Cellular reprogramming
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- SAMUEL AMY JANE
- Filing Date
- 2024-06-28
- Publication Date
- 2026-05-06
AI Technical Summary
Current cell transplantation therapies for Huntington's disease face challenges with the use of human embryonic stem cells or induced pluripotent stem cells due to risks of tumorigenesis, genetic mutagenesis, and insertional mutagenic effects, necessitating an alternative source for neural precursor cells that can safely and effectively replace damaged neurons.
The use of chemically modified mRNAs (cmRNAs) to directly reprogram adult human somatic cells, specifically adult human fibroblasts, into human neural precursor cells, such as lateral ganglionic eminence precursor cells, which can survive transplantation and differentiate into medium spiny striatal neurons, thereby addressing the limitations of previous therapies.
This approach allows for the generation of functional medium spiny striatal neurons that restore motor function in a rat model of Huntington's disease, providing a safe and effective cell source for replacement therapy, reducing the severity and potentially delaying the onset of the disease.
Smart Images

Figure IMGF000040_0001 
Figure IMGF000040_0002 
Figure IMGF000040_0003
Abstract
Description
[0001]CELLULAR REPROGRAMMING 1. FIELD OF THE INVENTION The present invention relates generally to compositions for cellular reprogramming of human somatic cells into induced neural precursor cells, methods of making induced human neural precursor cells by cellular reprogramming and methods of using reprogramed induced human neural precursor cells for treating disease. 2. BACKGROUND TO THE INVENTION Huntington’s disease (HD) is a genetic neurological disorder caused by an expansion mutation of the trinucleotide (CAG) repeat in exon 1 of the HTT (IT15) gene, encoding a 350-kDa protein termed Huntingtin (HTT). The disease is inherited in an autosomal dominant manner and shows a prevalence of about 1 to 15,000 individuals. HD is characterised by neuronal cell loss mainly in the caudate nucleus, putamen and the cerebral cortex. In later stages, areas such as the hippocampus and hypothalamus are affected (Vonsattel et al., 1985). Predominant degeneration of medium-sized spiny striatal projection neurons (MSNs) results in motor dysfunction together with cognitive and psychiatric disturbances. Current treatment options for HD are severely limited. While some of the behavioural symptoms of HD respond to psychiatric treatments and several drugs are available to reduce the impact of chorea, other motor symptoms and the cognitive symptoms of HD are currently not treatable (Caron et al., 1998). Cell transplantation is a viable option for the treatment of HD with the aim of reconstructing the damaged neural circuitry by replacing cells lost to the disease process, with the expectation that the donor cells will reconnect to remaining host neural networks to repair connectivity. Through genetic testing early therapeutic intervention is possible allowing for transplantation of replacement MSNs prior to extensive degeneration with the aim of maintaining the corticostriatal circuitry. Both rodent and primate HD studies have demonstrated that reconstruction of the corticostriatal circuitry following cell transplantation can alleviate both motor and cognitive deficits observed in HD (Dunnett et al., 2000; Kendall et al., 1998; Palfi et al., 1998). Small open-label clinical trials investigating the transplantation of human fetal striatal tissue into HD patients have been performed and provide preliminary proof of principle that neural transplantation can benefit patients with HD (Rosser & Bachoud-Levi, 2012). However, for cell transplantation therapy to be a viable therapeutic option for HD patients, one of the main issues that needs to be addressed is the identification of an ethically and technically viable source of donor cells other than human fetal striatal tissue. In searching for an alternative donor cell source attention has fallen on the potential use of human- derived stem cells including human embryonic stem cells (hESCs) or human induced pluripotent stem cells (iPSC) (Connor, 2018). While initial studies demonstrated that hESC-derived neural stem cells (NSC) transplanted into the quinolinic acid (QA) lesion model of HD survive and generate new neurons, transplanted human NSCs did not differentiate into region-specific neurons expressing markers of MSNs (Joannides et al., 2007; Reidling et al., 2018; Song et al., 2007; Vazey et al., 2010). To increase lineage specificity and encourage differentiation into MSNs, several groups differentiated hESCs into striatal precursors (Arber et al., 2015; Aubry et al., 2008; Delli Carri et al., 2013; Faedo et al., 2017; 2013). These studies reported the generation of MSNs following transplantation of striatal precursors into the QA lesioned striatum demonstrating the requirement to drive hESCs to a lineage-specific precursor fate before transplantation. Several studies have also demonstrated the potential use of iPSC-derived NSCs as a cellular source for transplantation therapy for HD (An et al., 2012; Jeon et al., 2012), with An and colleagues (An et al., 2012) demonstrating the capability to transplant genetically corrected HD patient- derived cells. However, the use of hESC- or hiPSC-derived NSCs for cell transplantation comes with the potential risk of tumorigenesis and genetic mutagenesis due to the accumulation of chromosomal abnormalities associated with long-term passaging. Furthermore, hiPSCs carry the risk of developing genetic abnormalities and insertional mutagenic effects due to the oncogenic nature of reprogramming factors and the integrative methods of gene delivery used in the reprogramming process (González et al., 2011). In view of the above, there is a need in the art for the development of alternative forms of cellular transplantation therapy that avoid the problems identified with the use of hESC- or hiPSC-derived NSCs, particularly the risks associated with tumorigenesis, genetic mutagenesis, development of genetic abnormalities and insertional mutagenic effects. It is an object of the invention to provide compositions and methods that will support at least one such alternative form of cellular transplantation therapy while avoiding at least some of the defects identified in prior therapies, and / or that will at least provide the public with a useful choice. In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. 3. SUMMARY OF THE INVENTION The compositions and methods disclosed herein employ chemically modified mRNAs to cellularly reprogram somatic cells into neural precursor cells. The present disclosure provides, for the first time, compositions and methods for cellularly reprogramming adult human somatic cells (aHSs), particularly adult human fibroblasts (aHFs), particularly adult human dermal fibroblasts (aHDFs) to human neural cells, particularly human lateral ganglionic eminence precursor cells (hiLGEP). Also disclosed for the first time is the inventors’ determination that directly reprogrammed somatic cells produced using the compositions and methods described herein survive cellular transplantation into the quinolinic acid (QA) lesioned rat striatum (an art accepted model of HD) and generate medium spiny striatal neurons (MSNs). Following transplantation, these directly reprogrammed hiLGEPs restore motor function impairment by 14 weeks post-transplantation, demonstrating that directly reprogrammed hiLGEPs offer an effective and clinically viable cell source for cell replacement therapy to treat brain degenerative disorders, particularly Huntington’s disease (HD). In one aspect the present application relates to a composition comprising a basal brain medium and at least two active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In another aspect the invention relates to a method of making a human induced lateral ganglionic eminence precursor cell (hiLGEP) comprising: a) reprogramming a human fibroblast (HF) cell into a hiLGEP comprising a. transfecting the HF with SOX2 cmRNA and PAX6 cmRNA, b. culturing the transfected HF in a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement, c. passaging the HF in b. into a composition comprising a basal brain medium, and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA), and d. culturing the passaged HF. In another aspect the invention relates to a kit comprising i. a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement, and ii. a composition comprising a basal brain medium and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA). In another aspect the invention relates to a human induced lateral ganglionic eminence precursor cell (hiLGEP). In another aspect the invention relates to a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier. In another aspect the invention relates to composition comprising a basal brain medium, B27-RA, N2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and Activin A (ActA). In another aspect the invention relates to a composition comprising a basal brain medium, B27-RA, N2 supplement, a cAMP activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and dorsomorphin. In another aspect the invention relates to the use of a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement to induce the expression of at least one lateral ganglionic eminence (LGE) transcription factor in a reprogrammed HF. In another aspect the invention relates to the use of a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement to promote induction of a lateral ganglionic eminence (LGE) precursor fate in a fibroblast, preferably a human fibroblast (HF). In another aspect the invention relates to the use of a composition comprising a basal brain medium, B27-RA, N2 supplement, a cAMP activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and Activin A to induce the expression of at least one biomarker associated with neuronal differentiation of a reprogrammed HF LGE precursor. In another aspect the invention relates to the use of a composition comprising a basal brain medium, B27-RA, N2 supplement, a cAMP activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and dorsomorphin to induce the expression of at least one of biomarker associated with neuronal differentiation of a reprogrammed HF LGE precursor. In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) or a reprogramed HF that expresses at least one lateral ganglionic eminence (LGE) transcription factor and a carrier to make a medium-sized spiny striatal projection neuronal cell (MSN). In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to treat Huntington’s disease. In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to reduce the severity of Huntington’s disease. In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to delay the onset of Huntington’s disease. In another aspect the invention relates to a method of treating Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject having or suspected of having Huntington’s disease. In another aspect the invention relates to a method of delaying the onset of Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject suspected of having Huntington’s disease or having at least one symptom of Huntington’s disease. In another aspect the invention relates to a method of reducing the severity of Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject suspected of having Huntington’s disease or having at least one symptom of Huntington’s disease. 4. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described by way of example only and with reference to the drawings in which: Figure 1 shows direct reprogramming and differentiation protocols disclosed herein. Figure 2 shows the expression of lateral ganglionic eminence precursor biomarkers by reprogrammed HDFs. (A) and (B) show the combined positive effect of additives ActA, Gö6983, Y-27632 and N-2 (GYN) in Neurobasal A (NBA) or BrainPhys base reprogramming medium on the acquisition of a LGE fate as assessed by expression of CTIP2. (C) shows a representative image of hiLGEPs which express key biomarkers at the gene (D) and protein level (E-H). Figure 3 shows the ability for hiLGEPs to differentiate into medium spiny striatal neurons. hiLGEPs reprogrammed in a BrainPhys-based medium with ActA and GYN give rise to a high yield of striatal neurons expressing (A) TUJ1 and (B) DARPP32. (C) Addition of dorsomorphin to the striatal differentiation medium resulted in the generation of a more robust and consistent number of DARPP32- positive striatal neurons from hiLGEPs. Reprogramming with GYN alone or in combination with ActA with or without all three GYN compounds yields hiLGEPs capable of differentiating to striatal neurons expressing (D) TUJ1 and (E) DARPP32, with GYN + ActA during reprogramming resulting in the largest yield of striatal neurons. * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001. Figure 4 shows the expression of medium spiny striatal neuron biomarkers by differentiated hiLGEPs. (A) shows a representative image of striatal neurons generated by differentiation of hiLGEPs which express key biomarkers (B) TUJ1, (C) DARPP32, (D) GABA and (E) GAD65 / 67. hiLGEP-derived striatal neurons have the ability to flux calcium (G; brighter staining indicates more calcium in the cell) as a measure of cellular functionality in response to increasing concentrations of glutamate (F). Figure 5 (A) shows the cell transplantation protocol and timeline in the QA rat model disclosed herein. (B) shows that hiLGEPs transplanted into the QA rat model of Huntington’s disease significantly reduce the impairment in forelimb locomotor function as seen by a reduction in ipsilateral forelimb use overtime. # p ≤ 0.05; ## p ≤ 0.01 compared to baseline; * p ≤ 0.05 compared to post-QA. Figure 6 shows the expression of key biomarkers by striatal neurons derived from transplanted hiLGEPs after 14 weeks. hiLGEPs gave rise to human medium spiny neurons expressing the human marker STEM121 (A) and co-expressing STEM121 (B1, C1, D1 and E1) with (B2) MAP2, (C2) DARPP32, (D2) GAD65 / 67and (E2) GABA. A’ is a higher magnification image of A. Figure 7 shows the ability to generate hiLGEPs and derived medium spiny striatal neurons irrespective of the cmRNA transfection method used. (A) HDFs transfected with either SOX2 and PAX6 cmRNA SNIM for 5 hours over 4 consecutive days (4 x 5hr SNIM) or SOX2 and PAX6 lipid nanoparticle once for 24 hours (1 x 24hr LNP) yield the same morphological changes over the course of reprogramming. HDFs reprogrammed with either 4 x 5hr SNIM or 1 x 24hr LNP show up-regulation of (B) SOX2 and (C) PAX6 after 7 days of reprogramming, (D) and of the striatal lineage marker CTIP2. hiLGEPs differentiated for 14 days to medium spiny striatal neurons display similar morphology (E) and express the neuron marker TUJ1 (F1 and F3) and the medium spiny striatal neuron marker DARPP32 (F2 and F4). 5. DETAILED DESCRIPTION OF THE INVENTION 5.1 Definitions and abbreviations The term “cmRNA” as used herein is an abbreviation for chemically modified mRNA containing a combination of modified and unmodified nucleotides and refers to stabilized non-immunogenic mRNA (known and commercialized as SNIM RNA) as disclosed in WO 2011 / 012316, the entirety of which is hereby incorporated by reference. Chemical modification of cmRNA structural elements allows these molecules to avoid the innate immunity and instability of naturally occurring mRNA. cmRNA can be used repeatedly, i.e., in separate and / or sequential transfection events, providing a cell the ability to produce sustained levels of desired protein products. Known uses for cmRNA include the augmentation and / or replacement of absent or non-functional proteins and / or for the introduction of new proteins. In some embodiments, cmRNA can be transfected into cells using lipid-nanoparticle technology (LNP), such as described in the Examples. The term “Gö6983” as used herein means Gö6983 having CAS Number: 133053-19-7. The term “Y27632” as used herein means Y-27632 dihydrochloride having CAS Number 129830-38-2. The term “N-2 supplement” as used herein means Bottenstein's N-2 formulation (1) which is a chemically defined supplement composed of Human transferrin (holo), recombinant insulin full chain, progesterone, putrescine and selenite (Bottenstein, J.E. (1985) Cell Culture in the Neurosciences, Bottenstein, J.E. and Harvey, A.L., editors, p. 3, Plenum Press: New York and London). The combination of Gö6983, Y27632 and N-2 is abbreviated as “GYN” herein. The term “cyclic adenosine 3′,5′-monophosphate (cAMP) activator” or “cAMP activator” as used herein refers to a molecule that activates the cAMP pathway. In one embodiment the cAMP activator is dcAMP, forskolin (FSK), 8-Bromo-cAMP, cAMPS-Sp. The term "active agent" as used herein means that the agent is an essential component of a composition, kit, method or use as described herein for driving the cellular reprogramming of human fibroblasts, particularly adult human fibroblasts, particularly adult human dermal fibroblasts to human lateral ganglionic eminence precursor cells (hiLGEPs). Compositions, kits, methods and / or uses as described herein may also comprise additional agents that contribute and / or allow cell culturing and passaging while the cells are being reprogrammed. The additional agents may include valproic acid, penicillin-streptomycin-glutamine, B-27 without retinoic acid, epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2) heparin, and retinoic acid including any combination thereof. The active agents contemplated herein are selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In a preferred embodiment the active agents are Activin A, Gö6983, Y27632, and N-2 supplement. In some embodiments, at least two active agents, preferably three active agents that are a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement are used for culturing fibroblasts to be reprogrammed to hiLGEPs according to the compositions, kits, methods and / or uses described herein. In a preferred embodiment the three active agents are Gö6983, Y27632, and N-2 supplement. In some embodiments, at least three active agents, preferably four active agents that are a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement, and Activin A (ActA) are used for passaging fibroblasts to be reprogrammed to hiLGEPs according to the compositions, kits, methods and / or uses described herein. In a preferred embodiment the four active agents are Gö6983, Y27632, N-2 supplement, and ActA. As used herein "basal brain medium" refers to a generalized medium that is suitable for in vitro culture of neural cells. In one embodiment the basal brain medium is Neurobasal A or Brain Phys supplemented with at least one active agent, preferably at least two, three or all four active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In some embodiments the basal brain medium is supplemented with at least one, preferably at least two, three or all four of Activin A, Gö6983, Y27632, and N-2 supplement. The basal brain medium may also be supplemented with additional agents that are not the “active agents” but that are used as known to the skilled person for culturing and passaging human cells. In some embodiments the additional agents are any combination of and / or all of the following constituents: valproic acid, penicillin-streptomycin-glutamine, B-27 without retinoic acid, epidermal growth factor (EGF), fibroblast growth factor 2 (FGF2) heparin, and retinoic acid. The term “SOX2” as used herein means the SRY-box transcription factor 2 [Homo sapiens (human)] having Gene ID: 6657. The gene encoding SOX2 is an intronless gene encoding this a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT) (https: / / www.ncbi.nlm.nih.gov / gene / 6657). The specific sequence of the SOX2 cmRNA used herein is provided as SEQ ID NO: 1. GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCCAGTGTGGTGGTACGGG AAATCACAAGTTTGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACCATGTACAACATGATGGAGACGGA GCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCG GCAACCAGAAAAACAGCCCGGACCGCGTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAGC GGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCCGAGTGGA AACTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGACGAGGCTAAGCGGCTGCGAGCGCTGCACATGAAGG AGCACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAGACGCTCATGAAGAAGGATAAGTACACGCTGCC CGGCGGGCTGCTGGCCCCCGGCGGCAATAGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGG GCGTGAACCAGCGCATGGACAGTTACGCGCAATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGA CCAGCTGGGCTACCCGCAGCACCCGGGCCTCAATGCGCACGGCGCAGCGCAGATGCAGCCCATGCACCGCTAC GACGTGAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCGCCCACCTACAGCA TGTCCTACTCGCAGCAGGGCACCCCTGGCATGGCTCTTGGCTCCATGGGTTCGGTGGTCAAGTCCGAGGCCA GCTCCAGCCCCCCTGTGGTTACCTCTTCCTCCCACTCCAGGGCGCCCTGCCAGGCGGGGACCTCCGGGACATG ATCAGCATGTATCTCCCCGGCGCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCACT ACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCACACATGTGAAAGGGTGGGC GCGCCGACCCAGCTTTCTTGTACAAAGTGGTGATATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGT CTGGTGTCAAAAATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATGTAC TATTTAAACTCGAAATTCTGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA The term “PAX6” as used herein means the paired box 6 [ Homo sapiens (human)] having NIH Gene ID: 5080. The gene that encodes paired box protein Pax-6 is one of many human homologs of the Drosophila melanogaster gene prd. In addition to a conserved paired box domain, a hallmark feature of this gene family, the encoded protein also contains a homeobox domain. Both domains are known to bind DNA and function as regulators of gene transcription. Activity of this protein is key in the development of neural tissues, particularly the eye. This gene is regulated by multiple enhancers located up to hundreds of kilobases distant from this locus. Mutations in this gene or in the enhancer regions can cause ocular disorders such as aniridia and Peter's anomaly. Use of alternate promoters and alternative splicing results in multiple transcript variants encoding different isoforms. Interestingly, inclusion of a particular alternate coding exon has been shown to increase the length of the paired box domain and alter its DNA binding specificity. Consequently, isoforms that carry the shorter paired box domain regulate a different set of genes compared to the isoforms carrying the longer paired box domain (https: / / www.ncbi.nlm.nih.gov / gene / 5080). The specific sequence of the PAX6 cmRNA used herein is provided as SEQ ID NO: 2. GGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACGTTTTGCTGGAGGATGATGACAGAGGAATCT GAGAATTGCTCTCACACACCAACCCAGCAACATCCGTGGAGAAAACTCTCACCAGCAACTCCTTTAAAACACCG TCATTTCAAACCATTGTGGTCTTCAAGCAACAACAGCAGCACAAAAAACCCCAACCAAACAAAACTCTTGACAG AAGCTGTGACAACCAGAAAGGATGCCTCATAAAGGGGGAAGACTTTAACTAGGGGCGCGCAGATGTGTGAGG CCTTTTATTGTGAGAGTGGACAGACATCCGAGATTTCAGAGCCCCATATTCGAGCCCCGTGGAATCCCGCGGC CCCCAGCCAGAGCCAGCATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGC GGCCACTGCCGGACTCCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTT CCCGAATTCTGCAGGTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAG ACCCAGGGCAATCGGTGGTAGTAAACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAG CGGGAGTGCCCGTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGATA ACATACCAAGCGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGA CGGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGTTGGTATCC GGGGACTTCGGTGCCAGGGCAACCTACGCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAATACCAA CTCCATCAGTTCCAACGGAGAAGATTCAGATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGA AATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATG TGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCG AAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATT CCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCAC ATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGC TTCACCATGGCAAATAACCTGCCTATGCAACCCCCAGTCCCCAGCCAGACCTCCTCATACTCCTGCATGCTGCC CACCAGCCCTTCGGTGAATGGGCGGAGTTATGATACCTACACCCCCCCACATATGCAGACACACATGAACAGT CAGCCAATGGGCACCTCGGGCACCACTTCAACAGGACTCATTTCCCCTGGTGTGTCAGTTCCAGTTCAAGTTC CCGGAAGTGAACCTGATATGTCTCAATACTGGCCAAGATTACAGTAAAAAAAAAAAAAAAAAAAAAAAAATTCT GCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA The term “B27-RA” as used herein means the neuronal cell culture B27 supplement without retinoic acid. As known in the art B27 supplement is composed of biotin, DL alpha tocopherol acetate, DL alpha tocopherol, vitamin A, biotin, bovine serum albumin fatty acid free fraction V, catalase, human recombinant insulin, human transferrin, superoxide dismutase, corticosterone, D-galactose, ethanolamine HCL, glutathione (reduced), L-carnitine HCL, linoleic acid, linolenic acid, progesterone, putrescine 2HCL, sodium selenite and T3 (triodo-I-thyronine). The term “adult” as used herein with reference to somatic cells, particularly fibroblasts, refers to cells taken from an adult organism, preferably an adult human. In one embodiment an adult human fibroblast is a fibroblast taken from a human at any stage other than embryonic or fetal. The term “mature” as used herein with reference to somatic cells, particularly fibroblast, refers to a cell that has differentiated, which means it has acquired a specific rather than a generalized function. This is in contrast to an immature or stem cell that remains pluripotent and has the potential to differentiate into any cell type found in the body. In a one embodiment, the term "mature human somatic cell" means a human somatic cell that has reached a final differentiation state. Such cells no longer have the potential to further differentiate. Such cells can be found at different stages of development including embryonal, postnatal or adult stages; however, they are typically obtained from human adults. As used herein a “therapeutically effective amount” is a suitable dose as may be determined by a person of skill in the art based on a number of known factors. Such a dose can be administered as part of a dosage regimen that may be determined by an attending physician based on a number of known clinical factors. Such factors will include the size of a subject, their weight, age, body surface area, sex, time and route of administration, other drugs being administered to the subject at the time and the subject’s general health (but not limited to). The therapeutically effective amount will be an amount that is sufficient to provide a treatment for the disease or condition to be treated. In some embodiments the disease or condition to be treated is Huntington’s disease. The term "treatment" as used herein refers to obtaining, generally, a preferred or desired result, typically a preferred or desired pharmacological and / or physiological response or effect. In this context the term "treatment" refers to a beneficial therapeutic outcome in terms of partially or completely curing a disease and / or adverse effect and / or symptoms attributed to the disease. By way of example, treating a subject having Huntington’s disease can be treating any stage of Huntington’s disease, including acute stages of the disease. Treating in the context of the present disclosure also includes measures taken to reduce the severity and / or delay the onset of the disease, e.g., encompassing the partial or complete treatment of the disease (or a symptom thereof). As used herein the term “delaying the onset” (and grammatical variations thereof) in the context of treatment refers to reducing the time between an initial indication that a subject has or is suspected of having Huntington’s disease, and the onset of “acute” disorder. As considered herein, Huntington’s disease is “acute” in a subject that displays some and / or all of the symptoms of the disease. Such a subject requires treatment following the onset of the disease, for example, to reduce some and / or all symptoms. The term "delay the onset of" including grammatical variations thereof means a delay in the occurrence of at least one clinical symptom of Huntington’s disease in a subject. These would be determined by assessing change from baseline in UHDRS-TMS measure. UHDRS (Unified Huntington’s Disease Rating Scale) is a research tool know to those skilled in the art to provide a uniform assessment of the clinical features and course of Huntington’s disease. Components of the full UHDRS assess motor function, cognition, behaviour, functional abilities, independence scale and total functional capacities. Motor function assessment includes Total Motor Score (TMS) and Total Functional Capacity (TFC) score. The UHDRS TMS assesses all the motor features of HD and includes maximal chorea, maximal dystonia, ocular pursuit, saccade initiation and velocity, dysarthria, tongue protrusion, finger tapping, hand pronation and supination, luria, rigidity, bradykinesia, gait, tandem walking, and retropulsion pull test. Each of these was rated on a scale of 0 (normal motor function) to 4 (severely impaired motor function). TMS score is a sum of individual scores ranging from 0 (normal motor function) to 124 (severely impaired motor function). Lower TMS scores indicate better motor function. As used herein the term “comprising” means “consisting at least in part of”. When interpreting each statement in this specification that includes the term “comprising”, features other than that or those prefaced by the term may also be present. Related terms such as “comprise” and “comprises” are to be interpreted in the same manner. The term “about” as used herein means a reasonable amount of deviation of the modified term such that the end result is not significantly changed. For example, when applied to a value, the term should be construed as including a deviation of+ / - 5% of the value. It is intended that reference to a range of numbers disclosed herein (for example, 1 to 10) also incorporates reference to all rational numbers within that range (for example, 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example, 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are hereby expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner. Whenever a range is given in the specification, for example, a temperature range, a time range, or a composition range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. In the disclosure and the claims, “and / or” means additionally or alternatively. Moreover, any use of a term in the singular also encompasses plural forms. 5.1 Detailed Description Disclosed herein is the inventors’ work demonstrating for the first time that human fibroblasts (HFs), particularly human dermal fibroblasts (HDFs) can be directly reprogrammed with SOX2 and PAX6 cmRNA to a human induced lateral ganglionic eminence precursor cell (hiLGEP) phenotype which, following transplantation into the QA lesioned rat striatum, results in the generation of DARPP32- and GABA-positive neurons and restoration of motor function. This work is exemplified in adult human dermal fibroblasts but is not so limited. Based on the present disclosure, the inventors believe that the compositions and methods of cellular reprogramming as described herein can be successfully applied for reprogramming different types of human fibroblasts with a reasonable expectation of success. In one example, the compositions and methods described herein leverage the use of cmRNA to generate hiLGEPs for transplantation. Regarding both safety and efficiency, cmRNA provides an ideal non-viral, non-integrating delivery system for cell reprogramming. The cmRNA system described herein allows for mRNA transfection without immune response inhibition through the replacement of uridine and cytidine residues with chemically modified uridine and cytidine analogues, respectively, reducing the activation of an innate immune response and increasing mRNA stability. As such, the use of cmRNA to generate reprogrammed donor cells for cell replacement therapy is highly attractive as it provides an efficient and stable system of gene delivery without the risk of genomic integration and insertional mutation inherent to all DNA-based methodologies, as well as, allowing cell reprogramming without residual tracers of transgenes. These features make cmRNA an excellent option for the clinical translation of reprogramming-based cell replacement therapies. Also disclosed herein is the inventors’ demonstration that HFs, particularly HDFs, can be directly reprogrammed to a lateral ganglionic eminence precursor (LGEP) fate. In this regard, the compositions and methods of cellular reprogramming described herein are not limited to the reprogramming of lineage-specific neural precursor cells for transplantation. Rather, as described herein, cellular reprogramming of various types of HFs, particularly HDFs, is provided in a manner that ensures complete differentiation to a striatal phenotype. In some embodiments, the HFs, particularly the HDFs are lineage specific. By culturing HFs, particularly HDFs, in Activin A combined with Gö6983, Y27632 and N-2 (GYN) following transfection with SOX2 / PAX6 cmRNA as described herein, the inventors demonstrate that direct reprogramming results in neural precursor cells expressing the striatal factors GSX2, DLX2, FOXP1, FOXP2, CTIP2 and MEIS2. Based on this profile, and particularly the large up-regulation of CTIP2 expression, the inventors have determined that using Activin A, they can induce a LGE fate (i.e., they can produce hiLGEPs) which is further promoted by the addition of Gö6983, Y27632 and N-2. Further described herein, the generation of hiLGEPs by direct reprogramming is further confirmed by the generation of DARPP32-positive neurons following in vitro differentiation of hiLGEPs in BrainPhys™ - based striatal differentiation media supplemented with Activin A and dorsomorphin. Moreover, also described herein is the ability for hiLGEPs as described to survive transplantation, to differentiate to MSNs and to improve motor function in a QA lesion rat model of the brain degenerative disorder, Huntington’s disease. Importantly, the inventors’ work as disclosed herein demonstrates that transplantation of directly reprogrammed hiLGEPs to the QA lesioned striatum can restore motor function impairment as determined by spontaneous exploratory forelimb use when compared to saline treated animals. Accordingly, in one aspect the present invention relates to a composition comprising a basal brain medium and at least two active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In one embodiment the composition comprises a basal brain medium and at least three active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In one embodiment the composition comprises a basal brain medium and four active agents that are Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In one embodiment the composition is a culture medium. In one embodiment the PKC inhibitor is selected from the group consisting of Gö6983, Enzastaurin, Staurosporine, GF 109203X, Go6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, Sotrastaurin and K252a. In one embodiment the PKC inhibitor is Gö6983. In one embodiment the p160ROCK inhibitor selected from the group consisting of is Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A. In one embodiment the p160ROCK inhibitor is Y27632. In one embodiment the “N-2 supplement” is Bottenstein's N-2 formulation (1). In one embodiment the basal brain medium is Neurobasal-A (NBA) or BrainPhys, preferably BrainPhys. In one embodiment the basal brain medium further comprises at least one additional agent, at least two, three, four, at least five, six or all seven additional agents selected from the group consisting of valproic acid, penicillin-streptomycin-glutamine, B27-RA, FGF2, EGF, retinoic acid and heparin. In one embodiment the composition is used for reprogramming a fibroblast, preferably a human fibroblast (HF) to a hiLGEP. In one embodiment the composition is for use to reprogram a fibroblast, preferably a human fibroblast (HF) to a hiLGEP. In one embodiment the composition when used, is used to reprogram a fibroblast, preferably a human fibroblast (HF) to a hiLGEP. In one embodiment the HF is a lineage specific cell. In one embodiment the HF is non-lineage specific cell. In one embodiment the HF is a human dermal fibroblast (HDF). In one embodiment the HF is an adult human fibroblast (aHF). In one embodiment the HF is an adult human dermal fibroblast (aHDF). In another aspect the invention relates to a method of making a human induced lateral ganglionic eminence precursor cell (hiLGEP) comprising: a) reprogramming a human fibroblast (HF) into a hiLGEP comprising a. transfecting the HF with SOX2 cmRNA and PAX6 cmRNA, b. culturing the transfected HF in a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement, c. passaging the HF in b. into a composition comprising a basal brain medium and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA), and d. culturing the passaged HF. In one embodiment transfection in a. comprises transfecting with 0.5 to 5 µg, preferably 1.5 to 4 µg, preferably 2-3 µg, preferably 2.5 µg of each of SOX2 cmRNA and PAX6 cmRNA. In one embodiment transfection in a. comprises at least one, preferably at least two, at least three, at least four, preferably five separate transfection events. In one embodiment at least two separate transfection events are conducted over two to six consecutive days, preferably over three to five consecutive days, preferably over four consecutive days. In one embodiment transfection events are about 10 min in duration, preferably about 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 400, 420, 480, or about 500 min in duration, preferably about 300 min in duration. In one embodiment transfection events are about 100 to about 500 min in duration, preferably about 150 to about 450, 200 to 400, 250 to 350, preferably about 300 min in duration. In one embodiment the SOX2 cmRNA comprises (SEQ ID NO:1). In one embodiment the SOX2 cmRNA consists essentially of or consists of (SEQ ID NO:1). In one embodiment the PAX6 cmRNA comprises (SEQ ID NO:2). In one embodiment the PAX6 cmRNA consists essentially of or consists of (SEQ ID NO:2). In one embodiment the basal brain medium is Neurobasal A or BrainPhys, preferably BrainPhys. In one embodiment the basal brain medium further comprises at least one additional agent, at least two, three, four, at least five, six or all seven additional agents selected from the group consisting of valproic acid, penicillin-streptomycin-glutamine, B27 without RA, FGF2, EGF, retinoic acid and heparin. In one embodiment culturing in b. is for about four to about ten days, preferably for about five to about nine days, preferably for about six to about eight days. In one embodiment culturing in b. is for about seven days. In one embodiment the PKC inhibitor in b. is selected from the group consisting of GÖ6983, Enzastaurin, Staurosporine, GF 109203X, Go6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, Sotrastaurin and K252a. In one embodiment the PKC inhibitor in b. is GÖ6983. In one embodiment the concentration of the PKC inhibitor in b. is about 0.5nM to 50µM, preferably about 1nM to about 40µM, about 10nM to about 30µM, about 100nM to about 20µM, about 500nM to about 15µM, about 1µM to about 10µM, about 3µM to about 8µM, about 5µM to about 6µM, preferably about 5µM. In one embodiment the p160ROCK inhibitor in b. is selected from the group consisting of Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A. In one embodiment the P160ROCK inhibitor in b. is Y27632. In one embodiment the concentration of the P160ROCK inhibitor in b. is about 0.1nM to about 100µM, preferably about 1nM to about 75µM, about 500nM to about 50µM, about 1µM to about 25µM, about 5µM to about 15µM, about 7µM to about 13µM, preferably about 10uM. In one embodiment passaging in c. is at about four to about ten days, preferably at about five to about nine days, preferably at about six to about eight days. In one embodiment passaging in c. is at about 7 days. In one embodiment the composition in c. comprises a basal brain medium and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N- 2 supplement and Activin A (ActA). In one embodiment the composition in c. comprises a basal brain medium and all four active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA). In one embodiment the concentration of the N-2 supplement in c. is about 0.1% to about 10%, preferably about 0.3% to about 8%, about 0.5% to about 5%, about 0.7% to about 3%, about 0.9% to about 2%, preferably about 1%. In one embodiment the concentration of ActA in c. is about 25pg / mL to about 25µg / mL, preferably about 50pg / mL to about 1µg / mL, about 250pg / mL to about 750ng / mL, about 500pg / mL to about 500ng / mL, about 750pg / mL to about 250ng / mL, about 1ng / mL to about 100ng / mL, about 5ng / mL to about 75ng / mL, about 10ng / mL to about 65ng / mL, about 15ng / mL to about 50ng / mL, about 20ng / mL to about 30ng / mL, about 22ng / mL to about 28ng / mL, preferably about 25ng / mL. In one embodiment the PKC inhibitor in c. is selected from the group consisting of GÖ6983, Enzastaurin, Staurosporine, GF 109203X, Go6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, Sotrastaurin and K252a. In one embodiment the PKC inhibitor in b. is GÖ6983. In one embodiment the concentration of the PKC inhibitor in c. is about 0.5nM to 50µM, preferably about 1nM to about 40µM, about 10nM to about 30µM, about 100nM to about 20µM, about 500nM to about 15µM, about 1µM to about 10µM, about 3µM to about 8µM, about 5µM to about 6µM, preferably about 5µM. In one embodiment the p160ROCK inhibitor in c. is selected from the group consisting of Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A. In one embodiment the P160ROCK inhibitor in c. is Y27632. In one embodiment the concentration of the P160ROCK inhibitor in c. is about 0.1nM to about 100µM, preferably about 1nM to about 75µM, about 500nM to about 50µM, about 1µM to about 25µM, about 5µM to about 15µM, about 7µM to about 13µM, preferably about 10uM. In one embodiment culturing in d. is for about four to about ten days, preferably for about five to about nine days, preferably for about six to about eight days. In one embodiment culturing in d. is for about seven days. In one embodiment the HF is a lineage specific cell. In one embodiment the HF is non-lineage specific cell. In one embodiment the HF is a human dermal fibroblast (HDF). In one embodiment the HF is an adult human fibroblast (aHF). In one embodiment the HF is an adult human dermal fibroblast (aHDF). In one embodiment the hiLGEP expresses at least one lateral ganglionic eminence (LGE) transcription factor. In one embodiment the at least one LGE transcription factor is selected from the group consisting of GSX2, FOXP1, FOXP2, MEIS and CTIP2. In one embodiment the hiLGEP expresses at least two, at least three, at least four, preferably five LGE transcription factors selected from the group consisting of GSX2, FOXP1, FOXP2, MEIS andCTIP2. In one embodiment the method further comprises differentiating the hiLGEP in a striatal differentiation medium (STDM). In one embodiment differentiating is for about four to about 10 days, preferably about five to about nine days, preferably for about six to about eight days. In one embodiment differentiating is for about seven days. In one embodiment the STDM comprises B27-RA, N-2 supplement, a cAMP activator, a p160ROCK inhibitor, and brain derived neurotrophic factor (BDNF), wherein the STDM is supplemented with dorsomorphin for about the first four to about the first six days of differentiating and with ActA for about the first six to eight days of differentiating. In one embodiment the cAMP activator is dcAMP or forskolin (FSK). In one embodiment the concentration of the cAMP activator is about 0.1nm to about 10mM, preferably about 1nM to about 1mM, about 10nM to about 0.1mM, about 100nM to about 100µM, about 1µM to about 50µM, about 5µM to about 25µM, about 7µM to about 15µM, preferably about 10µM. In one embodiment the concentration of B27-RA is about 0.2% to about 20%, preferably about 0.5% to about 15%, about 0.7% to about 10%, about 0.9% to about 5%, about 1% to about 3%, preferably about 2%. In one embodiment the concentration of N2 is about 0.1% to about 10%, preferably about 0.3% to about 8%, about 0.5% to about 5%, about 0.7% to about 3%, about 0.9% to about 2%, preferably about 1%. In one embodiment the concentration of BDNF is about 0.3ng / mL to 3ug / mL, preferably about 3ng / mL to about 300ng / mL, about 5ng / mL to about 150ng / mL, about 10ng / mL to about 75ng / mL, about 15ng / mL to about 50ng / mL, about 20ng / mL to about 40ng / mL, preferably about 30ng / mL. In one embodiment the STDM is supplemented with dorsomorphin for about the first five days of differentiating. In one embodiment the concentration of dorsomorphin is about 1nM to about 1mM, preferably about 100nM to about 100µM, about 500nM to about 50µM, about 750nM to about 25µm, about 800nM to about 15µM, about 900nM to about 5µM, about 950nM to about 2.5µm, preferably about 1µM. In one embodiment the STDM is supplemented with ActA for about the first seven days of differentiating. In one embodiment the concentration of ActA is about 25pg / mL to about 25µg / mL, preferably about 50pg / mL to about 1µg / mL, about 250pg / mL to about 750ng / mL, about 500pg / mL to about 500ng / mL, about 750pg / mL to about 250ng / mL, about 1ng / mL to about 100ng / mL, about 5ng / mL to about 75nm / mL, about 10ng / mL to about 65ng / mL, about 15ng / mL to about 50ng / mL, about 20ng / mL to about 30ng / mL, about 22ng / mL to about 28ng / mL, preferably about 25ng / mL. In one embodiment the p160ROCK inhibitor is selected from the group consisting of Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A. In one embodiment the p160ROCK inhibitor is Y27632. In one embodiment the concentration of the p160ROCK inhibitor is about 0.1nM to about 100µM, preferably about 1nM to about 75µM, about 500nM to about 50µM, about 1µM to about 25µM, about 5µM to about 15µM, about 7µM to about 13µM, preferably about 10uM. In one embodiment differentiating comprises differentiating the hiLGEP into a cell that expresses at least one biomarker associated with neuronal differentiation. In one embodiment differentiating comprises differentiating the hiLGEP into a medium spiny striatal neuron (MSN). In one embodiment the hiLGEP expresses at least one of TUJ1, MAP2, DARPP32, GABA and GAD65 / 67 after differentiation in STDM, preferably at least three, preferably at least four, preferably all five of TUJ1, MAP2, DARPP32, GABA and GAD65 / 67. In another aspect the invention relates to a kit comprising i. a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement, and ii. a composition comprising a basal brain medium and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA). In one embodiment the composition in i. comprises a basal brain medium and all three active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement. In one embodiment the composition in ii. comprises a basal brain medium and all four active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA). In one embodiment the composition in i. or ii. or both is a dry, substantially dry, lyophilized, liquid or frozen composition. In one embodiment i. and ii. are packaged separately in the kit in a manner that requires the sequential use of i. before ii. In one embodiment the kit comprises iii., at least one cmRNA selected from the group consisting of SOX2 cmRNA and PAX6 cmRNA. In one embodiment the kit comprises SOX2 cmRNA and PAX6 cmRNA. In one embodiment the SOX2 cmRNA comprises (SEQ ID NO:1). In one embodiment the SOX2 cmRNA consists essentially of or consists of (SEQ ID NO:1). In one embodiment the PAX6 cmRNA comprises (SEQ ID NO:2). In one embodiment the PAX6 cmRNA consists essentially of or consists of (SEQ ID NO:2). In one embodiment iii. is provided in a composition comprising a carrier. In one embodiment the composition is a dried, substantially dried, lyophilized, liquid or frozen composition. In one embodiment, when iii. is present in the kit, i., ii., and iii. are packaged separately in the kit in a manner that requires the sequential use of iii. followed by i., followed by ii. In one embodiment the kit is used for reprogramming a fibroblast, preferably a human fibroblast (HF) to a hiLGEP. In one embodiment the kit is for use to reprogram a fibroblast, preferably a human fibroblast (HF) to a hiLGEP. In one embodiment the kit when used, is used to reprogram a fibroblast, preferably a human fibroblast (HF) to a hiLGEP. In one embodiment the HF is a lineage specific cell. In one embodiment the HF is non-lineage specific cell. In one embodiment the HF is a human dermal fibroblast (HDF). In one embodiment the HF is an adult human fibroblast (aHF). In one embodiment the HF is an adult human dermal fibroblast (aHDF). Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments of the basal brain medium, protein kinase (PKC) inhibitor and p160ROCK inhibitor, N-2 supplement and ActA as set forth in any other aspect disclosed herein. In another aspect the invention relates to a human induced lateral ganglionic eminence precursor cell (hiLGEP). In one embodiment the hiLGEP does not express ZNF503. In one embodiment the hiLGEP is made according to a method as described herein. In another aspect the invention relates to a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier. In one embodiment the hiLGEP does not express ZNF503. In one embodiment the carrier is a buffer, a culture medium or a pharmaceutically acceptable carrier. In one embodiment the carrier is a pharmaceutically acceptable carrier. In one embodiment the composition comprises at least about 1,000,000 viable hiLGEPs, preferably at least about 2,000,000, at least about 3,000,000, at least about 4,000,000, preferably at least about 5,000,000 viable hiLGEPs. In one embodiment the at least one hiLGEP is made according to a method as described herein. In another aspect the invention relates to a composition comprising a basal brain medium, B27-RA, N- 2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and Activin A (ActA). In one embodiment the composition comprises dorsomorphin. In another aspect the invention relates to a composition comprising a basal brain medium, B27-RA, N2 supplement, a cyclic adenosine 3′,5′-monophosphate (cAMP) activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and dorsomorphin. In one embodiment the composition comprises Activin A. In one embodiment the composition comprises hiLGEPs. In one embodiment the hiLGEPs are reprogramed human fibroblasts (HFs), human dermal fibroblasts (HDFs), adult human fibroblasts (aHFs) or adult human dermal fibroblasts (aHDFs). In one embodiment the hiLGEPs are made according to a method as described herein. Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments of the basal brain medium, B27-RA, N-2 supplement, cAMP activator, protein kinase (PKC) inhibitor, p160ROCK inhibitor, BDNF, dorsomorphin and ActA as set forth in any other aspect disclosed herein. In another aspect the invention relates to the use of a composition comprising a basal brain medium, Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement to induce the expression of at least one lateral ganglionic eminence (LGE) transcription factor in a reprogrammed HF. In one embodiment the reprogrammed HF is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the LGE transcription factor that is induced is at least one of GSX2, FOXP1, FOXP2, MEIS, CTIP2, preferably at least two, at least three, at least four, preferably all five of GSX2, FOXP1, FOXP2, MEIS, and CTIP2. Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments of the basal brain medium, ActA, protein kinase (PKC) inhibitor, p160ROCK inhibitor and N-2 supplement, as set forth in any other aspect disclosed herein. In another aspect the invention relates to the use of a composition comprising a basal brain medium, and at least three active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement to promote induction of a lateral ganglionic eminence (LGE) precursor fate in a fibroblast, preferably a human fibroblast (HF). In one embodiment the composition comprises four active agents that are Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement. In one embodiment the HF is an adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the use is according to the method of reprogramming a HF as described herein. In one embodiment the use provides a reprogramed HF LGE precursor or hiLGEP. Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments of the basal brain medium, ActA, protein kinase (PKC) inhibitor, p160ROCK inhibitor and N-2 supplement, as set forth in any other aspect disclosed herein. In another aspect the invention relates to the use of a composition comprising a basal brain medium, B27-RA, N2 supplement, a cAMP activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and Activin A to induce the expression of at least one biomarker associated with neuronal differentiation of a reprogrammed HF LGE precursor. In one embodiment the reprogrammed HF LGE precursor is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the reprogrammed HF is a hiLGEP as described herein. In one embodiment the use is as a cell culture media. In one embodiment the use is for about 13 to about 15 days, preferably for about 14 days. In one embodiment the use comprises using Activin A in the composition for about five to about nine days, preferably for about six to about eight days, preferably for about seven days. In one embodiment the composition comprises dorsomorphin. In one embodiment the use comprises using dorsomorphin in the composition for about three to about seven days, preferably for about four to about six days, preferably for about five days. In one embodiment the biomarkers are at least one of TUJ1, MAP2, DARPP32, GABA and GAD65 / 67, preferably at least three, at least four, preferably all five of TUJ1, MAP2, DARPP32, GABA and GAD65 / 67. Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments of the basal brain medium, B27-RA, N-2 supplement, cAMP activator, protein kinase (PKC) inhibitor, p160ROCK inhibitor, BDNF, dorsomorphin and ActA as set forth in any other aspect disclosed herein. In another aspect the invention relates to the use of a composition comprising a basal brain medium, B27-RA, N2 supplement, a cAMP activator, a p160ROCK inhibitor, brain derived neurotrophic factor (BDNF) and dorsomorphin to induce the expression of at least one of biomarker associated with neuronal differentiation of a reprogrammed HF LGE precursor. In one embodiment the reprogrammed HF LGE precursor is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the reprogrammed HF is a hiLGEP as described herein. In one embodiment the use is as a cell culture media. In one embodiment the use is for about 13 to about 15 days, preferably for about 14 days. In one embodiment the use comprises using dorsomorphin in the composition for about three to about seven days, preferably for about four to about six days, preferably for about five days. In one embodiment the composition comprises Activin A. In one embodiment the use comprises using Activin A in the composition for about five to about nine days, preferably for about six to about eight days, preferably for about seven days. In one embodiment the biomarkers are at least one of TUJ1, MAP2 DARPP32, GABA and GAD65 / 67, preferably at least three, at least four, preferably all five of TUJ1, MAP2, DARPP32, GABA and GAD65 / 67. Specifically contemplated as embodiments of this aspect of the invention are all of the embodiments of the basal brain medium, B27-RA, N-2 supplement, cAMP activator, protein kinase (PKC) inhibitor, p160ROCK inhibitor, BDNF, dorsomorphin and ActA as set forth in any other aspect disclosed herein. In another aspect the invention relates to the use of a composition comprising at least one induced human lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to make a medium spiny striatal neuron (MSN). In one embodiment the carrier is a buffer, a culture medium or a pharmaceutically acceptable carrier. In one embodiment the carrier is a pharmaceutically acceptable carrier. In one embodiment the hiLGEP is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the hiLGEP is made according to a method as described herein. In one embodiment the LGE transcription factor that is induced is at least one of GSX2, FOXP1, FOXP2, MEIS, CTIP2, preferably at least two, at least three, at least four, preferably all five of GSX2, FOXP1, FOXP2, MEIS, and CTIP2. In one embodiment the MSN is made in vitro or in vivo. In one embodiment the MSN is made in vitro by culturing the hiLGEP in STDM is supplemented with dorsomorphin and ActA as described herein. In one embodiment the MSN is made in vivo by transplanting the hiLGEP into a subject, preferably a human subject. In one embodiment transplanting comprises inserting the hiLGEP or into the subject. In one embodiment inserting is by injection. In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to treat Huntington’s disease. In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to reduce the severity of Huntington’s disease. In another aspect the invention relates to the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to delay the onset of Huntington’s disease. In another aspect the invention relates to the use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) in the manufacture of a medicament to treat Huntington’s disease. In another aspect the invention relates to the use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) in the manufacture of a medicament to reduce the severity of Huntington’s disease. In another aspect the invention relates to the use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) in the manufacture of a medicament to delay the onset of Huntington’s disease. In another aspect the invention relates to the use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) to treat Huntington’s disease. In another aspect the invention relates to the use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) to reduce the severity of Huntington’s disease. In another aspect the invention relates to the use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) to delay the onset of Huntington’s disease. The following embodiments are specifically contemplated as embodiments of any and / or all of the use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP), the use of a hiLGEP in the manufacture of a medicament and / or the use of a hiLGEP aspects described herein. In one embodiment the carrier is a pharmaceutically acceptable carrier. In one embodiment the composition is a pharmaceutical composition. In one embodiment the hiLGEP expresses at least one LGE transcription factor is selected from the group consisting of GSX2, DLX2, FOXP1, FOXP2, CTIP2 and MEIS2. In one embodiment the hiLGEP expresses at least two, preferably at least three, at least four, preferably all five of GSX2, DLX2, FOXP1, FOXP2, CTIP2 and MEIS2. In one embodiment the hiLGEP expresses at least one pro-neural factor, preferably NESTIN. In one embodiment the hiLGEP is a lineage specific cell. In one embodiment the hiLGEP is non-lineage specific cell. In one embodiment the hiLGEP is a reprogrammed adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the use comprises inserting the hiLGEP or the pharmaceutical composition into the striatum of a human subject. In one embodiment inserting is by injection. In one embodiment injecting is injecting into the striatum of a human subject suspected of having Huntington’s disease or having at least one symptom of Huntington’s disease. In one embodiment injecting comprises injecting a therapeutically effective amount the hiLGEPs or of the pharmaceutical composition. In one embodiment a therapeutically effective amount of the composition comprises at least about 1,000,000 viable hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, preferably at least about 5,000,000 viable hiLGEPs per injection. In one embodiment a therapeutically effective amount of the hiLGEPs is at least about 1,000,000 viable hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, preferably at least about 5,000,000 viable hiLGEPs. In another aspect the invention relates to a method of treating Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject having or suspected of having Huntington’s disease. In another aspect the invention relates to a method of ameliorating Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject suspected of having Huntington’s disease or having at least one symptom of Huntington’s disease. In another aspect the invention relates to a method of delaying the onset of Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject suspected of having Huntington’s disease or having at least one symptom of Huntington’s disease. In another aspect the invention relates to a method of reducing the severity of Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject suspected of having Huntington’s disease or having at least one symptom of Huntington’s disease. The following embodiments are specifically contemplated as embodiments of any and / or all of the method aspects of the invention as set out above. In one embodiment transplanting comprises transplanting a therapeutically effective amount of hiLGEP. In one embodiment a therapeutically effective amount of the hiLGEP comprises at least about 1,000,000 viable hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, preferably at least about 5,000,000 viable hiLGEPs. In one embodiment transplanting comprises inserting the hiLGEP into the striatum of the subject. In one embodiment inserting is by injection. In one embodiment the hiLGEP expresses at least one LGE transcription factor is selected from the group consisting of GSX2, DLX2, FOXP1, FOXP2, CTIP2 and MEIS2. In one embodiment the hiLGEP expresses at least two, preferably at least three, at least four, preferably all five of GSX2, DLX2, FOXP1, FOXP2, CTIP2 and MEIS2. In one embodiment the hiLGEP expresses at least one pro-neural factor, preferably NESTIN. In one embodiment the hiLGEP is a lineage specific cell. In one embodiment the hiLGEP is non-lineage specific cell. In one embodiment the hiLGEP has been reprogrammed from an adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast. In one embodiment the hiLGEP is comprised in a pharmaceutical composition comprising a physiologically acceptable carrier. In one embodiment transplanting comprises inserting the pharmaceutical composition into the striatum of a human subject. In one embodiment inserting is by injection. In one embodiment the pharmaceutical composition comprises a therapeutically effective amount of hiLGEPs. In one embodiment a therapeutically effective amount of the hiLGEPs is at least about 1,000,000 viable hiLGEPs per injection, preferably at least 2,000,000, at least 3,000,000, at least 4,000,000, preferably at least 5,000,000 viable hiLGEPs per injection. In one embodiment ameliorating Huntington’s disease comprises improving at least one symptom of Huntington’s disease. In one embodiment delaying the onset of Huntington’s disease comprises increasing the time of appearance of at least one symptom of Huntington’s disease that has not been observed in a subject. In one embodiment reducing the severity of Huntington’s disease comprises reducing the severity of at least one symptom of Huntington’s disease. In one embodiment the at least one symptom is selected from the group consisting of motor dysfunction including involuntary jerking or writhing movements (chorea), muscle problems, including rigidity or muscle contracture (dystonia), slow or unusual eye movements, impaired gait, posture and balance, and difficulty with speech or swallowing. Disclosed herein are compositions and methods that provide for the cellular reprogramming of human fibroblasts (HFs) to neural precursor cells. In a particular embodiment disclosed are compositions and methods that provide for the cellular reprogramming of HFs to human induced lateral ganglionic eminence precursor cells. As described herein cellular reprogramming using SOX2 and PAX6 cmRNA provides HFs with the ability to form cellular progeny having at least one new cellular phenotype as compared to the cellular progeny of the same HF cell type that have not been reprogramed. This new cellular phenotype can be observed in reprogrammed cells either in culture or in vivo. The cellular reprogramming described herein provides multipotent potential to a HF transfected with cmRNA as described herein. In this context, “multipotent potential” refers to a measurable proportion of the progeny of the reprogrammed cell having the potential to differentiate into cells displaying phenotypic characteristics of a new cell type, as compared to a cell that was not reprogramed and does not have that potential. In some embodiments, the proportion of progeny displaying phenotypic characteristics of a new cell type will be measurably more than before reprogramming. In some embodiments, the proportion of progeny displaying phenotypic characteristics of a new cell type will be at least 0.05%, 0.1%, 0.5%>, 1%, 5%, 10%, 15%, 25%, 30%, 40%, 50% or greater than observed in an appropriate control as understood by a person of skill in the art. In some embodiments, the reprogramed cell is a cell displaying phenotypic characteristics of a cell from the nervous system and / or a lineage specific neural cell. The term "lineage specific" is a genealogic pedigree of cells from a tissue type that are related products of cellular mitosis. As described herein, a neural precursor cell, particularly a human induced lateral ganglionic eminence precursor cell is a cell which is capable of differentiating into the cell and / or tissue types of the lateral ganglionic eminence neural cell lineage. In this regard, lineage specific the neural precursor cells, particularly the lineage specific induced human lateral ganglionic eminence precursor cells described herein are artificially created, multipotent precursor cells derived from a non-pluripotent and non- multipotent source. This source is exemplified herein using human dermal fibroblasts (HDFs) reprogrammed to express specific genes characteristic of lineage specific neural cells. In some embodiments, reprogramming of HFs with cmRNA(s) as described herein comprises the transfection of cmRNAs encoding SOX2 and PAX6 as described herein, into HDFs. Transfection comprises the introduction or delivery of the cmRNA encoding SOX2 or PAX6 into a HDF and is carried out using standard techniques of transfection as known and used by a person of skill in the art. Transfection protocols are provided in the examples included in the present specification and can be carried out as described. Standard transfection techniques are also known to the person of skill in the art, such as those described in WO2011 / 012316 which discloses methods for transfecting lung cells with mRNA using Lipofectamine 2000 (Invitrogen). Additional transfection protocols are also described by Kim and Eberwine (Anal Bioanal Chem. 397(8):3173-8 (2010)) who review biological, chemical and physical transfection methods that are employed in the art to deliver nucleic acids into cells. Transfection of HDFs as described herein comprises transfection with cmRNA. In some embodiments transfection comprises transfection with separate cmRNAs that encode SOX2 and PAX6. In some embodiments about 5 to 50% of the cytidine nucleotides and 5 to 50% of the uridine nucleotides of a cmRNA are modified. In some embodiments, about 10% to 35% of the cytidine and uridine nucleotides are modified. In some embodiments the cmRNA may comprise about 7.5 to 25% modified cytidine nucleotides and about 7.5 to 25% modified uridine nucleotides. In a preferred embodiment about 25% of the cytidine nucleotides and about 25% of the uridine nucleotides are modified. In some embodiments the modified uridine nucleotides are 2-thiouridin. In some embodiments the modified cytidine nucleotides are 5-methylcytidin residues. In some embodiments the adenosine- and guanosine-containing nucleotides are unmodified or partially modified. The cmRNA(s) encoding SOX2 and PAX6 as described herein can be made using recombinant methods in an in vivo or an in vitro system or can be made synthetically (e.g., conventional chemical synthesis on an automated nucleotide sequence synthesizer using a solid-phase support and standard techniques). A person of skill in the art can produce cmRNA recombinantly in an in vivo or an in vitro system or synthetically using known methods. Once produced by any method, cmRNAs can be purified and recovered using methods known to the skilled worker. In some embodiments an HF is an adult human fibroblast (aHF), a human dermal fibroblast (HDF) or an adult human dermal fibroblast (aHDF). Preferably the HF is an adult HDF. Fibroblasts are found generally in connective tissues where they are associated with collagen fibre formation and the production of connective tissue ground substance. Contemplated for cellular reprogramming as described herein are mammalian fibroblasts from any source tissue including, but not limited to fibroblasts from kidney, cardiac tissue, lung tissue, stroma and dermal tissue. In some embodiments the fibroblasts reprogrammed using the compositions and methods described herein are adult mammalian dermal fibroblasts, preferably adult human dermal fibroblasts (aHDFs). aHDFs are obtainable from commercial sources or may be isolated from various tissues as known in the art using known methodologies, laboratory equipment and techniques. Following transfection with cmRNA, fibroblasts are cultured to allow expression of the transfected RNAs and subsequent reprogramming. As described herein, HDFs are cultured under permissive conditions in a brain based reprogramming culture media that is capable of supporting the growth of neural precursor cells. Preferred brain based reprogramming media are Neurobasal-A and BrainPhys media but are not necessarily limited thereto. In some embodiments the medium is supplemented with various constituents that contribute to the remodelling process. As described herein some constituents are essential particularly preferred for reprogramming HFs (including HDFs) to neural precursor cells, particularly hiLGEPs. These constituents are termed “active agents” herein. Additional constituents of the medium can comprise a chromatin modifying agent to facilitate reprogramming. A chromatin modifying agent may be an agent that inhibits deacetylation of chromatin, alters histone methylation states within chromatin, induces to DNA demethylation within chromatin or promotes acetylation of chromatin. In one embodiment, valproic acid at an appropriate concentration, typically 1 μM, may be used as a chromatin modifying agent. The brain based reprogramming medium may also contain various combinations of some and / or all of the following constituents: amino acids (including non-essential amino acids), fatty acids lipids, growth factors, vitamin(s), antioxidant substances, cytokines, inorganic salts, pyruvic acid (pyruvate) and reducing agents such as 2-mercaptoethanol. In some embodiments the listed constituents are chosen for use at and supplied in the media at an appropriate concentration for culturing neural cells as based on what is known and used in the art. In some embodiments permissive conditions for the culture of neural cells are the conditions described in the examples provided in the present disclosure but are not limited there to. Cell cultures can also be performed under conditions permissive to the culture of neural cells as known and used in the art. Cultures can be grown in vessels including culture bags, tubes, flasks, bottles, dishes (including petri dishes and culture dishes), well plates (micro and multi), trays, and slide chambers, but not limited thereto. A skilled worker can choose an appropriate vessel for cell culture. HFs, particularly HDFs, being reprogramed as disclosed herein may be cultured in any appropriate volume of culture media. For example, volumes of from about 0.2 ml to about 2000 ml may be chosen as appropriate for culturing with the equipment and protocols available to the skilled person and depending on the permissive conditions required. In some embodiments bioreactors may be employed as known and used in the art. Culture vessels may be selected based on purpose and can be cellular adhesive or non-adhesive as known in the art. Cellular adhesive culture vessels may comprise a coating that promotes and / or improves cell adhesion to the vessel. A vessel comprising an interior surface coated to promote and / or improve cell adhesin may be coated with various constituents as known in the art including, but not limited to fibronectin, gelatin, laminin, collagen, vitronectin, poly-L or poly-D lysine, or mixtures thereof. A skilled worker can define further culturing conditions based on the present disclosure combined with what is known and used in the art. Such conditions include choice of temperature, oxygen tension and concentration of CO2. By way of non-limiting example, culture temperature can be in a range of about 30 to 40°C, including all temperature points in between, but not necessarily limited thereto, oxygen tension can be in a range of about 1 to 20%, including all percentages in between but not necessarily limited thereto, and CO2concentration can be about 1 to 10%, again including any percentage between, but not necessarily limited thereto. Components of the media / compositions In addition to the general considerations regarding cell culture provided, the inventors have determined that certain culture conditions are required for the effective reprogramming of HFs to hiLGEPs. These required conditions are set out as embodiments herein. In one example, reprogramming HFs, particularly HDFs, particularly aHDFs as described herein comprises transfecting the cells with cmRNA encoding the transcription factors, SOX2 and PAX6 followed by culturing the transfected cells with the broad-spectrum protein kinase C inhibitor Gö6983 (5µM), the p160ROCK inhibitor Y27632 (10µM) and 1% N-2 supplement (combination abbreviated to GYN), and 10µM retinoic acid in an brain-based reprogramming media containing 1mM valproic acid, 1% penicillin-streptomycin-glutamine, 2% B-27 without retinoic acid, 20ng / ml EGF, 20ng / ml FGF2, and 2µg / ml heparin. A preferred brain based reprogramming medium is BrainPhys. Cells are cultured for about 6 to 8 days, preferably about 7 days, after which the culture is passaged, and Activin A (25 ng / ml) is added to the culture media. The passaged cells are cultured for a further about 6 to 8 days, preferably about 7 days, for a total of about 12 to about 16 days in culture. A preferred number of total days in culture is about 14 days. Reprogramed cells were assayed to identify that reprogramming had acquired a lateral ganglionic eminence precursor fate using molecular and cytological techniques as known in the art and as described in the appended Example. A subset of reprogrammed cells having an LGEP fate were further differentiated as described in the appended Example into functional DARPP32 positive neurons in vitro. Pharmaceutical compositions as described herein are compositions that are suitable for administration to a subject, preferably a human subject. A pharmaceutical composition comprising hiLGEPs as described herein may be formulated as appropriate for methods of cell transplantation therapy. In some embodiments such pharmaceutical compositions are used in to treat Huntington’s disease or to at least reduce the severity and / or to delay the onset of, Huntington's disease. In addition to comprising hiLGEPs as described herein, the pharmaceutical compositions described herein comprise pharmaceutically acceptable carriers, diluents and / or excipients. As used herein a pharmaceutically acceptable carrier is a physiologically acceptable carrier. Pharmaceutically acceptable carriers, diluents and / or excipients include inactive substances included in formulations of hiLGEPs as described herein. Such substances serve various purposes in the formulations. In one example, such substances are used for bulking up formulations to allow greater convenience and / or accuracy when producing dosage forms. Such substances may be referred to as diluents, fillers or bulking agents. Pharmaceutically acceptable carriers, diluents and / or excipients can also provide therapeutic-enhancing properties to a formulation, including but not limited to facilitating solubility or absorption of an active agent. Various excipients are also used to reduce difficulties in handling active agents during manufacturing, e.g., by providing flowability or non-stick properties. Additionally, various carriers, diluents and / or excipients may provide stabilizing properties, including preventing oxidation, crystallization or denaturation, to increase formulation shelf life. The choice of the appropriate pharmaceutically acceptable carriers, diluents and / or excipients for any given formulation is believed to be within the skill of those in the art. Consideration will be given to various factors when designing such formulations including dosage form, the nature of the active ingredient, route of administration and others. A number of well-known pharmaceutically acceptable carriers, excipients and / or diluents suitable in many formulations include water, saline, phosphate buffered saline (PBS), wetting agents, and emulsifiers. Pharmaceutical compositions comprising various pharmaceutically acceptable carriers can be formulated by well-known conventional methods. Pharmaceutical compositions comprising hiLGEPs as described herein are formulated to comprise an effective amount of the hiLGEPs together with an appropriate pharmaceutically acceptable carrier, diluent and / or excipient. Such formulations can readily be determined by the skilled person based on the disclosure provided herein and methods known in the art. As will be appreciated, a "therapeutically effective amount" is an amount sufficient to induce a detectable therapeutic response in the subject to which the pharmaceutical composition is administered. In some embodiments the therapeutically effective amount is at least about 1,000,000 hiLGEPs / injection dose, preferably 2,000,000, preferably 3,000,000, preferably 4,000,000, preferably at least about 5,000,000 hiLGEPs per dose. In one embodiment a dose is an injection dose. Administration of a therapeutically effective amount of hiLGEPs as described herein comprises administration of the hiLGEP or a pharmaceutical composition comprising hiLGEPs as described herein and can be carried out using various cell transplantation techniques appropriately chosen for cell therapy as known to the person of skill in the art. It is believed that methods to transplant cells for transplantation therapy are well known to the person skilled in the art. By way of non-limiting example, cells to be transplanted may be administered by intracerebral injection, stereotaxic injection, localized injection, or by direct injection into the vertebral channel. The pharmaceutical composition described herein may also comprise appropriate amount of a carrier comprising a pharmaceutically acceptable salt or other pharmaceutically acceptable substances. The presence of the pharmaceutically acceptable salt and / or other substances is to render the pharmaceutical composition isotonic. By way of non-limiting example, the carrier may include saline, Ringer's solution and dextrose solution. Pharmaceutically acceptable carriers, diluents and / or carriers (including stabilizers) are non-toxic at the dosages and concentrations employed. Suitable carriers and their formulations are described in greater detail in Remington's Pharmaceutical Sciences, 17th ed., 1985, Mack Publishing Co. Progress. Pharmaceutically acceptable carriers, diluents and / or excipients may include, but are not limited to, buffers including citrate, phosphate, and other organic acid buffers; proteins including serum albumin, or gelatine and / or low molecular weight (> 10 amino acid residues) polypeptides; chelating agents including EDTA; non-ionic surfactants such as Tween, Pluronics or polyethylene glycol; salt- forming counter-ions including sodium and potassium; hydrophilic polymers such as polyvinylpyrrolidone (PVP); amino acids including histidine, glutamine, lysine, asparagine, arginine, or glycine; antioxidants including methionine, ascorbic acid and tocopherol; carbohydrates such as glucose, mannose, dextrose or dextrins; various mono- and di-saccharides; various sugars including sucrose, mannitol, trehalose or sorbitol; and / or a number of different preservatives, e.g. octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens, e.g. methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol). 6. EXAMPLES Materials and Methods Adult Human Fibroblast Direct-to-Induced Lateral Ganglionic Eminence Precursor Cell Reprogramming and Differentiation. Human induced lateral ganglionic eminence precursor (hiLGEP) cells were generated from adult human dermal fibroblast (aHDF) cell lines (1507: Male Caucasian, 50 years old, facial tissue; 1838: Male Caucasian, 50 years old, facial tissue; 2116: Female Caucasian, 35 years old, abdominal tissue; 2298: Female Caucasian, 33 years old, abdominal tissue; Cell Applications Inc). aHDF cells were cultured in Dulbecco’s modified eagle medium (DMEM; Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific). aHDFs were induced to a lateral ganglionic eminence precursor (LGEP) fate by transient over-expression of the pro-neural genes SOX2 and PAX6 using chemically modified mRNA (cmRNA; Ethris GmbH, Munich, Germany) (Connor et al., 2018). Several transfection protocols were utilized in this work, with both protocols providing successful transfections and resulting in the same morphological changes in transfected cells being observed over the course of reprograming (Figure 7). In a first protocol, the aHDFs were transfected with 2.5µg of each SOX2 and PAX6 cmRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific) transfection reagent. Five-hour transfections were conducted over four consecutive days. In a second protocol, hiLGEP were induced by reprogramming of aHDFs using transient overexpression of the pro-neural genes SOX2 and PAX6 combined into lipo-nano-particle technology (LNP; Ethris GmbH, Munich, Germany). A one-off 24-hour transfection was performed using 2.5µg of SOX2-PAX6- LNP. Briefly, the SOX2-PAX6-LNP was added to 500µL of Opti-MEM™ Reduced Serum Medium (Gibco) and gently mixed, followed by adding the transfection mix dropwise to the well containing reprogramming medium. The cells transfected using both protocols were cultured and reprogrammed under normoxia in either a Neurobasal-A (NBA; Thermo Fisher Scientific) or a BrainPhys™-based (Stem Cell Technologies) reprogramming medium containing 1mM valproic acid (Sigma Aldrich), 1% penicillin-streptomycin- glutamine (Thermo Fisher Scientific), 2% B-27 without retinoic acid (Thermo Fisher Scientific), 20ng / ml epidermal growth factor (EGF) (Prospec Bio), 20ng / ml fibroblast growth factor 2 (FGF2) (Prospec Bio), 2µg / ml heparin (Sigma Aldrich), 1% N-2 supplement (Thermo Fisher Scientific), 5µM Gö6983 (Abcam), 10µM Y27632 (Abcam), and 10µM retinoic acid (Sigma Aldrich). The cells were passaged at Day 7 of reprogramming and Activin A (25ng / mL; Prospec Bio) was added to the reprogramming medium from Day 7 to Day 14 of reprogramming (Figure 1). After 14 days of reprogramming the hiLGEPs were collected for transplantation into an art accepted model of Huntington’s disease, a quinolinic acid (QA) lesioned rat striatum. At Day 14 of reprogramming, hiLGEPs were collected either for transplantation or were processed for RT-qPCR and immunocytochemistry to confirm the acquisition of a LGEP cell fate. An additional subset of cells were plated out for differentiation at 60,000 cells / well on GelTrex-coated glass coverslips and cultured in either NBA-based or BrainPhys™-based striatal differentiation media containing 1% penicillin-streptomycin-glutamine, 2% B-27 supplement without retinoic acid, 1% N-2 supplement, 10µM Y-27632, 10µM forskolin (Sigma Aldrich), 30ng / mL BDNF (PeproTech) and for the first 5 days, 1µM dorsomorphin (Sigma Aldrich) with or without 5µM Gö6983, and the first 7 days 25ng / mL Activin A. After 14 days of differentiation, the cells were fixed with 4% paraformaldehyde at 4⁰C and processed for immunocytochemistry. Quantitative RT-PCR Total RNA was isolated from hiLGEPs at 14 days of reprogramming and the originating aHDF cell line using the Nucleospin RNA kit (Macherey Nagel). cDNA was synthesised from total RNA using Superscript IV reverse transcriptase (Thermo Fisher Scientific). Duplex qPCR reactions were performed using the TaqMan system (Applied Biosystems) with ribosomal 18S rRNA as the internal standard and an equivalent of 4-10ng RNA per reaction, in triplicate. Gene expression was normalised to ribosomal 18S rRNA as the internal standard. Gene expression was presented as fold change relative to aHDFs using the ΔΔCt method. Immunocytochemistry The cells were first permeabilised in phosphate-buffered saline with 0.5% Triton X-100 for 5 minutes. The following human-specific primary antibodies were used: GSX2 (1:500, Abcam), FOXP1 (1:100, R&D), FOXP2 (1:500, Abcam), MEIS2 (1:500, Abcam), TUJ1 (1:500, Abcam), DARPP32 (1:500, Invitrogen), GABA (1:500, Invitrogen) and GAD65 / 67(1:500, AbCam). The species-appropriate Alexa Fluor™ secondary conjugated antibodies (1:500; Invitrogen) were used for visualisation of the primary antibody. DAPI included in Prolong Diamond antifade mountant (Thermo Fisher Scientific) was used to confirm individual cell nuclei. Images were captured using an inverted Nikon TE2000E fluorescence microscope equipped with a DS-Ri2 camera. Quantification of the number of TUJ1+ or DARPP32+ hiLGEP-derived neurons was undertaken manually in ImageJ as a proportion of DAPI+ cells from a minimum of 500 DAPI+ cells. Live-Cell Calcium Imaging hiLGEPs were plated out for differentiation at 80,000 cells / well on GelTrex-coated glass bottom Greiner black wall plates and cultured in BrainPhys™-based striatal differentiation media for 14 days as described above. The cells were loaded with 5mM of Cal-520 AM (Abcam) with 0.04% Pluronic F-127 (Thermo Fisher Scientific) and incubated at 37°C for 1 h, followed by incubation at room temperature for 30 min. The Cal-520 AM dye working solution was replaced with Hank’s Balanced Salt Solution buffer without phenol red (Thermo Fisher Scientific) containing 1mM Probenecid and 20mM 4-(2- hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific). Cells were imaged at Ex / Em = 420 / 525nm for Cal-520 AM fluorescence intensity for a total of 180 seconds, with or without glutamate treatment at 12.5, 25, and 50µM. Timelapse recordings were captured on a Nikon TE2000E inverted microscope equipped with a colour DS-Ri2 camera using NIS Elements BR software. Live-cell calcium imaging analysis was conducted using the Time Series Analyser plugin in FIJI. Average florescence intensity values for 100 regions of interest were recorded from 2 replicates. Fluorescence was measured as the percentage increase in average fluorescence intensity relative to baseline fluorescence at time 0 (DF / F0). Animals Adult male Sprague-Dawley rats (University of Auckland Vernon Jansen Unit) 250 to 350 g (8 weeks old) at the time of quinolinic acid (QA) lesions were used in this study. All procedures strictly complied with the University of Auckland Animal Ethics Guidelines, in accordance with the New Zealand Animal Welfare Act 1999 and international ethical guidelines. All efforts were made to minimize the number of animals used and their suffering. The rats were randomly allocated into the following treatment groups: hiLGEP transplants n = 15; sham transplants (0.9% sterile saline) n = 15. The rats were group-housed in a temperature- and humidity- controlled room on a 12-hour light / dark cycle. Food and water were available ad libitum throughout the whole study. Forty-eight hours before transplant surgery, all rats received an intraperitoneal injection of Sandimmun (20mg / kg Cyclosporine; supplied by the Vernon Jansen Unit, University of Auckland). Following the transplant surgery, Sandimmun injections continued thrice weekly for the entirety of the experiment. Surgical Procedures All surgeries were performed using isoflurane anaesthetic (induction 5% isoflurane and a flow rate of 2 L / min O2; maintenance 1.5% isoflurane and a flow rate of 1.5 L / min O2). All rats received a unilateral intrastriatal infusion of QA (50 nmol, 400 nl; 100 nl / min with a 32G Hamilton syringe controlled by a WPI UltraMicroPump II) at the following stereotaxic coordinates: +0.5 mm anterior-posterior (AP), -2.7 mm medial-lateral (ML), relative to bregma and -5.0 mm dorsal-ventral (DV) from the dural surface (Vazey & Connor, 2010; Vazey et al., 2006; Vazey et al., 2010). Injections of hiLGEPs (~250,000 viable cells per animal) or 0.9% sterile saline were performed 21 days after QA lesioning into two adjacent sites in the lesioned striatum (~62,500 viable cells / µl: 2 µl per injection site; 400 nl / min with a 26G Hamilton syringe) at the following stereotaxic coordinates: +0.3 mm AP, -2.5 mm ML, at -5.0 and -4.0 mm DV (Vazey & Connor, 2010; Vazey et al., 2006; Vazey et al., 2010). Spontaneous Exploratory Forelimb Use The rats were placed in a Plexiglas cylinder (20 cm diameter) and their behaviour videotaped for 5 min. Baseline tests of motor function were obtained prior to QA lesioning. Motor function was also assessed 2 weeks following QA lesioning. Following transplantation, the rats were assessed at 2-, 4-, 12- and 14-weeks post-transplantation. Spontaneous exploratory forelimb use was scored by an experimenter blind to the condition of the animals during slow-motion feedback of the videotaped sessions using forelimb asymmetry analysis as described (Schallert et al., 2000). Forelimb use was assessed as a single asymmetry score representing the overall ipsilateral forepaw use for rearing, wall placement, and landing during exploratory rearing over a 5- minute trial period (Vazey & Connor, 2010; Vazey et al., 2006). Rats that failed to respond to the QA lesion by predominantly using the forelimb contralateral to the lesion were removed from all analysis. Immunohistochemical Analysis Rats were culled 14 weeks after transplantation with sodium pentobarbital (120mg / kg i.p.) followed by transcardial perfusion with 0.9% saline and 4% paraformaldehyde. Brains were cryoprotected in 30% sucrose before sectioning coronally at 40 µm on a HM450 sliding microtome (Microm International GmbH, Walldorf, Germany). Eight sets of sections were collected from each brain (distance 320 µm between consecutive sections in each set) and stored at -20⁰C. Fluorescent immunohistochemistry was performed on free-floating coronal sections from each animal using antibodies against STEM121 (1:500, Takara), TUJ1 (1:500, Biolegend), MAP2 (1:500, Sigma Aldrich), DARPP32 (1:500, Invitrogen), GAD65 / 67(1:500, AbCam), and GABA (1:500, Invitrogen). The species-appropriate Alexa Fluor™ secondary conjugated antibodies (1:500; Invitrogen) were used for visualisation of the primary antibody. DAPI (1:1000, Thermo Fisher Scientific) was used to confirm individual cell nuclei. Imaging was undertaken on a Nikon TE2000E inverted microscope (Nikon) equipped with a Nikon DS-Ri2 camera or on a Zeiss LSM 710 inverted confocal scanning laser microscope (Biomedical imaging Resource Unit, University of Auckland). Statistical Analysis Statistical analyses were performed using IBM SPSS Statistics v28 (IBM Corporation). Levene’s test for equality of variances was performed on all data. A one-way or two-way analysis of variance was used for comparison of media composition and / or cell line. Post-hoc analyses were performed with the Bonferroni test. A two-way mixed ANOVA with subsequent simple main effect analysis using Bonferroni correction was used to compare the spontaneous exploratory forelimb use of hiLGEP-transplanted animals to sham overtime. All data are presented as mean ± SEM. Results were considered significant if p < 0.05. Results Adult human dermal fibroblasts can be directly reprogrammed to a lateral ganglionic eminence phenotype. Figure 1 depicts the direct reprogramming and differentiation protocols disclosed herein, that promote the generation of neural precursor cells with a hiLGEP phenotype and enhance differentiation to MSNs. In the examples provided herein, the inventors have investigated the effect of adding the broad- spectrum protein kinase C inhibitor Gö6983 (5µM), the p160ROCK inhibitor Y27632 (10µM) and 1% N- 2 supplement (combination abbreviated to GYN), and 10µM retinoic acid to our standard NBA-based reprogramming media containing 1mM valproic acid, 1% penicillin-streptomycin-glutamine, 2% B-27 without retinoic acid, 20ng / ml EGF, 20ng / ml FGF2, and 2µg / ml heparin. Most importantly, the inventors included Activin A (25 ng / ml) to the media after 7 days of reprogramming. After 14 days of reprogramming, the inventors observed that NBA supplemented with Activin A either with or without GYN had little effect on the expression of the striatal transcription factors GSX2 or DLX2 compared to NBA media alone (Figure 2A). In contrast, NBA supplemented with Activin A up-regulated the expression of the lateral ganglionic eminence (LGE)-selective gene CTIP2, which was further up-regulated with the addition of GYN (Figure 2A). The inventors next compared the effect of the base media Brain Phys™ to NBA on hiLGEP gene expression after 14 days reprogramming (Figure 2B). After 14 days of reprogramming, an up-regulation of CTIP2 in cells reprogrammed in BrainPhys™ supplemented with Activin A alone was not seen. However, when BrainPhys™ was supplemented with both GYN and Activin A we observed a large up- regulation of CTIP2 (Figure 2B). Combined, these results indicate that Activin A in combination with Gö6983, Y27632 and N-2 promotes the expression of the key LGEP gene CTIP2. To confirm the ability of BrainPhys™ supplemented with GYN and Activin A to induce the expression of LGE transcription factors we collected cells after 14 days of reprogramming with SOX2 / PAX6 cmRNA and assessed both gene and protein expression. After 14 days of reprogramming the inventors observed extensive colony formation (Figure 2C) as well as up-regulation of the pro-neural factor NESTIN and the LGE transcription factors DLX2, FOXP2 and CTIP2 when compared to aHDF (Figure 2D). The inventors did not see a change in expression of the pro-glutamatergic neural factor NGN2 (Colasante et al., 2019). At the protein level, the reprogrammed cells expressed GSX2, FOXP1, FOXP2 and MEIS2 (Figures 2E-H). Without wishing to be bound by theory, the inventors believe that the above findings support the proposition that BrainPhys™ supplemented with GYN and Activin A promotes the induction of an LGE precursor fate. Directly reprogrammed human lateral ganglionic eminence precursors differentiate to functional DARPP32 positive neurons in vitro. To ensure optimal differentiation of hiLGEPs to an MSN fate, the inventors compared the effect of NBA and BrainPhys™ media on neuronal differentiation. Also investigated was whether the addition of Activin A for the first 7 days of differentiation could enhance striatal differentiation (Figure 1). hiLGEPs that were reprogrammed in NBA media were subsequently differentiated in NBA and hiLGEPs reprogrammed in BrainPhys™ media were differentiated in BrainPhys™. It was observed that differentiation of hiLGEPs in NBA-based striatal differentiation media containing Activin A resulted in 1.2% ± 0.33% to 14.33% ± 3.4% TUJ1 / DAPI-positive cells regardless of the reprogramming protocol (Figure 3A). In contrast, hiLGEPs reprogrammed in BrainPhys™ supplemented with GYN and Activin A and differentiated in BrainPhys™ -based striatal differentiation media containing Activin A significantly enhanced the generation of TUJ1-positive cells to 63.8% ± 4.59% of the total DAPI+ cell population compared to 9.4% ± 1.74% TUJ1 / DAPI-positive cells from hiLGEPs reprogrammed with BrainPhys™ and Activin A alone (Figure 3A). Similarly, the number of DARPP32-positive cells following differentiation in NBA- based standard striatal differentiation media was very low (0.15% ± 1.15% to 10.76% ± 2.2%; Figure 3B). However, hiLGEPs reprogrammed in BrainPhys™ supplemented with GYN and Activin A and differentiated in BrainPhys™ -based striatal differentiation media containing Activin A resulted in 42.45% ± 2.72% of the total DAPI+ cell population expressing DARPP32 compared to 3.77% ± 0.95% of DARPP32 / DAPI-positive cells from hiLGEPs reprogrammed with BrainPhys™ and Activin A alone (Figure 3B & 4A, B & C). Further demonstration on the effect of reprogramming with GYN alone or in combination with Activin A can be seen in Figures 3D & E. The findings confirm that reprogramming SOX2 / PAX6 cmRNA-transfected aHDFs in BrainPhys™ supplemented with GYN and Activin A promotes the induction of hiLGEPs and differentiation of hiLGEPs in BrainPhys™ media supplemented with Activin A enhances the generation of DARPP32-positive neurons. Finally, the inventors investigated whether supplementation of BrainPhys™ -based striatal differentiation media with the AMP-activated kinase inhibitor dorsomorphin for the first 5 days of differentiation or supplementation with the broad-spectrum protein kinase C inhibitor Gö6983 for the first 5 days of differentiation followed by dorsomorphin for the next 5 days of differentiation could further enhance the generation of DARPP32-positive neurons. Also compared was the effect of dorsomorphin with or without Gö6983 between 2 independent cell lines (2116 and 1507) to assess consistency and robustness of DARPP32-positive neuronal yield. Interestingly the addition of dorsomorphin with or without Gö6983 did not significantly alter the proportion of DARPP32-positive neurons compared to standard BrainPhys™ -based striatal differentiation media (Figure 3C). There was a significant interaction of differentiation condition and cell line (2-way ANOVA; p = 0.001) indicating the different media conditions had an effect on DARPP32 yield which differed between cell lines. While a significant increase in DARPP32-positive cells was seen when striatal differentiation media was supplemented with Gö6983 and dorsomorphin compared to dorsomorphin alone for line 2116 (p = 0.007; Figure 3C), Further post hoc analysis determined that BrainPhys™ -based striatal differentiation media supplemented with dorsomorphin alone produced the most consistent DARPP32-positive cell yield between cell lines (p = 0.088 for 2116 compared to 1507 in striatal differentiation + dorsomorphin; p = 0.0008 for 2116 compared to 1507 in striatal differentiation only; p = 0.0003 for 2116 compared to 1507 in striatal differentiation + Gö6983 + dorsomorphin). Based on these findings, the inventors chose to use BrainPhys™ -based striatal differentiation media supplemented with dorsomorphin for the first 5 days and Activin A for the first 7 days of differentiation. Using these culture conditions, the inventors were able to generate TUJ1+ neurons co-expressing DARPP32 as well as GABA-positive and GAD65 / 67-positive neurons, which exhibited extensive neurite outgrowth and network formation (Figures 4A – E). Functionality of hiLGEP-derived neurons was demonstrated by live-cell calcium imaging (video data not shown, representative data provided in snapshot image Figure 4F&G). Cultures were loaded with the fluorescence-based calcium indicator Cal- 520, and exposed to either 0, 12.5, 25, or 50µM glutamate. Cal-520 fluorescence was measured as the percentage increase in average fluorescence intensity relative to baseline at time 0. hiLGEP-derived neurons exhibited an increase in Cal-520 fluorescence with increasing concentration of glutamate, with the average intensity greatest for 25µM glutamate peaking at 90 seconds after glutamate administration followed by a reduction in average intensity between 95 - 100 seconds of -300 to -750 % relative to baseline (Figures 4F). Transplantation of directly reprogrammed human lateral ganglionic eminence precursors reduces impairment of spontaneous exploratory forelimb use. The spontaneous exploratory forelimb use test is a non-drug induced test of forelimb locomotor function that is dependent on the integrity of intrinsic striatal neurons, the nigrostriatal dopaminergic system and the sensorimotor area of the neocortex. Following a unilateral striatal lesion, rats will preferentially use the forelimb ipsilateral to the lesion to initiate and terminate weight-shifting movements during rearing and exploration along vertical surfaces (Vazey & Connor, 2010; Vazey et al., 2006). Using the spontaneous exploratory forelimb use test, the inventors investigated the effect of transplanting hiLGEPs into the QA-lesioned striatum on forelimb locomotor function at 2-, 4-, 12- and 14-weeks following transplantation (Figure 5A). A two-way mixed ANOVA with subsequent simple main effects analysis demonstrated a significant interaction between time and treatment (F = 2.83, df = 5, p = 0.043). After QA lesioning, both treatment groups exhibited a significant preference for use of the ipsilateral forelimb compared to baseline (saline treatment, p = 0.017; hiLGEP treatment, p = 0.027, Figure 5B). Animals that received saline treatment continued to exhibit a significant preference for ipsilateral forelimb use over time when compared to baseline (2 weeks post-transplant, p = 0.008; 12 weeks post-transplant, p = 0.036; 14 weeks post-transplant, p = 0.026; Figure 5B). In contrast, hiLGEP transplanted animals only exhibited a significant preference for ipsilateral forelimb use at 2 weeks post-transplant when compared to baseline (p = 0.04; Figure 5B). Extending this observation, a significant decrease in the ipsilateral forelimb use of hiLGEP transplanted animals was seen at 14 weeks post-transplant when compared to after QA lesioning (*; p = 0.027; Figure 5B). These results indicate that striatal transplantation of hiLGEPs can reduce impairment of spontaneous exploratory forelimb use caused by QA lesioning of the striatum. Human induced lateral ganglionic eminence precursors survive transplantation into the QA lesioned striatum and differentiate to medium spiny striatal neurons. The inventors also investigated the capability for SOX2 / PAX6 cmRNA directly reprogrammed hiLGEPs to survive transplantation and differentiate to medium spiny striatal neurons (MSNs) in the rat QA lesion model of HD. hiLGEP-derived neurons were identified in the QA lesioned rat striatum by expression the human cytoplasmic marker STEM121 (14 weeks post-transplantation; Figure 6A). At 14 weeks after transplantation, STEM121-positive cells were detected within a defined boundary in the anterior aspect of the striatum of hiLGEP transplanted animals (Figure 6A). No STEM121-positive cells were detected in the animals that received injection of sterile saline. STEM121-positive cells displayed a distinctive neuronal morphology with extensive neurite outgrowth seen by 14 weeks post-transplant (Figure 6A&A’). The inventors did not observe STEM121- positive cells exhibiting an astrocytic morphology and there was no co-expression of STEM121 with GFAP (data not shown). To determine the resultant phenotype of the hiLGEP-derived neurons 14 weeks after transplantation into the QA lesioned striatum, double-label immunofluorescence for STEM121 and cell type-specific markers was performed. At 14 weeks post-transplantation, STEM121-positive cells co-expressed MAP2 (Figure 6B1 and 6B2) with the majority of STEM121-positive cells co-expressing DARPP32 (Figure 6C1 and 6C2). A sub- population of STEM121-positive cells also expressed GABA (Figure 6E1 and 6E2) with a small number of STEM121-positive cells co-expressing the enzyme GAD65 / 67 (Figure 6D1 and 6D2). We also observed GABA-positive / STEM121-negative cells displaying an astrocytic morphology (Figure 6E1 and 6E2). Astrocytes have been shown to synthesis and uptake GABA via multiple pathways (Ishibashi et al., 2019; Jo et al., 2014). The lack of STEM121 co-expression indicates the astrocytes are from the host rat brain in response to the QA lesion. Furthermore, this observation combined with the lack of STEM121 co-expression with GFAP demonstrates the transplanted hiLGEPs do not generate astrocytes following transplantation. These results indicate that SOX2 / PAX6 cmRNA direct reprogramming generates hiLGEPs which survive transplantation and differentiate into medium spiny striatal neurons (MSNs) in the QA lesioned rat striatum. Discussion – Conclusion The results provided by this study demonstrate that aHDFs can be directly reprogrammed to hiLGEPs following transient cmRNA-mediated over-expression of SOX2 and PAX6 and exposure to Activin A, Gö6983, Y27632 and N-2 in a BrainPhys™-based reprogramming medium. Also demonstrated for the first time is that the transplantation of directly reprogrammed hiLGEPs results in a high yield of medium spiny striatal neurons (MSNs) in a QA lesioned rat striatum, an art accepted animal model of a brain degenerative disorder, specifically Huntington’s disease. Furthermore, transplantation of hiLGEPs in the QA lesioned striatum significantly reduces motor function impairment as determined by spontaneous exploratory forelimb use when compared to saline treated animals. Without wishing to be bound by theory, the inventors believe that based on these findings, the use of cmRNA directly reprogrammed hiLGEPs offers an effective and clinically viable strategy for cell replacement therapy to treat brain degenerative disorders, particularly Huntington’s disease. 7. INDUSTRIAL APPLICATION The present invention is useful for cellular reprogramming of HDFs to neuronal precursor cells, having applications in both research and medicine. Those persons skilled in the art will understand that the above description is provided by way of illustration only and that the invention is not limited thereto. 8. REFERENCES An, M. C., Zhang, N., Scott, G., Montoro, D., Wittkop, T., Mooney, S., Melov, S., & Ellerby, L. M. (2012). Genetic correction of huntington's disease phenotypes in induced pluripotent stem cells. Cell Stem Cell, 11(2), 253-263. Arber, C., Precious, S. V., Cambray, S., Risner-Janiczek, J. R., Kelly, C., Noakes, Z., Fjodorova, M., Heuer, A., Ungless, M. A., Rodriguez, T. A., Rosser, A. E., Dunnett, S. B., & Li, M. (2015). Activin A directs striatal projection neuron differentiation of human pluripotent stem cells. Development, 142(7), 1375-1386. Aubry, L., Bugi, A., Lefort, N., Rousseau, F., Peschanski, M., & Perrier, A. L. (2008). Striatal progenitors derived from human ES cells mature into DARPP32 neurons in vitro and in quinolinic acid-lesioned rats. Proceedings of the National Academy of Sciences, 105, 16707-16712. Caron, N., Wright, G., & Hayden, M. (1998). Huntington Disease. . In M. Adam, D. Everman, & G. Mirzaa, et al., (Eds.), GeneReviews® [Internet]. https: / / www.ncbi.nlm.nih.gov / books / NBK1305 / Colasante, G., Rubio, A., Massimino, L., & Broccoli, V. (2019). Direct Neuronal Reprogramming Reveals Unknown Functions for Known Transcription Factors [Review]. Frontiers in Neuroscience, 13. doi.org / 10.3389 / fnins.2019.00283 The Use of Stem Cells for Understanding and Treating Huntington's , doi.org / 10.1002 / stem.2747 Connor, B., Firmin, E., McCaughey-Chapman, A., Monk, R., Lee, K., Liot, S., Geiger, J., Rudolph, C., & Jones, K. (2018). Conversion of adult human fibroblasts into neural precursor cells using chemically modified mRNA. Heliyon, 4(11), e00918. doi.org / 10.1016 / j.heliyon.2018.e00918 Delli Carri, A., Onorati, M., Castiglioni, V., Faedo, A., Camnasio, S., Toselli, M., Biella, G., & Cattaneo, E. (2013). Human pluripotent stem cell differentiation into authentic striatal projection neurons. Stem Cell Rev, 9(4), 461-474. doi.org / 10.1007 / s12015-013-9441-8 Dunnett, S. B., Nathwani, F., & Björklund, A. (2000). Chapter 16 The integration and function of striatal grafts. In Prog Brain Res (Vol. 127, pp. 345-380). Elsevier. doi.org / 10.1016 / S0079-6123(00)27017-9 Faedo, A., Laporta, A., Segnali, A., Galimberti, M., Besusso, D., Cesana, E., Belloli, S., Moresco, R. M., Tropiano, M., Fuca, E., Wild, S., Bosio, A., Vercelli, A. E., Biella, G., & Cattaneo, E. (2017). Differentiation of human telencephalic progenitor cells into MSNs by inducible expression of Gsx2 and Ebf1. Proc Natl Acad Sci U S A, 114(7), E1234-E1242. doi.org / 10.1073 / pnas.1611473114 González, F., Boué, S., & Belmonte, J. C. I. (2011). Methods for making induced pluripotent stem cells: reprogramming à la carte [10.1038 / nrg2937]. Nat Rev Genet, 12(4), 231-242. doi.org / http: / / www.nature.com / nrg / journal / v12 / n4 / suppinfo / nrg2937_S1.html GABAergic Signaling. , Jeon, I., Lee, N., Li, J.-Y., Park, I.-H., Park, K. S., Moon, J., Shim, S. H., Choi, C., Chang, D.-J., Kwon, J., Oh, S.-H., Shin, D. A., Kim, H. S., Do, J. T., Lee, D. R., Kim, M., Kang, K.-S., Daley, G. Q., Brundin, P., & Song, J. (2012). Neuronal Properties, In Vivo Effects, and Pathology of a Huntington's Disease Patient-Derived Induced Pluripotent Stem Cells. STEM CELLS, 30(9), 2054-2062. doi.org / 10.1002 / stem.1135 Y. J., Chun, Y. E., Park, M., Woo, D. H., Bae, J. Y., Kim, T., Lee, J., Chun, J., Kim, H. Y., Oh, S.-J., Park, S. J., Lee, H., Yoon, B.-E., Kim, Y., . . . Lee, C. J. (2014). GABA from reactive astrocytes impairs memory in mouse models of Alzheimer's disease. Nature Medicine, 20(8), 886-896. doi.org / 10.1038 / nm.3639 Joannides, A. J., Webber, D. J., Raineteau, O., Kelly, C., Irvine, K.-A., Watts, C., Rosser, A. E., Kemp, P. J., Blakemore, W. F., Compston, A., Caldwell, M. A., Allen, N. D., & Chandran, S. (2007). Environmental signals regulate lineage choice and temporal maturation of neural stem cells from human embryonic stem cells. Brain, 130(5), 1263-1275. http: / / brain.oxfordjournals.org / cgi / content / abstract / 130 / 5 / 1263. Kendall, A. L., Rayment, F. D., Torres, E. M., Baker, H. F., Ridley, R. M., & Dunnett, S. B. (1998). Functional integration of striatal allografts in a primate model of Huntington's disease. Nature Medicine, 4, 727-729. Nicoleau, C., Varela, C., Bonnefond, C., Maury, Y., Bugi, A., Aubry, L., Viegas, P., Bourgois-Rocha, F., Peschanski, M., & Perrier, A. L. (2013). Embryonic stem cells neural differentiation qualifies the role of Wnt / beta-Catenin signals in human telencephalic specification and regionalization. STEM CELLS, 31(9), 1763-1774. doi.org / 10.1002 / stem.1462 Palfi, S., Conde, F., Riche, D., Brouillet, E., Dautry, C., Mittoux, V., Chibois, A., Peschanski, M., & Hantraye, P. (1998). Fetal striatal allografts reverse cognitive deficits in a primate model of Huntington's disease. Nature Medicine, 4, 963-966. Reidling, J. C., Relaño-Ginés, A., Holley, S. M., Ochaba, J., Moore, C., Fury, B., Lau, A., Tran, A. H., Yeung, S., Salamati, D., Zhu, C., Hatami, A., Cepeda, C., Barry, J. A., Kamdjou, T., King, A., Coleal- Bergum, D., Franich, N. R., Laferla, F. M., . . . Thompson, L. M. (2018). Human Neural Stem Cell Transplantation Rescues Functional Deficits in R6 / 2 and Q140 Huntington's Disease Mice. Stem Cell Reports, 10(1), 58-72. doi.org / 10.1016 / j.stemcr.2017.11.005 Rosser, A. E., & Bachoud-Levi, A. C. (2012). Clinical trials of neural transplantation in Huntington's disease. Prog Brain Res, 200, 345-371. doi.org / 10.1016 / b978-0-444-59575-1.00016-8 Schallert, T., Fleming, S. M., Leasure, J. L., Tillerson, J. L., & Bland, S. T. (2000). CNS plasticity and assessment of forelimb sensorimotor outcome in unilateral rat models of stroke, cortical ablation, parkinsonism and spinal cord injury. Neuropharmacology, 39, 777-787. Song, J., Lee, S.-T., Kang, W., Park, J.-E., Chu, K., Lee, S.-e., Hwang, T., Chung, H., & Kim, M. (2007). Human embryonic stem cell-derived neural precursor transplants attenuate apomorphine-induced rotational behavior in rats with unilateral quinolinic acid lesions. Neuroscience Letters, 423(1), 58-61. Vazey, E., & Connor, B. (2010). Differential fate and functional outcome of lithium chloride primed adult neural progenitor cell transplants in a rat model of Huntington disease. Stem Cell Res Ther, 1(5), 41. Vazey, E. M., Chen, K., Hughes, S. M., & Connor, B. (2006). Transplanted adult neural progenitor cells survive, differentiate and reduce motor function impairment in a rodent model of Huntington's disease. Experimental Neurology, 199(2), 384-396. Vazey, E. M., Dottori, M., Jamshidi, P., Tomas, D., Pera, M. F., Horne, M., & Connor, B. (2010). Comparison of Transplant Efficiency Between Spontaneously-Derived and Noggin-Primed Human Embryonic Stem Cell Neural Precursors in the Quinolinic Acid Rat Model of Huntington’s Disease. Cell Transplant, 19, 1055-1062. Vonsattel, J. P., Myers, R. H., Stevens, T. J., Ferrante, R. J., Bird, E. D., & Richardson, E. P. J. (1985). Neuropathological classification of Huntington's disease. Journal of Neuropathology and Experimental Neurology, 44, 559-577.
Claims
WHAT WE CLAIM:
1. A composition comprising a basal brain medium and at least two active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement.
2. The composition of claim 1 comprising a basal brain medium and at least three active agents selected from the group consisting of Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement.
3. The composition of claim 1 or claim 2 comprising a basal brain medium and all four active agents Activin A (ActA), a protein kinase C (PKC) inhibitor, a p160ROCK inhibitor and N-2 supplement.
4. The composition of any one of claims 1 to 3 wherein the PKC inhibitor is selected from the group consisting of Gö6983, Enzastaurin, Staurosporine, GF 109203X, Go6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, Sotrastaurin and K252a, preferably wherein the PKC inhibitor is Gö6983.
5. The composition of any one of claims 1 to 4 wherein the p160ROCK inhibitor is selected from the group consisting of is Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A, preferably wherein the p160ROCK inhibitor is Y27632.
6. A method of making a human induced lateral ganglionic eminence precursor cell (hiLGEP) comprising: a) reprogramming a human fibroblast (HF) into a hiLGEP comprising a. transfecting the HF with SOX2 cmRNA and PAX6 cmRNA, b. culturing the transfected HF in a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement, c. passaging the HF in b. into a composition comprising a basal brain medium and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA), and d. culturing the passaged HF.
7. The method of claim 6 wherein the SOX2 cmRNA comprises (SEQ ID NO:1).
8. The method of claim 6 or claim 7 wherein the PAX6 cmRNA comprises (SEQ ID NO:2).
9. The method of any one of claims 6 to 8 wherein the composition in b. comprises a basal brain medium and all three active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement.
10. The method of any one of claims 6 to 9 wherein the composition in c. comprises a basal brain medium and all four active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA).
11. The method in any one of claims 6 to 10 wherein the PKC inhibitor in b. and / or in c. is selected from the group consisting of Gö6983, Enzastaurin, Staurosporine, GF 109203X, Go6976, Ro 31- 8220 mesylate, Ro 32-0432 hydrochloride, Sotrastaurin and K252a, preferably wherein the PKC inhibitor is Gö6983.
12. The method of any one of claims 6 to 11 wherein the p160ROCK inhibitor in b. and / or in c. is selected from the group consisting of is Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A, preferably wherein the p160ROCK inhibitor is Y27632.
13. The method of any one of claims 6 to 12 wherein the HF is a human dermal fibroblast (HDF).
14. The method of any one of claims 6 to 12 wherein the HF is an adult human fibroblast (aHF), preferably an adult human dermal fibroblast (aHDF).
15. A kit comprising: i. a composition comprising a basal brain medium, and at least two active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement, and ii. a composition comprising a basal brain medium and at least three active agents selected from the group consisting of a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA).
16. The kit of claim 15 wherein the composition in i. comprises all three active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, and N-2 supplement.
17. The kit of claim 15 or claim 16 wherein the composition in ii. comprises all four active agents that are a protein kinase (PKC) inhibitor, a p160ROCK inhibitor, N-2 supplement and Activin A (ActA).
18. The kit in any one of claims 15 to 17 wherein the PKC inhibitor in i. and or ii. is selected from the group consisting of Gö6983, Enzastaurin, Staurosporine, GF 109203X, Go6976, Ro 31-8220 mesylate, Ro 32-0432 hydrochloride, Sotrastaurin and K252a, preferably wherein the PKC inhibitor is Gö6983.
19. The kit of any one of claims 15 to 18 wherein the p160ROCK inhibitor in i. and / or in ii. is selected from the group consisting of is Y27632, Thiazovivin, HA 1100 hydrochloride and GSK429286A, preferably wherein the p160ROCK inhibitor is Y27632.
20. A human induced lateral ganglionic eminence precursor cell (hiLGEP).
21. The hiLGEP of claim 20 made according to the method of any one of claims 6 to 14.
22. A pharmaceutical composition comprising at least one hiLGEP of claim 20 or claim 21.
23. Use of a composition as defined in any one of claims 1 to 5 to promote induction of a lateral ganglionic eminence (LGE) precursor fate in a fibroblast, preferably wherein the fibroblast is a human fibroblast, a human dermal fibroblast, an adult human fibroblast or an adult human dermal fibroblast.
24. Use of a composition comprising a human induced lateral ganglionic eminence precursor cell (hiLGEP) and a carrier to treat Huntington’s disease.
25. Use of a human induced lateral ganglionic eminence precursor cell (hiLGEP) in the manufacture of a medicament to treat Huntington’s disease.
26. A method of treating Huntington’s disease, the method comprising transplanting a human induced lateral ganglionic eminence precursor cell (hiLGEP) into the striatum of a subject having or suspected of having Huntington’s disease.
27. The use of any one of claims 23 to 25 or the method of claim 24 wherein the hiLGEP has been reprogrammed from a fibroblast, preferably an adult human fibroblast, a human dermal fibroblast, or an adult human dermal fibroblast.
28. The use of any one of claims 23 to 25 or the method of claim 24 wherein the hiLGEP is as defined in claim 21.
29. The composition of any one of claims 1 to 5 or the kit of any one of claims 15 to 19 when used to reprogram a fibroblast to a hiLGEP, preferably wherein the fibroblast is a human fibroblast, a human dermal fibroblast, an adult human fibroblast or an adult human dermal fibroblast.