of about 0.1 to 0.25 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL), and cholesterol at a concentration of or of about 0.3 to 0.45 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL). In some aspects, the liquid composition further comprises a Tris buffer composition comprising tromethamine at a concentration of or of about 0.1 to 0.3 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, or 0.30 mg / mL) and Tris hydrochloride (HCl) at a concentration of or of about 1.25 to 1.4 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 1.25, 1.26, 1.27, 1.28, 1.29, 1.30, 1.31, 1.32, 1.33, 1.34, 1.35, 1.36, 1.37, 1.38, 1.39, or 1.40 mg / mL), and sucrose at a concentration of or of about 95 to 110 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 mg / mL). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing elements can be excluded from the liquid RNA-LNP composition. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing element concentrations can be excluded from the liquid RNA-LNP composition. In some aspects, the liquid RNA-LNP immunogenic composition comprises an RNA molecule / polynucleotide encoding a RSV polypeptide as disclosed herein at a concentration of at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably of or of about 0.01 to 0.09 mg / mL, encapsulated in a LNP, and further comprising of or of about 5 to 15 mM Tris buffer(e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mM) and of or of about 200 to 400 mM sucrose (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, or 400 mM) at a pH of or of about 7.0 to 8.0 (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0). In some aspects, 1, 2, 3, or more of the foregoing elements can be excluded from the liquid RNA-LNP composition. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing element concentrations can be excluded from the liquid RNA-LNP composition. In some aspects, the RNA-LNP immunogenic composition is a lyophilized (reconstituted) RNA-LNP composition comprising an RNA molecule / polynucleotide encoding a RSV polypeptide as disclosed herein at a concentration of at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably of or of about 0.01 to 0.09 mg / mL, encapsulated in LNPs with a lipid composition comprising a cationic lipid at a concentration of or of about 0.8 to 0.95 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL), a PEGylated lipid at a concentration of or of about 0.05 to 0.15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL), a first structural lipid at a concentration of or of about 0.1 to 0.25 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL), and a second structural lipid at a concentration of or of about 0.3 to 0.45 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL). In some aspects, the lyophilized composition further comprises a first buffer at a concentration of or of about 0.01 and 0.15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL), a second buffer at a concentration of or of about 0.5 and 0.65 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL), a stabilizing agent at a concentration of or of about 35 to 50 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL), and a salt diluent at a concentration of or of about 5 to 15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL) for reconstitution. In specific aspects, the lyophilized compositions are reconstituted in or in about 0.6 to 0.75 mL of the salt diluent (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL). Concentrations in the lyophilized RNA-LNP composition are determined post-reconstitution. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing elements can be excluded from the lyophilized RNA-LNP composition. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing element concentrations can be excluded from the lyophilized RNA-LNP composition. In specific aspects, a lyophilized (reconstituted) RNA-LNP composition comprises an RNA polynucleotide encoding a RSV polypeptide as disclosed herein at a concentration of at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, preferably of or of about 0.01 to 0.09 mg / mL, encapsulated in LNPs with a lipid composition of ALC-0315 at a concentration of or of about 0.8 to 0.95 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, or 0.95 mg / mL), ALC-0159 at a concentration of or of about 0.05 to 0.15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL), DSPC at a concentration of or of about 0.1 to 0.25 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25 mg / mL), and cholesterol at a concentration of or of about 0.3 to 0.45 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, or 0.45 mg / mL), and further comprises a Tris buffer composition comprising tromethamine at a concentration of or of about 0.01 to 0.15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, or 0.15 mg / mL) and Tris HCl at a concentration of or of about 0.5 to 0.65 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0.61, 0.62, 0.63, 0.64, or 0.65 mg / mL), sucrose at a concentration of or of about 35 to 50 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mg / mL), and sodium chloride (NaCl) diluent at a concentration of or of about 5 to 15 mg / mL (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg / mL) for reconstitution. In specific aspects, the lyophilized compositions are reconstituted in or in about 0.6 to 0.75 mL of sodium chloride (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 0.60, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.70, 0.71, 0.72, 0.73, 0.74, or 0.75 mL). Concentrations in the lyophilized RNA-LNP composition are determined post-reconstitution. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing elements can be excluded from the lyophilized RNA-LNP composition. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing element concentrations can be excluded from the lyophilized RNA-LNP composition. The present disclosure provides for RNA molecules, RNA-LNPs and immunogenic compositions that may be administered to a subject at a dose per administration of at least, at most, exactly, or between (inclusive or exclusive) any two of 1 µg, 15 µg, 30 µg, 45 µg, 60 µg, 75 µg, 90 µg, 100 µg or higher of RSV RNA encapsulated in LNP. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing concentrations of RSV RNA encapsulated in LNP can be excluded. The present disclosure provides for RNA molecules, RNA-LNPs and immunogenic compositions that may be administered in a single dose. The present disclosure further provides for RNA molecules, RNA-LNPs and immunogenic compositions that may be administered twice (e.g., Day 0 and on or about Day 7, Day 0 and on or about Day 14, Day 0 and on or about Day 21, Day 0 and on or about Day 28, Day 0 and on or about Day 60, Day 0 and on or about Day 90, Day 0 and on or about Day 120, Day 0 and on or about Day 150, Day 0 and on or about Day 180, Day 0 and on or about 1 month later, Day 0 and on or about 2 months later, Day 0 and on or about 3 months later, Day 0 and on or about 6 months later, Day 0 and on or about 9 months later, Day 0 and on or about 12 months later, Day 0 and on or about 18 months later, Day 0 and on or about 2 years later, Day 0 and on or about 5 years later, or Day 0 and on or about 10 years later). The present disclosure further provides for RNA molecules, RNA-LNPs and immunogenic compositions that may be administered twice at Day 0 and on or about 2 months later. The present disclosure further provides for RNA molecules, RNA-LNPs and immunogenic compositions that may be administered twice at Day 0 and on or about 6 months later. The present disclosure further provides for RNA molecules, RNA-LNPs and immunogenic compositions that may be administered three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more times. In some aspects, periodic boosters at intervals of 1-5 years may be desirable to maintain protective levels of the antibodies. The present disclosure further provides for administration of at least one booster dose. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing dosing regimens can be excluded. The present disclosure provides for a method of inducing an immune response against RSV in a subject, including administering to the subject an effective amount of an RNA molecule, RNA- LNP and / or immunogenic composition described herein. The present disclosure further provides for the use of an RNA molecule, RNA-LNP and / or immunogenic composition described herein in the manufacture of a medicament for use in inducing an immune response against RSV in a subject. The present disclosure provides for a method of inducing an immune response against RSV in a subject, including administering to the subject an effective amount of an RNA molecule and / or RNA-LNP that includes at least one open reading frame encoding a RSV polypeptide or immunogenic composition described herein. The present disclosure further provides for the use of an RNA molecule and / or RNA-LNP that includes at least one open reading frame encoding a RSV polypeptide or immunogenic composition described herein in the manufacture of a medicament for use in inducing an immune response against RSV in a subject. The present disclosure provides for a method of inducing an immune response against RSV in a subject, including administering to the subject an effective amount of an RNA molecule and / or RNA-LNP that includes at least one open reading frame encoding a polypeptide of a gene of interest or composition described herein. The present disclosure further provides for the use of an RNA molecule and / or RNA-LNP that includes at least one open reading frame encoding a polypeptide of a gene of interest or composition described herein in the manufacture of a medicament for use in inducing an immune response against RSV in a subject. The present disclosure provides for a method of preventing, treating, and / or ameliorating an infection, disease, or condition in a subject, including administering to a subject an effective amount of an RNA molecule, RNA-LNP and / or immunogenic composition described herein. The present disclosure further provides for the use of an RNA molecule, RNA-LNP and / or immunogenic composition described herein in the manufacture of a medicament for use in preventing, treating, and / or ameliorating an infection, disease, or condition in a subject. In some aspects, the infection, disease, or condition is associated with RSV . In some aspects, the infection, disease, or condition is acute lower respiratory infection (ALRI), including pneumonia and bronchitis. In some aspects, the infection, disease, or condition is acute lower respiratory infection (ALRI), including pneumonia and bronchitis. The present disclosure provides for a method of preventing, treating, and / or ameliorating an infection, disease, or condition in a subject, including administering to a subject an effective amount of an RNA molecule and / or RNA-LNP that includes at least one open reading frame encoding a RSV polypeptide or immunogenic composition described herein. The present disclosure further provides for the use of an RNA molecule and / or RNA-LNP that includes at least one open reading frame encoding a RSV polypeptide or immunogenic composition described herein in the manufacture of a medicament for use in preventing, treating, and / or ameliorating an infection, disease, or condition in a subject. In some aspects, the infection, disease, or condition is associated with RSV . In some aspects, the infection, disease, or condition is acute lower respiratory infection (ALRI), including pneumonia and bronchitis. In some aspects, the infection, disease, or condition is acute lower respiratory infection (ALRI), including pneumonia and bronchitis. The present disclosure further provides for a method of preventing, treating, and / or ameliorating an infection, disease, or condition in a subject, including administering to a subject an effective amount of RNA molecules and / or RNA-LNPs that include at least one open reading frame encoding a polypeptide of a gene of interest or immunogenic compositions described herein. The present disclosure further provides for the use of RNA molecules and / or RNA-LNPs that include at least one open reading frame encoding a polypeptide of a gene of interest or immunogenic compositions described herein in the manufacture of a medicament for use in preventing, treating, and / or ameliorating an infection, disease, or condition in a subject. In some aspects, the infection, disease, or condition is associated with the gene of interest. In some aspects, the subject is at least, at most, exactly, or between (inclusive or exclusive) any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months of age, or 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more years of age. In some aspects, the subject is, is at least, is at most, or is about less than 1 year of age, 1 year of age or older, 5 years of age or older, 10 years of age or older, 20 years of age or older, 30 years of age or older, 40 years of age or older, 50 years of age or older, 60 years of age or older, 70 years of age or older, or older. In some aspects, the subject the subject is or is about 50 years of age or older. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing age groups are not administered the RNA molecules and / or RNA- LNPs. In some aspects, the subject is immunocompetent. In some aspects, the subject is immunocompromised. The present disclosure provides for a method or use described herein, wherein the RNA molecule, RNA-LNP and / or immunogenic composition is administered as a vaccine. The present disclosure provides a method or use described herein, wherein the RNA molecule, RNA-LNP and / or immunogenic composition is administered by intradermal, intramuscular, or intranasal injection. It is contemplated that any aspect discussed in this specification may be implemented with respect to any method or composition of the disclosure, and vice versa. Furthermore, compositions of the disclosure may be used to achieve methods of the disclosure. Any method in the context of a therapeutic, diagnostic, or physiologic purpose or effect may also be described in “use” claim language such as “use of” any compound, composition, or agent discussed herein for achieving or implementing a described therapeutic, diagnostic, or physiologic purpose or effect. Use of the one or more compositions may be employed based on any of the methods described herein. Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific aspects of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1A to 1E show immunogenicity of modRNA-LNP formulations of RSV 847 in mice. Female BALB / c mice (10 / group) were immunized intramuscularly at day 0 and 21 with RSV 847 constructs either as bivalent protein subunit (RSV 847A+B) or modRNA-LNP formulation either as monovalent (RSV 847A) or bivalent (RSV 847A+B) at indicated dose. On day 35 (2 weeks post dose 2, PD2), serum was collected for RSV neutralizing assay and spleen for T-cell assays (ELISpot and Intracellular Cytokine Staining, ICS assays). FIG. 1A and FIG. 1B show neutralization assay results for RSV A and B expressed as 50% neutralizing titers (each symbol represents a titer from an individual animal. Bars represent geometric mean titer (GMT)). FIG.1C shows ELISpot assay results that measure the number of RSV A+B F-specific cells secreting IFN-γ and expressed as spot forming cells (SFC) per million cells. FIG.1D and FIG.1E show ICS assay results that measured RSV A+B F-specific IFN-γ-expressing cells within CD4+ and CD8+ T cells expressed as percentage of IFN-γ+ cells. Bars and errors bars depict median with interquartile range. NA: not analyzed. FIG.2 shows the immunogenicity of modRNA-LNP formulations encoding for different RSV A prefusion F (preF) designs in mice. Female BALB / c mice (10 / group) were immunized intramuscularly at day 0 and 21 with modRNA-LNP formulations encoding RSV A prefusion F (preF) designs as depicted herein at 0.5 µg dose. On day 35 (2W PD2), serum was analyzed for RSV A neutralization response expressed as 50% neutralizing titers. Each symbol represents a titer from an individual animal. Bars represent geometric mean titer (GMT). FIG.3A to 3F show the immunogenicity of modRNA-LNP and saRNA-LNP formulations of RSV prefusion F (preF) in mice. Female BALB / c mice (10 / group) were immunized intramuscularly at day 0 and 21 with RSV preF constructs either as bivalent protein subunit (RSV preF A+B) or bivalent modRNA-LNP formulation or bivalent saRNA-LNP formulation at indicated dose. On day 21 (3W PD1) and 35 (2W PD2), serum was collected for RSV neutralizing assay and on day 35 spleens were harvested for T-cell assays (Intracellular Cytokine Staining, ICS assay). Neutralization assay results are shown for RSV A and B expressed as 50% neutralizing titers at either 3W PD1 (FIG.3A and FIG.3B) or 2W PD2 (FIG.3C and FIG.3D). Each symbol represents a titer from an individual animal. Bars represent geometric mean titer (GMT). FIG.3E and FIG.3F show ICS assay results that measured RSV preF A+B F-specific IFN-γ-expressing cells within CD4+ T cells and CD8+ T cells -. Bars and errors bars depict median with interquartile range. NT: not tested. FIG.4 schematically illustrates the wild-type (WT) RSV F protein (RSV WT) and variant RSV F protein constructs, where “SP” refers to a signal peptide sequence (amino acid residues 1-25 of each construct), “TM” refers to a transmembrane peptide sequence corresponding to the portion of the protein that spans the cell membrane, “CT” refers to a cytoplasmic tail peptide sequence corresponding to the portion of the protein that extends into the cell cytoplasm, and “ectodomain” refers to a peptide sequence corresponding to the portion of the protein that extends into the extracellular space wherein the ectodomain comprises amino acid residues 1-513 (without TM and CT, denoted by “ΔTM & CT”). The amino acid positions of each portion (i.e. SP, F2, pep27, F1) or mutation for each construct are indicated therein, e.g. SP of each construct spans from amino acid residues 1-25 of each construct. DETAILED DESCRIPTION The present disclosure provides for an RNA molecule (e.g., RNA polynucleotide) comprising at least one open reading frame (ORF) encoding a respiratory syncytial virus (RSV) antigen. In some aspects, the RSV antigen is a RSV polypeptide. In some aspects, the RSV polypeptide is a RSV F polypeptide. In some aspects, the RSV polypeptide comprises an amino acid sequence set forth in Table 1. In some aspects, the RNA molecules comprise an ORF transcribed from at least one DNA nucleic acid sequence of Table 2. In some aspects, the RNA molecules comprise an ORF comprising an RNA nucleic acid sequence of Table 3. In some aspects the RNA molecule comprises at least one of a 5’ cap, 5’ UTR, 3’ UTR and poly-A tail. In other aspects the RNA molecule comprises at least one of a 5’ cap, 3’ UTR and poly-A tail. The present disclosure provides for an RNA molecule comprising modified nucleotides (e.g., modified RNA; modRNA). The present disclosure provides for an immunogenic composition comprising any one of the RNA molecules encoding a RSV polypeptide described herein complexed with, encapsulated in, or formulated with one or more lipids, and forming lipid nanoparticles (RNA-LNPs). The present disclosure further provides for an immunogenic composition comprising any one of the RNA molecules comprising at least one RNA nucleic acid described herein complexed with, encapsulated in, or formulated with one or more lipids, and forming RNA-LNPs. The present disclosure further provides for a method of preventing, treating or ameliorating an infection, disease or condition (e.g., RSV infection-related Respiratory tract illness, including pneumonia and bronchitis) in a subject via administering to a subject an effective amount of an RNA molecule, RNA-LNP or an immunogenic composition described herein. The present disclosure further provides for the use of the RNA molecule, RNA-LNP and / or an immunogenic composition described herein as a vaccine. The present invention may be understood more readily by reference to the following detailed description of the embodiments of the invention and the Examples included herein. It is to be understood that this invention is not limited to specific methods of making that may of course vary. It is to be also understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All references cited herein, including patent applications, patent publications, UniProtKB accession numbers are herein incorporated by reference, as if each individual reference were specifically and individually indicated to be incorporated by reference in its entirety. I. EXAMPLES OF DEFINITIONS Unless otherwise defined herein, scientific and technical terms used in connection with the present invention have the meanings that are commonly understood by those of ordinary skill in the art. Throughout this application, the terms “about” and “approximately” and “substantially” are used according to their plain and ordinary meaning in the area of cell and molecular biology to indicate a deviation of ±10% of the value(s) to which it is attached. Therefore, in any disclosed aspect, the terms may be substituted with “within [a percentage] of” what is specified. In one non- limiting aspect, the percentage includes 0.1, 0.5, 1, 5, and 10 percent. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it was individually recited herein. The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” The phrase “and / or” means “and” or “or.” To illustrate, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, “and / or” operates as an inclusive or. The phrase “essentially all” is defined as “at least 95%”; if essentially all members of a group have a certain property, then at least 95% of members of the group have that property. In some aspects, essentially all means equal to any one of, at least any one of, or between any two of 95, 96, 97, 98, 99, or 100% of members of the group have that property. The compositions and methods for their use may “comprise,” “consist essentially of,” or “consist of” any of the ingredients or steps disclosed throughout the specification. Throughout this specification, unless the context requires otherwise, the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open- ended and will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. It is contemplated that aspects described herein in the context of the term “comprising” may also be implemented in the context of the term “consisting of” or “consisting essentially of.” Compositions and methods “consisting essentially of” any of the ingredients or steps disclosed limits the scope of the claim to the specified materials or steps which do not materially affect the basic and novel characteristic of the claimed disclosure. The words “consisting of” (and any form of consisting of, such as “consist of” and “consists of”) means including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. Reference throughout this specification to “one aspect,” “an aspect,” “a particular aspect,” “a related aspect,” “a certain aspect,” “an additional aspect,” or “a further aspect” or combinations thereof means that a particular feature, structure or characteristic described in connection with the aspect is included in at least one aspect of the present disclosure. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same aspect. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more aspects. The terms “inhibiting,” “decreasing,” or “reducing” or any variation of these terms includes any measurable decrease (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease) or complete inhibition to achieve a desired result. The terms “improve,” “promote,” or “increase” or any variation of these terms includes any measurable increase (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% increase) to achieve a desired result or production of a protein or molecule. As used herein, the terms “reference,” “standard,” or “control” describe a value relative to which a comparison is performed. For example, an agent, subject, population, sample, or value of interest is compared with a reference, standard, or control agent, subject, population, sample, or value of interest. A reference, standard, or control may be tested and / or determined substantially simultaneously and / or with the testing or determination of interest for an agent, subject, population, sample, or value of interest and / or may be determined or characterized under comparable conditions or circumstances to the agent, subject, population, sample, or value of interest under assessment. The term “isolated” may refer to a nucleic acid or polypeptide that is substantially free of cellular material, bacterial material, viral material, or culture medium (when produced by recombinant DNA techniques) of their source of origin, or chemical precursors or other chemicals (when chemically synthesized). Moreover, an isolated compound refers to one that may be administered to a subject as an isolated compound; in other words, the compound may not simply be considered “isolated” if it is adhered to a column or embedded in an agarose gel. Moreover, an “isolated nucleic acid fragment” or “isolated peptide” is a nucleic acid or protein fragment that is not naturally occurring as a fragment and / or is not typically in the functional state and / or that is altered or removed from the natural state through human intervention. For example, a DNA naturally present in a living animal is not “isolated,” but a synthetic DNA, or a DNA partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid may exist in substantially purified form, or may exist in a non-native environment such as, for example, a cell into which the nucleic acid has been delivered. A “nucleic acid,” as used herein, is a molecule comprising nucleic acid components and refers to DNA or RNA molecules. It may be used interchangeably with the term “polynucleotide.” A nucleic acid molecule is a polymer comprising or consisting of nucleotide monomers, which are covalently linked to each other by phosphodiester-bonds of a sugar / phosphate-backbone. Nucleic acids may also encompass modified nucleic acid molecules, such as base-modified, sugar-modified or backbone-modified etc. DNA or RNA molecules. Nucleic acids may exist in a variety of forms such as: isolated segments and recombinant vectors of incorporated sequences or recombinant polynucleotides encoding polypeptides, such as antigens or one or both chains of an antibody, or a fragment, derivative, mutein, or variant thereof, polynucleotides sufficient for use as hybridization probes, PCR primers or sequencing primers for identifying, analyzing, mutating or amplifying a polynucleotide encoding a polypeptide, anti-sense nucleic acids for inhibiting expression of a polynucleotide, mRNA, saRNA, modRNA and complementary sequences of the foregoing described herein. Nucleic acids may encode an epitope to which antibodies may bind. The term “epitope” refers to a moiety that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding component. In some aspects, an epitope is comprised of a plurality of chemical atoms or groups on an antigen. In some aspects, such chemical atoms or groups are surface-exposed when the antigen adopts a relevant three-dimensional conformation. In some aspects, such chemical atoms or groups are physically near to each other in space when the antigen adopts such a conformation. In some aspects, at least some such chemical atoms are groups are physically separated from one another when the antigen adopts an alternative conformation (e.g., is linearized). Nucleic acids may be single-stranded or double-stranded and may comprise RNA and / or DNA nucleotides and artificial variants thereof (e.g., peptide nucleic acids). In some cases, a nucleic acid sequence may encode a polypeptide sequence with additional heterologous coding sequences, for example to allow for purification of the polypeptide, transport, secretion, post- translational modification, or for therapeutic benefits such as targeting or efficacy. A tag or other heterologous polypeptide may be added to the modified polypeptide-encoding sequence, wherein “heterologous” refers to a polypeptide that is not the same as the modified polypeptide. The term “polynucleotide” refers to a nucleic acid molecule that may be recombinant or has been isolated from total genomic nucleic acid. Included within the term “polynucleotide” are oligonucleotides (nucleic acids 100 residues or less in length), recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like. Polynucleotides include, in certain aspects, regulatory sequences, isolated substantially away from their naturally occurring genes or protein encoding sequences. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or a combination thereof. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide. In certain aspects, there are polynucleotide variants having substantial identity to the sequences disclosed herein; those comprising equal to any one of, at least any one of, at most any one of, or between any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, compared to a polynucleotide sequence provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). In certain aspects, the isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide that has at least 90% identity to an amino acid sequence described herein, over the entire length of the sequence; or a nucleotide sequence complementary to said isolated polynucleotide. In some aspects, the isolated polynucleotide will comprise a nucleotide sequence encoding a polypeptide that has at least 95% identity to an amino acid sequence described herein, over the entire length of the sequence; or a nucleotide sequence complementary to said isolated polynucleotide. The nucleic acid segments, regardless of the length of the coding sequence itself, may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. The nucleic acids may be any length. They may be, for example, equal to any one of, at least any one of, at most any one of, or between any two of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, and / or may comprise one or more additional sequences, for example, regulatory sequences, and / or be a part of a larger nucleic acid, for example, a vector. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol. In this respect, the term “gene” is used to refer to a nucleic acid that encodes a protein, polypeptide, or peptide (including any sequences required for proper transcription, post- translational modification, or localization). As will be understood by those in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence encoding all or a portion of such a polypeptide. It also is contemplated that a particular polypeptide may be encoded by nucleic acids containing variations having slightly different nucleic acid sequences but, nonetheless, encode the same or substantially similar polypeptide. As used herein, the term “expression” of a nucleic acid sequence refers to the generation of any gene product from the nucleic acid sequence. In some aspects, a gene product may be a transcript. In some aspects, a gene product may be a polypeptide. In some aspects, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, etc.); (3) translation of an RNA into a polypeptide or protein; and / or (4) post- translational modification of a polypeptide or protein. In general, the term “engineered” refers to the aspect of having been manipulated by the hand of man. For example, a polynucleotide is considered to be “engineered” when two or more sequences that are not linked together in that order in nature are manipulated by the hand of man to be directly linked to one another in the engineered polynucleotide and / or when a particular residue in a polynucleotide is non-naturally occurring and / or is caused through action of the hand of man to be linked with an entity or moiety with which it is not linked in nature. The term “DNA,” as used herein, means a nucleic acid molecule comprising nucleotides such as deoxy-adenosine-monophosphate, deoxy-thymidine-monophosphate, deoxy- guanosine-monophosphate and deoxy-cytidine-monophosphate monomers which are composed of a sugar moiety (deoxyribose), a base moiety and a phosphate moiety, and polymerize by a characteristic backbone structure. The backbone structure is, typically, formed by phosphodiester bonds between the sugar moiety of the nucleotide, e.g., deoxyribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers, e.g., the order of the bases linked to the sugar / phosphate-backbone, is called the DNA sequence. DNA may be single stranded or double stranded. In the double stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g. by A / T-base-pairing and G / C- base-pairing. DNA may contain all, or a majority of, deoxyribonucleotide residues. As used herein, the term “deoxyribonucleotide” means a nucleotide lacking a hydroxyl group at the 2′ position of a β-D-ribofuranosyl group. Without any limitation, DNA may encompass double stranded DNA, antisense DNA, single stranded DNA, isolated DNA, synthetic DNA, DNA that is recombinantly produced, and modified DNA. The term “RNA,” as used herein, means a nucleic acid molecule comprising nucleotides such as adenosine-monophosphate, uridine-monophosphate, guanosine-monophosphate and cytidine-monophosphate monomers which are connected to each other along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar, e.g., ribose, of a first and a phosphate moiety of a second, adjacent monomer. RNA may be obtainable by transcription of a DNA-sequence, e.g., inside a cell. In eukaryotic cells, transcription is typically performed inside the nucleus or the mitochondria. In vivo, transcription of DNA may result in premature RNA which is processed into messenger-RNA (mRNA). Processing of the premature RNA, e.g. in eukaryotic organisms, comprises various posttranscriptional modifications such as splicing, 5′ capping, polyadenylation, export from the nucleus or the mitochondria. Mature messenger RNA is processed and provides the nucleotide sequence that may be translated into an amino acid sequence of a peptide or protein. A mature mRNA may comprise a 5′ cap, a 5′ UTR, an open reading frame, a 3′ UTR and a poly-A tail sequence. RNA may contain all, or a majority of, ribonucleotide residues. As used herein, the term “ribonucleotide” means a nucleotide with a hydroxyl group at the 2′ position of a β-D-ribofuranosyl group. In one aspect, RNA may be messenger RNA (mRNA) that relates to a RNA transcript which encodes a peptide or protein. As known to those of skill in the art, mRNA generally contains a 5′ untranslated region (5′ UTR), a polypeptide coding region, and a 3′ untranslated region (3′ UTR). Without any limitation, RNA may encompass double stranded RNA, antisense RNA, single stranded RNA, isolated RNA, synthetic RNA, RNA that is recombinantly produced, and modified RNA (modRNA). An “isolated RNA” is defined as an RNA molecule that may be recombinant or has been isolated from total genomic nucleic acid. An isolated RNA molecule or protein may exist in substantially purified form, or may exist in a non-native environment such as, for example, a host cell. A “modified RNA” or “modRNA” refers to an RNA molecule having at least one addition, deletion, substitution, and / or alteration of one or more nucleotides as compared to naturally occurring RNA. Such alterations may refer to the addition of non-nucleotide material to internal RNA nucleotides, or to the 5′ and / or 3′ end(s) of RNA. In one aspect, such modRNA contains at least one modified nucleotide, such as an alteration to the base of the nucleotide. For example, a modified nucleotide may replace one or more uridine and / or cytidine nucleotides. For example, these replacements may occur for every instance of uridine and / or cytidine in the RNA sequence, or may occur for only select uridine and / or cytidine nucleotides. Such alterations to the standard nucleotides in RNA may include non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide may be replaced with N1-methylpseudouridine in an RNA sequence. Other such altered nucleotides are known to those of skill in the art. Such altered RNA molecules are considered analogs of naturally-occurring RNA. In some aspects, the RNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid that contains deoxyribonucleotides. In some aspects, the RNA may be replicon RNA (replicon), in particular self-replicating RNA, or self-amplifying RNA (saRNA). As contemplated herein, without any limitations, RNA may be used as a therapeutic modality to treat and / or prevent a number of conditions in mammals, including humans. Methods described herein comprise administration of the RNA described herein to a mammal, such as a human. For example, in one aspect such methods of use for RNA include an antigen-coding RNA vaccine to induce robust neutralizing antibodies and accompanying / concomitant T-cell response to achieve protective immunization. In some aspects, minimal vaccine doses are administered to induce robust neutralizing antibodies and accompanying / concomitant T-cell response to achieve protective immunization. In one aspect, the RNA administered is in vitro transcribed RNA. For example, such RNA may be used to encode at least one antigen intended to generate an immune response in said mammal. Pathogenic antigens are peptide or protein antigens derived from a pathogen associated with infectious disease. In specific aspects, the pathogenic are peptide or protein antigens derived from RSV. Conditions and / or diseases that may be treated with RNA disclosed herein include, but are not limited to, those caused and / or impacted by viral infection. Such viruses include, but are not limited to, RSV. “Prevent” or “prevention,” as used herein when used in connection with the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing the disease, disorder and / or condition and / or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder, or condition has been delayed for a predefined period of time. As will be understood from context, “risk” of a disease, disorder, and / or condition refers to a likelihood that a particular individual will develop the disease, disorder, and / or condition. In some aspects, risk is expressed as a percentage. In some aspects, risk is, is at least, or is at most from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 up to 100%. In some aspects risk is expressed as a risk relative to a risk associated with a reference sample or group of reference samples. In some aspects, a reference sample or group of reference samples have a known risk of a disease, disorder, condition and / or event. In some aspects a reference sample or group of reference samples are from individuals comparable to a particular individual. In some aspects, risk may reflect one or more genetic attributes, e.g., which may predispose an individual toward development (or not) of a particular disease, disorder and / or condition. In some aspects, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Susceptible to: An individual who is “susceptible to” a disease, disorder, and / or condition is one who has a higher risk of developing the disease, disorder, and / or condition than does a member of the general public. In some aspects, an individual who is susceptible to a disease, disorder and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some aspects, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some aspects, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some aspects, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some aspects, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition. The terms “protein,” “polypeptide,” or “peptide” are used herein as synonyms and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. Polypeptides may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. A protein comprises one or more peptides or polypeptides, and may be folded into a 3-dimensional form, which may be required for the protein to exert its biological function. As used herein, the term “wild type” or ”WT” or “native” refers to the endogenous version of a molecule that occurs naturally in an organism. In some aspects, wild type versions of a protein or polypeptide are employed, however, in other aspects of the disclosure, a modified protein or polypeptide is employed to generate an immune response. The terms described above may be used interchangeably. A “modified protein” or “modified polypeptide” or a “variant” refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, is altered with respect to the wild type protein or polypeptide. In some aspects, a modified / variant protein or polypeptide has at least one modified activity or function (recognizing that proteins or polypeptides may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function yet retain a wild type activity or function in other respects, such as immunogenicity. Where a protein is specifically mentioned herein, it is in general a reference to a native (wild type) or recombinant (modified) protein. The protein may be isolated directly from the organism of which it is native, produced by recombinant DNA / exogenous expression methods, produced by solid-phase peptide synthesis (SPPS), or other in vitro methods. In particular aspects, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences that encode a polypeptide (e.g., an antigen or fragment thereof). The term “recombinant” may be used in conjunction with a polypeptide or the name of a specific polypeptide, and this generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is a replication product of such a molecule. The term “fragment,” with reference to an amino acid sequence (peptide or protein), relates to a part of an amino acid sequence, e.g., a sequence which represents the amino acid sequence shortened at the N-terminus and / or C-terminus. A fragment shortened at the C- terminus (N-terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 3′-end of the open reading frame. A fragment shortened at the N-terminus (C-terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 5′-end of the open reading frame, as long as the truncated open reading frame comprises a start codon that serves to initiate translation. A fragment of an amino acid sequence comprises, e.g., at least 50 %, at least 60 %, at least 70 %, at least 80%, at least 90%, or at least 99% of the amino acid residues from an amino acid sequence. In the present disclosure, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least, at most, exactly, or between any two of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 70% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 80% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 85% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 90% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 95% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 97% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. In one aspect, a fragment of a polypeptide, DNA nucleic acid or RNA nucleic acid sequence refers to a sequence having sequence identity of at least 99% with a polypeptide, DNA nucleic acid or RNA nucleic acid sequence, from which it is derived. As used herein in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term “variant” refers to a molecule that shows significant structural identity with a reference molecule but differs structurally from the reference molecule, e.g., in the presence or absence or in the level of one or more chemical moieties as compared to the reference entity. In some aspects, a variant also differs functionally from its reference molecule. In general, whether a particular molecule is properly considered to be a “variant” of a reference molecule is based on its degree of structural identity with the reference molecule. As will be appreciated by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs in at least one aspect from the reference molecule. In some aspects, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., that are attached to the polypeptide or nucleic acid backbone). In some aspects, a variant polypeptide or nucleic acid shows an overall sequence identity with a reference polypeptide or nucleic acid that is at least, at most, exactly, or between any two of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some aspects, a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid. In some aspects, a reference polypeptide or nucleic acid has one or more biological activities. In some aspects, a variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid lacks one or more of the biological activities of the reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid shows a reduced level of one or more biological activities as compared to the reference polypeptide or nucleic acid. In some aspects, a polypeptide or nucleic acid of interest is considered to be a “variant” of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference but for a small number of sequence alterations at particular positions. Preferably, the variant polypeptide or nucleic acid sequence has at least one modification compared to the reference polypeptide or nucleic acid sequence, e.g., from 1 to about 20 modifications. In one aspect, the variant polypeptide or nucleic acid sequence has from 1 to about 10 modifications compared to the reference polypeptide or nucleic acid sequence. In one aspect, the variant polypeptide or nucleic acid sequence has from 1 to about 5 modifications compared to the reference polypeptide or nucleic acid sequence. In one aspect, the variant polypeptide or nucleic acid sequence has from 1 to about 4 modifications compared to the reference polypeptide or nucleic acid sequence. Typically, fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted, as compared to the reference. Often, a variant polypeptide or nucleic acid comprises a very small number (e.g., fewer than about 5, about 4, about 3, about 2, or about 1) number of substituted, inserted, or deleted, functional residues (e.g., residues that participate in a particular biological activity) relative to the reference. In some aspects, a variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residues as compared to a reference. In some aspects, a variant polypeptide or nucleic acid comprises fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and commonly fewer than about 5, about 4, about 3, or about 2 additions or deletions as compared to the reference. In some aspects, a variant polypeptide or nucleic acid comprises not more than about 5, about 4, about 3, about 2, or about 1 addition or deletion, and, in some aspects, comprises no additions or deletions, as compared to the reference. In some aspects, a reference polypeptide or nucleic acid is a “wild type” or “WT” or “native” sequence found in nature, including allelic variations. A wild type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For the purposes of the present disclosure, “variants” of an amino acid sequence (peptide, protein, or polypeptide) comprise amino acid insertion variants, amino acid addition variants, amino acid deletion variants and / or amino acid substitution variants. “Variants” of a nucleotide sequence comprise nucleotide insertion variants, nucleotide addition variants, nucleotide deletion variants and / or nucleotide substitution variants. The term “variant” includes all mutants, splice variants, post-translationally modified variants, conformations, isoforms, allelic variants, species variants, and species homologs, in particular those which are naturally occurring. The term “variant” includes, in particular, fragments of an amino acid or nucleic acid sequence. Changes may be introduced by mutation into a nucleic acid, thereby leading to changes in the amino acid sequence of a polypeptide (e.g., an antigen or antibody or antibody derivative) that it encodes. Mutations may be introduced using any technique known in the art. In one aspect, one or more particular amino acid residues are changed using, for example, a site-directed mutagenesis protocol. In another aspect, one or more randomly selected residues are changed using, for example, a random mutagenesis protocol. In some aspects, however it is made, a mutant polypeptide may be expressed and screened for a desired property. Mutations may be introduced into a nucleic acid without significantly altering the biological activity of a polypeptide that it encodes. For example, one may make nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues. Alternatively, one or more mutations may be introduced into a nucleic acid that selectively changes the biological activity of a polypeptide that it encodes. For example, the mutation may quantitatively or qualitatively change the biological activity. Examples of quantitative changes include increasing, reducing or eliminating the activity. Examples of qualitative changes include altering the antigen specificity of an antibody. “Sequence similarity” indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. “Sequence identity” between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. “Sequence identity” between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences. The terms “% identical,” “% identity,” or similar terms are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences may be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or “window of comparison,” in order to identify local regions of corresponding sequences. The optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math.2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs using said algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group). In some aspects, percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website. Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence) and multiplying this result by 100. In some aspects, the degree of similarity or identity is given for a region that is at least, at most, exactly, or between any two of about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least, at most, exactly, or between any two of about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, in some aspects, continuous nucleotides. In some aspects, the degree of similarity or identity is given for the entire length of the reference sequence. Homologous amino acid sequences may exhibit at least, at most, exactly, or between any two of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of the amino acid residues. In one aspect, homologous amino acid sequences exhibit at least 95% identity of the amino acid residues. In one aspect, homologous amino acid sequences exhibit at least 98% identity of the amino acid residues. In one aspect, homologous amino acid sequences exhibit at least 99% identity of the amino acid residues. A fragment or variant of an amino acid sequence (peptide or protein) may be a “functional fragment” or “functional variant.” The term “functional fragment” or “functional variant” of an amino acid sequence relates to any fragment or variant exhibiting one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, e.g., it is functionally equivalent. With respect to antigens or antigenic sequences, one particular function is one or more immunogenic activities displayed by the amino acid sequence from which the fragment or variant is derived. The term “functional fragment” or “functional variant,” as used herein, in particular refers to a variant molecule or sequence that comprises an amino acid sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence and that is still capable of fulfilling one or more of the functions of the parent molecule or sequence, e.g., inducing an immune response. In one aspect, the modifications in the amino acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence. The term “mutant” of a wild-type RSV F protein, “mutant” of a RSV F protein, “RSV F protein mutant,” or “modified RSV F protein” refers to a polypeptide that displays introduced mutations relative to a wild-type F protein and is immunogenic against the wild-type F protein. An amino acid sequence (peptide, protein, or polypeptide) “derived from” a designated amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, the amino acid sequence which is derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical, or homologous to that particular sequence or a fragment thereof. Amino acid sequences derived from a particular amino acid sequence may be variants of that particular sequence or a fragment thereof. For example, it will be understood by one of ordinary skill in the art that the antigens suitable for use herein may be altered such that they vary in sequence from the naturally occurring or native sequences from which they were derived, while retaining the desirable activity of the native sequences. In the present disclosure, a vector refers to a nucleic acid molecule, such as an artificial nucleic acid molecule. A vector may be used to incorporate a nucleic acid sequence, such as a nucleic acid sequence comprising an open reading frame. Vectors include, but are not limited to, storage vectors, expression vectors, cloning vectors, transfer vectors. A vector may be an RNA vector or a DNA vector. In some aspects the vector is a DNA molecule. In some aspects, the vector is a plasmid vector. In some aspects, the vector is a viral vector. Typically, an expression vector will contain a desired coding sequence and appropriate other sequences necessary for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in in vitro expression systems. Cloning vectors are generally used to engineer and amplify a certain desired fragment (typically a DNA fragment), and may lack functional sequences needed for expression of the desired fragment(s). As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. Pharmaceutical compositions may be immunogenic compositions. In some aspects, active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some aspects, pharmaceutical compositions may be specially formulated for parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation. As used herein, the term “vaccination” refers to the administration of an immunogenic composition intended to generate an immune response, for example to a disease-associated (e.g., disease-causing) agent (e.g., a virus). In some aspects, vaccination may be administered before, during, and / or after exposure to a disease-associated agent, and in certain aspects, before, during, and / or shortly after exposure to the agent. In some aspects, vaccination includes multiple administrations, appropriately spaced in time, of a vaccine composition. In some aspects, vaccination generates an immune response to an infectious agent. In some aspects, vaccination generates an immune response to a tumor; in some such aspects, vaccination is “personalized” in that it is partly or wholly directed to epitope(s) (e.g., which may be or include one or more neoepitopes) determined to be present in a particular individual’s tumors. An immune response refers to a humoral response, a cellular response, or both a humoral and cellular response in an organism. An immune response may be measured by assays that include, but are not limited to, assays measuring the presence or amount of antibodies that specifically recognize a protein or cell surface protein, assays measuring T-cell activation or proliferation, and / or assays that measure modulation in terms of activity or expression of one or more cytokines. As used herein, the term “combination therapy” refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some aspects, the two or more regimens may be administered simultaneously; in some aspects, such regimens may be administered sequentially (e.g., all “doses” of a first regimen are administered prior to administration of any doses of a second regimen); in some aspects, such agents are administered in overlapping dosing regimens. In some aspects, “administration” of combination therapy may involve administration of one or more agent(s) or modality(ies) to a subject receiving the other agent(s) or modality(ies) in the combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily at the same time), although in some aspects, two or more agents, or active moieties thereof, may be administered together in a combination composition, or even in a combination compound (e.g., as part of a single chemical complex or covalent entity). Those skilled in the art will appreciate that the term “dosing regimen” may be used to refer to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some aspects, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some aspects, a dosing regimen comprises a plurality of doses each of which is separated in time from other doses. In some aspects, individual doses are separated from one another by a time period of the same length; in some aspects, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some aspects, all doses within a dosing regimen are of the same unit dose amount. In some aspects, different doses within a dosing regimen are of different amounts. In some aspects, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some aspects, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount. In some aspects, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (e.g., is a therapeutic dosing regimen). II. RESPIRATORY SYNCYTIAL VIRUS (RSV) The present disclosure provides for RNA molecules (e.g., RNA polynucleotides) comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. The present disclosure further provides for an immunogenic composition comprising at least one RNA molecule encoding an RSV polypeptide complexed with, encapsulated in, or formulated with one or more lipids, and forming lipid nanoparticles (LNPs). The RSV polypeptide to be included in the immunogenic composition disclosed herein can be any RSV F protein in the prefusion conformation. The term “prefusion conformation” refers to a structural conformation adopted by an RSV F protein or mutant thereof that can be specifically bound by (i) antibody D25 or AM22 when the RSV F protein or mutant is in the form of a monomer or trimer, or (ii) by antibody AM14 when the RSV F protein mutant is in the form of a trimer. The prefusion trimer conformation is a subset of prefusion conformations. As used herein, an RSV F protein or polypeptide or mutant thereof in prefusion conformation may be denoted as “RSV preF”. The term “postfusion conformation” refers to a structural conformation adopted by the RSV F protein that is not specifically bound by D25, AM22, or AM14. Native F protein adopts the postfusion conformation subsequent to the fusion of the virus envelope with the host cellular membrane. RSV F protein may also assume the postfusion conformation outside the context of a fusion event, for example, under stress conditions such as heat and low osmolality, when extracted from a membrane, when expressed as an ectodomain, or upon storage. The term “AM14” refers to an antibody described in WO 2008 / 147196 A2, which is hereby incorporated by reference in its entirety. The term “AM22” refers to an antibody described in WO 2011 / 043643 A1, which is hereby incorporated by reference in its entirety. The term “D25” refers to an antibody described in WO 2008 / 147196 A2, which is hereby incorporated herein by reference in its entirety. In some embodiments, the RSV F protein is an RSV F protein of subtype A. In some embodiments, the RSV F protein is an RSV F protein of subtype B. As used herein the terms “subtype” and “subgroup” are used interchangeably. As used herein the term “strain” refers to a specific isolate within each subtype or subgroup. In some embodiments, the RSV F protein is a mutant of wild type RSV F protein. In some embodiments, the RSV F protein is a mutant of wild type RSV F protein of subtype A. In some embodiments, the RSV F protein is a mutant of wild type RSV F protein of subtype B. In some embodiments, the mutants display introduced mutations in the amino acid sequence relative to the amino acid sequence of the corresponding wild-type RSV F protein and are immunogenic against the wild-type RSV F protein in the prefusion conformation or against a virus comprising the wild-type F protein. The amino acid mutations in the mutants include amino acid substitutions, deletions, or additions relative to a wild-type RSV F protein. In some embodiments, the RSV F protein is an RSV protein mutant as described in WO2017 / 109629, which is hereby incorporated by reference in its entirety. In some embodiments, the RSV F protein is a mutant of a wild-type RSV F protein, wherein the introduced amino acid mutations are mutation of a pair of amino acid residues in a wild-type RSV F protein to a pair of cysteines (”engineered disulfide mutation”). The introduced pair of cysteine residues allows for formation of a disulfide bond between the cysteine residues that stabilize the protein’s conformation or oligomeric state, such as the prefusion conformation. Examples of specific pairs of such mutations include: 55C and 188C; 155C and 290C; 103C and 148C; and 142C and 371C, such as S55C and L188C; S155C and S290C; A103C and I148C; and L142C and N371C. In still other embodiments, the RSV F protein mutants comprise amino acid mutations that are one or more cavity filling mutations. Examples of amino acids that may be replaced with the goal of cavity filling include small aliphatic (e.g. Gly, Ala, and Val) or small polar amino acids (e.g. Ser and Thr) and amino acids that are buried in the prefusion conformation, but exposed to solvent in the postfusion conformation. Examples of the replacement amino acids include large aliphatic amino acids (Ile, Leu and Met) or large aromatic amino acids (His, Phe, Tyr and Trp). In some specific embodiments, the RSV F protein mutant comprises a cavity filling mutation selected from the group consisting of: (1) substitution of S at positions 55, 62, 155, 190, or 290 with I, Y, L, H, or M; (2) substitution of T at position 54, 58, 189, 219, or 397 with I, Y, L, H, or M; (3) substitution of G at position 151 with A or H; (4) substitution of A at position 147 or 298 with I, L, H, or M; (5) substitution of V at position 164, 187, 192, 207, 220, 296, 300, or 495 with I, Y, H; and (6) substitution of R at position 106 with W. In some particular embodiments, the RSV F protein mutant comprises at least one cavity filling mutation selected from the group consisting of: T54H, S190I, and V296I. In still other embodiments, the RSV F protein mutants comprise electrostatic mutations, which decrease ionic repulsion or increase ionic attraction between resides in a protein that are proximate to each other in the folded structure. In several embodiments, the RSV F protein mutant includes an electrostatic substitution that reduces repulsive ionic interactions or increases attractive ionic interactions with acidic residues of Glu487 and Asp489 from another protomer of RSV F trimer. In some specific embodiments, the RSV F protein mutant comprises an electrostatic mutation selected from the group consisting of: (1) substitution of E at position 82, 92, or 487 by D, F, Q, T, S, L, or H; (2) substitution of K at position 315, 394, or 399 by F, M, R, S, L, I, Q, or T; (3) substitution of D at position 392, 486, or 489 by H, S, N, T, or P; and (4) substitution of R at position 106 or 339 by F, Q, N, or W. In still other embodiments, the RSV F protein mutants comprise a combination of two or more different types of mutations selected from engineered disulfide mutations, cavity filling mutations, and electrostatic mutations. In some particular embodiments, the RSV F protein mutants comprise a combination of mutations relative to the corresponding wild-type RSV F protein, wherein the combination of mutations is selected from the group consisting of: (1) combination of A103C, I148C, S190I, and D486S; (2) combination of T54H S55C L188C D486S; (3) combination of T54H, A103C, I148C, S190I, V296I, and D486S; (4) combination of T54H, S55C, L142C, L188C, V296I, and N371C; (5) combination of S55C, L188C, and D486S; (6) combination of T54H, S55C, L188C, and S190I; (7) combination of S55C, L188C, S190I, and D486S; (8) combination of T54H, S55C, L188C, S190I, and D486S; (9) combination of S155C, S190I, S290C, and D486S; (10) combination of T54H, S55C, L142C, L188C, V296I, N371C, D486S, E487Q, and D489S; (11) combination of T54H, S155C, S190I, S290C, and V296I, and, (12) combination of S155C, S190F, S290C, and V207L. In some embodiments, the RSV F protein is of subtype A and comprises the mutations S155C, S190F, S290C, and V207L. In some embodiments, the RSV F protein is of subtype B and comprises the mutations S155C, S190F, S290C, and V207L. In some embodiments, the RSV F protein is of subtype A and comprises the mutations S155C, S190F, and S290C. In some embodiments, the RSV F protein is of subtype B and comprises the mutations S155C, S190F, and S290C. In some embodiments, the RSV F protein is of subtype A and comprises the mutations A103C, I148C, S190I, and D486S. In some embodiments, the RSV F protein is of subtype B and comprises the mutations A103C, I148C, S190I, and D486S. In some embodiments, the RSV F protein is of subtype A and comprises the mutations T54H, A103C, I148C, S190I, and D486S. In some embodiments, the RSV F protein is of subtype B and comprises the mutations T54H, A103C, I148C, S190I, and D486S. In some embodiments, the RSV F protein is of subtype A and comprises the mutations T54H, S55C, L188C, and D486S. In some embodiments, the RSV F protein is of subtype B and comprises the mutations T54H, S55C, L188C, and D486S. In view of the substantial conservation of RSV F sequences, a person of ordinary skill in the art can easily compare amino acid positions between different native RSV F sequences to identify corresponding RSV F amino acid positions between different RSV strains and subtypes. For example, across nearly all identified native RSV F0 precursor proteins, the furin cleavage sites fall in the same amino acid positions. Thus, the conservation of native RSV F protein sequences across strains and subtypes allows use of a reference RSV F sequence for comparison of amino acids at particular positions in the RSV F protein. For the purposes of this disclosure (unless context indicates otherwise), the RSV F protein amino acid positions are given with reference to the amino acid sequence of the full length native F precursor polypeptide of the RSV A2 strain; corresponding to GenInfo Identifier GI 138251 and Swiss Prot identifier P03420 (SEQ ID NO: 1). In some embodiments, the RSV F protein is in the mature form of the RSV F protein, which comprises two separate polypeptide chains, namely the F1 polypeptide and F2 polypeptide. In some other embodiments, the F2 polypeptide is linked to the F1 polypeptide by one or two disulfide bonds to form a F2 / F1 heterodimer. In still other embodiments, the RSV F mutants are in the form a single chain protein, wherein the F2 polypeptide is linked to the F1 polypeptide by a peptide bond or peptide linker. Any suitable peptide linkers for joining two polypeptide chains together may be used. Examples of such linkers include G, GG, GGG, GS, and SAIG linker sequences. The linker may also be the full length pep27 sequence or a fragment thereof, which full length pep27 sequence corresponds to amino acids at positions 110-136 of SEQ ID NO:1. The F1 polypeptide chain of the mutant may be of the same length as the full length F1 polypeptide of the corresponding wild-type RSV F protein; however, it may also have deletions, such as deletions of 1 up to 60 amino acid residues from the C-terminus of the full-length F1 polypeptide. A full-length F1 polypeptide of the RSV F mutants corresponds to amino acid positions 137-574 of the native RSV F0 precursor (SEQ ID NO: 1), and includes (from N- to C- terminus) an extracellular region (residues 137-524), a transmembrane domain (“TM”) (residues 525-550), and a cytoplasmic domain (“CT”) (residues 551-574). It should be noted that amino acid residues 514 onwards in a native F1 polypeptide sequence are optional sequences in a F1 polypeptide of the RSV F protein to be included in the immunogenic composition provided herein, and therefore may be absent from the F1 polypeptide of the mutant. In some embodiments, the F1 polypeptide of the RSV F mutants lacks the entire cytoplasmic domain. In other embodiments, the F1 polypeptide lacks the cytoplasmic domain and a portion of or all entire transmembrane domain. In some specific embodiments, the mutant comprises a F1 polypeptide wherein the amino acid residues from position 510, 511, 512, 513, 514, 515, 520, 525, or 530 through 574 are absent. Typically, for mutants that are linked to trimerization domain, such as a foldon, amino acids 514 through 574 can be absent. Thus, in some specific embodiment, amino acid residues 514 through 574 are absent from the F1 polypeptide of the mutant. In still other specific embodiments, the F1 polypeptide of the RSV F mutants comprises or consists of amino acid residues 137-513 of a native F0 polypeptide sequence (SEQ ID NO: 1), such as the RSV 847A -Foldon polypeptide (SEQ ID NO: 74) or any of alternative F0 precursor sequence such as those disclosed in SEQ ID NOs: 1, 2, 4, 6, and 81- 270 of WO2017109629, which is hereby incorporated by reference in its entirety. The F1 polypeptide and F2 polypeptide of the RSV F protein mutants to which one or more mutations are introduced can be from any wild-type RSV F proteins known in the art or discovered in the future, including, without limitations, the F protein amino acid sequence of RSV subtype A, and subtype B strains, including A2 Ontario and Buenos Aires, or any other subtype. In some embodiments, the RSV F mutant comprises a F1 and / or a F2 polypeptide from a RSV A virus, for example, a F1 and / or F2 polypeptide from a RSV F0 precursor protein set forth in any one of SEQ ID NOs: 1, 2, 4, 6, and 81-270 of WO2017109629, which sequences are hereby incorporated by reference in their entireties, to which one or more mutations are introduced. In some other embodiments, the RSV F mutant comprises a F1 and / or a F2 polypeptide from a RSV B virus, for example, a F1 and / or F2 polypeptide from a RSV F0 precursor protein set forth in any one of SEQ ID NOs:2, and 211- 263 of WO2017 / 109629, which sequences are hereby incorporated by reference in their entireties, to which one or more mutations are introduced. In still other embodiments, the RSV F mutant comprises a F1 and / or a F2 polypeptide from a RSV bovine virus, for example, a F1 and / or F2 polypeptide from a RSV F0 precursor protein set forth in any one of SEQ ID NOs:264-270 of WO2017109629, which sequences are hereby incorporated by reference in their entireties, to which one or more mutations are introduced. The term “F0 polypeptide” (F0) refers to the precursor polypeptide of the RSV F protein, which is composed of a signal polypeptide sequence, a F1 polypeptide sequence, a pep27 polypeptide sequence, and a F2 polypeptide sequence. With rare exceptions the F0 polypeptides of the known RSV strains consist of 574 amino acids. The term “F1 polypeptide” (F1) refers to a polypeptide chain of a mature RSV F protein. Native F1 includes approximately residues 137-574 of the RSV F0 precursor and is composed of (from N- to C-terminus) an extracellular region (approximately residues 137-524), a transmembrane domain (“TM”) (approximately residues 525-550), and a cytoplasmic tail (“CT”) (approximately residues 551-574). As used herein, the term encompasses both native F1 polypeptides and F1 polypeptides including modifications (e.g., amino acid substitutions, insertions, or deletions) from the native sequence, for example, modifications designed to stabilize an RSV F protein mutant or to enhance the immunogenicity of an RSV F protein mutant. The term “F2 polypeptide” (F2) refers to the polypeptide chain of a mature RSV F protein. Native F2 includes approximately residues 26-109 of the RSV F0 precursor. As used herein, the term encompasses both native F2 polypeptides and F2 polypeptides including modifications (e.g., amino acid substitutions, insertions, or deletions) from the native sequence, for example, modifications designed to stabilize an RSV F protein mutant in a prefusion conformation or to enhance the immunogenicity of an RSV F protein mutant. In native RSV F protein, the F2 polypeptide is linked to the F1 polypeptide by two disulfide bonds to form a F2-F1 heterodimer. The term “foldon” or “foldon domain” refers to an amino acid sequence that is capable of forming trimers. One example of such foldon domains is the peptide sequence derived from bacteriophage T4 fibritin, which has the sequence of GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO: 45). In some aspects, the RNA molecule encodes an RSV F protein mutant as disclosed in WO2009 / 079796, WO2010 / 149745, WO2011 / 008974, WO2014 / 160463, WO2014 / 174018, WO2014 / 202570, WO2015 / 013551, WO2015 / 177312, WO2017 / 005848, WO2017 / 174564, WO2017 / 005844 and WO2018 / 109220. The RSV F proteins disclosed in these references are hereby incorporated by reference in their entirety. Antibodies to RSV F protein are prevalent after natural infection and following vaccination and have been shown to neutralize viral activity in vitro. As used herein, the term “respiratory syncytial virus” or “RSV” is not limited to any particular strain or variant. In some aspects, the RNA molecule comprises an open reading frame encoding a RSV antigen. In some aspects, the RSV antigen is a RSV polypeptide. In some aspects, the RSV polypeptide is a RSV glycoprotein or a fragment or a variant thereof. In some aspects, the RNA molecule encodes a RSV F protein. In some aspects, the RSV polypeptide is a full-length RSV polypeptide. In some aspects, the RSV polypeptide is a truncated RSV polypeptide. In some aspects, the RSV polypeptide is a variant of a RSV polypeptide. In some aspects, the RSV polypeptide is a fragment of a RSV polypeptide. In some aspects, the RSV polypeptide is a full-length RSV F protein. In some aspects, the RSV polypeptide is a truncated RSV F protein. In some aspects, the RSV polypeptide is a variant of a RSV F protein. In some aspects, the RSV polypeptide is a fragment of a RSV F protein. In some aspects, the RSV F protein comprises at least one mutation. In some aspects, the RSV F protein comprises at least two mutations. In some aspects, the RSV F protein comprises at least three mutations. In some aspects, the RSV F protein comprises at least four mutations. In some aspects, the RSV F protein comprises 4 mutations. In some aspects, the RSV F protein comprises at least five mutations. In some aspects, the RNA molecule encodes a RSV F protein as set forth in Table 1 (see Example 6). In some aspects, the RNA molecule encodes a RSV F protein comprising an amino acid sequence of any of SEQ ID NO: 1 to 6 and 71 to 74, or fragment or variant thereof. In some aspects, RSV F polypeptide may have at least, at most, exactly, or between any two of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the amino acid sequences of Table 1, for example, any of SEQ ID NO: 1 to 6 and 71 to 74. In some aspects, RSV F protein consists of any of the amino acid sequences of Table 1, for example, any of SEQ ID NO: 1 to 6 and 71 to 74. In some aspects, the RNA molecule sequence is transcribed from a DNA nucleic acid sequence (DNA polynucleotide) of Table 2 (see Example 6). In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence of any of SEQ ID NO: 7 to 10 and 59 to 62, or fragment or variant thereof. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that may have at least, at most, exactly, or between any two of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleic acid sequences of Table 2, for example, any of SEQ ID NO: 7 to 10 and 59 to 62. In some aspects, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that consists of any of the nucleic acid sequences of Table 2, for example, any of SEQ ID NO:7 to 10 and 59 to 62. In some aspects, the RNA molecule comprises an ORF comprising an RNA nucleic acid sequence (RNA polynucleotide) of Table 3 (see Example 6). In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence of any of SEQ ID NO: 11 to 16 and 63 to 70, or fragment or variant thereof. In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence that may have at least, at most, exactly, or between any two of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the RNA nucleic acid sequences of Table 3, for example, any of SEQ ID NO: 11 to 16 and 63 to 70. In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence that consists of any of the RNA nucleic acid sequences of Table 3, for example, any of SEQ ID NO: 11 to 16 and 63 to 70. In some aspects, the RNA molecule comprises stabilized RNA. In some aspects, the RNA molecule comprises a nucleic acid sequence having at least one uridine replaced by N1- methylpseudouridine. In some aspects, the RNA molecule comprises a sequence having all uridines replaced by N1-methylpseudouridine (designated as “Ψ”). In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence of any of SEQ ID NO: 11 to 16 and 63 to 70, wherein all uridines have been replaced by N1-methylpseudouridine (designated as “Ψ”). In some aspects, the RNA molecule comprises an open reading frame encoding a RSV F protein amino acid sequence that may be at least, at most, exactly, or between any two of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the RSV F protein sequences of SEQ ID NO: 1 to 6 and 71 to 74 (Table 1) or other RSV prefusion F proteins described herein. In some aspects, the RNA molecule comprises an open reading frame encoding a RSV F protein amino acid sequence that consists of any of the RSV F protein sequences of SEQ ID NO: 1 to 6 and 71 to 74 (Table 1) or other RSV prefusion F protein described herein. In some aspects, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that may be at least, at most, exactly, or between any two of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the nucleic acid sequences of SEQ ID NO: 7 to 10 and 59 to 62 (Table 2) or other nucleic acid described herein. In some aspects, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that consists of any of the nucleic acid sequences of SEQ ID NO: 7 to 10 and 59 to 62 (Table 2) or other nucleic acid described herein. In some aspects, the RNA molecule comprises an open reading frame comprising an RNA nucleic acid sequence that may be at least, at most, exactly, or between any two of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the nucleic acid sequences of SEQ ID NO: 11 to 16 and 63 to 70 (Table 3) or other nucleic acid described herein. In some aspects, the RNA molecule comprises an open reading frame comprising an RNA nucleic acid sequence that consists of any of the nucleic acid sequences of SEQ ID NO: 11 to 16 and 63 to 70 (Table 3) or other nucleic acid described herein. In some aspects, the RNA molecule comprises an ORF comprising a nucleic acid sequence of any of SEQ ID NO: 11 to 16 and 63 to 70 (Table 3), wherein all uridines have been replaced by N1-methylpseudouridine (designated as “Ψ”). III. RNA MOLECULE In some aspects, the RNA molecule described herein is a coding RNA molecule. Coding RNA includes a functional RNA molecule that may be translated into a peptide or polypeptide. In some aspects, the coding RNA molecule includes at least one open reading frame (ORF) coding for at least one peptide or polypeptide. An open reading frame comprises a sequence of codons that is translatable into a peptide or protein. The coding RNA molecule may include one (monocistronic), two (bicistronic) or more (multicistronic) ORFs, which may be a sequence of codons that is translatable into a polypeptide or protein of interest. The coding RNA molecule may be a messenger RNA (mRNA) molecule, viral RNA molecule, or self-amplifying RNA molecule (saRNA, also referred to as a replicon). In some aspects, the RNA molecule is an mRNA. Preferably, the RNA molecule of the present disclosure is an mRNA. In some aspects, the RNA molecule is modRNA. In some aspects, the RNA molecule is a saRNA. In some aspects, the saRNA molecule may be a coding RNA molecule. The RNA molecule may encode one polypeptide of interest or more, such as an antigen or more than one antigen, e.g., two, three, four, five, six, seven, eight, nine, ten or more polypeptides. Alternatively, or in addition, one RNA molecule may also encode more than one polypeptide of interest, such as an antigen, e.g., a bicistronic, or tricistronic RNA molecule that encodes different or identical antigens. The sequence of the RNA molecule may be codon optimized or deoptimized for expression in a desired host, such as a human cell. In some aspects, a gene of interest (e.g., an antigen) described herein is encoded by a coding sequence which is codon-optimized and / or the guanosine / cytidine (G / C) content of which is increased compared to wild type coding sequence. In some aspects, one or more sequence regions of the coding sequence are codon-optimized and / or increased in the G / C content compared to the corresponding sequence regions of the wild type coding sequence. In some aspects, codon-optimization and / or increasing the G / C content does not change the sequence of the encoded amino acid sequence. The term “codon-optimized” is understood by those in the art to refer to alteration of codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without altering the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, in some aspects, coding regions are codon-optimized for optimal expression in a subject to be treated using an RNA polynucleotide described herein. Codon-optimization is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNA molecules in cells. Thus, the sequence of RNA may be modified such that codons for which frequently occurring tRNA molecules are available are inserted in place of “rare codons.” In some aspects, G / C content of a coding region (e.g., of a gene of interest sequence; open reading frame (ORF)) of an RNA is increased compared to the G / C content of the corresponding coding sequence of a wild type RNA encoding the gene of interest, wherein in some aspects, the amino acid sequence encoded by the RNA is not modified compared to the amino acid sequence encoded by the wild type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of that mRNA. Sequences having an increased G (guanosine) / C (cytidine) content are more stable than sequences having an increased A (adenosine) / U (uridine) content. In respect to the fact that several codons code for one and the same amino acid (so-called degeneration of the genetic code), the most favorable codons for the stability may be determined (so-called alternative codon usage). Depending on the amino acid to be encoded by the RNA, there are various possibilities for modification of the RNA sequence, compared to its wild type sequence. In particular, codons which contain A and / or U nucleosides may be modified by substituting these codons by other codons, which code for the same amino acids but contain no A and / or U or contain a lower content of A and / or U nucleosides. Thus, in some aspects, G / C content of a coding region of an RNA described herein is increased by at least, at most, exactly, or between any two of 10%, 20%, 30%, 40%, 50%, 55%, or even more compared to the G / C content of a coding region of a wild type RNA. In some aspects, the coding region of the RSV RNA described herein comprises a G / C content of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or about 80%. In some aspects, the coding region of the RSV RNA described herein comprises a G / C content of about 50% to 75%, about 55% to 70%, about 50% to 60%, about 60% to 70%, about 70% to 80%, about 50% to 55%, about 55% to 60%, about 60% to 65%, about 65% to 70%, about 70% to 75%, or about 75% to 80%. In some aspects, the coding region of the RSV RNA described herein comprises a G / C content of about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, or about 75%. In some aspects, the coding region of the RSV RNA described herein comprises a G / C content of about 58%, about 66% or about 62%. In some aspects, the RNA molecule includes from about 20 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1,000, from 30 to 1,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1,000, from 100 to 1,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 3,000, from 1,000 to 5,000, from 1,000 to 7,000, from 1,000 to 10,000, from 1,000 to 25,000, from 1,000 to 50,000, from 1,000 to 70,000, from 1,000 to 100,000, from 1,500 to 3,000, from 1,500 to 5,000, from 1,500 to 7,000, from 1,500 to 10,000, from 1,500 to 25,000, from 1,500 to 50,000, from 1,500 to 70,000, from 1,500 to 100,000, from 2,000 to 3,000, from 2,000 to 5,000, from 2,000 to 7,000, from 2,000 to 10,000, from 2,000 to 25,000, from 2,000 to 50,000, from 2,000 to 70,000, and from 2,000 to 100,000 nucleotides). In some aspects, the RNA molecule has at least, at most, exactly, or between any two of about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000 nucleotides. In some aspects, the RNA molecule includes at least 100 nucleotides. For example, in some aspects, the RNA has a length between 100 and 15,000 nucleotides; between 7,000 and 16,000 nucleotides; between 8,000 and 15,000 nucleotides; between 9,000 and 12,500 nucleotides; between 11,000 and 15,000 nucleotides; between 13,000 and 16,000 nucleotides; between 7,000 and 25,000 nucleotides. In some aspects, the RNA molecule has at least, at most, exactly, or between any two of about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, 13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 nucleotides. The RNA molecules of the present disclosure may be prepared by any method know in the art, including chemical synthesis and in vitro methods, such as RNA in vitro transcription. In some of the aspects, the RNA of the present disclosure is prepared using in vitro transcription. In some aspects, the RNA molecule of the present disclosure is purified, e.g., such as by filtration that may occur via, e.g., ultrafiltration, diafiltration, or, e.g., tangential flow ultrafiltration / diafiltration. In some aspects, the RNA molecule of the present disclosure is lyophilized to be temperature stable. In some aspects of the present disclosure, an RNA is or comprises messenger RNA (mRNA) that relates to an RNA transcript which encodes a polypeptide. In some aspects, an RNA disclosed herein comprises: a 5′ cap comprising a 5′ cap disclosed herein; a 5′ untranslated region comprising a cap proximal sequence (5′ UTR), a sequence encoding a protein (e.g. polypeptide) (e.g., a RSV prefusion F protein); a 3′ untranslated region (3′ UTR); and / or a polyadenylate (poly- A) sequence. In some aspects, an RNA disclosed herein comprises the following components in 5′ to 3′ orientation: a 5′ cap comprising a 5′ cap disclosed herein; a 5′ untranslated region comprising a cap proximal sequence (5′ UTR), a sequence encoding a protein (e.g. polypeptide) (e.g., a RSV prefusion F protein); a 3′ untranslated region (3′ UTR); and a poly-A sequence. In some aspects, an RNA disclosed herein further comprises a signal peptide. Non- limiting examples of signal peptides and amino acid and nucleic acid sequences encoding such peptides can be found in, e.g., WO2017 / 109629, the disclosure of which is incorporated by reference herein in its entirety. In some aspects, an RNA disclosed herein encodes an antigenic fusion protein. Thus, the encoded antigen or antigens may include two or more proteins (e.g., protein and / or protein fragment) joined together. Alternatively, the protein to which a protein antigen is fused does not promote a strong immune response to itself, but rather to an antigen. Antigenic fusion proteins, in some aspects, retain the functional property from each original protein. In some aspects, an RNA disclosed herein encodes fusion proteins that comprise an antigen linked to a scaffold moieties. In some aspects, the RNA further encodes a linker located between at least one or each domain of the fusion protein. Non-limiting examples of such scaffold moieties and linkers can be found in, e.g., WO 2022 / 067010, the disclosure of which is incorporated by reference herein in its entirety. A. MODIFIED NUCLEOBASES In some aspects of the present disclosure, the RNA molecules are not chemically modified and comprise the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some aspects, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g., A, G, C, and / or U). In some aspects, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g., dA, dG, dC, and / or dT). In other aspects of the present disclosure the RNA molecules may comprise modified nucleobases which may be incorporated into modified nucleosides and nucleotides. In some aspects, the RNA molecule may include one or more modified nucleotides. In some aspects, the RNA molecule may include one or more modified nucleotides. Naturally occurring nucleotide modifications are known in the art. In some aspects, the RNA molecule may include a modified nucleotide. Non-limiting examples of modified nucleotides that may be included in the RNA molecule include pseudouridine, N1-methylpseudouridine, 5-methyluridine, 3-methyl-uridine, 5- methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxy hydroxymethyl-uridine, 5-carboxy hydroxy methyl-uridine methyl ester, 5- methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio- uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine, 1- methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-1-pseudouridine, 2-thio-1- methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza- pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl- dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2- methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl- pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)- 2-thio-uridine, a-thio-uridine, 2′-O-methyl-uridine, 5,2′-O-dimethyl-uridine, 2′-O-methyl- pseudouridine, 2-thio-2′-O-methyl-uridine, 5-methoxycarbonylmethyl-2′-O-methyl-uridine, 5- carbamoylmethyl-2′-O-methyl-uridine, 5-carboxymethylaminomethyl-2′-O-methyl-uridine, 3,2′-O- dimethyl-uridine, 5-(isopentenylaminomethyl)-2′-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2′-F-ara-uridine, 2′-F-uridine, 2′-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, 5-[3-(1-E-propenylamino)uridine, any other modified uridine known in the art, or combinations thereof. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified nucleotides can be excluded from the RNA molecules disclosed herein. Modifications that may be present in the RNA molecules further include, but are not limited to, e.g., the following: ms2io6A (2-methylthio-(N6-(cis-hydroxyisopentenyl)adenosine); ms2m6A (2-methylthio-N6-methyladenosine); ms2t6A 2-methylthio-N6-threonylcarbamoyladenosine; g6A (N6-glycinylcarbamoyladenosine); i6A (N6-isopentenyladenosine); m6A (N6-methyladenosine); t6A (N6-threonylcarbamoyladenosine); m′Am (1,2′-O-dimethyladenosine); m1A (1- methyladenosine); 2′-O-methyladenosine; Ar(p) (2′-O-ribosyladenosine (phosphate)); 2-m ethyl adenosine; 2-methylthio-N6 isopentenyladenosine; ms2hn6A (2-methylthio-N6- hydroxynorvalylcarbamoyladenosine); 2-O-methyladenosine; Am (2-1-O-methyladenosine); 2′- O-ribosyladenosine (phosphate); Isopentenyladenosine; io6A N6-(cis- hydroxyisopentenyl)adenosine; m6Am (N6,2′-O-dimethyladenosine); m62Am (N6,N6,2′-O- trimethyladenosine); m62A (N6,N6-dimethyladenosine); ac6A (N6-acetyladenosine); hn6A (N6- hydroxynorvalylcarbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); m2A (2-methyladenosine); ms2i6A (2-methylthio-N6-isopentenyladenosine); 7-deaza- adenosine; N1-methyl-adenosine; N6,N6 (dimethyl)adenine; N6-cis-hydroxy-isopentenyl- adenosine; a-thio-adenosine; 2 (amino)adenine; 2 (aminopropyl)adenine; 2 (methylthio) N6 (isopentenyl)adenine; 2-(alkyl)adenine; 2-(aminoalkyl)adenine; 2-(aminopropyl)adenine; 2- (halo)adenine; 2-(halo)adenine; 2-(propyl)adenine; 2′-amino-2′-deoxy-ATP; 2′-azido-2′-deoxy- ATP; 2′-deoxy-2′-a-aminoadenosine TP; 2′-deoxy-2′-a-azidoadenosine TP; 6 (alkyl)adenine; 6 (methyl)adenine; 6-(alkyl)adenine; 6-(methyl)adenine; 7 (deaza)adenine; 8 (alkenyl)adenine; 8 (alkynyl)adenine; 8 (amino)adenine; 8 (thioalkyl)adenine; 8-(alkenyl)adenine; 8-(alkyl)adenine; 8- (alkynyl)adenine; 8-(amino)adenine; 8-(halo)adenine; 8-(hydroxyl)adenine; 8-(thioalkyl)adenine; 8-(thiol)adenine; 8-azido-adenosine; 8-oxo-adenine; aza adenine; deaza adenine; N6 (methyl)adenine; N6-(isopentyl)adenine; 7-deaza-8-aza-adenosine; 7-methyladenine; 1- deazaadenosine TP; 2′fluoro-N6-Bz-deoxyadenosine TP; 2′-OMe-2-amino-ATP; 2′O-methyl-N6- Bz-deoxyadenosine TP; 2′-a-ethynyladenosine TP; 2-aminoadenine; 2-aminoadenosine TP; 2- amino-ATP; 2′-a-trifluoromethyladenosine TP; 2-azidoadenosine TP; 2′-b-Ethynyladenosine TP; 2-bromoadenosine TP; 2′-b-trifluoromethyladenosine TP; 2-chloroadenosine TP; 2′-deoxy-2′,2′- difluoroadenosine TP; 2′-deoxy-2′-a-mercaptoadenosine TP; 2′-deoxy-2′-a- thiomethoxyadenosine TP; 2′-deoxy-2′-b-aminoadenosine TP; 2′-deoxy-2′-b-azidoadenosine TP; 2′-deoxy-2′-b-bromoadenosine TP; 2′-deoxy-2′-b-chloroadenosine TP; 2′-deoxy-2′-b- fluoroadenosine TP; 2′-deoxy-2′-b-iodoadenosine TP; 2′-deoxy-2′-b-mercaptoadenosine TP; 2′- deoxy-2′-b-thiomethoxyadenosine TP; 2-fluoroadenosine TP; 2-iodoadenosine TP; 2- mercaptoadenosine TP; 2-methoxy-adenine; 2-methylthio-adenine; 2-Trifluoromethyladenosine TP; 3-deaza-3-bromoadenosine TP; 3-deaza-3-chloroadenosine TP; 3-deaza-3-fluoroadenosine TP; 3-deaza-3-iodoadenosine TP; 3-deazaadenosine TP; 4′-Azidoadenosine TP; 4′-Carbocyclic adenosine TP; 4′-Ethynyladenosine TP; 5′-Homo-adenosine TP; 8-Aza-ATP; 8-bromo-adenosine TP; 8-Trifluoromethyladenosine TP; 9-deazaadenosine TP; 2-aminopurine; substituted 7- deazapurine; 7-deaza-7-substituted purine; 7-deaza-8-substituted purine; 7-deaza-2,6- diaminopurine; 7-deaza-8-aza-2,6-diaminopurine; 7-deaza-8-aza-2-aminopurine; 2,4- diaminopurine; 2,6-diaminopurine; 7-deaza-8-aza-adenine; 7-deaza-2-aminopurine; 8- azapurine; s2C (2-thiocytidine); m3C (3 -methylcytidine); f5C (5-formylcytidine); hm5C (5- hydroxymethylcytidine); m5C (5-methylcytidine); ac4C (N4-acetylcytidine); Cm (2′-O- methylcytidine); m5Cm (5,2′-O-dimethylcytidine); f5Cm (5-formyl-2′-O-methylcytidine); k2C (Lysidine); m4Cm (N4,2′-O-dimethylcytidine); ac4Cm (N4-acetyl-2′-O-methylcytidine); m4C (N4- methylcytidine); N4,N4-dimethyl-2′-OMe-Cytidine TP; 4-methylcytidine; 5-aza-cytidine; Pseudo- iso-cytidine; pyrrolo-cytidine; a-thio-cytidine; 2-(thio)cytosine; 2′-amino-2′-deoxy-CTP; 2′-azido-2′- deoxy-CTP; 2′-deoxy-2′-a-aminocytidine TP; 2′-deoxy-2′-a-azidocytidine TP; 3 (deaza) 5 (aza)cytosine; 3 (methyl)cytosine; 3-(alkyl)cytosine; 3 -(deaza) 5 (aza)cytosine; 3- (methyl)cytidine; 4,2′-O-dimethylcytidine; 5 (halo)cytosine; 5 (methyl)cytosine; 5 (propynyl)cytosine; 5 (trifluoromethyl)cytosine; 5-chlorocytosine; 5-fluorocytosine; 5- bromocytosine; 5-hydroxycytosine; 5-methylcytosine; 5-(alkyl)cytosine; 5-(alkenyl)cytosine; 5- (alkynyl)cytosine; 5-(halo)cytosine; 5-(propynyl)cytosine; 5-(trifluoromethyl)cytosine; 5-bromo- cytidine; 5-iodo-cytidine; 5-propynyl cytosine; 6-(azo)cytosine; 6-aza-cytidine; aza cytosine; deaza cytosine; N4 (acetyl)cytosine; 1-methyl-1-deaza-pseudoisocytidine; 1-methyl- pseudoisocytidine; 2-methoxy-5-methyl-cytidine; 2-methoxy-cytidine; 2-thio-5-methyl-cytidine; 4- methoxy-1-methyl-pseudoisocytidine; 4-methoxy-pseudoisocytidine; 4-thio-1-methyl-1-deaza- pseudoisocytidine; 4-thio-1-methyl-pseudoisocytidine; 4-thio-pseudoisocytidine; 5-aza- zebularine; 5-methyl-zebularine; pyrrolo-pseudoisocytidine; Zebularine; (E)-5-(2-Bromo- vinyl)cytidine TP; 2,2′-anhydro-cytidine TP hydrochloride; 2′fluor-N4-Bz-cytidine TP; 2′fluoro-N4- Acetyl-cytidine TP; 2′-O-methyl-N4-Acetyl-cytidine TP; 2′O-methyl-N4-Bz-cytidine TP; 2′-a- ethynylcytidine TP; 2′-a-trifluoromethylcytidine TP; 2′-b-Ethynylcytidine TP; 2′-b- Trifluoromethylcytidine TP; 2′-deoxy-2′,2′-difluorocytidine TP; 2′-deoxy-2′-a-mercaptocytidine TP; 2′-deoxy-2′-a-thiomethoxycytidine TP; 2′-deoxy-2′-b-aminocytidine TP; 2′-deoxy-2′-b- azidocytidine TP; 2′-deoxy-2′-b-bromocytidine TP; 2′-deoxy-2′-b-chlorocytidine TP; 2′-deoxy-2′-b- fluorocytidine TP; 2′-deoxy-2′-b-iodocytidine TP; 2′-deoxy-2′-b-mercaptocytidine TP; 2′-deoxy-2′- b-thiomethoxycytidine TP; 2′-O-methyl-5-(1-propynyl)cytidine TP; 3′-ethynylcytidine TP; 4′- azidocytidine TP; 4′-carbocyclic cytidine TP; 4′-ethynyl cytidine TP; 5-(1-propynyl)ara-cytidine TP; 5-(2-chloro-phenyl)-2-thiocytidine TP; 5-(4-Amino-phenyl)-2-thiocytidine TP; 5-Aminoallyl-CTP; 5-cyanocytidine TP; 5-ethynylara-cytidine TP; 5-Ethynylcytidine TP; 5′-Homo-cytidine TP; 5- methoxycytidine TP; 5-Trifluoromethyl-Cytidine TP; N4-Amino-cytidine TP; N4-Benzoyl-cytidine TP; Pseudoisocytidine; mimG (methylguanosine); m7G (7-methylguanosine); m2Gm (N2,2′-O- dimethylguanosine); m2G (N2-methylguanosine); imG (Wyosine); m1Gm (1,2′-O- dimethylguanosine); m1G (1-methylguanosine); 2′-O-methylguanosine; 2′-O-ribosylguanosine (phosphate); Gm (2′-O-methylguanosine); Gr(p) (2′-O-ribosyl guanosine (phosphate)); preQi (7- aminomethyl-7-deazaguanosine); preQo (7-cyano-7-deazaguanosine); G* (Archaeosine); methylwyosine; m2′7G (N2,7-dimethylguanosine); m22Gm (N2,N2,2′-O-trimethylguanosine); m2′2′7G (N2,N2,7-trimethylguanosine); m22G (N2,N2-dimethylguanosine); N2,7,2′-O- trimethylguanosine; 6-thio-guanosine; 7-deaza-guanosine; 8-oxo-guanosine; N1-methyl- guanosine; a-thio-guanosine; 2 (propyl)guanine; 2-(alkyl)guanine; 2′-amino-2′-deoxy-GTP; 2′- azido-2′-deoxy-GTP; 2′-deoxy-2′-a-aminoguanosine TP; 2′-deoxy-2′-a-azidoguanosine TP; N2- dimethylguanine; 6-(methyl)guanine; 6-(alkyl)guanine; 6-(methyl)guanine; 6-methyl-guanosine; 6-thioguanine; 7 (alkyl)guanine; 7-deaza-7-substituted guanine; 7-deaza-7-(C2- c6)alkynylguanine; 7-deaza-8-substituted guanine; 7 (methyl)guanine; 7-(alkyl)guanine; 7- (deaza)guanine; 7-(methyl)guanine; 8-azaguanine; 8-hydroxyguanine; 8-oxoguanine; 8 (alkyl)guanine; 8 (alkynyl)guanine; 8 (halo)guanine; 8 (thioalkyl)guanine; 8-(alkenyl)guanine; 8- (alkyl)guanine; 8-(alkynyl)guanine; 8-(amino)guanine; 8-(halo)guanine; 8-(hydroxyl)guanine; 8- (thioalkyl)guanine; 8-(thiol)guanine; aza guanine; deaza guanine; N (methyl)guanine; N- (methyl)guanine; 1-methyl-6-thio-guanosine; 6-methoxy-guanosine; 6-thio-7-deaza-8-aza- guanosine; 6-thio-7-deaza-guanosine; 6-thio-7-methyl-guanosine; 7-deaza-8-aza-guanosine; 7- methyl-8-oxo-guanosine; N2,N2-dimethyl-6-thio-guanosine; N2-methyl-6-thio-guanosine; 1-me- GTP; 2′fluoro-N2-isobutyl-guanosine TP; 2′0-methyl-N2-isobutyl-guanosine TP; 2′-a- ethynylguanosine TP; 2′-a-trifluoromethylguanosine TP; 2′-b-ethynylguanosine TP; 2′-b- trifluoromethylguanosine TP; 2′-deoxy-2′,2′-difluoroguanosine TP; 2′-deoxy-2′-a- mercaptoguanosine TP; 2′-deoxy-2′-a-thiomethoxyguanosine TP; 2′-deoxy-2′-b-aminoguanosine TP; 2′-deoxy-2′-b-azidoguanosine TP; 2′-deoxy-2′-b-bromoguanosine TP; 2′-deoxy-2′-b- chloroguanosine TP; 2′-deoxy-2′-b-fluoroguanosine TP; 2′-deoxy-2′-b-iodoguanosine TP; 2′- deoxy-2′-b-mercaptoguanosine TP; 2′-deoxy-2′-b-thiomethoxyguanosine TP; 4′-Azidoguanosine TP; 4′-Carbocyclic guanosine TP; 4′-Ethynylguanosine TP; 5′-Homo-guanosine TP; 8-bromo- guanosine TP; 9-deazaguanosine TP; N2-isobutyl-guanosine TP; miI (1-methylinosine); I (Inosine); m′lm (1,2′-O-dimethylinosine); 2′-O-methylinosine; 7-methylinosine; Tm (2′-O- methylinosine); oQ (Epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosylqueuosine); Q (Queuosine); allyamino-thymidine; aza thymidine; deaza thymidine; deoxy-thymidine; Um (2′-O-methyluridine); s2U (2-thiouridine); m3U (3-methyluridine); cm5U (5- carboxymethyluridine); ho5U (5-hydroxyuridine); m5U (5-methyluridine); tm5s2U (5- taurinomethyl-2-thiouridine); 5-taurinomethyluridine; D (dihydrouridine); pseudouridine; acp3U (3-(3-amino-3-carboxypropyl)uridine); 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine; 1- methylpseudouridine; 1-ethyl-pseudouridine; 2′-O-methyluridine; 2′-O-methylpseudouridine; 2′- O-methyluridine; s2Um (2-thio-2′-O-methyluridine); 3-(3-amino-3-carboxypropyl)uridine; m3Um (3,2′-O-dimethyluridine); 3-methyl-pseudo-Uridine TP; s4U (4-thiouridine); chm5U (5- (carboxyhydroxymethyl)uridine); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); m5Um (5,2′-O-dimethyluridine); 5,6-dihydro-uridine; nm5s2U (5-aminomethyl-2-thiouridine); ncm5Um (5-carbamoylmethyl-2′-O-methyluridine); ncm5U (5-carbamoylmethyluridine); 5- carboxyhydroxymethyluridine; 5-carboxyhydroxymethyluridine methyl ester; cnmm5Um (5- carboxymethylaminomethyl-2′-O-methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2- thiouridine); 5-carboxymethylaminomethyluridine; cmnm5U (5- carboxymethylaminomethyluridine); 5-Carbamoylmethyluridine TP; mcm5Um (5- methoxycarbonylmethyl-2′-O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2- thiouridine); mcm5U (5-methoxycarbonylmethyluridine); mo5U (5-methoxyuridine); m5s2U (5- methyl-2-thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine); mnm5s2U (5- methylaminomethyl-2-thiouridine); mnm5U (5-methylaminomethyluridine); m5D (5- methyldihydrouridine); 5-Oxyacetic acid-Uridine TP; 5-Oxyacetic acid-methyl ester-Uridine TP; dihydrouracil; pseudouracil; N1-methyl-pseudo-uracil; N1-ethyl-pseudo-uracil; cmo5U (uridine 5- oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); 3-(3-Amino-3-carboxypropyl)- Uridine TP; 5-(iso-pentenylaminomethyl)-2-thiouridine TP; 5-(iso-pentenylaminomethyl)-2′-O- methyluridine TP; 5-(iso-pentenylaminomethyl)uridine TP; 5-propynyl uracil; a-thio-uridine; 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil; 1 (aminoalkylamino- carbonylethylenyl)-2,4-(dithio)pseudouracil; 1 (aminoalkylamino-carbonylethylenyl)-4 (thio)pseudouracil; 1 (aminoalkylamino-carbonylethylenyl)-pseudouracil; 1 (aminocarbonylethylenyl)-2(thio)-pseudouracil; 1 (aminocarbonylethylenyl)-2,4- (dithio)pseudouracil; 1 (aminocarbonylethylenyl)-4 (thio)pseudouracil; 1 (aminocarbonylethylenyl)-pseudouracil; 1 substituted 2(thio)-pseudouracil; 1 substituted 2,4- (dithio)pseudouracil; 1 substituted 4 (thio)pseudouracil; 1 substituted pseudouracil; 1- (aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouracil; 1-methyl-3-(3-amino-3- carboxypropyl) pseudouridine TP; 1-methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP; 1-methyl- pseudo-UTP; 1-ethyl-pseudo-UTP; 2 (thio)pseudouracil; 2′ deoxy uridine; 2′ fluorouridine; 2- (thio)uracil; 2,4-(dithio)pseudouracil; 2′methyl, 2′amino, 2′azido, 2′fluoro-guanosine; 2′-amino-2′- deoxy-UTP; 2′-azido-2′-deoxy-UTP; 2′-azido-deoxyuridine TP; 2′-O-methylpseudouridine; 2′ deoxyuridine; 2′ fluorouridine; 2′-deoxy-2′-a-aminouridine TP; 2′-deoxy-2′-a-azidouridine TP; 2- methylpseudouridine; 3 (3 amino-3 carboxypropyl)uracil; 4 (thio)pseudouracil; 4- (thio)pseudouracil; 4-(thio)uracil; 4-thiouracil; 5-aminouracil; 5 (1,3-diazole-1-alkyl)uracil; 5 (2- aminopropyl)uracil; 5 (aminoalkyl)uracil; 5 (dimethylaminoalkyl)uracil; 5 (guanidiniumalkyl)uracil; 5 (methoxycarbonylmethyl)-2-(thio)uracil; 5 (methoxycarbonyl-methyl)uracil; 5 (methyl) 2 (thio)uracil; 5 (methyl) 2,4 (dithio)uracil; 5 (methyl) 4 (thio)uracil; 5 (methylaminomethyl)-2 (thio)uracil; 5 (methylaminomethyl)-2,4 (dithio)uracil; 5 (methylaminomethyl)-4 (thio)uracil; 5 (propynyl)uracil; 5 (trifluoromethyl)uracil; 5-(2-aminopropyl)uracil; 5-(alkyl)-2-(thio)pseudouracil; 5-(alkyl)-2,4 (dithio)pseudouracil; 5-(alkyl)-4 (thio)pseudouracil; 5-(alkyl)pseudouracil; 5- (alkyl)uracil; 5-(alkenyl)uracil; 5-(alkynyl)uracil; 5-(allylamino)uracil; 5-(cyanoalkyl)uracil; 5- (dialkylaminoalkyl)uracil; 5-(dimethylaminoalkyl)uracil; 5-(guanidiniumalkyl)uracil; 5-(halo)uracil; 5-(1,3-diazole-1-alkyl)uracil; 5-(methoxy)uracil; 5-(methoxycarbonylmethyl)-2-(thio)uracil; 5- (methoxycarbonyl-methyl)uracil; 5-(methyl) 2(thio)uracil; 5-(methyl) 2,4 (dithio)uracil; 5-(methyl) 4 (thio)uracil; 5-(methyl)-2-(thio)pseudouracil; 5-(methyl)-2,4 (dithio)pseudouracil; 5-(methyl)-4 (thio)pseudouracil; 5-(methyl)pseudouracil; 5-(methylaminomethyl)-2 (thio)uracil; 5- (methylaminomethyl)-2,4(dithio)uracil; 5-(methylaminomethyl)-4-(thio)uracil; 5-(propynyl)uracil; 5-(trifluoromethyl)uracil; 5-aminoallyl-uridine; 5-bromo-uridine; 5-iodo-uridine; 5-uracil; 6 (azo)uracil; 6-(azo)uracil; 6-aza-uridine; allyamino-uracil; aza uracil; deaza uracil; 5-methyluracil; 5-(hydroxymethyl)uracil; 5-chlorouracil; 5-fluorouracil; 5-bromouracil; N3 (methyl)uracil; pseudo- UTP-1-2-ethanoic acid; Pseudouracil; 4-Thio-pseudo-UTP; 1-carboxymethyl-pseudouridine; 1- methyl-1-deaza-pseudouridine; 1-propynyl-uridine; 1-taurinomethyl-1-methyl-uridine; 1- taurinomethyl-4-thio-uridine; 1-taurinomethyl-pseudouridine; 2-methoxy-4-thio-pseudouridine; 2- thio-1-methyl-1-deaza-pseudouridine; 2-thio-1-methyl-pseudouridine; 2-thio-5-aza-uridine; 2- thio-dihydropseudouridine; 2-thio-dihydrouridine; 2-thio-pseudouridine; 4-methoxy-2-thio- pseudouridine; 4-methoxy-pseudouridine; 4-thio-1-methyl-pseudouridine; 4-thio-pseudouridine; 5-aza-uridine; Dihydropseudouridine; (±)1-(2-Hydroxypropyl)pseudouridine TP; (2R)-1-(2- Hydroxypropyl)pseudouridine TP; (2S)-1-(2-Hydroxypropyl)pseudouridine TP; (E)-5-(2-Bromo- vinyl)ara-uridine TP; (E)-5-(2-Bromo-vinyl)uridine TP; (Z)-5-(2-Bromo-vinyl)ara-uridine TP; (Z)-5- (2-Bromo-vinyl)uridine TP; 1-(2,2,2-trifluoroethyl)-pseudo-UTP; 1-(2,2,3,3,3- pentafluoropropyl)pseudouridine TP; 1-(2,2-diethoxyethyl)pseudouridine TP; 1-(2,4,6- trimethylbenzyl)pseudouridine TP; 1-(2,4,6-Trimethyl-benzyl)pseudo-UTP; 1-(2,4,6-trimethyl- phenyl )pseudo-UTP; 1-(2-amino-2-carboxyethyl)pseudo-UTP; 1-(2-amino-ethyl)pseudo-UTP; 1- (2-Hydroxyethyl)pseudouridine TP; 1-(2-methoxyethyl)pseudouridine TP; 1-(3,4-Bis- trifluoromethoxybenzyl)pseudouridine TP; 1-(3,4-dimethoxybenzyl)pseudouridine TP; 1-(3- Amino-3-carboxypropyl)pseudo-UTP; 1-(3-Amino-propyl)pseudo-UTP; 1-(3-Cyclopropyl-prop-2- ynyl)pseudouridine TP; 1-(4-Amino-4-carboxybutyl)pseudo-UTP; 1-(4-Amino-benzyl)pseudo- UTP; 1-(4-Amino-butyl)pseudo-UTP; 11(4-Amino-phenyl)pseudo-UTP; 1-(4- azidobenzyl)pseudouridine TP; 1-(4-Bromobenzyl)pseudouridine TP; 1-(4- Chlorobenzyl)pseudouridine TP; 1-(4-Fluorobenzyl)pseudouridine TP; 1-(4- iodobenzyl)pseudouridine TP; 1-(4-methanesulfonylbenzyl)pseudouridine TP; 1-(4- methoxybenzyl)pseudouridine TP; 1-(4-methoxy-benzyl)pseudo-UTP; 1 -(4-methoxy- phenyl)pseudo-UTP; 1 -(4-methylbenzyl)pseudouridine TP; 1-(4-methyl-benzyl)pseudo-UTP; 1- (4-nitrobenzyl)pseudouridine TP; 1-(4-Nitro-benzyl)pseudo-UTP; 1(4-Nitro-phenyl)pseudo-UTP; 1-(4-thiomethoxybenzyl)pseudouridine TP; 1-(4-Trifluoromethoxybenzyl)pseudouridine TP; 1-(4- trifluoromethylbenzyl)pseudouridine TP; 1-(5-Amino-pentyl)pseudo-UTP; 1-(6-Amino- hexyl)pseudo-UTP; 1,6-dimethyl-pseudo-UTP; 1-[3-(2-{2-[2-(2-aminoethoxy)-ethoxy]-ethoxy}- ethoxy)-propionyl]pseudouridine TP; 1-{3-[2-(2-aminoethoxy)-ethoxy]-propionyl} pseudouridine TP; 1-acetylpseudouridine TP; 1-Alkyl-6-(1-propynyl)-pseudo-UTP; 1-Alkyl-6-(2-propynyl)- pseudo-UTP; 1-Alkyl-6-allyl-pseudo-UTP; 1-Alkyl-6-ethynyl-pseudo-UTP; 1-Alkyl-6-homoallyl- pseudo-UTP; 1-Alkyl-6-vinyl-pseudo-UTP; 1-allylpseudouridine TP; 1-Aminomethyl-pseudo- UTP; 1-benzoylpseudouridine TP; 1-benzyloxymethylpseudouridine TP; 1-benzyl-pseudo-UTP; 1-biotinyl-PEG2-pseudouridine TP; 1-biotinylpseudouridine TP; 1-butyl-pseudo-UTP; 1- cyanomethylpseudouridine TP; 1-cyclobutylmethyl-pseudo-UTP; 1-cyclobutyl-pseudo-UTP; 1- cycloheptylmethyl-pseudo-UTP; 1-cycloheptyl-pseudo-UTP; 1-cyclohexylmethyl-pseudo-UTP; 1- cyclohexyl-pseudo-UTP; 1-cyclooctylmethyl-pseudo-UTP; 1-cyclooctyl-pseudo-UTP; 1- cyclopentylmethyl-pseudo-UTP; 1-cyclopentyl-pseudo-UTP; 1-cyclopropylmethyl-pseudo-UTP; 1-cyclopropyl-pseudo-UTP; 1-Ethyl-pseudo-UTP; 1-Hexyl-pseudo-UTP; 1- homoallylpseudouridine TP; 1-hydroxymethylpseudouridine TP; 1-iso-propyl-pseudo-UTP; 1-me- 2-thio-pseudo-UTP; 1-me-4-thio-pseudo-UTP; 1-me-alpha-thio-pseudo-UTP; 1- methanesulfonylmethylpseudouridine TP; 1-methoxymethylpseudouridine TP; 1-methyl-6-(2,2,2- Trifluoroethyl)pseudo-UTP; 1-methyl-6-(4-morpholino)-pseudo-UTP; 1-methyl-6-(4- thiomorpholino)-pseudo-UTP; 1-methyl-6-(substituted phenyl)pseudo-UTP; 1-methyl-6-amino- pseudo-UTP; 1-methyl-6-azido-pseudo-UTP; 1-methyl-6-bromo-pseudo-UTP; 1-methyl-6-butyl- pseudo-UTP; 1-methyl-6-chloro-pseudo-UTP; 1-methyl-6-cyano-pseudo-UTP; 1-methyl-6- dimethylamino-pseudo-UTP; 1-methyl-6-ethoxy-pseudo-UTP; 1-methyl-6-ethylcarboxylate- pseudo-UTP; 1-methyl-6-ethyl-pseudo-UTP; 1-methyl-6-fluoro-pseudo-UTP; 1-methyl-6-formyl- pseudo-UTP; 1-methyl-6-hydroxyamino-pseudo-UTP; 1-methyl-6-hydroxy-pseudo-UTP; 1- methyl-6-iodo-pseudo-UTP; 1-methyl-6-iso-propyl-pseudo-UTP; 1-methyl-6-methoxy-pseudo- UTP; 1-methyl-6-methylamino-pseudo-UTP; 1-methyl-6-phenyl-pseudo-UTP; 1-methyl-6-propyl- pseudo-UTP; 1-methyl-6-tert-butyl-pseudo-UTP; 1-methyl-6-trifluoromethoxy-pseudo-UTP; 1- methyl-6-trifluoromethyl-pseudo-UTP; 1-morpholinomethylpseudouridine TP; 1-Pentyl-pseudo- UTP; 1-Phenyl-pseudo-UTP; 1-pivaloylpseudouridine TP; 1-propargylpseudouridine TP; 1- propyl-pseudo-UTP; 1-propynyl-pseudouridine; 1-p-tolyl-pseudo-UTP; 1-tert-butyl-pseudo-UTP; 1-thiomethoxymethylpseudouridine TP; 1-thiomorpholinomethylpseudouridine TP; 1- trifluoroacetylpseudouridine TP; 1-trifluoromethyl-pseudo-UTP; 1-vinylpseudouridine TP; 2,2′- anhydro-uridine TP; 2′-bromo-deoxyuridine TP; 2′-F-5 -methyl-2′-deoxy-UTP; 2′-OMe-5-me-UTP; 2′-OMe-pseudo-UTP; 2′-a-ethynyluridine TP; 2′-a-trifluoromethyluridine TP; 2′-b-ethynyluridine TP; 2′-b-trifluoromethyluridine TP; 2′-deoxy-2′,2′-difluorouridine TP; 2′-deoxy-2′-a- mercaptouridine TP; 2′-deoxy-2′-a-thiomethoxyuridine TP; 2′-deoxy-2′-b-aminouridine TP; 2′- deoxy-2′-b-azidouridine TP; 2′-deoxy-2′-b-bromouridine TP; 2′-deoxy-2′-b-chlorouridine TP; 2′- deoxy-2′-b-fluorouridine TP; 2′-deoxy-2′-b-iodouridine TP; 2′-deoxy-2′-b-mercaptouridine TP; 2′- deoxy-2′-b-thiomethoxyuridine TP; 2-methoxy-4-thio-uridine; 2-methoxyuridine; 2′-O-methyl-5-(1- propynyl)uridine TP; 3-Alkyl-pseudo-UTP; 4′-Azidouridine TP; 4′-Carbocyclic uridine TP; 4′- Ethynyluridine TP; 5-(1-propynyl)ara-uridine TP; 5-(2-furanyl)uridine TP; 5-cyanouridine TP; 5- dimethylaminouridine TP; 5′-homo-uridine TP; 5-iodo-2′-fluoro-deoxyuridine TP; 5- phenylethynyluridine TP; 5-trideuteromethyl-6-deuterouridine TP; 5-Trifluoromethyl-Uridine TP; 5-vinylarauridine TP; 6-(2,2,2-Trifluoroethyl)-pseudo-UTP; 6-(4-morpholino)-pseudo-UTP; 6-(4- Thiomorpholino)-pseudo-UTP; 6-(Substituted-Phenyl)-pseudo-UTP; 6-Amino-pseudo-UTP; 6- Azido-pseudo-UTP; 6-Bromo-pseudo-UTP; 6-Butyl-pseudo-UTP; 6-Chloro-pseudo-UTP; 6- Cyano-pseudo-UTP; 6-Dimethylamino-pseudo-UTP; 6-Ethoxy-pseudo-UTP; 6-Ethylcarboxylate- pseudo-UTP; 6-Ethyl-pseudo-UTP; 6-Fluoro-pseudo-UTP; 6-Formyl-pseudo-UTP; 6- Hydroxyamino-pseudo-UTP; 6-Hydroxy-pseudo-UTP; 6-Iodo-pseudo-UTP; 6-iso-Propyl-pseudo- UTP; 6-methoxy-pseudo-UTP; 6-methylamino-pseudo-UTP; 6-methyl-pseudo-UTP; 6-Phenyl- pseudo-UTP; 6-Phenyl-pseudo-UTP; 6-Propyl-pseudo-UTP; 6-tert-Butyl-pseudo-UTP; 6- Trifluoromethoxy-pseudo-UTP; 6-Trifluoromethyl-pseudo-UTP; Alpha-thio-pseudo-UTP; Pseudouridine 1-(4-methylbenzenesulfonic acid) TP; Pseudouridine 1-(4-methylbenzoic acid) TP; Pseudouridine TP 1-[3-(2-ethoxy)]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-(2-ethoxy)- ethoxy]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-{2(2-ethoxy)-ethoxy}- ethoxy]-ethoxy)-ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-[2-ethoxy ]-ethoxy)- ethoxy}]propionic acid; Pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}] propionic acid; Pseudouridine TP 1-methylphosphonic acid; Pseudouridine TP 1-methylphosphonic acid diethyl ester; Pseudo-UTP-N1-3-propionic acid; Pseudo-UTP-N1-4-butanoic acid; Pseudo-UTP-N1-5- pentanoic acid; Pseudo-UTP-N1-6-hexanoic acid; Pseudo-UTP-N1-7-heptanoic acid; Pseudo- UTP-N1-methyl-p-benzoic acid; Pseudo-UTP-N1-p-benzoic acid; yW (Wybutosine); OHyW (Hydroxywybutosine); imG2 (isowyosine); o2yW (Peroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG-14 (4-demethylwyosine); 2,6-(diamino)purine; 1-(aza)-2-(thio)-3-(aza)- phenoxazin-1-yl: 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 1,3,5-(triaza)-2,6-(dioxa)-naphthalene; 2 (amino)purine; 2,4,5-(trimethyl)phenyl; 2′ methyl, 2′amino, 2′azido, 2′fluoro-cytidine; 2′ methyl, 2′amino, 2′azido, 2′fluoro-adenine; 2′methyl, 2′amino, 2′azido, 2′fluoro-uridine; 2′-amino-2′-deoxyribose; 2-amino-6-Chloro-purine; 2-aza- inosinyl; 2′-azido-2′-deoxyribose; 2′fluoro-2′-deoxyribose; 2′-fluoro-modified bases; 2′-O-methyl- ribose; 2-oxo-7-aminopyridopyrimidin-3-yl; 2-oxo-pyridopyrimidine-3-yl; 2-pyridinone; 3 nitropyrrole; 3-(methyl)-7-(propynyl)isocarbostyrilyl; 3-(methyl)isocarbostyrilyl; 4-(fluoro)-6- (methyl)benzimidazole; 4-(methyl)benzimidazole; 4-(m ethyl )indolyl; 4,6-(dimethyl)indolyl; 5 nitroindole; 5 substituted pyrimidines; 5-(methyl)isocarbostyrilyl; 5-nitroindole; 6-(aza)pyrimidine; 6-(azo)thymine; 6-(methyl)-7-(aza)indolyl; 6-chloro-purine; 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1-(aza)- 2-(thio)-3-(aza)-phenoxazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7- (aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(aminoalkylhydroxy)-1,3-(diaza)-2- (oxo)-phenoxazin-1-yl; 7-(aza)indolyl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)- phenoxazinl-yl; 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl; 7- (guanidiniumalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7- (guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 7-(guanidiniumalkyl-hydroxy)- 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl; 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)- phenoxazin-1-yl; 7-(propynyl)isocarbostyrilyl; 7-(propynyl)isocarbostyrilyl; propynyl-7- (aza)indolyl; 7-deaza-inosinyl; 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl; 7- substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl; 9-(methyl)-imidizopyridinyl; aminoindolyl; Anthracenyl; bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; bis-ortho- substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; difluorotolyl; Hypoxanthine; Imidizopyridinyl; Inosinyl; Isocarbostyrilyl; isoguanisine; N2-substituted purines; N6-methyl-2-amino-purine; N6- substituted purines; N-alkylated derivative; napthalenyl; nitrobenzimidazolyl; nitroimidazolyl; nitroindazolyl; nitropyrazolyl; nubularine; O6-substituted purines; O-alkylated derivative; ortho- (aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; ortho-substituted-6-phenyl-pyrrolo- pyrimidin-2-on-3-yl; oxoformycin TP; para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-on- 3-yl; para-substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl; pentacenyl; phenanthracenyl; phenyl; propynyl-7-(aza)indolyl; pyrenyl; pyridopyrimidin-3-yl; pyridopyrimidin-3-yl; 2-oxo-7-amino- pyridopyrimidin-3-yl; pyrrolo-pyrimidin-2-on-3-yl; pyrrolopyrimidinyl; pyrrolopyrizinyl; stilbenzyl; substituted 1,2,4-triazoles; tetracenyl; tubercidine; xanthine; xanthosine-5′-TP; 2-thio-zebularine; 5-aza-2-thio-zebularine; 7-deaza-2-amino-purine; pyridin-4-one ribonucleoside; 2-amino- riboside-TP; formycin A TP; formycin B TP; pyrrolosine TP; 2′-OH-ara-adenosine TP; 2′-OH-ara- cytidine TP; 2′-OH-ara-uridine TP; 2′-OH-ara-guanosine TP; 5-(2-carbomethoxyvinyl)uridine TP; N6-(19-Amino-pentaoxanonadecyl)adenosine TP; hydrogen (abasic residue); and 2′-O-methyl- U. In some aspects, RNA molecules include a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleobases. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modifications can be excluded from the RNA molecules disclosed herein. In some aspects, modified nucleobases in RNA molecules comprise pseudouridine (ψ), 2-thiouridine (s2U), 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2- thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 2′-O-methyl uridine, 1-methyl- pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), a-thio-guanosine, a-thio-adenosine, 5-cyanouridine, 4′-thio uridine 7-deaza-adenine, 1- methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2,6- Diaminopurine, inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7- deaza-guanosine, 7-cyano-7-deaza-guanosine (preQO), 7-aminomethyl-7-deaza-guanosine (preQl), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8- oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3- amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3- methylpseudouridine, 5-(carboxyhydroxymethyl)-2′-O-methyluridine methyl ester, 5- aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5- carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2- thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2- selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethyl-2- geranylthiouridine, 7-aminocarboxypropyl-demethylwyosine, 7-aminocarboxypropylwyosine, 7- aminocarboxypropylwyosine methyl ester, 8-methyladenosine, N4,N4-dimethylcytidine, N6- formyl adenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6- threonylcarbamoyladenosine, glutamyl-queuosine, methylated undermodified hydroxywybutosine, N4,N4,2′-O-trimethylcytidine, geranylated 5-methylaminomethyl-2- thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Qbase, preQObase, preQlbase, and combinations of two or more thereof. In some aspects, the RNA molecule includes a combination of at least two (e.g., 2, 3, 4, or more) of the aforementioned modified nucleobases, including but not limited to chemical modifications. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified nucleobases can be excluded from the RNA molecules disclosed herein. Exemplary nucleobases and nucleosides having a modified cytosine include 5-aza- cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2-thio-5-methyl-cytidine, 4-thio- pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza- pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl- zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl- cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), a- thio-cytidine, 2′-O-methyl-cytidine (Cm), 5,2′-O-dimethyl-cytidine (m5Cm), N4-acetyl-2′-O-methyl- cytidine (ac4Cm), N4,2′-O-dimethyl-cytidine (m4Cm), 5-formyl-2′-O-methyl-cytidine (f5Cm), N4,N4,2′-O-trimethyl-cytidine (m42Cm), 1-thio-cytidine, 2′-F-ara-cytidine, 2′-F-cytidine, and 2′- OH-ara-cytidine. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified cytosines can be excluded from the RNA molecules disclosed herein. In some aspects, a modified nucleobase is a modified uridine. Exemplary nucleobases and nucleosides having a modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4- thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo- uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 5-cyanouridine, 3-methyl-uridine (m3U), 5- methoxy-uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl -uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnmVU), 5-propynyl-uridine, 1- propynyl-pseudouridine, 5-taurinomethyl-uridine (xm5U), 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine (xmVu), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, e.g., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m1Ψ), 1-ethyl- pseudouridine (e1ψ), 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-pseudouridine (m1s4Ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3Ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3- carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3 ψ), 5- (isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2′-O-methyl-uridine (Um), 5,2′-O-dimethyl-uridine (m5Um), 2′-O-methyl- pseudouridine (Ψm), 2-thio-2′-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2′-O-methyl- uridine (mcm5Um), 5-carbamoylmethyl-2′-O-methyl-uridine (ncm5Um), 5- carboxymethylaminomethyl-2′-O-methyl -uridine (cmnm5Um), 3,2′-O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2′-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2′-F-ara-uridine, 2′-F-uridine, 2′-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(l-E- propenylamino)]uridine. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified uridines can be excluded from the RNA molecules disclosed herein. In some aspects of the present disclosure, modified nucleotides include any one of N1- methylpseudouridine and / or pseudouridine. In some aspects, the RNA molecule comprises nucleotides that are N1- methylpseudouridine modified. In some aspects, the RNA molecule comprises nucleotides that are pseudouridine modified. In some aspects, an RNA comprises a modified nucleoside in place of at least one uridine. In some aspects, an RNA comprises a modified nucleoside in place of each uridine. In some aspects, the RNA molecule comprises a sequence having at least one uridine replaced by N1- methylpseudouridine. In some aspects, the RNA molecule comprises a sequence having all uridines replaced by N1-methylpseudouridine. N1-methylpseudouridine is designated in sequences as “Ψ”. The term “uracil,” as used herein, describes one of the nucleobases that may occur in the nucleic acid of RNA. The term “uridine,” as used herein, describes one of the nucleosides that may occur in RNA. “Pseudouridine” is one example of a modified nucleoside that is an isomer of uridine, where the uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond. In some aspects, the RNA molecule comprises a nucleic acid sequence having at least one uridine replaced by N1-methylpseudouridine and / or pseudouridine. In some aspects, the RNA molecule comprises a nucleic acid sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of uridines replaced by N1-methylpseudouridine and / or pseudouridine. In some aspects, the RNA molecule comprises a nucleic acid sequence having all uridines replaced by N1- methylpseudouridine and / or pseudouridine. In some aspects, a modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having a modified adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino- 6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6- methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino- purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6- diaminopurine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl -adenosine (m6A), 2-methylthio-N6-methyl-adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2- methylthio-N6-isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl- adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6-methyl-N6-threonylcarbamoyl- adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6,N6-dimethyl- adenosine (m62A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl- adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2′-O-methyl-adenosine (Am), N6,2′-O-dimethyl -adenosine (m6Am), N6,N6,2′-O-trimethyl-adenosine (m62Am), 1,2′-O- dimethyl-adenosine (m1Am), 2′-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl- purine, 1-thio-adenosine, 8-azido-adenosine, 2′-F-ara-adenosine, 2′-F-adenosine, 2′-OH-ara- adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified adenines can be excluded from the RNA molecules disclosed herein. In some aspects, a modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQo), 7-aminomethyl-7- deaza-guanosine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6- thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m1G), N2- methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m2′7G), N2, N2,7-dimethyl-guanosine (m2′2′7G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a- thio-guanosine, 2′-O-methyl-guanosine (Gm), N2-methyl-2′-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2′-O-methyl-guanosine (m22Gm), 1-methyl-2′-O-methyl-guanosine, N2,7- dimethyl-2′-O-methyl-guanosine (m2′7Gm), 2′-O-methyl-inosine (Im), 1,2′-O-dimethyl-inosine (m1Im), 2′-O-ribosylguanosine (phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2′- F-ara-guanosine, and 2′-F-guanosine. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing modified guanines can be excluded from the RNA molecules disclosed herein. In some aspects, RNA molecules are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. In some aspects, the RNA molecules may be partially or fully (e.g., uniformly) modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine and / or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a polynucleotide of the disclosure, or in a given predetermined sequence region thereof. In some aspects, all nucleotides X in a polynucleotide of the present disclosure (or in a given sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, and / or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C and / or A+G+C. For example, a polynucleotide can be uniformly modified with pseudouridine, meaning that all uridine residues in the RNA sequence are replaced with pseudouridine. Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. The modified nucleotide can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4, or more unique structures). The RNA molecules may contain from or from about 1% to 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, e.g., any one or more of A, G, U and / or C) (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90%) to 100%), and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, and / or C. In some aspects, the RNA molecule may include phosphoramidate, phosphorothioate, and / or methylphosphonate linkages. In some aspects, the RNA molecules may include one or more structural and / or chemical modifications and / or alterations which impart useful properties to the polynucleotide including, in some aspects, reduced degradation in the cell or organism and / or lack of a substantial induction of the innate immune response of a cell into which the RNA molecule is introduced. As used herein, a “structural” feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted and / or randomized in an RNA molecule without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to affect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide “ATCG” may be chemically modified to “AT-5meC-G”. The same polynucleotide may be structurally modified from “ATCG” to “ATCCCG”. Here, the dinucleotide “CC” has been inserted, resulting in a structural modification to the polynucleotide. In some aspects, a modified RNA molecule, introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides. In some aspects, a modified RNA molecule, introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides. In some aspects, the RNA molecule may include one or more modified nucleotides in addition to any 5′ cap structure. In some aspects, the RNA molecule does not include modified nucleotides, e.g., does not include modified nucleobases, and all of the nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G and C, with the exception of an optional 5′ cap that may include, for example, 7-methylguanosine, which is further described below. In some aspects, the RNA may include a 5′ cap comprising a 7’-methylguanosine, and the first 1, 2, or 35′ ribonucleotides may be methylated at the 2’ position of the ribose. B. 5′ CAP In some aspects, the RNA molecule described herein includes a 5′ cap which generally “caps” the 5′ end of the RNA and stabilizes the RNA molecule. In some aspects, the 5′ cap moiety is a natural 5′ cap. A “natural 5′ cap” is defined as a cap that includes 7-methylguanosine connected to the 5′ end of an mRNA molecule through a 5′ to 5′ triphosphate linkage. In some aspects, a guanosine nucleoside included in a 5′ cap may be modified, for example, by methylation at one or more positions (e.g., at the 7-position) on a base (guanine), and / or by methylation at one or more positions of a ribose. In some aspects, a guanosine nucleoside included in a 5′ cap comprises a 3′O methylation at a ribose (3′OMeG). In some aspects, a guanosine nucleoside included in a 5′ cap comprises methylation at the 7- position of guanine (m7G). In some aspects, a guanosine nucleoside included in a 5′ cap comprises methylation at the 7-position of guanine and a 3′O methylation at a ribose (m7(3′OMeG)). The 5′ cap may be incorporated during RNA synthesis (e.g., co-transcriptional capping) or may be enzymatically engineered after RNA transcription (e.g., post-transcriptional capping). In some aspects, co-transcriptional capping with a cap disclosed herein improves the capping efficiency of an RNA compared to co-transcriptional capping with an appropriate reference comparator. In some aspects, improving capping efficiency may increase a translation efficiency and / or translation rate of an RNA, and / or increase expression of an encoded polypeptide. In some aspects, capping is performed after purification, e.g., tangential flow filtration, of the RNA molecule. In some aspects, an RNA described herein comprises a 5′ cap or a 5′ cap analog, e.g., a Cap 0, a Cap 1 or a Cap 2. In some aspects, a provided RNA does not have uncapped 5′- triphosphates. In some aspects, the 5′ end of the RNA is capped with a modified ribonucleotide. In some aspects, the 5′ cap moiety is a 5′ cap analog. In some aspects, an RNA may be capped with a 5′ cap analog. Cap structures include, but are not limited to,7mG(5′)ppp(5′)N1pN2p (Cap 0),7mG(5′)ppp(5′)N1mpNp (Cap 1), and7mG(5′)ppp(5′)N1mpN2mp (Cap 2). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing cap structures can be excluded from the RNA molecules disclosed herein. In some aspects, an RNA described herein comprises a Cap 0. In some aspects, Cap 0 is a N7-methyl guanosine, and a Cap 0 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G). In some aspects, a Cap 0 structure is connected to an RNA via a 5′ to 5′-triphosphate linkage and is also referred to herein as m7G, m7Gppp, and / or m7G(5′)ppp(5′).·A 5′ cap may be methylated with the structure7mG(5′)ppp(5′)N1pN2p (Cap 0) or a derivative thereof, wherein N is the terminal 5′ nucleotide of the nucleic acid carrying the 5′ cap, typically the 5′-end of an mRNA. An exemplary enzymatic reaction for capping may include use of Vaccinia Virus Capping Enzyme (VCE) that includes mRNA triphosphatase, guanylyl- transferase and guanine-7-methytransferase, which catalyzes the construction of N7- monomethylated Cap 0 structures. Cap 0 structures play an important role in maintaining the stability and translational efficacy of the RNA molecule. In the cell, the Cap 0 structure is essential for efficient translation of the mRNA that carries the cap. In some aspects, an RNA described herein comprises a Cap 1, e.g., as described herein. The 5′ cap of the RNA molecule may be further modified on the 2′O position by a 2′-O- methyltransferase, which results in the generation of a Cap 1 structure (m7Gppp [m2′-Ο] N), which may further increase translation efficacy. In some aspects, a Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and a 2′O methylated first nucleotide in an RNA (2′OMeN1). In some aspects, a Cap 1 structure is connected to an RNA via a 5′- to 5′-triphosphate linkage and is also referred to herein as m7GpppNm, wherein Nmdenotes any nucleotide with a 2′O methylation,7mG(5′)ppp(5′)N1mpNp, m7Gppp(2′OMeN1), and / or m7G(5′)ppp(5′)(2′OMeN1). In some aspects, N1is chosen from A, C, G, or U. In some aspects, N1is A. In some aspects, N1is C. In some aspects, N1is G. In some aspects, N1is U. In some aspects, a m7G(5′)ppp(5′)(2′OMeN1) Cap 1 structure comprises a second nucleotide, N2, which is a cap proximal nucleotide at position 2 and is chosen from A, G, C, or U (m7G(5′)ppp(5′)(2′OMeN1)N2). In some aspects, N2 is A. In some aspects, N2 is C. In some aspects, N2 is G. In some aspects, N2 is U. In some aspects, a Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and one or more additional modifications, e.g., methylation on a ribose, and a 2′O methylated first nucleotide in an RNA. In some aspects, a Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine, a 3′O methylation at a ribose (m7(3′OMeG)), and a 2′O methylated first nucleotide in an RNA (2′OMeN1). In some aspects, a Cap 1 structure is connected to an RNA via a 5′- to 5′-triphosphate linkage and is also referred to herein as m7(3′OMeG)ppp(2′OMeN1) and / or m7(3′OMeG)(5′)ppp(5′)(2′OMeN1). In some aspects, N1is chosen from A, C, G, or U. In some aspects, N1is A. In some aspects, N1is C. In some aspects, N1is G. In some aspects, N1is U. In some aspects, a m7(3′OMeG)(5′)ppp(5′)(2′OMeN1) Cap 1 structure comprises a second nucleotide, N2, which is a cap proximal nucleotide at position 2 and is chosen from A, G, C, or U (m7(3′OMeG)(5′)ppp(5′)(2′OmeN1)N2). In some aspects, N2 is A. In some aspects, N2 is C. In some aspects, N2 is G. In some aspects, N2 is U. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing Cap 1 structures can be excluded from the RNA molecules disclosed herein. In some aspects, a second nucleotide in a Cap 1 structure may comprise one or more modifications, e.g., methylation. In some aspects, an RNA described herein comprises a Cap 2. In some aspects, a Cap 1 structure comprising a second nucleotide comprising a 2′O methylation is a Cap 2 structure. In some aspects, the RNA molecule may be enzymatically capped at the 5′ end using Vaccinia guanylyltransferase, guanosine triphosphate, and S-adenosyl-L-methionine to yield Cap 0 structure. An inverted 7-methylguanosine cap is added via a 5′ to 5′ triphosphate bridge. Alternatively, use of a 2′O-methyltransferase with Vaccinia guanylyltransferase yields the Cap 1 structure where, in addition to the Cap 0 structure, the 2′OH group is methylated on the penultimate nucleotide. S-adenosyl-L-methionine (SAM) is a cofactor utilized as a methyl transfer reagent. Non-limiting examples of 5′ cap structures are those which, among other things, have enhanced binding of cap-binding polypeptides, increased half-life, reduced susceptibility to 5′ endonucleases and / or reduced 5′ decapping, as compared to synthetic 5′ cap structures known in the art (or to a wild type, natural or physiological 5′ cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2′ O- methyltransferase enzyme may create a canonical 5′-5′-triphosphate linkage between the 5′- terminal nucleotide of an mRNA and a guanine cap nucleotide wherein the cap guanine includes an N7 methylation and the 5′-terminal nucleotide of the mRNA includes a 2′-O-methyl. Such a structure is termed the Cap 1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5′ cap analog structures known in the art. A cap species may include one or more modified nucleosides and / or linker moieties. For example, a cap may include a guanine nucleotide and a guanine (G) nucleotide methylated at the 7 position joined by a triphosphate linkage at their 5′ positions, e.g., m7G(5′)ppp(5′)G, commonly written as m7GpppG. A cap species may also be an anti-reverse cap analog. A non- limiting list of possible cap species includes m7GpppG, m7Gpppm7G, m73′dGpppG, m27,O3′GpppG, m27,O3′GppppG, m27,O2′GppppG, m7Gpppm7G, m73′dGpppG, m27,O3′GpppG, m27,O3′GppppG, and m27,O2′GppppG. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing cap species can be excluded from the RNA molecules disclosed herein. In some aspects, the 5′ terminal cap includes a cap analog, for example, a 5′ terminal cap may include a guanine analog. Exemplary guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, and 2-azido-guanosine. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing guanine analogs can be excluded from the cap structures disclosed herein. In some aspects, the capping region may include a single cap or a series of nucleotides forming the cap. In this aspect the capping region may be from 1 to 10, e.g., 2-9, 3-8, 4-7, 1-5, 5- 10, or at least 2, or 10 or fewer nucleotides in length. In this aspect, the capping region is at least, at most, exactly, or between (inclusive or exclusive) any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some aspects, the cap is absent. In some aspects, the first and second operational regions may range from 3 to 40, e.g., 5-30, 10-20, 15, or at least 4, or 30 or fewer nucleotides in length and may comprise, in addition to a Start and / or Stop codon, one or more signal and / or restriction sequences. In some aspects, the first and second operational regions are at least, at most, exactly, or between (inclusive or exclusive) any two of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length and may comprise, in addition to a Start and / or Stop codon, one or more signal and / or restriction sequences. Further examples of 5′ cap structures include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety), 4′, 5′ methylene nucleotide, 1-(beta-D-erythrofuranosyl) nucleotide, 4′-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L- nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3′,4′-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3′-3′-inverted nucleotide moiety, 3′-3′-inverted abasic moiety, 3′-2′-inverted nucleotide moiety, 3′-2′-inverted abasic moiety, 1,4-butanediol phosphate, 3′-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3′-phosphate, 3′-phosphorothioate, phosphorodithioate, and / or bridging or non-bridging methylphosphonate moiety. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 5′ cap structures can be excluded from the RNA molecules disclosed herein. In some aspects, the RNA molecule of the present disclosure comprises at least one 5′ cap structure. In some aspects, the RNA molecule of the present disclosure does not comprise a 5′ cap structure. Numerous synthetic 5' cap analogs have been developed and are known in the art to enhance mRNA stability and translatability (see, e.g., Grudzien-Nogalska, E., Kowalska, J., Su, W., Kuhn, A.N., Slepenkov, S.V., Darynkiewicz, E., Sahin, U., Jemielity, J., and Rhoads, R.E., Synthetic mRNAs with superior translation and stability properties in Synthetic Messenger RNA and Cell Metabolism Modulation in Methods in Molecular Biology 69 (Rabinovich, P.H. Ed), 2013). In one aspect, the 5′ capping structure comprises a modified 5′ Cap 1 structure (m7G+m3′-5′-ppp- 5′-Am). In one aspect, the 5′ capping structure comprises is (3′OMe)-m27,3′-OGppp(m12’-O)ApG (TriLink BioTechnologies). This molecule is identical to the natural RNA cap structure in that it starts with a guanosine methylated at N7, and is linked by a 5′ to 5′ triphosphate linkage to the first coded nucleotide of the transcribed RNA (in this case, an adenosine). This guanosine is also methylated at the 3′ hydroxyl of the ribose to mitigate possible reverse incorporation of the cap molecule. The 2’ hydroxyl of the ribose on the adenosine is methylated, conferring a Cap 1 structure. C. UNTRANSLATED REGIONS (UTRs) The 5′ UTR is a regulatory region situated at the 5′ end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence and / or to the corresponding region in an RNA polynucleotide, such as an mRNA molecule. An untranslated region (UTR) may be present 5′ (upstream) of an open reading frame (5′ UTR) and / or 3′ (downstream) of an open reading frame (3′ UTR). In some aspects, the UTR is derived from an mRNA that is naturally abundant in a specific tissue (e.g., lymphoid tissue), to which the mRNA expression is targeted. In some aspects, the UTR increases protein synthesis. Without being bound by mechanism or theory, the UTR may increase protein synthesis by increasing the time that the mRNA remains in translating polysomes (message stability) and / or the rate at which ribosomes initiate translation on the message (message translation efficiency). Accordingly, the UTR sequence may prolong protein synthesis in a tissue-specific manner. In some aspects, the regulatory features of a UTR can be incorporated into the RNAs of the present disclosure to, among other things, enhance the stability of the molecule. The specific features can also be incorporated to ensure controlled down-regulation of the transcript in case they are misdirected to undesired organs sites. A variety of 5′ UTR and the 3′ UTR sequences are known and available in the art. It should be understood that any UTR from any gene may be incorporated into the regions of the RNAs of the present disclosure. Furthermore, multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation and / or location. Hence a 5′ and / or 3′ UTR may be inverted, shortened, lengthened, and / or made with one or more other 5′ UTRs or 3′ UTRs. As used herein, the term “altered” as it relates to a UTR sequence, means that the UTR has been changed in some way in relation to a reference sequence. For example, 5′ UTRs and / or 3′ UTRs may be altered relative to a wild-type or native UTR by the change in orientation and / or location as taught above and / or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping, and / or transposition of nucleotides. Any of these changes produces an “altered” UTR (whether 5′ and / or 3′) including a variant UTR. In some embodiments, a double, triple or quadruple UTR such as a 5′ and / or 3′ UTR may be used. As used herein, a “double” UTR is one in which two copies of the same UTR are encoded either in series or substantially in series. For example, a double beta-globin 3′ UTR may be used. It is also within the scope of the present disclosure to have patterned UTRs. As used herein “patterned UTRs” are those UTRs which reflect a repeating or alternating pattern, such as AB AB AB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than 3 times. In these patterns, each letter, A, B, or C represent a different UTR at the nucleotide level. RNAs may encode polypeptides of interest belonging to a family of proteins that are expressed in a particular cell, tissue and / or at some time during development. In some aspects, the UTRs from any of these genes may be swapped for any other UTR of the same or different family of proteins to create a new RNA molecule. As used herein, a “family of proteins” is used in the broadest sense to refer to a group of two or more polypeptides of interest which share at least one function, structure, feature, localization, origin, and / or expression pattern. In some aspects, the 5′ UTR and the 3′ UTR sequences are computationally derived. In some aspects, the 5′ UTR and the 3′ UTRs are derived from a naturally abundant mRNA in a tissue. The tissue may be, for example, liver, a stem cell and / or lymphoid tissue. The lymphoid tissue may include, for example, any one of a lymphocyte (e.g., a B-lymphocyte, a helper T- lymphocyte, a cytotoxic T-lymphocyte, a regulatory T-lymphocyte, and / or a natural killer cell), a macrophage, a monocyte, a dendritic cell, a neutrophil, an eosinophil and a reticulocyte. In some aspects, the 5′ UTR and the 3′ UTR are derived from an alphavirus. In some aspects, the 5′ UTR and the 3′ UTR are from a wild type alphavirus. In some aspects, untranslated regions may also include translation enhancer elements (TEE). As a non- limiting example, the TEE may include those described in US Application No. 20090226470, herein incorporated by reference in its entirety, and those known in the art. i. 5′ UTRS In some aspects, an RNA disclosed herein comprises a 5′ UTR. A 5′ UTR, if present, is located at the 5′ end and starts with the transcriptional start site upstream of the start codon of a protein encoding region. A 5′ UTR is downstream of the 5′ cap (if present), e.g. directly adjacent to the 5′ cap. The 5′ UTR may contain various regulatory elements, e.g., 5′ cap structure, stem- loop structure, and an internal ribosome entry site (IRES), which may play a role in the control of translation initiation. The 5′ UTR may harbor signatures like Kozak sequences, which are also involved in the process by which the ribosome initiates translation of many genes.5′ UTRs may also form secondary structures involved in elongation factor binding. In some aspects, a 5′ UTR disclosed herein comprises a cap proximal sequence, e.g., as disclosed herein. In some aspects, a cap proximal sequence comprises a sequence adjacent to a 5′ cap. In some aspects, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide. In some aspects, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some aspects, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (N1) of an RNA polynucleotide. In some aspects, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some aspects, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (N1and N2) of an RNA polynucleotide. Those skilled in the art, reading the present disclosure, will appreciate that, in some aspects, one or more residues of a cap proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in an RNA by virtue of having been included in a cap entity that (e.g., a Cap 1 structure, etc); alternatively, in some aspects, at least some of the residues in a cap proximal sequence may be enzymatically added (e.g., by a polymerase such as a T7 polymerase). For example, in certain exemplified aspects where a (m27,3′-O)Gppp(m2’-O)ApG cap is utilized, +1 and +2 residues are the (m27,3′-O) A and G residues of the cap, and +3, +4, and +5 residues are added by polymerase (e.g., T7 polymerase). In some aspects, a cap proximal sequence comprises N1 and / or N2 of a Cap structure, wherein N1 and N2 are any nucleotide, e.g., A, C, G or U. In some aspects, N1 is A. In some aspects, N1is C. In some aspects, N1is G. In some aspects, N1is U. In some aspects, N2is A. In some aspects, N2is C. In some aspects, N2is G. In some aspects, N2is U. In some aspects, a cap proximal sequence comprises N1 and N2 of a Cap structure and N3, N4 and N5, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide. In some aspects, N1, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some aspects, N1N2 comprises any one of the following: AA, AC, AG, AU, CA, CC, CG, CU, GA, GC, GG, GU, UA, UC, UG, or UU. In some aspects, N1N2 comprises AG and N3N4N5 comprises any one of the following: AAA, ACA, AGA, AUA, AAG, AGG, ACG, AUG, AAC, ACC, AGC, AUC, , AAU, ACU, AGU, AUU, CAA, CCA, CGA, CUA, CAG, CGG, CCG, CUG, CAC, CCC, CGC, CUC, , CAU, CCU, CGU, CUU, , GAA, GCA, GGA, GUA, , GAG, GGG, GCG, GUG, , GAC, GCC, GGC, GUC, , GAU, GCU, GGU, GUU, UAA, UCA, UGA, UUA, UAG, UGG, UCG, UUG, UAC, UCC, UGC, UUC, UAU, UCU, UGU, or UUU. In some aspects, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: A3A4X5 (SEQ ID NO: 46; wherein X5 is A, G, C, or U), where N1 and N2 are each independently chosen from: A, C, G, or U. In some aspects, N1 is A and N2 is G. In some aspects, X5is chosen from A, C, G or U. In some aspects, X5is A. In some aspects, X5is C. In some aspects, X5is G. In some aspects, X5is U. In some aspects, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: C3A4X5 (SEQ ID NO: 47; wherein X5 is A, G, C, or U), where N1 and N2 are each independently chosen from: A, C, G, or U. In some aspects, N1 is A and N2 is G. In some aspects, X5 is chosen from A, C, G or U. In some aspects, X5 is A. In some aspects, X5 is C. In some aspects, X5is G. In some aspects, X5is U. In some aspects, a cap proximal sequence comprises N1and N2of a Cap structure, and a sequence comprising X3Y4X5(SEQ ID NO: 48; wherein X3or X5are each independently chosen from A, G, C, or U; and Y4 is not C). In some aspects, N1 and N2 are each independently chosen from: A, C, G, or U. In some aspects, N1 is A and N2 is G. In some aspects, X3 and X5 is each independently chosen from A, C, G or U. In some aspects, X3 and / or X5 is A. In some aspects, X3and / or X5is C. In some aspects, X3and / or X5is G. In some aspects, X3and / or X5is U. In some aspects, Y4is C. In other aspects, Y4is not C. In some aspects, Y4is A. In some aspects, Y4is G. In other aspects, Y4 is not G. In some aspects, Y4 is U. In some aspects, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising A3C4A5 (SEQ ID NO: 49). In some aspects, N1 and N2 are each independently chosen from: A, C, G, or U. In some aspects, N1 is A and N2 is G. In some aspects, a cap proximal sequence comprises N1and N2of a Cap structure, and a sequence comprising A3U4G5(SEQ ID NO: 50). In some aspects, N1and N2are each independently chosen from: A, C, G, or U. In some aspects, N1is A and N2is G. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing cap proximal sequences can be excluded from the 5′ UTR of the RNA molecules disclosed herein. In some aspects of the disclosure, a 5′ UTR is a heterologous UTR, e.g., is a UTR found in nature associated with a different ORF. In another aspect, a 5′ UTR is a synthetic UTR, e.g., does not occur in nature. Synthetic UTRs include UTRs that have been mutated or synthesized to improve their properties, e.g., to increase gene expression. In some aspects, the 5′ UTR is functionally linked to the ORF, e.g., associated with the ORF such that it may exert a function, e.g., increasing, enhancing, stabilizing, and / or prolonging protein production from an RNA molecule and / or increasing protein expression and / or total protein production from an RNA molecule, compared to a reference RNA molecule comprising a reference 5′ UTR or an RNA molecule lacking a 5′ UTR. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 5′ UTR functions can be excluded. Exemplary 5′ UTRs include 5′ UTRs derived from Xenopus or human alpha globin or beta globin, human cytochrome b-245 a, hydroxysteroid (17b) dehydrogenase, Tobacco etch virus, the CMV immediate-early 1 (IE1) gene, TEV, HSP705′, c-Jun, or a homolog, fragment, or variant of any of the foregoing. In some aspects, the 5′ UTR is a fragment, homolog or variant of a 5′ UTR of a TOP gene lacking the 5′ TOP motif (the oligopyrimidine tract), the 5′ UTR derived from ribosomal protein Large 32 (L32) gene, the 5′ UTR derived from the 5′ UTR of an hydroxysteroid (17p) dehydrogenase 4 gene (HSD17B4), or the 5′ UTR derived from the 5′ UTR of ATP5A1. In some aspects, 5′ UTRs are derived from SEQ ID NOs: 1-1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 of the patent application WO2013 / 143700, the disclosure of which is incorporated herein by reference in its entirety, or a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the foregoing sequences. The sequence GGGAUCCUACC may also be used.In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 5′ UTR sequences may be excluded from the RNA molecules disclosed herein. In some aspects, the 5′ UTR comprises a sequence from the 5′ UTR region of a gene encoding RPSA, RPS2, RPS3, RPS3A, RPS4, RPS5, RPS6, RPS7, RPS8, RPS9, RPS10, RPS1 1 , RPS12, RPS13, RPS14, RPS15, RPS15A, RPS16, RPS17, RPS18, RPS19, RPS20, RPS21 , RPS23, RPS24, RPS25, RPS26, RPS27, RPS27A, RPS28, RPS29, RPS30, RPL3, RPL4, RPL5, RPL6, RPL7, RPL7A, RPL8, RPL9, RPL10, RPL10A, RPL11 , RPL12, RPL13, RPL13A, RPL14, RPL15, RPL17, RPL18, RPL18A, RPL19, RPL21 , RPL22, RPL23, RPL23A, RPL24, RPL26, RPL27, RPL27A, RPL28, RPL29, RPL30, RPL31 , RPL32, RPL34, RPL35, RPL35A, RPL36, RPL36A, RPL37, RPL37A, RPL38, RPL39, RPL40, RPL41 , RPLPO, RPLP1 , RPLP2, RPLP3, RPLPO, RPLP1 , RPLP2, EEF1A1 , EEF1 B2, EEF1 D, EEF1 G, EEF2, EIF3E, EIF3F, EIF3H, EIF2S3, EIF3C, EIF3K, EIF3EIP, EIF4A2, PABPC1 , HNRNPA1 , TPT1 , TUBB1 , UBA52, NPM1 , ATP5G2, GNB2L1, NME2, UQCRB, or from a homolog, fragment, or variant thereof, or a gene sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the foregoing gene sequences. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 5′ UTR sequences may be excluded from the RNA molecules disclosed herein. In one aspect, a DNA encoding a 5′ UTR disclosed herein comprises a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 17. In one aspect, the DNA encoding the 5′ UTR comprises a sequence of SEQ ID NO: 17. In one aspect, an RNA disclosed herein comprises a 5′ UTR comprising a sequence having at least, at most, exactly, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 5’ UTR provided in any of SEQ ID NO: 18 or 19 in which the transcribed 5′ cap structure is underlined. In one aspect, the 5′ UTR comprises a sequence of any of SEQ ID NO: 18 or 19, in which the transcribed 5′ cap structure is underlined. SEQ ID NO: 17 (DNA) AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCC SEQ ID NO:18 (RNA) AGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC SEQ ID NO: 19 (RNA) AGAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCC In one aspect, a DNA encoding a 5′ UTR disclosed herein comprises a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 51. In one aspect, the DNA encoding the 5′ UTR comprises a sequence of SEQ ID NO: 51. In one aspect, an RNA disclosed herein comprises a 5′ UTR comprising a sequence having at least, at most, exactly, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 5’ UTR provided in any of SEQ ID NO: 52 or 53. In one aspect, the 5′ UTR comprises a sequence of any of SEQ ID NO: 52 or 53, in which the transcribed 5′ cap structure is underlined. SEQ ID NO: 51 (DNA) GATAGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA SEQ ID NO: 52 (RNA) GAUAGGCGGCGCAUGAGAGAAGCCCAGACCAAUUACCUACCCAAA SEQ ID NO: 53 (RNA) GAΨAGGCGGCGCAΨGAGAGAAGCCCAGACCAAΨΨACCΨACCCAAA In some aspects, 1, 2, 3, or more of the foregoing 5′ UTR sequences may be excluded from the RNA molecules disclosed herein. ii. 3′ UTRS In some aspects, an RNA disclosed herein comprises a 3′ UTR. A 3′ UTR, if present, is situated downstream of a protein coding sequence open reading frame, e.g., downstream of the termination codon of a protein-encoding region. A 3′ UTR is typically the part of an mRNA which is located between the protein coding sequence and the poly-A tail of the mRNA. Thus, in some aspects, the 3′ UTR is upstream of the poly-A sequence (if present), e.g. directly adjacent to the poly-A sequence. The 3′ UTR may be involved in regulatory processes including transcript cleavage, stability and polyadenylation, translation, and mRNA localization. Natural or wild type 3′ UTRs comprise stretches of adenosines and uridines. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes: Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Class III ARES do not contain an AUUUA motif. Most proteins binding to AREs are known to destabilize the molecule. Accordingly, introduction, removal and / or modification of 3′ UTR AREs can be used to modulate the stability of nucleic acids (e.g., RNA) of the disclosure. When engineering specific nucleic acids, in some aspects, one or more copies of an ARE can be introduced to make RNAs less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, in some aspects, AREs can be identified and removed and / or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein. Transfection experiments can be conducted in relevant cell lines, using nucleic acids of the disclosure and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE-engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, and 7 days post-transfection. In some aspects, a 3′ UTR may have one or more AU-rich sequences removed. Alternatively the AU-rich sequences may remain in the 3′ UTR. A 3′ UTR may also comprise elements, which are not encoded in the template, from which an RNA is transcribed, but which are added after transcription during maturation, e.g. a poly-A tail. A 3′ UTR of the mRNA is not translated into an amino acid sequence. In some aspects, an RNA disclosed herein comprises a 3′ UTR comprising an F element and / or an I element. In some aspects, a 3′ UTR or a proximal sequence thereto comprises a restriction site. In some aspects, a restriction site is a BamHI site. In some aspects, a restriction site is a Xhol site. In some aspects of the disclosure, a 3′ UTR is a heterologous UTR, e.g., is a UTR found in nature associated with a different ORF. In another aspect, a 3′ UTR is a synthetic UTR, e.g., does not occur in nature. In some aspects, the 3′ UTR is functionally linked to the ORF, e.g., associated with the ORF such that it may exert a function, e.g., increasing, enhancing, stabilizing, and / or prolonging protein production from an RNA molecule and / or increasing protein expression and / or total protein production from an RNA molecule, compared to a reference RNA molecule comprising a reference 3′ UTR or an RNA molecule lacking a 3′ UTR. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 3′ UTR functions may be excluded. Exemplary 3′ UTRs include 3′ UTRs derived from an albumin gene, an a-globin gene, a β-globin gene, a ribosomal protein gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and a collagen alpha gene, such as a collagen alpha 1 (1) gene, or from a homolog, fragment, or variant of a 3′ UTR of a gene comprising an albumin gene, an a-globin gene, a β- globin gene, a ribosomal protein gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and / or a collagen alpha gene, such as a collagen alpha 1 (1) gene according to SEQ ID NOs: 1369-1390 of the patent application WO2013 / 143700, the disclosure of which is incorporated herein by reference in its entirety, or a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the foregoing sequences. In some aspects, the sequence UUUGAAUU is used. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 3′ UTR sequences may be excluded from the RNA molecules disclosed herein. In some aspects, the 3′ UTR comprises a sequence of a transcript including NM_000661.4, NM_001024921 .2, NM_000967.3, NM_001033853.1 , NMJD00968.3, NM_000969.3, NM_001024662.1 , NM_000970.3, NM_000971 .3, NMJD00972.2, NM_000975.3, NM_001 199802.1 , NM_000976.3, NM__000977.3, NM_033251 .2, NMJ 01243130.1 , NM_001243131 , NM_000978.3, NM_000979.3, NM_001270490.1 , NMJD00980.3, NM_000981.3, NM_000982.3, NM_000983.3, NM_000984.5, NM_000985.4, NM_001035006.2, NM_001 199340.1 , NM_001 199341 .1 , NMJD01 199342.1 , NM_001 199343.1 , NM_001 199344.1 , NM_001 199345.1 , NM_000986.3, NM_000987.3, NM_000988.3, NM_000989.3, NM_000990.4, NM_001 136134.1 , NMJD00991 .4, NM_001 136135.1 , NM_001 136136.1 , NM_001 136137.1 , NM_000992.2, NM_000993.4, NM_001098577.2, NM_001099693.1 , NM_000994.3, NM_001007073.1 , NM_001007074.1 , NM_000996.2, M_000997.4, NM_000998.4, NM_000999.3, NM_001035258.1 , NM_001000.3, NM_001002.3, NM_053275.3, NM_001003.2, NM_213725.1 , NM_001004.3 , NM_001005.4, NM_001256802.1 , NM_001260506.1 , NM_001260507.1 , NM_001006.4, NM_001267699.1 , NM_001007.4, NM_001008.3, N _001009.3, NM_001010.2, NM_001011 .3, NM_001012.1 , NM_001013.3, NM_001203245.2, NM_001014.4, NM_001204091.1 , NM_001015.4, NM_001016.3, NM_001017.2, NM_001018.3, NM_001030009.1 , NM_001019.4, NM_001020.4, NM_001022.3, NM_001 146227.1 , NM_001023.3, NM_001024.3, NM_001025.4, NM_001028.2, NM_001029.3, NM_001030.4, NM_002954, NM_001 135592.2, NM_001 177413.1 , NM_001031.4, NM_001032.4, NM_001030001.2, NM_002948.3, NM_001253379.1 , NM_001253380.1 , NM_001253382.1 , NM_001253383.1 , NM_001253384.1 , NM_002952.3, NM_001034996.2, NM_001025071 .1 , NM_001025070.1 , NM_005617.3, NM_006013.3, NM_001256577.1 , NM_001256580.1 , NM_007104.4, NM_007209.3, NM_012423.3, NM_001270491.1 , NM_033643.2, NM_015414.3, NM_021029.5, NM_001199972.1 , NM_021 104.1 , NM_022551.2, NM_033022.3, NM_001142284.1 , NM_001026.4, NM_001142285.1 , NM_001 142283.1 , NM_001 142282.1 , NM_000973.3, NM_033301 .1 , NM_000995.3, NM_033625.2, NM_001021.3, NM_002295.4, NM_001012321 .1 , NM_001033930.1 , NM_003333.3, NM_001997.4, NM_001099645.1 , NM_001021 .3, NM_052969.1 , NM_080746.2, NM_001001.4 , NM_005061.2 , NM_015920.3 , NM_016093.2 , NM_198486.2 , NG_011172.1 , NG_011253.1 , NG_000952.4, NR_002309.1 , NG_010827.2, NG_009952.2, or NG_009517.1, or a sequence of a transcript having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the foregoing transcripts. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 3′ UTR sequences may be excluded from the RNA molecules disclosed herein. In some aspects, the 3′ UTR comprises a sequence from the 3′ UTR region of a gene encoding a ribosomal protein, e.g., ribosomal protein L9 (RPL9), ribosomal protein L3 (RPL3), ribosomal protein L4 (RPL4), ribosomal protein L5 (RPL5), ribosomal protein L6 (RPL6), ribosomal protein L7 (RPL7), ribosomal protein L7a (RPL7A), ribosomal protein L11 (RPL11 ), ribosomal protein L12 (RPL12), ribosomal protein L13 (RPL13), ribosomal protein L23 (RPL23), ribosomal protein L18 (RPL18), ribosomal protein L18a (RPL18A), ribosomal protein L19 (RPL19), ribosomal protein L21 (RPL21 ), ribosomal protein L22 (RPL22), ribosomal protein L23a (RPL23A), ribosomal protein L17 (RPL17), ribosomal protein L24 (RPL24), ribosomal protein L26 (RPL26), ribosomal protein L27 (RPL27), ribosomal protein L30 (RPL30), ribosomal protein L27a (RPL27A), ribosomal protein L28 (RPL28), ribosomal protein L29 (RPL29), ribosomal protein L31 (RPL31 ), ribosomal protein L32 (RPL32), ribosomal protein L35a (RPL35A), ribosomal protein L37 (RPL37), ribosomal protein L37a (RPL37A), ribosomal protein L38 (RPL38), ribosomal protein L39 (RPL39), ribosomal protein, large, P0 (RPLP0), ribosomal protein, large, P1 (RPLP1 ), ribosomal protein, large, P2 (RPLP2), ribosomal protein S3 (RPS3), ribosomal protein S3A (RPS3A), ribosomal protein S4, X-linked (RPS4X), ribosomal protein S4, Y-linked 1 (RPS4Y1 ), ribosomal protein S5 (RPS5), ribosomal protein S6 (RPS6), ribosomal protein S7 (RPS7), ribosomal protein S8 (RPS8), ribosomal protein S9 (RPS9), ribosomal protein S10 (RPS10), ribosomal protein S1 1 (RPS1 1 ), ribosomal protein S12 (RPS12), ribosomal protein S13 (RPS13), ribosomal protein S15 (RPS15), ribosomal protein S15a (RPS15A), ribosomal protein S16 (RPS16), ribosomal protein S19 (RPS19), ribosomal protein S20 (RPS20), ribosomal protein S21 (RPS21 ), ribosomal protein S23 (RPS23), ribosomal protein S25 (RPS25), ribosomal protein S26 (RPS26), ribosomal protein S27 (RPS27), ribosomal protein S27a (RPS27a), ribosomal protein S28 (RPS28), ribosomal protein S29 (RPS29), ribosomal protein L15 (RPL15), ribosomal protein S2 (RPS2), ribosomal protein L14 (RPL14), ribosomal protein S14 (RPS14), ribosomal protein L10 (RPL10), ribosomal protein L10a (RPL10A), ribosomal protein L35 (RPL35), ribosomal protein L13a (RPL13A), ribosomal protein L36 (RPL36), ribosomal protein L36a (RPL36A), ribosomal protein L41 (RPL41 ), ribosomal protein S18 (RPS18), ribosomal protein S24 (RPS24), ribosomal protein L8 (RPL8), ribosomal protein L34 (RPL34), ribosomal protein S17 (RPS17), ribosomal protein SA (RPSA) or ribosomal protein S17 (RPS17), or a sequence of a gene encoding a ribosomal protein having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the foregoing ribosomal gene protein sequences. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 3′ UTR sequences may be excluded from the RNA molecules disclosed herein. In some aspects, the 3′ UTR comprises a sequence from the 3′ UTR region of a gene encoding a ribosomal protein or from a gene comprising ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (FAU), ribosomal protein L22-like 1 (RPL22L1), ribosomal protein L39-like (RPL39L), ribosomal protein L10-like (RPL10L), ribosomal protein L36a-like (RPL36AL), ribosomal protein L3-like (RPL3L), ribosomal protein S27-like (RPS27L), ribosomal protein L26-like 1 (RPL26L1), ribosomal protein L7-like 1 (RPL7L1), ribosomal protein L13a pseudogene (RPL13AP), ribosomal protein L37a pseudogene 8 (RPL37AP8), ribosomal protein S10 pseudogene 5 (RPS10P5), ribosomal protein S26 pseudogene 1 1 (RPS26P1 1), ribosomal protein L39 pseudogene 5 (RPL39P5), ribosomal protein, large, PO pseudogene 6 (RPLP0P6) and ribosomal protein L36 pseudogene 14 (RPL36P14), and / or a sequence of a gene encoding a protein having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with any of the foregoing gene protein sequences. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 3′ UTR sequences may be excluded from the RNA molecules disclosed herein. Those of ordinary skill in the art will understand that 5′ UTRs that are heterologous and / or synthetic may be used with any desired 3′ UTR sequence, and vice versa. For example, a heterologous 5′ UTR may be used with a synthetic and / or heterologous 3′ UTR. In one aspect, a DNA encoding a 3′ UTR disclosed herein comprises a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 20. In one aspect, the DNA encoding the 3′ UTR comprises a sequence of SEQ ID NO: 20. In some aspects, an RNA disclosed herein comprises a 3′ UTR comprising a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 3’ UTR provided in any of SEQ ID NO: 21 or 22. In one aspect, the 3′ UTR comprises a sequence of any of SEQ ID NO: 21 or 22. SEQ ID NO: 20 (DNA) CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCG AGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACC TCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAG CCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAG CTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC SEQ ID NO: 21 (RNA) CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCC CGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCAC CACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAG CCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUU AACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUA GC SEQ ID NO: 22 (RNA) CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨAC CCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCAC ΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAAC GCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAAC GAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACA CCCΨGGAGCΨAGC In one aspect, a DNA encoding a 3′ UTR disclosed herein comprises a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 23. In one aspect, the DNA encoding the 3′ UTR comprises a sequence of SEQ ID NO: 23. In one aspect, an RNA disclosed herein comprises a 3′ UTR comprising a sequence having at least, at most, exactly, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 3’ UTR provided in any of SEQ ID NO: 24 or 25. In one aspect, the 3′ UTR comprises a sequence of any of SEQ ID NO: 24 or 25. SEQ ID NO: 23 (DNA) ATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTA AAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC SEQ ID NO: 24 (RNA) AUACAGCAGCAAUUGGCAAGCUGCUUACAUAGAACUCGCGGCGAUUGGCAUGCCGCCU UAAAAUUUUUAUUUUAUUUUUCUUUUCUUUUCCGAAUCGGAUUUUGUUUUUAAUAUUUC SEQ ID NO: 25 (RNA) AΨACAGCAGCAAΨΨGGCAAGCΨGCΨΨACAΨAGAACΨCGCGGCGAΨΨGGCAΨGCCGC CΨΨAAAAΨΨΨΨΨAΨΨΨΨAΨΨΨΨΨCΨΨΨΨCΨΨΨΨCCGAAΨCGGAΨΨΨΨGΨΨΨΨΨ AAΨAΨΨΨC In some aspects, 1, 2, 3, 4, 5, or more of the foregoing 3′ UTR sequences may be excluded from the RNA molecules disclosed herein. D. OPEN READING FRAME (ORF) The 5′ and 3′ UTRs may be operably linked to an open reading frame (ORF), which may be a sequence of codons that is capable of being translated into a polypeptide of interest. An open reading frame may be a sequence of several DNA or RNA nucleotide triplets, which may be translated into a peptide or protein. An ORF may begin with a start codon, e.g., a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG or AUG), at its 5’ end and a subsequent region, which usually exhibits a length which is a multiple of 3 nucleotides. An open reading frame may terminate with at least one stop codon, including but not limited to TAA, TAG, TGA or UAA, UAG or UGA, or any combination thereof. In some aspects, an open reading frame may terminate with one, two, three, four or more stop codons, including but not limited to TAATAA (SEQ ID NO: 27), TAATAG (SEQ ID NO: 28), TAATGA (SEQ ID NO: 29), TAGTGA (SEQ ID NO: 30), TAGTAA (SEQ ID NO: 31), TAGTAG (SEQ ID NO: 32), TGATGA (SEQ ID NO: 33), TGATAG (SEQ ID NO: 34), TGATAA (SEQ ID NO: 35) or UAAUAA (SEQ ID NO: 36), UAAUAG (SEQ ID NO: 37), UAAUGA (SEQ ID NO: 38), UAGUGA (SEQ ID NO: 39), UAGUAA (SEQ ID NO:40), UAGUAG (SEQ ID NO: 41), UGAUGA (SEQ ID NO: 42), UGAUAG (SEQ ID NO: 43), UGAUAA (SEQ ID NO: 44), or any combination thereof. An open reading frame may be isolated or it may be incorporated in a longer nucleic acid sequence, e.g. in a vector or an mRNA. An open reading frame may also be termed “(protein) coding region” or “coding sequence”. As stated herein, the RNA molecule may include one (monocistronic), two (bicistronic) or more (multicistronic) open reading frames. In some aspects, the ORF encodes a non-structural viral gene. In some aspects, the ORF further includes one or more subgenomic promoters. In some aspects, the RNA molecule includes a subgenomic promoter operably linked to the ORF. In some aspects, a first RNA molecule does not include an ORF encoding any polypeptide of interest, whereas a second RNA molecule includes an ORF encoding a polypeptide of interest. In some aspects, the first RNA molecule does not include a subgenomic promoter. The present disclosure provides for an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. In some aspects, an RNA molecule comprising at least one open reading frame encoding a RSV F protein. In a preferred aspect, an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) prefusion F protein (preF) polypeptide. E. GENES OF INTEREST The RNA molecules described herein may include a gene of interest. The gene of interest encodes a polypeptide of interest. Non-limiting examples of polypeptides of interest include, e.g., biologics, antibodies, vaccines, therapeutic polypeptides or peptides, cell penetrating peptides, secreted polypeptides, plasma membrane polypeptides, cytoplasmic or cytoskeletal polypeptides, intracellular membrane bound polypeptides, nuclear polypeptides, polypeptides associated with human disease, targeting moieties, those polypeptides encoded by the human genome for which no therapeutic indication has been identified but which nonetheless have utility in areas of research and discovery, or combinations thereof. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing polypeptides of interest may be excluded. The sequence for a particular gene of interest is readily identified by one of skill in the art using public and private databases, e.g., GENBANK®. In some aspects, the RNA molecules include a coding region for a gene of interest. In some aspects, a gene of interest is or comprises an antigenic polypeptide or an immunogenic variant or an immunogenic fragment thereof. In some aspects, an antigenic polypeptide comprises one epitope from an antigen. In some aspects, an antigenic polypeptide comprises a plurality of distinct epitopes from an antigen. In some aspects, an antigenic polypeptide comprising a plurality of distinct epitopes from an antigen is polyepitopic. In some aspects, an antigenic polypeptide comprises: an antigenic polypeptide from an allergen, a viral antigenic polypeptide, a bacterial antigenic polypeptide, a fungal antigenic polypeptide, a parasitic antigenic polypeptide, an antigenic polypeptide from an infectious agent, an antigenic polypeptide from a pathogen, a tumor antigenic polypeptide, or a self-antigenic polypeptide. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing antigenic polypeptides may be excluded. The term “antigen” may refer to a substance, which is capable of being recognized by the immune system, e.g., by the adaptive immune system, and which is capable of eliciting an antigen-specific immune response, e.g., by formation of antibodies and / or antigen-specific T cells as part of an adaptive immune response. An antigen may be or may comprise a peptide or protein, which may be presented by the MHC to T cells. An antigen may be the product of translation of a provided nucleic acid molecule, e.g., an RNA molecule comprising at least one coding sequence as described herein. In addition, fragments, variants and derivatives of an antigen, such as a peptide or a protein, comprising at least one epitope are understood as antigens. In some aspects, an RNA encoding a gene of interest, e.g., an antigen, is expressed in cells of a subject treated to provide a gene of interest, e.g., an antigen. In some aspects, the RNA is transiently expressed in cells of the subject. In some aspects, expression of a gene of interest, e.g., an antigen, is at the cell surface. In some aspects, a gene of interest, e.g., an antigen, is expressed and presented in the context of MHC. In some aspects, expression of a gene of interest, e.g., an antigen, is into the extracellular space, e.g., the antigen is secreted. In some aspects, the RNA molecules include a coding region for a gene of interest, e.g., an antigen. In some aspects, the RNA molecules include a coding region for a gene of interest, e.g., an antigen, that is derived from a pathogen associated with an infectious disease. In some aspects, the RNA molecules include a coding region for a gene of interest, e.g., an antigen, that is derived from RSV. In some aspects, the RNA molecule encodes a RSV preF protein or a fragment or a variant thereof. In some aspects, an RNA polynucleotide described herein or a composition or medical preparation comprising the same comprises a nucleotide sequence disclosed herein. In some aspects, an RNA polynucleotide comprises a sequence having at least 80% identity to a nucleotide sequence disclosed herein. In some aspects, an RNA polynucleotide comprises a sequence encoding a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some aspects, an RNA polynucleotide described herein or a composition or medical preparation comprising the same is transcribed by a DNA template. In some aspects, a DNA template used to transcribe an RNA polynucleotide described herein comprises a sequence complementary to an RNA polynucleotide. In some aspects, a gene of interest described herein is encoded by an RNA polynucleotide described herein comprising a nucleotide sequence disclosed herein. In some aspects, an RNA polynucleotide encodes a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some aspects, a polypeptide described herein is encoded by an RNA polynucleotide transcribed by a DNA template comprising a sequence complementary to an RNA polynucleotide. In some aspects, the RNA molecule encodes a RSV preF protein comprising the sequence of any one of SEQ ID NOs: 1-6 and 71-74, or a fragment or variant thereof. In some aspects, the RNA molecule encodes a RSV preF protein synthesized from the nucleic acid sequence comprising any one of SEQ ID NOs: 7 to 10 and 59 to 62, or fragment or variant thereof. F. POLY-A TAIL In some aspects, RNA molecules disclosed herein comprise a poly-adenylate (poly-A) sequence, e.g., as described herein. In some aspects, a poly-A sequence is situated downstream of a 3′ UTR, e.g., adjacent to a 3′ UTR. A “poly-A tail” or “poly-A sequence” refers to a stretch of consecutive adenine residues, e.g., of up to or up to about 400 adenosine nucleotides, e.g., from or from about 20 to about 400, preferably from or from about 50 to about 400, more preferably from or from about 50 to about 300, even more preferably from or from about 50 to about 250, most preferably from or from about 60 to about 250 adenosine nucleotides, which may be attached to the 3′ end of the RNA molecule. Poly-A sequences are known to those of skill in the art and may follow the 3′ UTR in the RNA molecules described herein. The poly-A tail may increase the stability, half-life, and / or translational efficiency of the RNA molecule. After cleavage, most pre-mRNAs, with exceptions that include replication-dependent histone transcripts that terminate with a histone stem-loop instead of a poly-A sequence, acquire a polyadenylated tail. In this context, 3′-end processing is a nuclear co-transcriptional process that promotes transport of mRNAs from the nucleus to the cytoplasm and affects the stability and the translation of mRNAs. Formation of this 3′ end occurs in a two-step reaction directed by the cleavage / polyadenylation machinery and depends on the presence of two sequence elements in mRNA precursors (pre-mRNAs); a hexanucleotide polyadenylation signal and a downstream G / U-rich sequence. In a first step, pre-mRNAs are cleaved between these two elements to a free 3′ hydroxyl. In a second step, the newly formed 3′ end is extended by polyadenylation or addition of a poly-A sequence. Polyadenylation refers to the addition of a poly-A sequence to an RNA molecule, e.g., to a premature mRNA. Polyadenylation may be induced by a so-called polyadenylation signal. This signal may be located within a stretch of nucleotides close to or at the 3′-end of an RNA molecule to be polyadenylated. A polyadenylation signal may also be comprised by the 3′ UTR of the artificial nucleic acid molecule. A polyadenylation signal typically comprises a hexamer consisting of adenine and uracil / thymine nucleotides, preferably the hexamer sequence AAUAAA, though other sequences, preferably hexamer sequences, are also conceivable. Polyadenylation typically occurs during processing of a pre-mRNA (also called premature-mRNA). Typically, RNA maturation (from pre-mRNA to mature mRNA) comprises the step of polyadenylation. Poly-A tailing of in vitro transcribed mRNA can be achieved using various approaches including, but not limited to, cloning of a poly-T tract into the DNA template or by post-transcriptional addition using poly-A polymerase. The term may relate to polyadenylation of RNA as a cellular process or to polyadenylation carried out by enzymatic reaction in vitro with a suitable enzyme, such as E. coli poly-A polymerase, or by chemical synthesis. RNA molecules disclosed herein may have a poly-A sequence attached to the free 3′-end of the RNA by a template-independent RNA polymerase after transcription or a poly-A sequence encoded by DNA and transcribed by a template-dependent RNA polymerase. In some aspects, a poly-A sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand. The DNA sequence encoding a poly-A sequence (coding strand) is referred to as poly-A cassette. In some aspects, the poly-A cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such a random sequence may be at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. Such a cassette is disclosed in, e.g., WO 2016 / 005324 A1, hereby incorporated by reference. Any poly-A cassette disclosed in WO 2016 / 005324 A1 may be used in the present disclosure. A poly-A cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides, shows, on a DNA level, constant propagation of plasmid DNA in E. coli and is still associated, on an RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency. In some aspects, the poly-A sequence contained in an RNA polynucleotide described herein consists essentially of adenosine nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such a random sequence may be at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. The poly-A sequence may be located at any position within the 3′ UTR. In some aspects, no nucleotides other than adenosine nucleotides flank a poly-A sequence at its 3′-end, e.g., the poly-A sequence is not masked or followed at its 3′-end by a nucleotide other than adenosine. In some aspects, the poly-A sequence may be located at the 3′ terminus of the 3′ UTR, e.g., the 3′ UTR does not contain more than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides located 3′ of the poly-A sequence; more preferably the 3′ UTR does not contain further elements located 3′ to the poly-A sequence. In some aspects, poly-A sequence is located at the 3′ terminus of the RNA molecule, e.g., the artificial nucleic acid molecule does not contain more than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides located 3′ of the poly-A sequence. Alternatively, the poly-A sequence may be located at the 5′ terminus of the 3′ UTR, e.g., immediately 3′ of the ORF of the artificial nucleic acid molecule, or located within the 3′ UTR, e.g., flanked on the 5′ and on the 3′ side by other 3′ UTR elements. In some aspects, the poly-A sequence is flanked on the 3′ side by a poly- C sequence and / or a histone stem-loop sequence. In addition or alternatively, the poly-A sequence can be flanked on the 5′ side by a 3′ UTR element derived from, e.g., a human albumin or globin gene. In some aspects, the RNA molecule may further include an endonuclease recognition site sequence immediately downstream of the poly-A tail sequence. The RNA molecule may further include a poly-A polymerase recognition sequence (e.g., a polyadenylation signal) (e.g., AAUAAA) near its 3′ end. In some aspects, the polyadenylation signal is located 3′ of the poly-A sequence comprised in the 3′ UTR. In some aspects, the poly-A sequence is separated from the polyadenylation signal by a nucleotide sequence comprising or consisting of at least, at most, exactly, or between (inclusive or exclusive) any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides, wherein the nucleotide sequence does preferably not comprise more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive adenine nucleotides. In some aspects, the nucleotide sequence that separates the poly-A sequence and the polyadenylation signal comprises from or from about 1 to about 200 nucleotides, e.g., from 10 to 90, from 20 to 85, from 30 to 80, from 40 to 80, from 50 to 75 or from 55 to 85 nucleotides, more preferably from 55 to 80 nucleotides, and the nucleotide sequence does not comprise more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 consecutive adenine nucleotides. In some aspects, the polyadenylation signal comprises the consensus sequence NN(U / T)ANA, with N = A or U, preferably AA(U / T)AAA or A(U / T)(U / T)AAA. Such a consensus sequence may be recognized by most animal and bacterial cell-systems, for example, by the polyadenylation-factors, such as cleavage / polyadenylation specificity factor (CPSF) cooperating with CstF, PAP, PAB2, CFI and / or CFII. In some aspects, the polyadenylation signal (e.g., the consensus sequence NNUANA) is located less than or less than about 50 nucleotides, e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides, downstream of the 3′-end of the 3′ UTR element as defined herein such that transcription of an RNA molecule will result in a premature-RNA containing the polyadenylation signal downstream of its 3′ UTR and subsequent attachment of a poly-A sequence to the premature-RNA. Accordingly, a resulting RNA may comprise a 3′ UTR, which comprises at least one poly-A sequence, and wherein the 3′ UTR is followed by an additional poly-A sequence. The poly-A sequence may be of any length. In some aspects, the poly-A tail may be 5 to 300 nucleotides in length. In some aspects, the RNA molecule includes a poly-A tail that comprises, consists essentially of, or consists of a sequence of or of about 25 to about 400 adenosine nucleotides, a sequence of or of about 50 to about 400 adenosine nucleotides, a sequence of or of about 50 to about 300 adenosine nucleotides, a sequence of or of about 50 to about 250 adenosine nucleotides, a sequence of or of about 60 to about 250 adenosine nucleotides, or a sequence of or of about 40 to about 100 adenosine nucleotides. In some aspects, the poly-A tail comprises, consists essentially of, or consists of at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, 665, 670, 675, 680, 685, 690, 695, 700, 705, 710, 715, 720, 725, 730, 735, 740, 745, 750, 755, 760, 765, 770, 775, 780, 785, 790, 795, 800, 805, 810, 815, 820, 825, 830, 835, 840, 845, 850, 855, 860, 865, 870, 875, 880, 885, 890, 895, 900, 905, 910, 915, 920, 925, 930, 935, 940, 945, 950, 955, 960, 965, 970, 975, 980, 985, 990, 995, or 1000 adenosine nucleotides. In this context, “consists essentially of” means that most nucleotides in the poly-A sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly-A sequence are adenosine nucleotides, but permits remaining nucleotides to be nucleotides other than adenosine nucleotides, such as uridine, guanosine, and / or cytosine. In this context, “consists of” means that all nucleotides in the poly-A sequence, i.e., 100% by number of nucleotides in the poly-A sequence, are adenosine nucleotides. In some aspects, the RNA molecule includes a poly-A tail that includes a sequence of greater than 30 adenosine nucleotides. In some aspects, the RNA molecule includes a poly-A tail that includes or includes about 40 adenosine nucleotides. In some aspects, the RNA molecule includes a poly-A tail that includes or includes about 80 adenosine nucleotides. In some aspects, the 3′ poly-A tail has a stretch of at least 10 consecutive adenosine residues and at most 300 consecutive adenosine residues. In some specific aspects, the RNA molecule includes or includes about 40 consecutive adenosine residues. In some aspects, the RNA molecule includes or includes about 80 consecutive adenosine residues. Poly-A tails may play key regulatory roles in enhancing translation efficiency and regulating the efficiency of mRNA quality control and degradation. Short sequences or hyperpolyadenylation may signal for RNA degradation. In some aspects, a poly-A tail may be located within an RNA molecule or other nucleic acid molecule, such as, e.g., in a vector, for example, in a vector serving as template for the generation of an RNA, e.g., an mRNA, e.g., by transcription of the vector. In some aspects, the RNA molecule may not include a poly-A tail. In some aspects, a poly-A tail may be located within an RNA molecule or other nucleic acid molecule, such as, e.g., in a vector, for example, in a vector serving as template for the generation of an RNA, e.g. an mRNA, e.g., by transcription of the vector. In some aspects, the RNA molecule may not include a poly-A tail. In one aspect, a DNA encoding a poly-A tail disclosed herein comprises a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 26. In one aspect, the DNA encoding the poly-A tail comprises a sequence of SEQ ID NO: 26. In one aspect, an RNA disclosed herein comprises a poly-A tail comprising a sequence having at least, at most, exactly, or between (inclusive or exclusive) any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 26. In one aspects, the poly-A tail comprises a sequence of SEQ ID NO: 26. In one aspect, the poly-A tail comprises a sequence of SEQ ID NO: 26 + / - 2 adenosine (A) nucleotides. In one aspect, the poly-A tail comprises a sequence of SEQ ID NO: 26 + / - 1 adenosine (A) nucleotides. In one aspect, the poly-A tail comprises a sequence of SEQ ID NO: 26. In one aspect, the poly- A tail comprises a sequence of SEQ ID NO: 26 + / - 2 adenosine (A) nucleotides. In one aspect, the poly-A tail comprises a sequence of SEQ ID NO: 26 + / - 1 adenosine (A) nucleotides. In some aspects, the poly-A tail comprises a sequence of SEQ ID NO: 26. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing poly-A sequences may be excluded from the RNA molecules disclosed herein. SEQ ID NO: 26 (DNA, RNA) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA G. OTHER ELEMENTS In some aspects of the present disclosure, the RNA molecules additionally include a chain terminating nucleoside. For example, a chain terminating nucleoside may include those nucleosides deoxygenated at the 2’ and / or 3′ positions of their sugar group. Such species may include 3′ deoxyadenosine (cordycepin), 3′ deoxyuridine, 3′ deoxycytosine, 3′ deoxyguanosine, 3′ deoxythymine, and 2',3′ dideoxynucleosides, such as 2',3′ dideoxyadenosine, 2',3′ dideoxyuridine, 2',3′ dideoxycytosine, 2',3′ dideoxyguanosine, and 2',3′ dideoxythymine. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing chain terminating nucleosides may be excluded from the RNA molecules disclosed herein. In some aspects, incorporation of a chain terminating nucleotide into an mRNA, for example at the 3′-terminus, may result in stabilization of the mRNA, as described, for example, in International Patent Publication No. WO 2013 / 103659. In some aspects of the present disclosure, the RNA molecules additionally include a stem loop, such as a histone stem loop. A stem loop may include 2, 3, 4, 5, 6, 7, 8, or more nucleotide base pairs. For example, a stem loop may include 4, 5, 6, 7, or 8 nucleotide base pairs. A stem loop may be located in any region of an mRNA. For example, a stem loop may be located in, before, or after an untranslated region (a 5′ UTR or a 3′ UTR), a coding region, or a poly-A sequence or tail. In some aspects, a stem loop may affect one or more function(s) of an mRNA, such as initiation of translation, translation efficiency, and / or transcriptional termination. Such histone stem-loop sequences may be histone stem-loop sequences disclosed in WO 2012 / 019780, the disclosure of which is incorporated herein by reference in its entirety. Other non-limiting examples of histone stem loop structures and nucleic acid sequences encoding such structures can be found in, e.g., WO 2016 / 091391, the disclosure of which is incorporated by reference herein in its entirety. In some aspects, the combination of a poly-A sequence or polyadenylation signal and at least one histone stem-loop, even though both represent alternative mechanisms in nature, acts synergistically to increase the protein expression beyond the level observed with either of the individual elements. In some aspects, the synergistic effect of the combination of poly-A and at least one histone stem-loop does not depend on the order of the elements and / or the length of the poly-A sequence. In some aspects, the RNA does not comprise a histone downstream element (HDE). An HDE includes a purine-rich polynucleotide stretch of approximately 15 to 20 nucleotides 3′ of naturally occurring stem-loops, representing the binding site for the U7 snRNA, which is involved in processing of histone pre-mRNA into mature histone mRNA. In some aspects, the histone stem-loop is generally derived from histone genes, and includes an intramolecular base pairing of two neighbored partially or entirely reverse complementary sequences separated by a spacer, consisting of a short sequence, which forms the loop of the structure. The unpaired loop region is typically unable to base pair with either of the stem loop elements. Stability of the stem-loop structure generally depends on the length, number of mismatches or bulges, and / or base composition of the paired region. In some aspects, wobble base pairing (non-Watson-Crick base pairing) may result. In some aspects, the at least one histone stem-loop sequence comprises a length of 15 to 45 nucleotides. In some aspects, the RNA molecules include (e.g., within the 3′ UTR) a poly(C) sequence. In some aspects, the poly-C sequences has at least, at most, exactly, or between (inclusive or exclusive) any two of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 cytidines. In some aspects, the poly-C sequences has or has about 30 cytidines. In some aspects, the RNA molecules include an internal ribosome entry site (IRES) sequence or IRES-motif. In some aspects, an IRES sequence separates ORFs, e.g., if the RNA encodes two or more peptides or proteins. An IRES-sequence may therefore be useful if the RNA molecule is a bi- or multicistronic nucleic acid molecule. In some aspects, the RNA does not comprise an intron. In some aspects, the RNA may instead or additionally include a microRNA binding site. Representative RNA molecules including a combination of the elements disclosed herein can include, without limitation, in 5′-to-3′-direction, the following: ORF - poly-A sequence; ORF - IRES - ORF - poly-A sequence; ORF - 3′ UTR - poly-A sequence; ORF - poly-A sequence - 3′ UTR; ORF - 3′ UTR - poly-A sequence - poly(C) sequence - histone stem-loop; ORF - 3′ UTR - poly-A sequence - poly(C) sequence - poly-A sequence; ORF - 3′ UTR - poly-A sequence - histone stem-loop - poly-A sequence; 5′ UTR - ORF - 3′ UTR; 5′ UTR - ORF - poly-A sequence; 5′ UTR - ORF - poly-A sequence - poly(C) sequence - histone stem-loop; 5′ UTR - ORF - poly-A sequence - poly(C) sequence - poly-A sequence; 5′ UTR - ORF - poly-A sequence - histone stem-loop - poly-A sequence; 5′ UTR - ORF - 3′ UTR - poly-A sequence; 5′ UTR - ORF - 3′ UTR - poly-A sequence - poly(C) sequence 5′ UTR - ORF - 3′ UTR - poly-A sequence - poly(C) sequence - histone stem- loop; 5′-cap - 5′ UTR - ORF - 3′ UTR; 5′-cap - 5′ UTR - ORF - poly-A sequence; 5′-cap - 5′ UTR - ORF - 3′ UTR - poly-A sequence; 5′-cap - 5′ UTR - ORF - 3′ UTR - poly-A sequence - poly(C) sequence; or 5′-cap - 5′ UTR - ORF - 3′ UTR - poly-A sequence - poly(C) sequence - histone stem- loop. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing elements may be excluded from the RNA molecules disclosed herein. H. SELF-AMPLIFYING RNA (saRNA) In some aspects, the RNA molecule may be an saRNA. “Self-amplifying RNA,” “saRNA,” and “replicon” refer to RNA with the ability to replicate itself. Self-amplifying RNA molecules may be produced by using replication elements derived from, e.g., alphaviruses, and substituting the structural viral polypeptides with a nucleotide sequence encoding a polypeptide of interest. A self- amplifying RNA molecule is typically a positive-strand molecule that may be directly translated after delivery to a cell, and this translation provides an RNA-dependent RNA polymerase that then produces both antisense and sense transcripts from the delivered RNA. The delivered RNA leads to the production of multiple daughter RNA molecules. These daughter RNA molecules, as well as collinear subgenomic transcripts, may be translated themselves to provide in situ expression of an encoded gene of interest, e.g., a viral antigen, and / or may be transcribed to provide further transcripts with the same sense as the delivered RNA that are translated to provide in situ expression of the antigen. The overall result of this sequence of transcriptions is an amplification in the number of the introduced saRNA molecules, and consequently, the encoded gene of interest, e.g., a viral antigen, becomes a major polypeptide product of the cells. In some aspects, the self-amplifying RNA includes at least one or more genes including any one of viral replicases, viral proteases, viral helicases and other nonstructural viral proteins, or combination thereof. In some aspects, 1, 2, 3, or more of the foregoing genes may be excluded from the self-amplifying RNA molecules disclosed herein. In some aspects, the self-amplifying RNA may also include 5′- and 3′-end tractive replication sequences, and optionally a heterologous sequence that encodes a desired amino acid sequence (e.g., an antigen of interest). A subgenomic promoter that directs expression of the heterologous sequence may be included in the self-amplifying RNA. Optionally, the heterologous sequence (e.g., an antigen of interest) may be fused in frame to other coding regions in the self-amplifying RNA and / or may be under the control of an internal ribosome entry site (IRES). In some aspects, a self-amplifying RNA molecule described herein encodes (i) an RNA- dependent RNA polymerase that may transcribe RNA from the self-amplifying RNA molecule and (ii) a polypeptide of interest, e.g., a viral antigen. In some aspects, the polymerase may be an alphavirus replicase, e.g., including any one of alphavirus proteins nsP1, nsP2, nsP3, nsP4, or any combination thereof. In some aspects, 1, 2, 3, or more of the foregoing alphavirus proteins may be excluded from the RNA molecules disclosed herein. In some aspects, the self-amplifying RNA molecule may have two open reading frames. The first (5′) open reading frame may encode a replicase; the second (3′) open reading frame may encode a polypeptide comprising an antigen of interest. In some aspects the RNA may have additional (e.g., downstream) open reading frames, e.g., to encode further antigens or to encode accessory polypeptides. In some aspects, the saRNA molecule further includes (1) an alphavirus 5′ replication recognition sequence, and (2) an alphavirus 3′ replication recognition sequence. In some aspects, the 5′ sequence of the self-amplifying RNA molecule is selected to ensure compatibility with the encoded replicase. In some aspects, the self-amplifying RNA molecule may encode a single polypeptide antigen or, optionally, two or more polypeptide antigens linked together in a way that each of the sequences retains its identity (e.g., linked in series) when expressed as an amino acid sequence. The polypeptides generated from the self-amplifying RNA may then be produced as a fusion polypeptide or engineered in such a manner to result in separate polypeptide or peptide sequences. In some aspects, the self-amplifying RNA described herein may encode one or more polypeptide antigens that include a range of epitopes. In some aspects, the self-amplifying RNA described herein may encode epitopes capable of eliciting either a helper T cell response or a cytotoxic T cell response or both. In one aspect, a self-amplifying RNA disclosed herein comprises a subgenomic promoter comprising a sequence having at least, at most, exactly, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 54. In one aspect, the subgenomic promoter comprises a sequence of SEQ ID NO: 54. SEQ ID NO: 54 (RNA) CCUGAAUGGACUACGACAUAGUCUAGUCCGCCAAG In some aspects, a self-amplifying RNA molecule described herein encodes (i) an RNA- dependent RNA polymerase that may transcribe RNA from the self-amplifying RNA molecule and (ii) a polypeptide of interest, e.g., a viral antigen. In some aspects, the polymerase may be an alphavirus replicase, e.g., including any one of alphavirus protein nsP1, nsP2, nsP3, nsP4, and any combination thereof. In one aspect, a self-amplifying RNA disclosed herein comprises an alphavirus replicase, e.g., including any one of alphavirus protein nsP1, nsP2, nsP3, nsP4, and any combination thereof, comprising a sequence having at least, at most, exactly, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 55-58, respectively. In one aspect, the alphavirus protein nsP1, nsP2, nsP3 and nsP4 each comprise a sequence of SEQ ID NO: 55-58, respectively. SEQ ID NO: 55 (nsP1 RNA) AUGGAGAAAGUUCACGUUGACAUCGAGGAAGACAGCCCAUUCCUCAGAGCUUUGCAGC GGAGCUUCCCGCAGUUUGAGGUAGAAGCCAAGCAGGUCACUGAUAAUGACCAUGCUAA UGCCAGAGCGUUUUCGCAUCUGGCUUCAAAACUGAUCGAAACGGAGGUGGACCCAUCC GACACGAUCCUUGACAUUGGAAGUGCGCCCGCCCGCAGAAUGUAUUCUAAGCACAAGU AUCAUUGUAUCUGUCCGAUGAGAUGUGCGGAAGAUCCGGACAGAUUGUAUAAGUAUGC AACUAAGCUGAAGAAAAACUGUAAGGAAAUAACUGAUAAGGAAUUGGACAAGAAAAUGAA GGAGCUCGCCGCCGUCAUGAGCGACCCUGACCUGGAAACUGAGACUAUGUGCCUCCAC GACGACGAGUCGUGUCGCUACGAAGGGCAAGUCGCUGUUUACCAGGAUGUAUACGCGG UUGACGGACCGACAAGUCUCUAUCACCAAGCCAAUAAGGGAGUUAGAGUCGCCUACUG GAUAGGCUUUGACACCACCCCUUUUAUGUUUAAGAACUUGGCUGGAGCAUAUCCAUCAU ACUCUACCAACUGGGCCGACGAAACCGUGUUAACGGCUCGUAACAUAGGCCUAUGCAG CUCUGACGUUAUGGAGCGGUCACGUAGAGGGAUGUCCAUUCUUAGAAAGAAGUAUUUG AAACCAUCCAACAAUGUUCUAUUCUCUGUUGGCUCGACCAUCUACCACGAGAAGAGGGA CUUACUGAGGAGCUGGCACCUGCCGUCUGUAUUUCACUUACGUGGCAAGCAAAAUUAC ACAUGUCGGUGUGAGACUAUAGUUAGUUGCGACGGGUACGUCGUUAAAAGAAUAGCUA UCAGUCCAGGCCUGUAUGGGAAGCCUUCAGGCUAUGCUGCUACGAUGCACCGCGAGGG AUUCUUGUGCUGCAAAGUGACAGACACAUUGAACGGGGAGAGGGUCUCUUUUCCCGUG UGCACGUAUGUGCCAGCUACAUUGUGUGACCAAAUGACUGGCAUACUGGCAACAGAUG UCAGUGCGGACGACGCGCAAAAACUGCUGGUUGGGCUCAACCAGCGUAUAGUCGUCAA CGGUCGCACCCAGAGAAACACCAAUACCAUGAAAAAUUACCUUUUGCCCGUAGUGGCCC AGGCAUUUGCUAGGUGGGCAAAGGAAUAUAAGGAAGAUCAAGAAGAUGAAAGGCCACUA GGACUACGAGAUAGACAGUUAGUCAUGGGGUGUUGUUGGGCUUUUAGAAGGCACAAGA UAACAUCUAUUUAUAAGCGCCCGGAUACCCAAACCAUCAUCAAAGUGAACAGCGAUUUC CACUCAUUCGUGCUGCCCAGGAUAGGCAGUAACACAUUGGAGAUCGGGCUGAGAACAA GAAUCAGGAAAAUGUUAGAGGAGCACAAGGAGCCGUCACCUCUCAUUACCGCCGAGGA CGUACAAGAAGCUAAGUGCGCAGCCGAUGAGGCUAAGGAGGUGCGUGAAGCCGAGGAG UUGCGCGCAGCUCUACCACCUUUGGCAGCUGAUGUUGAGGAGCCCACUCUGGAAGCCG AUGUCGACUUGAUGUUACAAGAGGCUGGGGCC SEQ ID NO: 56 (NSP2 RNA) GGCUCAGUGGAGACACCUCGUGGCUUGAUAAAGGUUACCAGCUACGAUGGCGAGGACA AGAUCGGCUCUUACGCUGUGCUUUCUCCGCAGGCUGUACUCAAGAGUGAAAAAUUAUC UUGCAUCCACCCUCUCGCUGAACAAGUCAUAGUGAUAACACACUCUGGCCGAAAAGGGC GUUAUGCCGUGGAACCAUACCAUGGUAAAGUAGUGGUGCCAGAGGGACAUGCAAUACC CGUCCAGGACUUUCAAGCUCUGAGUGAAAGUGCCACCAUUGUGUACAACGAACGUGAG UUCGUAAACAGGUACCUGCACCAUAUUGCCACACAUGGAGGAGCGCUGAACACUGAUGA AGAAUAUUACAAAACUGUCAAGCCCAGCGAGCACGACGGCGAAUACCUGUACGACAUCG ACAGGAAACAGUGCGUCAAGAAAGAACUAGUCACUGGGCUAGGGCUCACAGGCGAGCU GGUGGAUCCUCCCUUCCAUGAAUUCGCCUACGAGAGUCUGAGAACACGACCAGCCGCU CCUUACCAAGUACCAACCAUAGGGGUGUAUGGCGUGCCAGGAUCAGGCAAGUCUGGCA UCAUUAAAAGCGCAGUCACCAAAAAAGAUCUAGUGGUGAGCGCCAAGAAAGAAAACUGU GCAGAAAUUAUAAGGGACGUCAAGAAAAUGAAAGGGCUGGACGUCAAUGCCAGAACUGU GGACUCAGUGCUCUUGAAUGGAUGCAAACACCCCGUAGAGACCCUGUAUAUUGACGAA GCUUUUGCUUGUCAUGCAGGUACUCUCAGAGCGCUCAUAGCCAUUAUAAGACCUAAAAA GGCAGUGCUCUGCGGGGAUCCCAAACAGUGCGGUUUUUUUAACAUGAUGUGCCUGAAA GUGCAUUUUAACCACGAGAUUUGCACACAAGUCUUCCACAAAAGCAUCUCUCGCCGUUG CACUAAAUCUGUGACUUCGGUCGUCUCAACCUUGUUUUACGACAAAAAAAUGAGAACGA CGAAUCCGAAAGAGACUAAGAUUGUGAUUGACACUACCGGCAGUACCAAACCUAAGCAG GACGAUCUCAUUCUCACUUGUUUCAGAGGGUGGGUGAAGCAGUUGCAAAUAGAUUACA AAGGCAACGAAAUAAUGACGGCAGCUGCCUCUCAAGGGCUGACCCGUAAAGGUGUGUA UGCCGUUCGGUACAAGGUGAAUGAAAAUCCUCUGUACGCACCCACCUCAGAACAUGUGA ACGUCCUACUGACCCGCACGGAGGACCGCAUCGUGUGGAAAACACUAGCCGGCGACCC AUGGAUAAAAACACUGACUGCCAAGUACCCUGGGAAUUUCACUGCCACGAUAGAGGAGU GGCAAGCAGAGCAUGAUGCCAUCAUGAGGCACAUCUUGGAGAGACCGGACCCUACCGA CGUCUUCCAGAAUAAGGCAAACGUGUGUUGGGCCAAGGCUUUAGUGCCGGUGCUGAAG ACCGCUGGCAUAGACAUGACCACUGAACAAUGGAACACUGUGGAUUAUUUUGAAACGGA CAAAGCUCACUCAGCAGAGAUAGUAUUGAACCAACUAUGCGUGAGGUUCUUUGGACUC GAUCUGGACUCCGGUCUAUUUUCUGCACCCACUGUUCCGUUAUCCAUUAGGAAUAAUC ACUGGGAUAACUCCCCGUCGCCUAACAUGUACGGGCUGAAUAAAGAAGUGGUCCGUCA GCUCUCUCGCAGGUACCCACAACUGCCUCGGGCAGUUGCCACUGGAAGAGUCUAUGAC AUGAACACUGGUACACUGCGCAAUUAUGAUCCGCGCAUAAACCUAGUACCUGUAAACAG AAGACUGCCUCAUGCUUUAGUCCUCCACCAUAAUGAACACCCACAGAGUGACUUUUCUU CAUUCGUCAGCAAAUUGAAGGGCAGAACUGUCCUGGUGGUCGGGGAAAAGUUGUCCGU CCCAGGCAAAAUGGUUGACUGGUUGUCAGACCGGCCUGAGGCUACCUUCAGAGCUCGG CUGGAUUUAGGCAUCCCAGGUGAUGUGCCCAAAUAUGACAUAAUAUUUGUUAAUGUGA GGACCCCAUAUAAAUACCAUCACUAUCAGCAGUGUGAAGACCAUGCCAUUAAGCUUAGC AUGUUGACCAAGAAAGCUUGUCUGCAUCUGAAUCCCGGCGGAACCUGUGUCAGCAUAG GUUAUGGUUACGCUGACAGGGCCAGCGAAAGCAUCAUUGGUGCUAUAGCGCGGCAGUU CAAGUUUUCCCGGGUAUGCAAACCGAAAUCCUCACUUGAAGAGACGGAAGUUCUGUUU GUAUUCAUUGGGUACGAUCGCAAGGCCCGUACGCACAAUCCUUACAAGCUUUCAUCAAC CUUGACCAACAUUUAUACAGGUUCCAGACUCCACGAAGCCGGAUGU SEQ ID NO: 57 (NSP3 RNA) GCACCCUCAUAUCAUGUGGUGCGAGGGGAUAUUGCCACGGCCACCGAAGGAGUGAUUA UAAAUGCUGCUAACAGCAAAGGACAACCUGGCGGAGGGGUGUGCGGAGCGCUGUAUAA GAAAUUCCCGGAAAGCUUCGAUUUACAGCCGAUCGAAGUAGGAAAAGCGCGACUGGUC AAAGGUGCAGCUAAACAUAUCAUUCAUGCCGUAGGACCAAACUUCAACAAAGUUUCGGA GGUUGAAGGUGACAAACAGUUGGCAGAGGCUUAUGAGUCCAUCGCUAAGAUUGUCAAC GAUAACAAUUACAAGUCAGUAGCGAUUCCACUGUUGUCCACCGGCAUCUUUUCCGGGAA CAAAGAUCGACUAACCCAAUCAUUGAACCAUUUGCUGACAGCUUUAGACACCACUGAUG CAGAUGUAGCCAUAUACUGCAGGGACAAGAAAUGGGAAAUGACUCUCAAGGAAGCAGUG GCUAGGAGAGAAGCAGUGGAGGAGAUAUGCAUAUCCGACGACUCUUCAGUGACAGAAC CUGAUGCAGAGCUGGUGAGGGUGCAUCCGAAGAGUUCUUUGGCUGGAAGGAAGGGCU ACAGCACAAGCGAUGGCAAAACUUUCUCAUAUUUGGAAGGGACCAAGUUUCACCAGGCG GCCAAGGAUAUAGCAGAAAUUAAUGCCAUGUGGCCCGUUGCAACGGAGGCCAAUGAGC AGGUAUGCAUGUAUAUCCUCGGAGAAAGCAUGAGCAGUAUUAGGUCGAAAUGCCCCGU CGAAGAGUCGGAAGCCUCCACACCACCUAGCACGCUGCCUUGCUUGUGCAUCCAUGCC AUGACUCCAGAAAGAGUACAGCGCCUAAAAGCCUCACGUCCAGAACAAAUUACUGUGUG CUCAUCCUUUCCAUUGCCGAAGUAUAGAAUCACUGGUGUGCAGAAGAUCCAAUGCUCCC AGCCUAUAUUGUUCUCACCGAAAGUGCCUGCGUAUAUUCAUCCAAGGAAGUAUCUCGU GGAAACACCACCGGUAGACGAGACUCCGGAGCCAUCGGCAGAGAACCAAUCCACAGAG GGGACACCUGAACAACCACCACUUAUAACCGAGGAUGAGACCAGGACUAGAACGCCUGA GCCGAUCAUCAUCGAAGAGGAAGAAGAGGAUAGCAUAAGUUUGCUGUCAGAUGGCCCG ACCCACCAGGUGCUGCAAGUCGAGGCAGACAUUCACGGGCCGCCCUCUGUAUCUAGCU CAUCCUGGUCCAUUCCUCAUGCAUCCGACUUUGAUGUGGACAGUUUAUCCAUACUUGA CACCCUGGAGGGAGCUAGCGUGACCAGCGGGGCAACGUCAGCCGAGACUAACUCUUAC UUCGCAAAGAGUAUGGAGUUUCUGGCGCGACCGGUGCCUGCGCCUCGAACAGUAUUCA GGAACCCUCCACAUCCCGCUCCGCGCACAAGAACACCGUCACUUGCACCCAGCAGGGC CUGCUCGAGAACCAGCCUAGUUUCCACCCCGCCAGGCGUGAAUAGGGUGAUCACUAGA GAGGAGCUCGAGGCGCUUACCCCGUCACGCACUCCUAGCAGGUCGGUCUCGAGAACCA GCCUGGUCUCCAACCCGCCAGGCGUAAAUAGGGUGAUUACAAGAGAGGAGUUUGAGGC GUUCGUAGCACAACAACAAUGACGGUUUGAUGCGGGUGCA SEQ ID NO: 58 (NSP4 RNA) UACAUCUUUUCCUCCGACACCGGUCAAGGGCAUUUACAACAAAAAUCAGUAAGGCAAAC GGUGCUAUCCGAAGUGGUGUUGGAGAGGACCGAAUUGGAGAUUUCGUAUGCCCCGCG CCUCGACCAAGAAAAAGAAGAAUUACUACGCAAGAAAUUACAGUUAAAUCCCACACCUGC UAACAGAAGCAGAUACCAGUCCAGGAAGGUGGAGAACAUGAAAGCCAUAACAGCUAGAC GUAUUCUGCAAGGCCUAGGGCAUUAUUUGAAGGCAGAAGGAAAAGUGGAGUGCUACCG AACCCUGCAUCCUGUUCCUUUGUAUUCAUCUAGUGUGAACCGUGCCUUUUCAAGCCCC AAGGUCGCAGUGGAAGCCUGUAACGCCAUGUUGAAAGAGAACUUUCCGACUGUGGCUU CUUACUGUAUUAUUCCAGAGUACGAUGCCUAUUUGGACAUGGUUGACGGAGCUUCAUG CUGCUUAGACACUGCCAGUUUUUGCCCUGCAAAGCUGCGCAGCUUUCCAAAGAAACACU CCUAUUUGGAACCCACAAUACGAUCGGCAGUGCCUUCAGCGAUCCAGAACACGCUCCAG AACGUCCUGGCAGCUGCCACAAAAAGAAAUUGCAAUGUCACGCAAAUGAGAGAAUUGCC CGUAUUGGAUUCGGCGGCCUUUAAUGUGGAAUGCUUCAAGAAAUAUGCGUGUAAUAAU GAAUAUUGGGAAACGUUUAAAGAAAACCCCAUCAGGCUUACUGAAGAAAACGUGGUAAA UUACAUUACCAAAUUAAAAGGACCAAAAGCUGCUGCUCUUUUUGCGAAGACACAUAAUU UGAAUAUGUUGCAGGACAUACCAAUGGACAGGUUUGUAAUGGACUUAAAGAGAGACGU GAAAGUGACUCCAGGAACAAAACAUACUGAAGAACGGCCCAAGGUACAGGUGAUCCAGG CUGCCGAUCCGCUAGCAACAGCGUAUCUGUGCGGAAUCCACCGAGAGCUGGUUAGGAG AUUAAAUGCGGUCCUGCUUCCGAACAUUCAUACACUGUUUGAUAUGUCGGCUGAAGAC UUUGACGCUAUUAUAGCCGAGCACUUCCAGCCUGGGGAUUGUGUUCUGGAAACUGACA UCGCGUCGUUUGAUAAAAGUGAGGACGACGCCAUGGCUCUGACCGCGUUAAUGAUUCU GGAAGACUUAGGUGUGGACGCAGAGCUGUUGACGCUGAUUGAGGCGGCUUUCGGCGA AAUUUCAUCAAUACAUUUGCCCACUAAAACUAAAUUUAAAUUCGGAGCCAUGAUGAAAUC UGGAAUGUUCCUCACACUGUUUGUGAACACAGUCAUUAACAUUGUAAUCGCAAGCAGAG UGUUGAGAGAACGGCUAACCGGAUCACCAUGUGCAGCAUUCAUUGGAGAUGACAAUAU CGUGAAAGGAGUCAAAUCGGACAAAUUAAUGGCAGACAGGUGCGCCACCUGGUUGAAU AUGGAAGUCAAGAUUAUAGAUGCUGUGGUGGGCGAGAAAGCGCCUUAUUUCUGUGGAG GGUUUAUUUUGUGUGACUCCGUGACCGGCACAGCGUGCCGUGUGGCAGACCCCCUAAA AAGGCUGUUUAAGCUUGGCAAACCUCUGGCAGCAGACGAUGAACAUGAUGAUGACAGG AGAAGGGCAUUGCAUGAAGAGUCAACACGCUGGAACCGAGUGGGUAUUCUUUCAGAGC UGUGCAAGGCAGUAGAAUCAAGGUAUGAAACCGUAGGAACUUCCAUCAUAGUUAUGGCC AUGACUACUCUAGCUAGCAGUGUUAAAUCAUUCAGCUACCUGAGAGGGGCCCCUAUAAC UCUCUACGGCUAA. IV. RNA TRANSCRIPTION In some aspects, the RNA disclosed herein is produced by in vitro transcription or chemical synthesis. In the context of the present disclosure, the term “transcription” relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA may be translated into peptide or protein. According to the present disclosure, “transcription” comprises “in vitro transcription” or “IVT,” which refers to the process whereby transcription occurs in vitro in a non-cellular system to produce a synthetic RNA product for use in various applications, including, e.g., production of protein or polypeptides. The methodology for in vitro transcription of mRNA is well known in the art. (see, e.g., Losick, R.1972. In vitro transcription, Ann Rev Biochem, 41409-46; Kamakaka, R. T. and Kraus, W. L. 2001. In vitro Transcription, Current Protocols in Cell Biology, 2:11.6:11.6.1-11.6.17; Beckert, B. And Masquida, B. 2010. Synthesis of RNA by In vitro Transcription in RNA, Methods in Molecular Biology, 703 (Neilson, H. Ed), New York, N.Y. Humana Press, 2010; Brunelle, J.L. and Green, R., 2013, Chapter Five – In vitro transcription from plasmid or PCR-amplified DNA, Methods in Enzymology 530:101-114; all of which are incorporated herein by reference). Cloning vectors may be applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are according to the present invention encompassed by the term “vector.” According to specific aspects, the RNA used is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template. Template DNA can be prepared for in vitro transcription from a number of sources with appropriate techniques which are well known in the art including, but not limited to, plasmid DNA and polymerase chain reaction amplification (see Linpinsel, J.L and Conn, G.L., General protocols for preparation of plasmid DNA template, and Bowman, J.C., Azizi, B., Lenz, T.K., Ray, P., and Williams, L.D. in RNA in vitro transcription and RNA purification by denaturing PAGE in Recombinant and in vitro RNA syntheses, Methods 941 Conn G.L. (ed), New York, N.Y. Humana Press, 2012, each incorporated herein by reference). The promoter for controlling transcription may be any promoter for any RNA polymerase. Particular examples of RNA polymerases are the T7, T3, and SP6 RNA polymerases. Preferably, the in vitro transcription according to the invention is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA. Synthetic IVT RNA products may be translated in vitro or introduced directly into cells, where they may be translated. With respect to RNA, the term “expression” or “translation” relates to the process in the ribosomes of a cell by which a strand of mRNA directs the assembly of a sequence of amino acids to make a peptide or protein. Such synthetic RNA products include but are not limited to, e.g., mRNA molecules, saRNA molecules, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNA molecules (e.g., for CRISPR), ribosomal RNA molecules, small nuclear RNA molecules, small nucleolar RNA molecules, and the like. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing synthetic RNA products may be excluded. An IVT reaction typically utilizes a DNA template (e.g., a linear DNA template) as described and / or utilized herein, ribonucleotides (e.g., non-modified ribonucleotide triphosphates or modified ribonucleotide triphosphates), and an appropriate RNA polymerase. In some aspects, an mRNA is produced by in vitro transcription using a DNA template where DNA refers to a nucleic acid that contains deoxyribonucleotides. In some aspects, an RNA disclosed herein is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription may be any promoter for any RNA polymerase. A DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA. In some aspects, starting material for IVT may include linearized DNA template, nucleotides, Rnase inhibitor, pyrophosphatase, and / or a polymerase (e.g., a T7 RNA polymerase). The nucleotides may be manufactured in house, may be obtained from a supplier, or may be synthesized. The nucleotides may be, but are not limited to, those described herein including natural and unnatural (modified) nucleotides. Any number of RNA polymerases or variants may be used, including, but not limited to, a phage RNA polymerase, e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, and / or mutant polymerases such as, but not limited to, polymerases able to incorporate modified nucleic acids and / or modified nucleotides, including chemically modified nucleic acids and / or nucleotides. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing RNA polymerases may be excluded from. Some embodiments exclude the use of Dnase. In some aspects, the IVT process is conducted in a bioreactor. The bioreactor may comprise a mixer. In some aspects, nucleotides may be added into the bioreactor throughout the IVT process. In some aspects, one or more post-IVT agents are added into the IVT mixture comprising RNA in the bioreactor after the IVT process. Exemplary post-IVT agents may include DNAse I configured to digest the linearized DNA template and / or proteinase K configured to digest DNAse I and T7 RNA polymerase. In some aspects, the post-IVT agents are incubated with the mixture in the bioreactor after IVT. In some aspects, the bioreactor may contain at least, at most, exactly, or between (inclusive or exclusive) any two of 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 ,160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500 or more liters IVT mixture. The IVT mixture may have an RNA concentration that is or is not at least, at most, exactly, or between (inclusive or exclusive) any two of 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL or more RNA. In some aspects, the IVT mixture may include residual spermidine, residual DNA, residual proteins, peptides, HEPES, EDTA, ammonium sulfate, cations (e.g., Mg2+, Na+, Ca2+), RNA fragments, residual nucleotides, free phosphates, or any combinations thereof. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing can be excluded from the IVT mixture. Isolation and / or purification of the nucleic acids described herein may include, but is not limited to, phenol / chloroform extraction and / or precipitation with either alcohol (ethanol, isopropanol) in the presence of monovalent cations or lithium chloride for nucleic acid clean-up, quality assurance and quality control. Additional, non-limiting examples of purification procedures include AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark), HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), size exclusion chromatography, and silica-based affinity chromatography and polyacrylamide gel electrophoresis. Purification can be performed using a variety of commercially available kits including, but not limited to SV Total Isolation System (Promega) and In vitro Transcription Cleanup and Concentration Kit (Norgen Biotek). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing purification may be excluded. The term “purified” when used in relation to a nucleic acid such as a “purified nucleic acid” refers to one that is separated from at least one contaminant. A “contaminant” is any substance that makes another unfit, impure or inferior. Thus, a purified nucleic acid (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment and / or purification method. In some aspects, at least a portion of the IVT mixture is filtered. The IVT mixture may be filtered via ultrafiltration and / or diafiltration to remove at least some impurities from the IVT mixture and / or to change buffer solution for the at least a portion of IVT mixture to produce a concentrated RNA solution as a retentate. In some aspects, both “ultrafiltration” and “diafiltration” refer to a membrane filtration process. Ultrafiltration typically uses membranes having pore sizes of at least, at most, exactly, or between (inclusive or exclusive) any two of 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1 µm. In some aspects, ultrafiltration membranes are typically classified by molecular weight cutoff (MWCO) rather than pore size. For example, the MWCO may be at least, at most, exactly, or between (inclusive or exclusive) any two of 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 110 kDa, 120 kDa, 130 kDa, 140 kDa, 150 kDa, 160 kDa, 170 kDa, 180 kDa, 190 kDa, 200 kDa, 210 kDa, 220 kDa, 230 kDa, 240 kDa, 250 kDa, 260 kDa, 270 kDa, 280 kDa, 290 kDa, 300 kDa, 310 kDa, 320 kDa, 330 kDa, 340 kDa, 350 kDa, 360 kDa, 370 kDa, 380 kDa, 390 kDa, 400 kDa, 500 kDa, 600 kDa, 700 kDa, 800 kDa, 900 kDa, 1000 kDa, 2000 kDa, 3000 kDa, 4000 kDa, 5000 kDa, 6000 kDa, 7000 kDa, 8000 kDa, 9000 kDa, and 10000 kDa. A skilled artisan will understand that filtration membranes may comprise different suitable materials, including, e.g., polymers, cellulose, ceramic, etc., depending upon the application. In some aspects, membrane filtration may be more desirable for large volume purification process. In some aspects, ultrafiltration and diafiltration of the IVT mixture for purifying RNA may include (1) Direct Flow Filtration (DFF), also known as “dead-end” filtration, that applies a feed stream perpendicular to the membrane face and attempts to pass 100% of the fluid through the membrane, and / or (2) Tangential Flow Filtration (TFF), also known as crossflow filtration, where a feed stream passes parallel to the membrane face as one portion passes through the membrane (permeate) while the remainder (retentate) is retained and / or recirculated back to the feed tank. In some aspects, the filtering of the IVT mixture is conducted via TFF comprising an ultrafiltration step, a first diafiltration step, and a second diafiltration step. In some aspects, the first diafiltration step is conducted in the presence of ammonium sulfate. The first diafiltration step may be configured to remove a majority of impurities from the IVT mixture. In some aspects, the second diafiltration step is conducted without ammonium sulfate. The second diafiltration step may be configured to transfer the RNA into a DS buffer formulation. A filtration membrane with an appropriate MWCO may be selected for ultrafiltration in the TFF process. The MWCO of a TFF membrane determines which solutes may pass through the membrane into the filtrate and which are retained in the retentate. The MWCO of a TFF membrane may be selected such that substantially all of the solutes of interest (e.g., desired synthesized RNA species) remain in the retentate, whereas undesired components (e.g., excess ribonucleotides, small nucleic acid fragments such as digested or hydrolyzed DNA template, peptide fragments such as digested proteins and / or other impurities) pass into the filtrate. In some aspects, the retentate comprising desired synthesized RNA species may be re-circulated to a feed reservoir to be re-filtered in additional cycles. In some aspects, a TFF membrane may have a MWCO of at least, at most, exactly, or between (inclusive or exclusive) any two of 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, or more. In some aspects, a TFF membrane may have a MWCO of at least, at most, exactly, or between (inclusive or exclusive) any two of 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, or more. In some aspects, a TFF membrane may have a MWCO of or of about 250-350 kDa. In some aspects, a TFF membrane (e.g., a cellulose-based membrane) may have a MWCO of or of about 30-300 kDa; 50-300 kDa, 100-300 kDa, or 200-300 kDa. Diafiltration may be performed either discontinuously, or alternatively, continuously. For example, in continuous diafiltration, a diafiltration solution may be added to a sample feed reservoir at the same rate as filtrate is generated. In this way, the volume in the sample reservoir remains constant but small molecules (e.g., salts, solvents, etc.) that may freely permeate through a membrane are removed. Using solvent removal as an example, each additional diafiltration volume (DV) reduces the solvent concentration further. In discontinuous diafiltration, a solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g., salts, solvents, etc.) remaining in the reservoir is reached. Each additional diafiltration volume (DV) reduces the small molecule (e.g., solvent) concentration further. Continuous diafiltration typically requires a minimum volume for a given reduction of molecules to be filtered. Discontinuous diafiltration, on the other hand, permits fast changes of the retentate condition, such as pH, salt content, and the like. In some aspects, the first diafiltration step is conducted with at least, at most, exactly, or between (inclusive or exclusive) any two of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more diavolumes. In some aspects, the second diafiltration step is conducted with at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more diavolumes. In some aspects, the first diafiltration step is conducted with 5 diavolumes, and second diafiltration step is conducted with 10 diavolumes. In some aspects, for ultrafiltration and / or diafiltration, the IVT mixture is filtered at a rate of at least, at most, exactly, or between (inclusive or exclusive) any two of 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m2of filter area per hour, or more. The concentrated RNA solution may comprise at least, at most, exactly, or between (inclusive or exclusive) any two of 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL single stranded RNA. The bioburden of the concentrated RNA solution via filtration to obtain an RNA product solution may also be reduced, in some aspects. The filtration for reducing bioburden may be conducted using one or more filters. The one or more filters may include a filter with a pore size that is or is not at least, at most, exactly, or between (inclusive or exclusive) any two of 0.2 µm, 0.45 µm, 0.65 µm, 0.8 µm, or any other pore size configured to remove bioburdens. As one example, reducing the bioburden may include draining a retentate tank containing retentate obtained from the ultrafiltration and / or diafiltration to obtain the retentate. Reducing the bioburden may include flushing a filtration system for ultrafiltration and / or diafiltration using a wash buffer solution to obtain a wash pool solution comprising residue RNA remaining in the filtration system. The retentate may be filtered to obtain a filtered retentate. The wash pool solution may be filtered using a first 0.2 µm filter to obtain a filtered wash pool solution. The retentate may be filtered using the first 0.2 µm filter or another 0.2 µm filter. The filtered wash pool solution and the filtered retentate may be combined to form a combined pool solution. The combined pool solution may be filtered using a second 0.2 µm filter to obtain a filtered combined pool solution, which is further filtered using a third 0.2 µm filter to produce an RNA product solution. A quality assurance and / or quality control check may be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, and / or analytical HPLC. In some aspects, the nucleic acids may be sequenced by methods including, but not limited to reverse-transcriptase-PCR. In some aspects, the nucleic acid may be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acid may be analyzed in order to determine if the nucleic acid may be of proper size and / or to assess degradation. Degradation of the nucleic acid may be assessed by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE). In some aspects, 1, 2, 3, 4, 5, or more of the foregoing assessment methods may be excluded. V. RNA ENCAPSULATION The RNA in an RNA product solution may be encapsulated, and the RNA solution may further comprise at least one encapsulating agent. In one aspect, the encapsulating agent comprises a lipid, a lipid nanoparticle (LNP), lipoplexes, polymeric particles, polyplexes, monolithic delivery systems, or a combination thereof. In some aspects, 1, 2, 3, 4, 5, or more of the foregoing elements may be excluded as an encapsulating agent. In one aspect, the encapsulating agent is a lipid, and produced is lipid nanoparticle (LNP)- encapsulated RNA. Without intending to be bound by any theory, it is believed that the cationic or cationically ionizable lipid or lipid-like material and / or the cationic polymer combine together with the nucleic acid to form aggregates, and this aggregation results in colloidally stable particles. A lipid may be a naturally occurring lipid or a synthetic lipid. However, a lipid is usually a biological substance. Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glucolipids, sulphatides, lipids with ether and ester-linked fatty acids and polymerizable lipids, and combinations thereof. A lipid is a substance that is insoluble in water and extractable with an organic solvent. Compounds other than those specifically described herein are understood by one of skill in the art as lipids and are encompassed by the compositions and methods of the present disclosure. A lipid component and a non-lipid may be attached to one another, either covalently or non-covalently. In some aspects, LNPs may be designed to protect RNA molecules (e.g., saRNA, mRNA) from extracellular Rnases and / or may be engineered for systemic delivery of the RNA to target cells. In some aspects, such LNPs may be particularly useful to deliver RNA molecules (e.g., saRNA, mRNA) when RNA molecules are intravenously administered to a subject in need thereof. In some aspects, such LNPs may be particularly useful to deliver RNA molecules (e.g., saRNA, mRNA) when RNA molecules are intramuscularly administered to a subject in need thereof. In some aspects, such LNPs may be particularly useful to deliver RNA molecules (e.g., saRNA, mRNA) when RNA molecules are intradermally administered to a subject in need thereof. In some aspects, such LNPs may be particularly useful to deliver RNA molecules (e.g., saRNA, mRNA) when RNA molecules are intranasally administered to a subject in need thereof. In one aspect, the RNA in the RNA product solution is at a concentration of < 1 mg / mL. In another aspect, the RNA is at a concentration of at least or at least about 0.05 mg / mL. In another aspect, the RNA is at a concentration of at least or at least about 0.5 mg / mL. In another aspect, the RNA is at a concentration of at least or at least about 1 mg / mL. In another aspect, the RNA concentration is from or from about 0.05 mg / mL to about 0.5 mg / mL. In another aspect, the RNA is at a concentration of at least 10 mg / mL. In another aspect, the RNA is at a concentration of at least 50 mg / mL. In some aspects, the RNA is or is not at a concentration of at least, at most, exactly, between (inclusive or exclusive) any two of, or about 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or more. The present disclosure provides for an RNA product solution and a lipid preparation mixture or compositions thereof comprising at least one RNA encoding, e.g., an antigen (e.g., an RSV prefusion F protein) complexed with, encapsulated in, and / or formulated with one or more lipids, and forming lipid nanoparticles (LNPs), liposomes, lipoplexes and / or nanoliposomes. In some aspects, the composition comprises a lipid nanoparticle. A lipid nanoparticle or LNP refers to particles of any morphology generated when a cationic lipid and optionally one or more further lipids are combined, e.g., in an aqueous environment and / or in the presence of RNA. In some aspects, lipid nanoparticles are included in a formulation that may be used to deliver an active agent or therapeutic agent, such as a nucleic acid (e.g., mRNA) to a target site of interest (e.g., cell, tissue, organ, tumor, and the like). In some aspects, the lipid nanoparticles of the present disclosure comprise a nucleic acid (e.g., mRNA). Such lipid nanoparticles typically comprise a cationic lipid and one or more excipients, e.g., one or more neutral lipids, charged lipids, steroids, polymer conjugated lipids, or combinations thereof. In some aspects, the LNPs comprise at least one cationic (e.g., ionizable) lipid, at least one neutral (e.g., non-cationic) lipid, at least one structural lipid (e.g., a steroid), and / or at least one polymer conjugated lipid (e.g., a polyethylene glycol (PEG)-modified lipid). In some aspects, 1, 2, 3, or more of the foregoing excipients may be excluded from the LNPs. In some aspects, the LNPs comprise 20-60 mol% cationic (e.g., ionizable) lipid(s). For example, the LNPs may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% cationic (e.g., ionizable) lipid(s). In some aspects, the LNPs comprise or do not comprise at least, at most, exactly, or between (inclusive or exclusive) any two of 20 mol%, 30 mol%, 40 mol%, 50, or 60 mol% cationic (e.g., ionizable) lipid(s). In some aspects, the LNPs comprise 45 to 55 mole percent (mol%) cationic (e.g., ionizable) lipid(s). For example, LNPs may comprise or not comprise at least, at most, exactly, or between (inclusive or exclusive) any two of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% cationic (e.g., ionizable) lipid(s). In some aspects, the LNPs comprise 5-25 mol% neutral (e.g., non-cationic) lipid(s). For example, the LNPs may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% neutral (e.g., non-cationic) lipid(s). In some aspects, the LNPs are or are not at least, at most, exactly, or between (inclusive or exclusive) any two of 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% neutral (e.g., non- cationic) lipid(s). In some aspects, the LNPs comprise 5 to 15 mol% neutral (e.g., non-cationic) lipid(s). For example, LNPs may comprise at least, at most, exactly, or between (inclusive or exclusive) any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% neutral (e.g., non-cationic) lipid(s). In some aspects, the LNPs comprise 25-55 mol% structural lipid(s) (e.g., a steroid). For example, the LNPs may comprise 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% structural lipid(s) (e.g., a steroid). In some aspects, the LNPs are or are not at least, at most, exactly, or between (inclusive or exclusive) any two of 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% structural lipid(s) (e.g., a steroid). In some aspects, the LNPs comprise 35 to 40 mol% structural lipid(s) (e.g., a steroid). For example, LNPs may comprise at least, at most, exactly, or between (inclusive or exclusive) any two of 35, 36, 37, 38, 39, or 40 mol% structural lipid(s) (e.g., a steroid). In some aspects, the LNPs comprise 0.5-15 mol% polymer conjugated lipid(s) (e.g., a polyethylene glycol (PEG)-modified lipid). For example, the lipid nanoparticle may comprise 0.5- 10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5- 15 mol%, 5-10 mol%, or 10-15 mol% polymer conjugated lipid(s) (e.g., a polyethylene glycol (PEG)-modified lipid). In some aspects, the lipid LNPs are or are not at least, at most, exactly, or between (inclusive or exclusive) any two of 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% polymer conjugated lipid(s) (e.g., a polyethylene glycol (PEG)-modified lipid). In some aspects, the LNPs comprise 1 to 2 mol% polymer conjugated lipid(s) (e.g., a polyethylene glycol (PEG)- modified lipid). For example, LNPs may comprise at least, at most, exactly, or between (inclusive or exclusive) any two of 1, 1.5, or 2 mol% polymer conjugated lipid(s) (e.g., a polyethylene glycol (PEG)-modified lipid). In some aspects, the LNPs comprise 20-75 mol% cationic (e.g., ionizable) lipid(s) (e.g., at least, at most, exactly, or between (inclusive or exclusive) any two of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, and 75%), 0.5-25 mol% neutral (e.g., non-cationic) lipid(s) (e.g., at least, at most, exactly, or between (inclusive or exclusive) of 0.5%, 2.25%, 4%, 5.75%, 7.5%, 9.25%, 11%, 12.75%, 14.5%, 16.25%, 18%, 19.75%, 21.5%, 23.25%, and 25%), 5-55 mol% structural lipid(s) (e.g., a sterol) e.g., non-cationic) lipid(s) (e.g., at least, at most, exactly, or between (inclusive or exclusive) of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, and 55%), and 0.5-20 mol% polymer conjugated lipid(s) (e.g., a polyethylene glycol (PEG)- modified lipid) (e.g., at least, at most, exactly, or between (inclusive or exclusive) of 0.5%, 2%, 3.5%, 5%, 6.5%, 8%, 9.5%, 11%, 12.5%, 14%, 15.5%, 17%, 18.5%, and 20%). In some aspects, 1, 2, 3, or more of the lipids may be excluded from the LNPs. In some non-limiting aspects, the molar lipid ratio is 50 / 10 / 38.5 / 1.5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 60 / 7.5 / 31 / 1.5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 57.5 / 7.5 / 31.5 / 3.5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 57.2 / 7.1 / 34.3 / 1.4 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 40 / 15 / 40 / 5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 50 / 10 / 35 / 4.5 / 0.5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 50 / 10 / 35 / 5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 40 / 10 / 40 / 10 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), 35 / 15 / 40 / 10 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid), or 52 / 13 / 30 / 5 (mol% cationic lipid / neutral lipid / structural lipid / polymer conjugated lipid). In some aspects, the active agent or therapeutic agent, such as a nucleic acid (e.g., mRNA), may be encapsulated in the lipid portion of the lipid nanoparticle and / or an aqueous space enveloped by some or all of the lipid portion of the lipid nanoparticle, thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cells, e.g., an adverse immune response. The nucleic acid (e.g., mRNA) or a portion thereof may also be associated and complexed with the lipid nanoparticle. A lipid nanoparticle may comprise any lipid capable of forming a particle to which the nucleic acids are attached, and / or in which the one or more nucleic acids are encapsulated. In some aspects, provided RNA molecules (e.g., saRNA, mRNA) may be formulated with LNPs. In some aspects, the lipid nanoparticles may or may not have a mean diameter of or of about 1 to 500 nm (e.g., at least, at most, exactly, or between (inclusive or exclusive) of 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 nm). In some aspects, the lipid nanoparticles have a mean diameter of or of from about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or at least, at most, exactly, or between (inclusive or exclusive) of 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, and are substantially non-toxic. The term “mean diameter” refers to the mean hydrodynamic diameter of particles as measured by dynamic laser light scattering (DLS) with data analysis using the so-called cumulant algorithm, which provides as results the so-called Z-average with the dimension of a length, and the polydispersity index (PI), which is dimensionless (Koppel, D., J. Chem. Phys.57, 1972, pp 4814- 4820, ISO 13321). Here, “mean diameter,” “diameter,” or “size” for particles is used synonymously with the value of the Z-average. LNPs described herein may exhibit a polydispersity index less than or less than about 0.5, 0.4, 0.3, or 0.2 or less. By way of example, the LNPs may or may not exhibit a polydispersity index of at least, at most, exactly, or between (inclusive or exclusive) of 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5. The polydispersity index is, in some aspects, calculated based on dynamic light scattering measurements by the so-called cumulant analysis referred to in the definition of “average diameter.” Under certain prerequisites, it may be taken as a measure of the size distribution of an ensemble of nanoparticles. In some aspects, an LNP of the disclosure comprises or does not comprise an N:P ratio of or of from about 2:1 to about 30:1, e.g., at least, at most, exactly, or between (inclusive or exclusive) of 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, or 30:1. In some aspects, an LNP of the disclosure comprises an N:P ratio of or of about 6:1. In some aspects, an LNP of the disclosure comprises an N:P ratio of or of about 3:1. In some aspects, an LNP of the disclosure comprises or does not comprise a wt / wt ratio of the cationic lipid component to the RNA of or of from about 5:1 to about 100:1, e.g., at least, at most, exactly, or between (inclusive or exclusive) of 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1, 60:1, 61:1, 62:1, 63:1, 64:1, 65:1, 66:1, 67:1, 68:1, 69:1, 70:1, 71:1, 72:1, 73:1, 74:1, 75:1, 76:1, 77:1, 78:1, 79:1, 80:1, 81:1, 82:1, 83:1, 84:1, 85:1, 86:1, 87:1, 88:1, 89:1, 90:1, 91:1, 92:1, 93:1, 94:1, 95:1, 96:1, 97:1, 98:1, 99:1, or 100:1. In some aspects, an LNP of the disclosure comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of or of about 20:1. In some aspects, an LNP of the disclosure comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of or of about 10:1. In certain aspects, nucleic acids (e.g., RNA molecules), when present in provided LNPs, are resistant in aqueous solution to degradation with a nuclease. In some aspects, LNPs are liver- targeting lipid nanoparticles. In some aspects, LNPs are cationic lipid nanoparticles comprising one or more cationic lipids (e.g., those described herein). In some aspects, cationic LNPs may comprise at least one cationic lipid, at least one polymer conjugated lipid, and at least one helper lipid (e.g., at least one neutral lipid). In certain aspects, the RNA solution and lipid preparation mixture or compositions thereof may have at least, at most, exactly, between (inclusive or exclusive) of, or about 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of a particular lipid, lipid type, or non- lipid component such as lipid-like materials and / or cationic polymers and / or an adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid or other material disclosed herein or as would be known to one of skill in the art. LNPs described herein can be generated using components, compositions, and methods as are generally known in the art, see, , e.g., PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US2016 / 014280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 52117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575 and PCT / US2016 / 069491 all of which are incorporated by reference herein in their entirety. Other non-limiting examples of methods for preparing LNPs can be found in, e.g., WO 2022 / 032154, the disclosure of which is incorporated by reference herein in its entirety. For example, methods of preparing LNPs may involve obtaining a colloid from at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer and mixing the colloid with nucleic acid to obtain nucleic acid particles. The term “colloid” as used herein relates to a type of homogeneous mixture in which dispersed particles do not settle out. The insoluble particles in the mixture are microscopic, with particle sizes between 1 and 1000 nanometers. The mixture may be termed a colloid or a colloidal suspension. Sometimes the term “colloid” refers only to the particles in the mixture and not the entire suspension. For the preparation of colloids comprising at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer, methods are applicable herein that are conventionally used for preparing liposomal vesicles and are appropriately adapted. The most commonly used methods for preparing liposomal vesicles share the following fundamental stages: (i) lipids dissolution in organic solvents, (ii) drying of the resultant solution, and (iii) hydration of dried lipid (using various aqueous media). In the film hydration method, lipids are first dissolved in a suitable organic solvent and dried down to yield a thin film at the bottom of the flask. The obtained lipid film is hydrated using an appropriate aqueous medium to produce a liposomal dispersion. Furthermore, an additional downsizing step may be included. Reverse phase evaporation is an alternative method to film hydration for preparing liposomal vesicles that involves formation of a water-in-oil emulsion between an aqueous phase and an organic phase containing lipids. A brief sonication of this mixt...

Claims

CLAIMS 1. An RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) fusion protein F (F) polypeptide.

2. The RNA molecule of claim 1, wherein the RSV polypeptide is a full-length, truncated, fragment or variant thereof.

3. The RNA molecule of claim 1, wherein the RSV polypeptide comprises at least one mutation.

4. The RNA molecule of claim 1, wherein the RSV polypeptide has at least 90%, 95, 96%, 97%, 98% or 99% identity to the amino acid sequence selected from SEQ ID NO: 1 to 6 and 71 to 74.

5. The RNA molecule of claim 1, wherein the open reading frame is transcribed from a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences of SEQ ID NOs: 7 to 10 and 59 to 62.

6. The RNA molecule of claim 1, wherein the open reading frame comprises a nucleic acid sequence having at least 90%, 95, 96%, 97%, 98%, or 99% identity to any one of the sequences of SEQ ID NOs: 11 to 16 and 63 to 70.

7. The RNA molecule of claim 1, wherein the open reading frame comprises a nucleic acid sequence of any one of SEQ ID NOs: 11 to 16 and 63 to 70.

8. The RNA molecule of claim 1, further comprising a 5’ untranslated region (5’ UTR).

9. The RNA molecule of claim 8, wherein the 5’ UTR comprises a sequence selected from any of SEQ ID NO: 17 to 19.

10. The RNA molecule of claim 1, further comprising a 3’ untranslated region (3’ UTR).

11. The RNA molecule of claim 10, wherein the 3’ UTR comprises the sequence of any one of SEQ ID NO: 20 to 25.

12. The RNA molecule of claim 1, wherein the RNA molecule further comprises a 5’ cap moiety or a 3’ poly-A tail.

13. The RNA molecule of claim 12, wherein the poly-A tail comprises a sequence having SEQ ID NO:

26.

14. The RNA molecule of claim 1, wherein the open reading frame comprises a G / C content of at least 55%, 60%, 65%, 70%, or 75%, or of or of about 50% to 75% or 55% to 70%.

15. The RNA molecule of claim 1, wherein the encoded RSV polypeptide localizes in the cellular membrane, localizes in the Golgi and / or is secreted.

16. The RNA molecule of claim 1, wherein the RNA comprises at least one modified nucleotide.

17. The RNA molecule of claim 16, wherein the modified nucleotide is pseudouridine, N1- methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5- methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1- methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine OR 2′-O-methyl uridine.

18. The RNA molecule of claim 17, wherein the modified nucleotide is N1- methylpseudouridine (Ψ).

19. The RNA molecule of claim 1, wherein the RNA is mRNA.

20. The RNA molecule of claim 19, wherein the RNA is modRNA or saRNA.

21. A composition comprising the RNA molecule of claim 1, wherein the RNA molecule is formulated in a lipid nanoparticle (LNP).

22. The composition of claim 21, wherein lipid nanoparticle comprises at least one of a cationic lipid, a PEGylated lipid, a neutral lipid, and a steroid or steroid analog.

23. The composition of claim 22, wherein the cationic lipid is (4- hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

24. The composition of claim 22, wherein the PEGylated lipid is PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramides (e.g. PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, 2-[(polyethylene glycol)-2000]-N,N- ditetradecylacetamide, glycol-lipids including PEG-c-DOMG, PEG-c-DMA, PEG-s- DMG,N-[(methoxy polyethylene glycol)2000)carbamyl]-1,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerol (PEG-DAG) such as 1 - (monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), a PEGylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2’,3’- di(tetradecanoyloxy)propyl-1-O-((o- methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a PEGylated ceramide (PEG- cer), or a PEG dialkoxypropylcarbamate such as co-methoxy(polyethoxy)ethyl-N- (2,3di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(u>- methoxy(polyethoxy)ethyl)carbamate.

25. The composition of claim 24, wherein the PEGylated lipid is 2-[(polyethylene glycol)- 2000]-N,N-ditetradecylacetamide (ALC-0159).

26. The composition of claim 22, wherein the neutral lipid is distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl- phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1carboxylate (DOPE- mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl- phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O- dimethyl PE, 18-1-trans PE, 1-stearioyl-2- oleoylphosphatidyethanol amine (SOPE), or 1,2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE).

27. The composition of claim 26, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3- phosphocholine (DSPC).

28. The composition of claim 22, wherein the steroid or steroid analog is cholesterol.

29. A method of inducing an immune response against RSV in a subject, comprising administering to the subject an effective amount of the RNA molecule of claim 1.

30. A method of preventing, treating or ameliorating an infection, disease or condition associated with RSV in a subject, comprising administering to a subject an effective amount of the RNA molecule of claim 1.

31. The method of claim 30, wherein the infection, disease or condition is RSV infection- induced acute respiratory tract illness, including pneumonia and bronchitis.

32. The method of claim 29 or 30, wherein the subject is less than about 1 year of age, about 1 year of age or older, about 5 years of age or older, about 10 years of age or older, about 20 years of age or older, about 30 years of age or older, about 40 years of age or older, about 50 years of age or older, about 60 years of age or older, about 70 years of age or older, or older.

33. The method of claim 29 or 30, wherein the RNA molecule is administered as a vaccine.

34. The method of claim 29 or 30, wherein the subject is administered a single dose, two doses, three doses, or more, and optionally, a booster dose of the RNA molecule.

35. A method of inducing an immune response against RSV in a subject, comprising administering to the subject an effective amount of the composition of claim 22.

36. A method of preventing, treating or ameliorating an infection, disease or condition associated with RSV in a subject, comprising administering to a subject an effective amount of the composition of claim 22.

Images