RNA interference mediated therapy for neoplastic diseases
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV DEGLI STUDI DEL PIEMONTE ORIENTALEAMEDEO AVOGADRO
- Filing Date
- 2024-06-28
- Publication Date
- 2026-05-06
AI Technical Summary
Current therapeutic options for neoplastic diseases, such as colorectal cancer, are inadequate due to high incidence and mortality rates, with TRIM28 emerging as an oncogenic driver promoting cancer cell survival, proliferation, and metastasis, necessitating a targeted approach to inhibit its expression or activity.
Development of a double-stranded small interfering RNA (siRNA) therapy specifically targeting TRIM28 mRNA exons 3, 4, 6, and 12 to inhibit TRIM28 protein expression, thereby restoring normal expression levels and activity, using siRNA sequences designed to induce selective degradation of TRIM28 transcripts and administered via liposomal nano-carriers.
The siRNA therapy effectively downregulates TRIM28 protein levels in cancer cells, inhibiting tumor development, progression, and metastasis, enhancing sensitivity to chemotherapeutic agents and improving clinical outcomes by promoting apoptosis and cell cycle arrest.
Smart Images

Figure IMGF000021_0001 
Figure IMGF000022_0001 
Figure IMGF000023_0001
Abstract
Description
[0001] “RNA interference mediated therapy for neoplastic diseases” * * * FIELD OF THE INVENTION The present invention concerns RNA interference mediated therapy for primary and metastatic cancers. More specifically, the present invention concerns siRNA-mediated gene silencing of TRIM28 as therapy for neoplastic diseases. BACKGROUND OF THE INVENTION The discovery of RNA interference (RNAi), a natural mechanism controlling gene expression in mammalian cells, has recently led to the development of innovative methods to efficiently repress target genes by delivering synthetic small interfering RNA (siRNA) molecules into the host cells(1). siRNAs selectively bind to messenger RNA (mRNA), preventing them from being translated into proteins. As a result, a target gene can be efficiently silenced both in vitro and in vivo. Due to its flexibility and efficiency, the use of siRNA in therapy is increasingly considered as a promising therapeutic strategy and siRNA drugs have recently been approved for clinical use or are currently being evaluated for diseases like cancers (i.e. glioblastoma)(2). Colorectal cancer (CRC) is the third-most prevalent malignancy and the second leading cause of cancer-related deaths worldwide(3). Over the last two decades, the improved understanding of the pathogenic mechanisms and the risk factors has led to the development of surveillance programs and new treatment modalities. Nevertheless, CRC incidence has further increased and the mortality rate has remained unacceptable high(3). In the context of CRC, chronic inflammation is well recognized as a key trigger of intestinal carcinogenesis, but little is it known about the molecular sensors connecting chronic inflammatory signals to genomic instability, DNA mutations and consequent cell transformation. In the attempt to develop more effective therapeutic options, many studies have evaluated the possibility of targeting key oncogenic signaling pathways (e.g., Hedgehog, JAK / STAT, TGFβ, EGFR / MAPK, Notch, PI3K, Wnt / βcatenin, NF-κB) by using siRNA-based drugs(4, 5). This has brought about a large body of preclinical in vitro and in vivo evidence demonstrating that siRNA-mediated gene silencing can effectively inhibit tumor cell proliferation, survival, progression, invasion and treatment resistance(4, 5). For the development of siRNA therapeutics three central steps have to been taken: (i) identification of a cancer-related gene, (ii) design and synthesis of a specific siRNA and (iii) delivery of synthetic siRNA into the cancer cells controlling the absence of unspecific off-target effects. TRIM28, also known as KRAB (Kruppel-associated box)-associated protein (KAP1) or transcription intermediary factor 1β (TIF1β), is a pleiotropic protein involved in the dynamic organization of chromatin and in several aspects of cellular physiology, including gene expression, DNA repair, pluripotency, proliferation, differentiation and survival(6). Due to this diverse range of functions, TRIM28 exerts a complex role in cancer cell biology. While it may prevent neoplastic transformation by maintaining epigenetic stability and promoting repair of double strand DNA breaks (DSBs)(7, 8), in most cancers TRIM28 emerges as an oncogenic driver. Indeed, TRIM28 can promote cancer cell survival and proliferation by inhibiting p53-dependent apoptosis(9, 10), repressing of the cyclin-dependent kinase inhibitor p21(11, 12) and inducing mTOR signaling pathway(13, 14). Additionally, in different cancer cell types, such as pancreatic(15), lung(16), breast(17) and ovarian(18) cancer cells, TRIM28 favors invasion and dissemination by supporting epithelial-to-mesenchymal transition (EMT) and cell migration. Finally, being a key pluripotency gatekeeper of normal embryonic stem cells(19, 20) and inducible pluripotent stem cells(21, 22), not surprisingly, different studies have demonstrated that in different types of cancer (e. g. breast, melanoma and glioblastoma) overexpression of TRIM28 also promotes cancer stem cell maintenance(23- 26). Accordingly, TRIM28 is over-expressed in many human cancers (e. g. stomach, colon, pancreas, kidney, ovary, melanoma, prostate, testis, liver, lymphoma, lung, thyroid, glioma) and its association with worse clinical outcomes has been proven in cervical, gastric, ovarian, glioma, hepatocellular, colorectal, breast and prostate cancers(27). This conclusion was further consolidated by recent gene expression analyzes of TCGA and GTEx databases, which confirmed that TRIM28 expression is higher in various tumor tissues than in normal tissues and that higher TRIM28 expression is associated with poorer prognosis in multiple cancers(42). Additional histochemical analysis performed taking advantage of a specific antibody targeting TRIM28, revealed an higher TRIM28 intensity level at localized at the neoplastic lesions if compared to the healthy resected margin (The Human Protein Altas). Overall, this large body of evidence fosters the development of strategies aimed to inhibit TRIM28 expression or activity for new potential cancer treatments. Accordingly, an anti-TRIM28 selective nanobody NB237 has recently demonstrated significant inhibition of glioblastoma cancer stem cell invasion in a zebrafish model (29), whereas TRIM28 knockdown in lung cancer cells not only inhibited their tumorigenicity, both in vitro and in vivo, but also increased tumor cell sensibility to the chemotherapeutic drug 5-fluorouracil(28). Thus, drugs or small molecules that specifically inhibit TRIM28 expression or activity may represent valuable new cancer therapies. OBJECT AND SUMMARY OF THE INVENTION The object of the present invention is to provide a therapeutic agent effective in the treatment of neoplastic diseases associated with overexpression of Trim28 gene encoded protein TRIM28. According to the invention, the above object is achieved thanks to the method specified in the ensuing claims, which are understood as forming an integral part of the present description. This disclosure discloses a therapeutic agent for use in the treatment of oncological diseases associated with overexpression of TRIM28 protein and / or its elevated phosphorylation state. In an embodiment, the present description provides for a double-stranded small interfering RNA (siRNA) having a length of at least 19 nucleotides, targeting an exon of Trim28 gene mRNA (gene ID: ENST000000253024.10), wherein the exon is selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double-stranded siRNA is capable of inhibiting TRIM28 protein, thus restoring a normal expression level and / or activity of TRIM28 protein. In one embodiment, the present description discloses a medical use of the double-stranded small interfering RNA (siRNA) targeting Trim28 gene mRNA and a pharmaceutical composition comprising at least one double-stranded small interfering RNA (siRNA) targeting Trim28 gene mRNA. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described, by way of example only, with reference to the enclosed figures of drawing, wherein: - Figure 1. Mass spectrometry-based identification of Trim28 protein as a target of the inflammatory signaling cascade operating in different form of macrophagic polarization, including tumor-associated macrophages (TAM). The phosphoproteoma of TAMs isolated from murine MN / MCA1 fibrosarcoma was investigated by mass spectrometry-based phosphoproteomics, and compared to resting (ctr), M1 (IFNγ / LPS, 30min) and M2 (IL-4, 8 hours) polarized macrophages (Fig. 1). The data obtained (Table.1) report the 24 proteins with the higher levels of phosphorylation. Particularly, Trim28 emerged as the top-ranking phosphorylated protein, with the highest levels of phospho-Ser473 (S473p), in both M1 -polarized macrophages and TAMs (Table.1, red arrow). The values represent mean of two biological replicates. These data were additionally confirmed by Western Blot Analysis (Fig.1B, Western Blot). Briefly, PECs were left untreated (CTR) or stimulated with INFγ+LPS, for 30’ (M1-polarized activation) or IL-4 for 8 hours (M2-polarized activation). TAMs were isolated from MN / MCA1 fibrosarcoma. 30 μg of total protein extracts were analyzed by Western blot for Trim28 S473p and TRIM28. Actin was used as loading control. - Figure 2. Genetic ablation of Trim28 gene in intestinal epithelial cells inhibits tumor development in a murine model of Colitis Associated Cancer (CAC). (Fig.2A) Graphical scheme of the treatment of AOM / DSS model. To mimic colitis associated cancer development, we took advantage of the Azoxymethane (AOM) / Dextran Sodium Sulfate (DSS) mouse model of Colitis Associated Cancer (CAC)(29). Briefly, Trim28 Villin-Cre mice (bearing conditional Trim28 gene ablation only into intestinal epithelial cells) and Trim28 flox / flox mice (the relative Trim28 competent control mice) were treated with a single intra-peritoneal injection of AOM (10mg / kg / mouse), a potent mutagenic agent, followed by three rounds of treatment with DSS, a sugar synthesized from sucrose characterized by a high inflammatory potential. Each round of DSS treatment consisted of 5 days of 2.5% of DSS in drinking water, followed by 16 days of regular water administered ad libitum. The mice were sacrificed at the end of the experiment,and subjected to colon explantation. Fig.2B reports representative images of colon lesions detected in both experimental groups, where colons were longitudinally opened and polyps counted (Fig.2B). Data shown are mean ±SEM, two-tailed t-test, n=7 (n= 8 Trim28Villin-Cre mice and n=8 Trim28flox / flox mice for each experiment); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). - Figure 3. Efficacy of TRIM28 downregulation by selected siRNAs (siRNA1-siRNA2-siRNA3-siRNA4) against Trim28. A screening test was performed for the four selected human siRNA-Trim28 sequences siRNA1-siRNA2- siRNA3-siRNA4 to verify their downregulation efficiency on Trim28 mRNA levels, comparing the values obtained with the levels found after treatment with the siRNA scramble control. 2.5 μg of each siRNA and scramble control were separately transfected into human colorectal adenocarcinoma Caco2 cells at two scheduled time points (24h and 48h). Real-time PCR was performed to verify the downregulation efficiency of Trim28 transcript (Fig. 3A), while TRIM28 protein levels were assessed by Western Blot analysis (Fig.3B). For the 48h samples, 30 μg of total protein extracts were analyzed by Western blot for TRIM28 expression. Beta-Actin was used as loading control. Values represent mean ±SEM (n=3); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). - Figure 4. Characterization of the inhibitory effect of siRNA3 (S3) in the human colorectal cancer cell line Caco2. Caco2 cells were transfected with liposomes loaded with 2.5 μg siRNA3 or control siRNA (scramble). The inhibitory activity of siRNA3 was evaluated by Real-Time PCR for the determination of TRIM28 mRNA levels at the three scheduled time points (24h-48h-72h) (Fig.4A) and by Western Blot for the relative protein levels at 48h-72h after the transfection (Fig.4B). For both 48h and 72h time points, 30 μg of total protein extracts were analyzed by Western blot for TRIM28 expression and Actin was used as loading control. Caco2 tumor cells treated with siRNA3 or control scramble were furthermore analyzed for their proliferative (Fig.4C), apoptotic and necrotic (Fig.4D-E) activity and progression stages in the cell cycle at 24h (Fig.4F), 48h (Fig.4G) and 72h (Fig.4H), by flow cytometry. Values represent mean ±SEM (n=3); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). - Figure 5. Characterization of the inhibitory effect of siRNA3 (S3) in the human colorectal cancer metastatic cell line SW620. SW620 cells were transfected with liposomes loaded with 2.5 μg siRNA3 or control siRNA (scramble). The inhibitory activity of siRNA3 was evaluated by Real-Time PCR for the determination of TRIM28 mRNA levels (Fig.5A) at 24h- 48h-72h and by Western Blot for the relative protein levels (Fig.5B) at 48h-72h, after cells transfection. For both 48h and 72h time points, 30μg of total protein extracts were analyzed by Western blot for TRIM28 expression. Actin was used as loading control. SW620 tumor cells treated with siRNA3 or control scramble were furthermore analyzed for their proliferative (Fig.5C), apoptotic and necrotic status (Fig.5D-E) and progression in the cell cycle, at 24h (Fig.5F), 48h (Fig.5G) and 72h (Fig.5H, by flow cytometry. Values represent mean ±SEM (n=3); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). - Figure 6. Antitumor effect of siRNA Trim28 treatment, in a murine model of Colitis Associated Cancer (CAC). (Fig.6A), treatment protocol with AOM / DSS in the mouse model of CAC (29). Wild-type male mice were treated with a single intra-peritoneal injection of azoxymethane (AOM), a potent mutagenic agent, followed by three rounds of treatment with Dextran Sodium Sulfate (DSS), a sugar synthesized from sucrose and characterized by a high inflammatory potential. Each round of treatment consisted of 5 days of 2.5% of DSS administered in drinking water, followed by 16 days of regular water administered ad libitum. Mice were treated with an intrarectal dose of 5μg of murine Trim28 siRNA or scramble control, 3 times / week, starting from the 3 cycles of DSS. At the end of the experiment, mice were sacrificed and subjected to colon explantation. Fig.6B, siRNA inhibits tumor development in the murine model of Colitis Associated Cancer (CAC). Fig.6C reports representative images of tumor lesions in a cross section of colon, detected with Hematoxylin and Eosin in both experimental groups. Data shown are mean ±SEM, two-tailed t-test (n=4 mice for each experiment); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;*** *p.Value ≤ 0.0001). - Figure 7. Antimetastatic effect of Trim28 treatment. (Fig.7A) C57BL76 / J male mice were injected in the spleen with MC38pLuc colorectal cancer cells (300.000 cells / mouse), a murine colorectal cancer cell line exhibiting a high metastatic potential. Next, mice were divided into two experimental groups and intravenously administered (three times / week for four weeks) with liposomes, respectively loaded with either 25μg of Trim28 murine siRNA or scramble control. At the end of the experiment mice were sacrificed and the livers of both experimental groups harvested and analyzed for metastasis formation, assessed as region- of-interest (ROI) (Fig.7B-C). Evaluation of both Myeloid and Lymphoid cells was assessed in blood and tumor tissue. Briefly, 1.000.000 of cells were stained for myeloid (i.e. Ly6C, Ly6G and F4 / 80) or lymphoid (i.e. CD8, CD4 and CD19) markers and analyzed by Flow cytometry (Fig.7D-E). In addition, the metastatic potential of MC38pLuc was also checked by flow cytometry evaluating the principal markers characterizing the stemness and mesenchymal phenotype (Vim=Vimentin; Lgr5=Leucine-rich repeat-containing G- protein coupled receptor 5; and E-Cadh= E-cadherin), to discriminate prometastatic tumor cells endowed with epithelial-to-mesenchymal transition(30) (Fig.7E, bottom). Data shown are mean ±SEM, two-tailed t-test (n= 5 mice / group); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;**** p.Value ≤ 0.0001). - Figure 8. Antitumor efficacy of siRNA-mediated down-regulation of Trim28 in an orthotopic model of murine mesothelioma. (Fig.R1A) Balb\c female mice were injected in the torax with the murine mesothelioma AB22-pLuc cell line (50.000 cells / mouse). Mice were divided into two experimental groups and intravenously administered (three times / week for 3 weeks) with liposomes, respectively loaded with either 25μg of Trim28 murine siRNA against or the relative scramble siRNA control. Tumor growth was estimated at 10-14-21 days after the starting of the treatment, taking advantage of an in vivo imaging instrument (IVIS Illumina III) to evaluate the tumor reactive area (Fig.8A-B). At the end of the experiment, mice were sacrificed and the lungs and pleural tumors were harvested and analyzed macroscopically for the number of tumoral foci (Fig.8C-D). Data shown are mean ±SEM; (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;**** p.Value ≤ 0.0001). - Figure 9. Validation of human TRIM28 gene downregulation and analysis of cell survival. Human pancreatic cancer cell line PANC1 was transfected with liposomes loaded with 2.5 μg siRNAs against exons 3 (siRNA1), 6(siRNA2) and 12 (siRNA3) of the human TRIM28 gene, or scramble siRNA control. The inhibitory activity of all siRNAs was evaluated by Real-Time PCR to determinate TRIM28 mRNA levels at the three scheduled time points (24h-48h-72h) (Fig.9A), as well as by flow cytometry for the relative protein expression levels at (48h-72h)(Fig.9B). Furthermore, PANC1 transfected cells were evaluated for their survival rate in terms of absolute number of living cells, at 24h-48h-72h (Fig.9C). Values are represented as mean ±SEM (n=3)(A-B);(*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). For this purpose, human siRNA4 which shares with siRNA1 a common interference activity against exon 3 of the TRIM28 gene (Figure 1), has been replaced by siRNA8, since the latter elicits a distinct interference activity against exon 4. - Figure 10. Effect of TRIM28 siRNAs on apoptosis / necrosis of PANC1 tumor cells and on the expression levels of the cell cycle inhibitor "cyclin- dependent kinase inhibitor" p21. PANC1 cell line was transfected with liposomes loaded with 2.5 μg siRNA against exons 3,4,6 and 12 or control scramble. PANC1 tumor cells were analyzed for their apoptotic-necrotic activity at 24h (Fig.10A) and 48h (Fig.10B) by flow cytometry. Furthermore, the trasfected cells were examinated by flow cytometry for the protein expression of the cyclin-dependent kinase inhibitor p21 (Fig.10C), involed in cell cycle arrest. Values represent mean ±SEM (n=3); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). Of note, siRNA3, targeting exon 12, significantly reduced cell survival and enhanced early apoptotic cell death (Fig. R3A, B), also showing higher induction of the cyclin-dependent kinase inhibitor p21 (Fig.10C; 48h). - Figure 11. Effect of siRNAs-mediated downregulation of TRIM28 on the survival of human hepatic cancer cells HepG2. HepG2 hepatic cancer cells were transfected with liposomes loaded with 2.5 μg siRNA against exons 3,4,6 and 12 or control siRNA scramble. The inhibitory activity of the tested siRNAs was evaluated by Real-Time PCR by determination of TRIM28 mRNA levels, at the three scheduled time points (24h-48h-72h) (Fig.11A) and by flow cytometry for protein expression levels, at 48h and 72h after the transfection (Fig.11B). HepG2 tumor cells treated with siRNA against exons 3,4,6 and 12 or control scramble were further analyzed for cell survival, assessed as absolute number of living cells (Fig.11C). Cell survival was estimated by using Cristal Violet Assay at 24h-48h-72h (Fig.11D). Values were represented mean ±SEM (n=3); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001). Of note, siRNA3, targeting exon 12, significantly reduced cell survival (i.e. Fig.11D , 72h) - Figure 12. Effect of selected siRNAs on HepG2 liver tumor cell death and proliferation. HepG2 cell line was transfected with liposomes loaded with 2.5 μg siRNA against exons 3,4,6 and 12 or control scramble. HepG2 tumor cells were analyzed for their survival and apoptotic-necrotic state at 24 hours (Fig.12A), 48 hours (Fig.12B), and 72 hours (Fig.12C), by flow cytometry. In addition, p21 protein expression was also determined by flow cytometry (Fig.12D). siRNAs trasfected cells were also examinated for their proliferative activity at the scheduled time points by flow cytometry, by estimating the cell proliferation marker Ki67 (Fig.12E). Values represent mean ±SEM (n=3); (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;****p.Value ≤ 0.0001. Overall, siRNA3, targeting exon 12, demonstrated a higher capacity to induce apoptotic cell death (Fig.12C), associated with increased expression of p21 (i.e. Fig.12D, 48h) and reduced ki67 expression (i.e. Fig.12E, 48h). - Figure 13. Evaluation of the contribution of TRIM28 to the DNA damage response. MC38 TRIM28 WT and TRIM28 KO cells were either pre-treated with Olaparib (10 ^^M) for 4 h, to provoke inhibition of poly ADP ribose polymerase (PARP) and consequent inhibition of DNA-repair processes or let untreated (43). Subsequently, cells were administered with the carcinogen etoposide for 1h to induce DNA damage. After 2h and 3h cells were collected and evaluated for expression of the molecular market of DNA damage ^^H2AX, as well as for the expression levels of the oncosuppressor p53, by flow cytometry analysis (Fig.13 A-B). The human pancreatic cancer cell line PANC1 (Fig.13 C-F) was transfected with siRNA3 or scramble control for 48h. Subsequently, cells were pre-treated with olaparib (10 ^^M) for 4h or let untreated. Next, PANC1 cells were administered with etoposide for 1h in order to provoke DNA damage. After 2h (Fig.13C and E) and 3h (Fig.13D and F) cells were collected and evaluated for ^^H2AX and p53 expression levels by Flow cytometry analysis. (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;**** p.Value ≤ 0.0001) - Figure 14. Evaluation of antitumor efficacy of Trim28 down-regulation in a xenograft model of Pancreatic cancer. Swiss nude male mice were injected subcutaneously with human pancreatic cancer cells PANC1 (5x106cells / mouse) (Fig.14A). Mice were divided into three experimental groups and intravenously administered (three times / week for 3 weeks) with liposomes, respectively loaded with either 25μg of siRNA3, siRNA1 and scramble control (Fig.14A-B). Tumor growth was monitored starting from the beginning of the treatment (Fig.14C). At the end of the experiment, mice were sacrificed, tumor explanted and weighted (Fig.14B-D). Tumors were paraffin-embedded and collected for further histological evaluations (*p.Value ≤ 0.05; **p.Value ≤ 0.01; ***p.Value ≤ 0.001;**** p.Value ≤ 0.0001). DETAILED DESCRIPTION OF THE INVENTION The invention will now be described in detail, by way of non-limiting example, with reference to an RNA interference-mediated therapy which uses a cellular model and in vivo models which recapitulate oncological pathologies of colorectal cancer associated with alterations of TRIM28. However, the RNA interference- mediated therapy described here can be used to treat other oncological diseases associated with abnormalities in the TRIM28 protein encoded by the Trim28 gene. In the following description, numerous specific details are given to provide a thorough understanding of embodiments. The embodiments can be practiced without one or more of the specific details, or with other methods, components, materials, etc. In other instances, well-known structures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the embodiments. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. The headings provided herein are for convenience only and do not interpret the scope or meaning of the embodiments. In one embodiment, the present invention concerns a double-stranded small interfering RNA (siRNA) having a length of at least 19 nucleotides, targeting an exon of Trim28 gene mRNA (having the nucleotide sequence set forth in ENST000000253024.10), wherein the exon is selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double-stranded siRNA is capable of inhibiting TRIM28 protein, thus restoring a normal expression level and / or activity of TRIM28 protein. In one embodiment, the double-stranded siRNA is able to induce selective degradation of Trim28 transcripts containing one of exons 3, 4, 6, and 12. In one embodiment, the double-stranded siRNA is able to induce selective degradation of one of exon 3, exon 4, exon 6 or exon 12 of Trim28 transcripts. In one embodiment, the exon is selected from the group consisting of exon 4, exon 6 and exon 12. Our comparative studies of siRNA activity against TRIM28, indicate a clear advantage of functional silencing of TRIM28 activity using preferably siRNA against TRIM28 exon 12 (i.e. siRNA3). This is demonstrated by a consistently greater induction of cell death on various tumor lines (PANC1 and HepG2), associated with a higher expression of cell cycle inhibitors (i.e. cyclin-dependent kinase inhibitor p21). In one embodiment, the exon is exon 12. In one embodiment, the double-stranded siRNA has a length comprised between 19 and 29 nucleotides, preferably between 19 and 23 nucleotides, more preferably 19 and 21 nucleotides. In one embodiment, at least one strand of the double-stranded siRNA has an overhang at the 3' terminus. In one embodiment, at least one strand of the double-stranded siRNA has an overhang at the 3' terminus, wherein the overhang comprises at least one deoxyribosylthymine. In one embodiment, the double-stranded siRNA has a content of G-C bases lower than 52%. In one embodiment, the double-stranded siRNA has a content of G-C bases higher than 36%. In one embodiment, the double-stranded siRNA has a content of G-C bases higher than 36% and lower than 52%. In one embodiment, at least one strand of the double-stranded siRNA has a melting temperature lower than 64 °C. In one embodiment, each strand of the double- stranded siRNA has a melting temperature lower than 64 °C. In one embodiment, the sense strand of the double- stranded siRNA has a nucleotide sequence selected from SEQ ID No.: 1 to 4, and 21, wherein the antisense strand has a sequence complementary and reverse thereto. In one emnodiment, the sense strand of the double- stranded siRNA has a nucleotide sequence selected from SEQ ID No.: 2, 3 and 21, preferably the sense strand of the double-stranded siRNA has a nucleotide sequence as set forth in SEQ ID No.: 21, wherein the antisense strand has a sequence complementary and reverse thereto. In one embodiment, the present invention concerns a double-stranded siRNA as disclosed above for use in treating and / or preventing a neoplastic disease associated with an abnormality of Trim28 gene encoded protein TRIM28. In one embodiment, the abnormality of Trim28 gene encoded protein TRIM28 is upregulation and / or hyperphosphorylation of protein TRIM28 in the cancer tissue, compared to the normal, healthy adjacent tissue. In one embodiment, the neoplastic disease is a primary cancer and / or a metastatic cancer. In one embodiment, the neoplastic disease is selected from stomach, pancreas, kidney, ovary, melanoma, prostate, testis, liver, lymphoma, lung, thyroid, glioma, cervical, gastric, ovarian, glioma, colorectal, breast and prostate cancer. In one embodiment, the neoplastic disease is a primary and / or a metastatic colorectal cancer. In one embodiment, the double-stranded siRNA is for use in preventing colitis-associated cancer development. In one embodiment, the double-stranded siRNA is for use in a combination therapy with a poly ADP ribose polymerase (PARP) inihibitor for the treatment of a neoplastic disease. A PARP inhibitor as Olaparib can significantly prolong the survival time of cancer patients such as breast cancer and ovarian cancer (49). As discussed above, poly (ADP-ribose) polymerase 1 (PARP1) is an enzyme that plays an important role in the recognition and repair of DNA damage. PARP inhibitors (i.e. olaparib) are known to induce “synthetic lethality” in patients with homologous recombination deficiency (HRD) and BRCA mutations. However, PARP inhibitors (i.e. olaparib) also induce molecular mechanisms of resistance to therapy in 40% of patients (45). On this basis, gene silencing mediated by TRIM28 siRNA may offer an advantage and therapeutic alternative to these patients, both in monotherapy and in combination, as it acts through mechanisms distinct from PARP inhibitors. Indeed, the combination of a double-stranded TRIM28 siRNA with a PARP inhibitor enables an enhanced interference effect on the DNA damage repair activities of tumor cells, suggesting a new possible combinatorial strategy to improve cancer patient responses. In one embodiment, the present invention concerns a pharmaceutical composition comprising at least one double-stranded siRNA as disclosed above and a pharmaceutically acceptable excipient. In one embodiment, the pharmaceutical composition is suitable for administration by subcutaneous (s.c.), intramuscular (i.m.) and intravenous (31-33). In one embodiment, the present invention concerns a pharmaceutical composition comprising at least one double-stranded siRNA as disclosed above and a pharmaceutically acceptable excipient for use in the treatment of a neoplastic disease associated with abnormality of Trim28 gene encoded protein TRIM28. The present description also discloses a method for the treatment and / prevention of a neoplastic disease associated with abnormality of Trim28 gene encoded protein TRIM28 comprising administering to a patient in need thereof of one or more siRNA as disclosed above in an amount sufficient to make said treatment, wherein the one or more siRNAs induce selective degradation of Trim28 transcripts containing one of exons 3, 4, 6, and 12. The present description concerns a therapeutic agent for the treatment of cancer diseases associated with an aberrant up-regulation or activation of TRIM28 protein, wherein said therapeutic agent comprises one or more siRNAs targeting TRIM28 transcripts referring to Trim28 gene exon 4, exon 6 and exon 12, preferibly exon 12. Our comparative studies demonstrate that overall siRNA against exon 4, 6, 12 show better anti-tumor activity than siRNA against exon 3. In particular, siRNA against TRIM28 exon 12 (i.e. siRNA3) consistently demonstrated higher induction of cell death across various tumor lines (PANC1 and HepG2), which was associated with increased expression of cell cycle inhibitors (e.g. cyclin-dependent kinase inhibitor p21). This observation indicates how silencing of TRIM28 with siRNAs targeting exons 4, 6 and / or 12 may represent a new and valid anti-tumor approach, capable of interfering with the survival and proliferation of tumor cells. This antitumor activity seems optimal with siRNA3, directed against exon 12. Our in vivo studies also demonstrated that the antitumor activity of TRIM28 siRNAs is optimal in all preclinical models used (i.e. AOM / DSS CAC, metastasis model colorectal cancer / MC38), while human siRNA3 strongly inhibited the development of human pancreatic cancer in a xenograft model. In the following some embodiments of the present invention are disclosed. This part of the description must not be interpreted as limiting the scope of protection of the present application, being provided for illustrative purposes only. The therapeutic siRNAs are characterized by a sense strand comprising at least 19 continuous bases of mRNA corresponding to the TRIM28 exon 3 (ID:ENSE00003563013), exon 4 (ID:ENSE00003542576), exon 6 (ID:ENSE00003654842) or exon 12 (ID:ENSE00003587053) sequences, respectively, and an antisense strand comprising a sequence complementary and reverse thereto. Both sense and anti-sense sequences are characterized by an overhang (deoxyribosylthymine, dT) [dT-dT] at the 3'-OH terminal of their strands to protect the molecule from the RNAse degradation. In addition, each strand is characterized by a melting temperature that does not exceed 64°C and calculated through the following mathematical formula: Tm = [4(G + C) + 2(A + T)] °C). Moreover, the content of the G-C bases, in terms of percentage in each siRNA’ bones, is in the range of 36-52%. The complete gene sequence of Human Trim28 is identified by the following ID: ENSG00000130726. Other Trim28 transcript’s isoforms have the following nucleotide sequences: ID: ENST00000341753.10; ID: ENST00000597136.1; ID: ENST00000594806.5; ID: ENST00000593582.5; ID: ENST00000597968.1; ID: ENST000000253024.10. The sequence ID: ENST000000253024.10 turns out to be the largest in terms of base pairs and able to generate the largest coding protein (835 aa). The double-stranded siRNAs do not bind to intron regions of the Trim28 gene sequence. The sense and antisense strands of double-stranded siRNAs disclosed herein have the nucleotide sequences shown in Table 1. Table 1 Cancers associated with altered expression (over- expression) of the Trim28 gene encoded protein TRIM28, that can benefit from the administration of one or more siRNAs according to the present description include: stomach, pancreas, kidney, ovary, melanoma, prostate, testis, liver, lymphoma, lung, thyroid, glioma, cervical, gastric, ovarian, glioma, colorectal, breast and prostate cancer. The present disclosure demonstrates the feasibility of siRNA-based gene therapy to enable post- transcriptional gene silencing of Trim28 transcripts related to exon 3, exon 4, exon 6 and exon 12. A panel of siRNAs targeting the mRNA of these exons was designed and tested in both Caco2 cells, primary human adenocarcinoma tumor cells, and SW620 human colorectal cancer metastatic cells by transfection using liposomal nano-carriers. Furthermore, siRNA3, which appears to exert greater silencing activity, was also tested on a human metastatic colon cancer line and whose impact in the regulation of biological activities due to its silencing was evaluated. The silencing capacity of the five siRNAs was analyzed by evaluating the transcript expression using RT-PCR analysis. Further screening, by Western blot, investigated and confirmed TRIM28 protein down-regulation. In the present description, the inventors have designed a new approach for restoring a normal expression level and activity of the TRIM28 protein, based on the use of siRNAs selectively designed on exon 3, exon 4, exon 6 and exon 12 and capable of leading to degradation of the related transcripts. These siRNAs provide therapeutic benefits for patients with various cancer pathologies who have TRIM28 up-regulation and hyperphosphorylation in their tumors. The five siRNAs evaluated here have the nucleotide sequences indicated in Table 1. Table 2 provides further features of the siRNA sequences. Table 2 MATERIALS AND METHODS siRNAs The following siRNAs – employed in the present experiments - were designed along the sequences of four exons: 3, 4, 6 and 12. Each sequence was produced by Merck (United Kingdom). All siRNAs were produced in powder, in desalt condition as degree of purity. After resuspension in water, siRNAs were aliquot and stored at -80°C. siRNA1 (exon 3): sense strand: 5’ GCACTAGCTGTGAGGATAA dTdT3’ (SEQ ID No.: 11) antisense strand: 5’ TTATCCTCACAGCTAGTGC dTdT3’ (SEQ ID No.: 12); siRNA2 (exon 6): sense strand: 5’ GTGCAAGTGGATGTCAAGA dTdT3’ (SEQ ID No.: 13) antisense strand: 5’ TCTTGACATCCACTTGCAC dTdT3’ (SEQ ID No.: 14); siRNA3 (exon 12): sense strand: 5’ GTACCACTGAGGACTACAA dTdT3’ (SEQ ID No.: 15) antisense strand: 5’ TTGTAGTCCTCAGTGGTAC dTdT3’ (SEQ ID No.: 16); siRNA4 (exon 3): sense strand: 5' GTACACCAAGGACCATACT dTdT3’ (SEQ ID No.: 17) antisense strand: 5' AGTATGGTCCTTGGTGTAC dTdT3’ (SEQ ID No.: 18). siRNA8 (exon 4): sense strand: 5' GATGGTGAACGTACTGTCTAT dTdT 3’ (SEQ ID No.: 23) antisense strand: 5' ATAGACAGTACGTTCACCATC dTdT 3’ (SEQ ID No.: 24). All the siRNAs generated are characterized by the presence of a protrusion consisting of two deoxyribosylthymine monophosphate (dT), which were introduced at the 3' end to increase the intracellular stability of the siRNA and its efficiency. Murine Trim28 siRNA: sense strand: 5’ GACCTCGTCTAGCTTCACCTA dTdT 3’ (SEQ ID No.: 19) antisense strand: 5’ TAGGTGAAGCTAGACGAGGTC dTdT 3’ (SEQ ID No.: 20) Scramble control: MISSION® siRNA Universal Negative Control, was used as scramble control for each siRNA sequences (Merck, Milan, Italy). Caco2 cell line (ATCC;HTB-37) The Caco2 cell line used for transfection experiments is a human colorectal cancer cell line derived from primary adenocarcinoma. The transfection efficiency (50% to 75%) in this cell line is comparatively higher than the other primary colorectal cancer cell lines. Therefore, this cell line was chosen to test the efficacy of siRNAs against endogenous the selected exons transcripts and used until their 35thpassage in culture. Cells were maintained in DMEM complete medium, high glucose (Euroclone) with 10% Fetal Bovine Serum (FBS) without antibiotics at 37° C in 5% CO2. SW620 cell line (ATCC; CCL-227) Metastatic human colorectal cancer cell line SW620 was used to check siRNA3 efficiency, within a transfection efficiency ranging from 50% to 75%. Cells were maintained in RPMI complete medium (Euroclone) with 10% Fetal Bovine Serum (FBS) without antibiotics at 37°C in 5% CO2 and used until their 35thpassage in culture. PANC1 cell line (ATCC; CRL-1469) Human pancreatic cancer cell line PANC1 (48) was used to check the efficiency of siRNA-mediated down- regulation of Trim28, considering a transfection efficiency ranging from 50% to 75%. In addition, in vitro and in vivo experiments were performed on PANC1 cell line in order to examinate the effects of Trim28 silencing on pancreatic cancer cells, as well as in in vivo growth. PANC1 were cultured in DMEM high Glucose complete medium (Euroclone), supplemented with 10% Fetal Bovine Serum (FBS) antibiotics and L-Glutammine, at 37°C in 5% CO2 and used until their 35thpassage in culture. HepG2 cell line (ATCC; HB-8065) Human hepatic cancer cell line HepG2 was used to check the efficiency of siRNA-mediated down-regulation of Trim28, considering a transfection efficiency ranging from 50% to 75%. In addition, in vitro experiments were performed on HepG2 cell line to examinate the effects of Trim28 silencing on hepatic cancer cells. HepG2 cell line was cultured in RPMI complete medium (Euroclone) with 10% Fetal Bovine Serum (FBS), supplemented with antibiotics at 37°C in 5% CO2 and used until their 35thpassage in culture. AB22-pLucipherase cell line Murine cancer cell line of Mesothelioma AB22 was kindly offered by prof. Paola Allavena (Humanitas Research institute) and used in a in vivo murine orthotopic model of mesothelioma to validate the impact of Trim28 siRNA-mediated silencing on tumor growth. The murine mesothelioma cell line AB22 has been previously generated in BALB / c mice upon intraperitoneal injection of crocidolite asbestos fibers (46). AB22 cell line was cultured in RPMI complete medium (Euroclone) with 10% Fetal Bovine Serum (FBS), supplemented with antibiotics at 37°C in 5% CO2 and used until their 35thpassage in culture. MC38-pLucipherase and MC38-pLucipherase knock out (MC38 TRIM28 KO) cell line lines MC38-pLucipherase murine colorectal cancer cell line (47) was kindly offered by prof. Maria Rescigno (Humanitas Research institute) and used in a in vivo murine orthotopic metastatic model of colorectal cancer to validate the impact of Trim28 siRNA-mediated silencing on tumor growth and dissemination. MC38- pLucipherase TRIM28 knock-out cells were generated by using CrispR / Cas9 technique and used to evaluate the impact of TRIM28 ablation in DNA damage response. Both the Cell lines were cultured in RPMI complete medium (Euroclone) with 10% Fetal Bovine Serum (FBS), supplemented with antibiotics at 37°C in 5% CO2 and used until their 35thpassage in culture. Treatment with siRNA on Endogenous condition 1. In vitro and in vivo cells transfection with siRNAs. The transfection of all cell lines and for the in vivo experiment with siRNAs were performed using the Lipofectamine 3000 lipid-based transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000- 008). 1.1. Preparation of cells for in vitro experiments On the day before the experiment, 360.000 cells were seeded on a 6 well plate in 2mL of complete medium, at 37° C in 5% CO2. Cells were left to adhere for 24 hours. 1.2. In vitro Transfection of siRNAs The day before the transfection Caco2 and SW620 cell lines were plated at 300.000 cells / well for the 24h; 200.000 cells / well for the 48h; 180.000 cells / well for the 72h to guarantee a confluence between 40-70% at the day of transfection, accordingly to the manufacturing instructions. The day before the transfection, PANC-1 and Hep G2 cell lines were plated in a 6 well plate at 180.000 cells / well for the 24h, 48h and 72h. 1.2.1. Transfections were performed as instructed by the manufacturer with 3,75 (µl) Lipofectamine3000 (Catalog number: L300000, ThermoFisher) for 2,5μg of siRNAs concentration of 2,5μg - in 250 µl Opti-MEM medium without phenol red (Life Technologies-Gibco, Monza, Italy; #11058-021) - per well in a final volume of 2 ml of DMEM or RPMI complete medium. 1.2.2. As control, cells were transfected with Lipofectamine3000 (Catalog number: L300000, ThermoFisher) loaded with MISSION® siRNA Universal Negative Control. 1.2.3. Following transfection, cells were incubated at 37° C in 5% CO2 for 6h. After 6h of incubation, the medium with Lipofectamine was aspirated from every well and was washed with 2mL of saline and replaced with fresh complete DMEM or RPMI medium. 1.2.4. At the scheduled time points (24h-48h-72h) the transfected cells were washed with physiological saline and detached with a trypsin-EDTA mixture (EuroClone). PANC-1 and Hep G2 cells were collected and manually counted with a hemocytometer; the cell viability was assessed by trypan blue dye exclusion staining. In addition, cell viability of Hep G2 cell line was also evaluated by Crystal violet staining. Briefly, at the scheduled time points (24h-48h-72h) the transfected cells were washed with physiological saline solution and stained with a solution of Crystal violet 0,5% for 20 minutes at room temperature. At the end of the incubation, cells were washed with tap water and the plates were allowed to air-dry for at least 2 hours. Methanol was then added to the wells and the plates were incubated for 20 minutes at room temperature on a bech rocket. At the end of the incubation, the optical density was measured at 570 nm (OD570) with a plate reader (Agilent BioTek Synergy). Trizol reagent (Life Technologies, Monza, Italy; #15596-026) was used for the extraction of RNA following manufacturer's instructions. The 6 well plate format has been chosen to allow the recovery of a sufficient number of cells at the end of the assay, in order to perform downstream molecular analysis, such as RT-PCR and Western Blot, flow cytometry analysis of proliferation and cell death. 2. RNA extractions and RT-PCR 2.1. Before all experiments, cells were washed with physiological saline and detached with a trypsin- EDTA mixture (EuroClone). RNA was extracted from each well using Trizol-reagent following manufacturer’s instructions. 2.2. RNA was quantified using the Nanodrop spectrophotometer. RNA quality was assessed as OD ratio 260 / 280 and 260 / 230 >1.5. 1 μg of RNA was transcribed by the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher,catalog number: 4368814), and then the diluted CDNA (1:5 ratio) was used as a template for SYBER Green Master Mix (Biorad) . 2.3. The cDNA obtained serves as a template for evaluation of the transcripts using RealTime-PCR (ViiA™ 7 Real-Time PCR System with 96-Well BlockGreen Catalog number: 4453534). All samples were analyzed in triplicate. 2.4. The expression levels of Trim28, following siRNA-mediated Trim28 silencing, were analyzed with the following primers: human TRIM28 FW: 5’ CTACTCAAGTGCAGAGCCCC 3’ (SEQ ID No.: 9) human TRIM28 RV: 5’ GGGAAGACCTTGAAGACGGG 3’ (SEQ ID No.: 10) 3. CrispR\Cas9 knock-out technique MC38pLucipherase cell line were maintained in culture as previously described. The transfection of GFP-plasmids designed to target MC38-pLucipherase and to generate a TRIM28 KO cell line, were prepared and delivered in Liposomes. Briefly, 250.000 cell / well of MC38-pLucipherase cells were plated in a 6-well and transfections were performed as instructed by the manufacturer with 5 µl of Lipofectamine3000 (Catalog number: L300000, ThermoFisher), 5 µl p3000 reagent for 2,5μg of plasmid final concentration, in 250 µl Opti-MEM medium without phenol red (Life Technologies-Gibco, Monza, Italy; #11058-021) per well, in a final volume of 2 ml of RPMI complete medium. After 6 hours, the transfection medium was removed and replaced by complete RPMI fresh medium. After 48h, cells were harvested and single-cell sorted. The gating strategy was selected in order to isolated only the GFP+cells including the plasmids and undergoing TRIM28 knock-down. The clones were ufficially tested for TRIM28 knock-down by Western Blot analysis. 4. Western Blot (WB) Analysis. 30 μg total of proteins were separated on 7.5% SDS-PAGE under reducing conditions and transferred onto nitrocellulose membranes. Membrane was incubated at RT, with 5% nonfat dry milk (Applichem) or 5%BSA (Sigma) in TBST (50mM Tris, 150mM NaCl, 0.1% Tween) to saturated non-specific binding sites. After 1 hour of blocking, membrane was incubated with the primary antibody solution at 4°C, overnight. Next, the membrane was washed with TBST for 10 minutes at RT (three times) and incubated with the HRP-conjugated secondary antibodies solution. After 1 hour at RT, membrane was washed three times for 10 minutes with TBST. Finally, chemiluminescence substrate (ECL, Biorad) was added and signals were detected at transilluminator Chemidoc (Biorad). TRIM28 (ab 10484, Abcam), dilution 1:1000, 5% milk, 4°C, o / n dilution 1:1000, 5% BSA, 4°C, o / n; Actin (Sigma-Aldrich). List of secondary antibodies: Goat-α- Rabbit-HRP-conjugated (7074S, Cell Signaling) and Goat- α-Mouse-HRP-conjugated (7076S, Cell Signaling); dilution 1:5000, RT, 1 hour. Densitometric analyzes were performed with Image J software (an open architecture system using Java plugin) after image acquisition with BioDoc–It imaging system (UPV, Upland, CA, USA). 5. Flow Cytometry Analysis Before all experiments, cells were washed with physiological saline and detached with a trypsin-EDTA mixture (EuroClone) and 1x106cells of both experimental conditions were used for every detection. Analysis regarding cell proliferation, cell cycle progression and apoptosis-necrosis were validated by flow cytometry (BD LSRFortessa™) respectively with the following markers: anti-human 488 Ki-67 (clone 16A8, Biolegend), DAPI (4',6 -diamidino-2-phenylindole) (#D1306, Life Technologies) and Annexin / PI Kit (MyBiosource, MBS668896), anti-human p21 (Biolegend, PE, 326008); anti-TIF1β (KAP-1, TRIM28) Antibody (clone 20A1, Biolegend). The acquired flow cytometry data were analyzed with the Flowjo Software program. 6. In vivo Transfection cells with siRNAs A murine siRNA against Trim28 was delivered in vivo, in two colon cancer models, one primary and inflammation-associated and one metastatic in C57Bl6 / J mice and aged between 10-12 weeks (Charles River Laboratories; Calco, Italy). The transfection with murine siRNA, as well as for the in vivo experiment, was performed using the Lipofectamine 3000 lipid-based transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM. 6.1. In vivo administration of murine TRIM28 siRNA (CAC model). Mice were treated with a single dose of the mutagen azoxymethane (AOM; SigmaAldrich, A5486) at a dosage of 10 mg / kg body weight, intraperitoneally (i.p.). Subsequently, 5 days after administration of the genotoxic agent, mice were subjected to three cycles of 2.5% dextran sulfate (DSS, MP Biomedicals, Molecular Weight: 40 kDa) ad libitum, for five days per cycle. Mice were anesthetized with a Ketamine / Xylazine mixture (Ketamine 100 mg / kg-Xylazine 20 mg / kg) given equal weight intraperitoneally. Mice were divided into two experimental groups and treated with a dose of murine siRNA or Scramble control equal to 5 μg / mouse for three times / week starting from the third week. To create lipoplex siRNA preparations, 2μl lipofectamine 3000 (Invitrogen) was mixed with 48μl OptiMEM and incubated for 5 minutes, according to the manufacturer's instructions. 5μg of murine siRNA was suspended in 50 μl OptiMEM were then added to this mixture and incubated at room temperature for 20 minutes. Mice were anesthetized with a cocktail of Ketamine (100 mg / kg) / Xylazine (20 mg / kg), administered accordingly with their body weight. This solution was immediately administered intrarectally anesthetized mice. Mice were treated with siRNA preparations or relative scramble control three times for week, starting from the third week of AOM / DSS experiment. Each rectal administration consisted of a 100μl solution of liposomal siRNA and was delivered with 0.5mL syringe at the concentration of 5 μg(34). 6.2. In vivo administration of murine TRIM28 siRNA MC38pLuc Colorectal cancer metastatic Model. C57Bl6 / J mice and aged between 10-12 weeks were divided in two experimental group. The anti-metastatic effect was estimated and confirmed in the liver using an established metastatic model of colorectal cancer (MC38pLuc) injected into the spleen (metastasizes to the liver after spleen excision). After ten minutes, mice’s spleen were removed, and experiment was set to 30 days in order wait for liver metastasis formations. The transfection with murine siRNA or Scramble control was performed using the Lipofectamine 3000 lipid-based transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM. Briefly, 2μl lipofectamine 3000(Invitrogen) was mixed with 48μl OptiMEM and incubated for 5 minutes, according to the manufacturer's instructions. 25μg of murine siRNA was suspended in 50 μl OptiMEM were then added to this mixture and incubated at room temperature for 20 minutes. This solution was immediately administered i.v. (intraocular administration) to anesthetized mice. All murine siRNA or scramble control preparations were administered three times for week. After 30 days, the mice were treated with luciferin and then sacrificed. Liver metastases were evaluated with IVIS (The IVIS® SpectrumCT). The tumors of both experimental groups were digested. Briefly, the recovered tumor pieces, cleaned from the necrotic and vascularized areas, were digested with a solution composed of RPMI medium (Lonza) supplemented with DNAse (ThermoFisher), Collagenase (ThermoFisher) and Calcium Chloride (20-40 ml / tumor, home made) and subsequently left to rest at 37°C for 30-40min in the incubator. The digestion reaction was then stopped with the addition of Fetal Bovine Serum (Euroclone) and EDTA and the tumor microenvironment was evaluated, in particular the inflammatory infiltrate and the stemness profile(35). 6.3. In vivo administration of TRIM28 murine siRNA in a murine orthotopic model of mesothelioma. The murine mesothelioma Lucipherase-expressing cell line Lucipherase AB22 (epitheliod histology) were generated in Balb / c mice upon intraperitoneal injection of crocidolite asbestos fibers. Cell line was cultured in RPMI 1640 medium (Euroclone) supplemented with 10% of FBS, 2mM of L-Glutamine and antibiotics at 37°C and 5% of CO2. Balb / c female mice of 8 weeks old were used to performe the syngeneic orthotopic mouse model. Briefly, AB22 cell line were injected intra- thoracically in anesthetized mice with ketamine / xilazyne cocktail and positionated on left lateral decubitus. The thoracic area was shaved and sterilized with 70% of ethanol. An 8-10 mm skin incision was cut on the right thorax and 50.000 cells resuspended in 50 ^l of saline water were injected between the third and the fourth costal space, with the needle perpendicularly oriented on the rib cage (29- gauge needle of a 500 ^l syringe, BD Becton, Dickinson). After cell injection, mice were sutured and maintained under a heating lamp to recover from anesthesia. Tumor Growth quantification was performed taking advantage of in vivo imaging over time. Mice were injected i.p. with D-Lucipherin. After ten minutes the bioluminescent signal was acquired using IVIS Illumina III instrument (Parkin Elmer). During the acquisition mice were anesthetized with a cocktain of ketamine / xilazyne. After 15 days after injection, mice were check for tumor growth to start siRNA Scramble or Murine Trim28 siRNA, 3 times for week for three weeks after the beginning of the treatment. The transfection with murine siRNA or Scramble control was performed using the Lipofectamine 3000 lipid-based transfection reagent (Life Technologies-Invitrogen, Monza, Italy; #L3000- 008) and Opti-MEM. Briefly, 2μl lipofectamine 3000(Invitrogen) was mixed with 48μl OptiMEM and incubated for 5 minutes, according to the manufacturer's instructions. 25μg or of murine siRNA or siRNA Scramble control was resuspended in 50 μl OptiMEM were then added to this mixture and incubated at room temperature for 20 minutes. This solution was immediately administered i.v. (intraocular administration) to anesthetized mice. 6.4. In vivo administration of human TRIM28 siRNA3 (Targeting the ex_12) in a murine Xenograft model of Pancratic Cancer (PANC1 human pancreatic cell line). To ensure high tumor take in mice, cells were grown at exponential rate. PANC1 cells were collected in trypsin-EDTA and subsequently 5 milions of cells were resuspended in 100 μl of saline water. Swiss Nude Athymic male mice of 8-10 weeks old were anesthetized with ketamine / xylazine cocktail and subcutaneously injected with 5 milions of cells resuspended in 100 μl of saline water and then injected on the right flank. Mice were monitored everyday to check the effective tumor engraftment. Tumors are measured with caliper everyday. When tumor reached the size of 50-100 mm3of volume, mice were subjected to treatment and injection of siRNA Scramble, siRNA3 or siRNA1, which was performed 3 times per week, for two weeks after the start of treatment. The transfection with siRNA3 or siRNA Scramble control was prepeared using Lipofectamine 3000, lipid-based transfection reagent kit (Life Technologies-Invitrogen, Monza, Italy; #L3000-008) and Opti-MEM medium. Briefly, 2μl lipofectamine 3000(Invitrogen) was mixed with 48μl OptiMEM and incubated for 5 minutes, according to the manufacturer's instructions. 25μg of human siRNA3 or siRNA Scramble control were resuspended in 50 μl of OptiMEM and incubated at room temperature for 20 minutes. This solution was immediately administered i.v. (intraocular and retro-orbital administration) to anesthetized mice. At the end of the experiment, mice were sacrificed and the tumors were romoved and weighed. Portions of tumor tissues were cut, processed and paraffin-embedded for further histological analysis. RESULTS The silencing efficacy of the designed siRNAs (siRNA1-siRNA2-siRNA3-siRNA4) was tested on Caco2 cells, a cell line of primary human colon adenocarcinoma. After evaluating, by both RT-PCR and Western Blot, that the tumor line actually expressed TRIM28, Caco2 cells were silenced with each siRNA, which was previously loaded into lipid cages generated through the Kit Lipofectamine3000. After validating the silencing of TRIM28 for all four siRNA sequences, RT- PCR and Western Blot analysis verified that each of them presented an efficient down-regulation (over 50%) of both the transcript and the protein target, as compared to the scramble treated control group (Fig. 3A-B). After identifying siRNA3 as the best performing sequence in down-regulating TRIM28 expression, we re- transfected both Caco2 cells and the highly metastatic colorectal cancer cell line SW620 with siRNA3 for 24h- 48h-72h (Fig. 4 and 5). After confirming the effective efficacy of down-regulation of TRIM28, we investigated how TRIM28 silencing impacts on cell proliferation (detected by expression of the intra-nuclear proliferation marker Ki67), cell death (assessed with Annexin / PI staining) and cell progression in the cell cycle phases (DAPI intra-nuclear staining), by flow cytometry analysis. As far as the primary human cell line Caco2 is concerned, siRNA3-treated cells showed no differences in terms of cell proliferation, compared to their relative controls (Fig.4C). However, the analysis of apoptosis, i.e., programmed cell death, showed that in terms of percentage, cells treated with siRNA3 were more prone to programmed cell death than those treated with scramble control (Fig.4D). Furthermore, the analysis of the cell cycle revealed that Caco2 cells treated with the scramble control siRNA mostly proceeded regularly at 48h and 72h in the cell cycle, accumulating in the S phase, the phase of the cell cycle in which active replication of the genetic material takes place, and which includes cells that progress towards proliferation (Fig.4G-H). For the SW620 metastatic cell line, cells treated with siRNA3 appeared to be less proliferative, in terms of percentage, than the control (Fig.5C), as well as more apoptotic (Fig. 5D) and necrotic (Fig. 5E). In contrast, SW620 cells treated with the siRNA scramble, entered a higher percentage in the S phase of the cell cycle, indicating their greater predisposition to progress towards mitotic division (Fig.5G-H). In non-immune cells, TRIM28 has been extensively studied in different cancers, in which, depending on the type, it can exert pro- or anti-tumoral functions(36). The tumor-suppressor activity of TRIM28 is related to the regulation of DNA repair mechanisms and epigenetic stability(37), regulated by its phosphorylation of Ser473 and / or Ser824. Given that, we have found that both TLR ligands and inflammatory cytokines can induce TRIM28 S473p, we explored the impact of inflammation on TRIM28-dependent DNA damage response and consequent susceptibility of intestinal epithelial cells (IECs) to undergo neoplastic transformation. To explore the role of IECs-specific ablation of TRIM28 in CAC development, TRIM28flox / floxand TRIM28Villin-Cremice were used. Briefly, TRIM28flox / flox(B6.129S2(SJL)-Trim28tm1.1Ipc / J) and Villin-Cre mice (B6.Cg-Tg(Vil1-cre)997Gum / J) were both purchased from Jackson Laboratories and crossed to generate offspring IECs-specific ablation of TRIM28. hen, both TRIM28flox / floxand TRIM28Villin-Cremice were treated with azoxymethane (AOM) in combination with three rounds of DSS treatment. Albeit we confirmed an increased body weight loss in TRIM28Villin-Cremice after the first DSS treatment, both mice groups showed similar flare up in response to the following rounds of DSS administration. However, macroscopic analysis of colons showed a drastic reduction of tumor lesions in TRIM28Villin-Cremice (Fig. 2A-B). These results indicate that lack of TRIM28 in IECs enhances resistance against CAC development without affecting the overall degree of intestinal inflammation. In conclusion, our results showed that in preclinical models of CRC, the lack of TRIM28 in intestinal epithelial cells is fundamental to confer tumor resistance in CAC, suggesting TRIM28 as novel regulator in cancer-related inflammation. Having established that genetic silencing of Trim28 in the intestinal epithelium inhibits tumor development in response to AOM / DSS treatment (Fig. 2), we verified the ability of a siRNA targeting the murine Trim28 transcript to replicate this result and to inhibit tumor development. Hence, the on-target potential of TRIM28 silencing was assessed during colitis-associated cancer development. Briefly, C57Bl / 6 male mice were divided into two experimental groups and treated with the carcinogen azoxymethane (AOM) in combination with three rounds of dextran sulfate (DSS) treatment (Fig.6A). Each cycle of DSS treatment consisted of 5 days of 2.5% DSS in drinking water, followed by 16 days of regular water administered ad libitum. The mice were then treated with an intrarectal dose of 5 μg of murine siRNA or scramble control, three times / week, starting with the third cycle of DSS. At the end of the experiment, mice were sacrificed, and colon explanted (Fig.6A) for analysis. Macroscopic and histologic analysis of colons showed a drastic reduction of tumor lesions in Trim28 murine siRNA treated mice compared to the control group, indicating that the siRNA-mediated down-regulation of Trim28 in vivo enhances resistance against CAC development, thus confirming Trim28 as novel regulator of the tumor development in conditions of chronic inflammation (Fig.6B-C). Next, we investigated whether Trim28 silencing could interfere with tumor dissemination, in a metastatic model of colorectal cancer. Male C57Bl / 6 mice were divided into two experimental groups and the highly metastatic colon cancer cell line MC38pluc was injected intra-splenically to induce the development of liver metastases(38). Mice were subsequently treated with 25μg / mouse of liposome-encapsulated murine siRNA or with the same amount of scramble siRNA control, three times a week for four weeks, by the intravenous route (Fig.7A). After four weeks, the mice were sacrificed and the liver, blood and bone marrow were collected for analysis. As shown in Fig.7B, mice treated with murine siRNA exhibit a reduced burden of liver metastases, so that their formation was almost totally absent (Fig.7B-C). Next, we tested the role of Trim28 silencing in regulating cancer development in a murine model of mesothelioma. Female Balb / c mice were injected with the AB22 cell line, intrathoracically. The starting day of Liposomes-loaded siRNAs treatment was scheduled ten days after the AB22-pLuc cell line injection, when the tumor size was comparable in all AB22-pLuc injected mice. Briefly, mice were treated with 25μg / mouse of liposome-encapsulated murine siRNA or with the same amount of scramble siRNA control, three times a week for four weeks, by the intravenous route. During the entire duration of the experiment, tumor growth was monitored and measured by in vivo imaging, after C- Lucipherin administration. As shown in Fig.8, mice treated with murine siRNA exhibit a reduced burden of tumor growth at 10-14-21 days after the beginning of the treatment compared to the control scramble group (Fig.8A), characterized by a statistically significant reduction of tumor burden at 21 days after the beginning of the treatment (Fig.8B). This conclusion was also supported by the macroscopic count of tumor foci formations, as mice administered with murine siRNA showed a drastic reduction in the development of tumor formations (Fig.8 C-D). All these data confirmed the involvement of TRIM28 in supporting fundamental mechanisms underlying tumor progression. Next, we selected a group of siRNAs specifically targeting exons 4, 6 and 12. In particular, we identified siRNA3, targeting exon 12, as the most performing one and able to confer antitumor activity. Our aim was to demonstrate that siRNA-mediating TRIM28 down-regulation, through the targeting of exons 4, 6 and 12, can confer an advantage in performing anti- tumoral activities in comparison with siRNAs disegned on other exons, in particular exon 3. To this aim, we silenced human pancreatic cancer cell line, PANC1 by siRNAs generated against exons 4 (siRNA8), 6 (siRNA2), 12 (siRNA3) and 3 (siRNA1). We first validated the efficacy of siRNAs’ silencing by both RT-PCR and Flow Cytometry, where siRNAs and relative scramble control were previously loaded into lipid cages generated through the Kit Lipofectamine3000. Data revealed that all the siRNAs induced a statistically significant reduction of Trim28 transcript at 24h, 48h and 72h in comparison with scramble control (Fig.9A) and these results were also sustained by a specular reduction of Trim28 protein levels at 48h and 72h hours (Fig.9B). In order to discriminate the effects of Trim28 silencing induced by siRNAs designed on different exons we harvested cells and calculated the absolute number of living cells. All siRNAs induced reduction in cell survival at each scheduled time point, in comparison with the relative scramble control. Considering the differences among all the experimental conditions, PANC1 cells treated with both siRNA3 and siRNA2 were characterized by a pronounced reduction of living cells, compared with siRNA1 (against the exon 3). Furthermore, a trend in reduction of living cells was reported at 48h among the group treated with siRNA8 (targeting exon 4) compared to siRNA1 (targeting exon 3) (Fig.9C). In order to clarify if siRNAs targeting exons 4, 6 and 12 could regulate cell death, in particular affecting the apoptotic and necrotic processes, PANC1 cell line was treated with all siRNAs, as well as with the relative scramble control. After 24h and 48h cells were assessed for cell death through AnnexinV / PI cell staining, through flow cytometry. The percentage of living cells were drastically reduced in PANC1 treated with siRNA3, compared with cells derived from both scramble control group and siRNA1 (Fig.10A-B). These results also reflect the higher and statistically significant accumulation of cells in the early and late apoptotic phases, in the group treated with siRNA3, compared to the other experimental groups. Considering the siRNAs targeting exon 4 and exon 6 we found out a significant accumulation of siRNA8 treated cells in the Late apoptotic phase, compared to the scramble control and siRNA1 treated cells at 48h. All these data support the the view that Trim28 silencing is positively associated with promotion of cell death, and in particular the apoptotic process, expecially when induced through siRNA3 targeting exon 12. Furthermore, to uncover the molecular actors regulated by of Trim28 silencing involved in the apoptotic process, we analyzed p21 expression levels at 48h and 72h after the treatment of down-regulation. The resuls showed a significant increasing of p21 expression in siRNA3 treated group at 72h, compared with scramble control and siRNA1 treated group. The same behavior was exhibited by PANC1 cells treated with siRNAs targeting either exon 4 or 6, indicating that all siRNAs targeting exon 4, 6 and 12 are able to positively modulate p21 expression levels, as wel as the apoptotic process (Fig.10C). To further support these results we replicated the same experiments using another cancer cell line. In particular we focused on the HepG2 a human cell line derived from a primary hepatic tumor. We compared the anti-tumoral activity of Trim28-silencing induced by siRNA3, siRNA2, siRNA8 and siRNA1. We first validated the efficacy of siRNAs silencing by RT-PCR and Flow Cytometry to detect Trim28 protein level down- regulation. Data revealed that siRNA3 targeting exon 12 performed a more efficient silencing efficacy not only in comparison with the scramble control, but also with the other siRNAs at every scheduled time points(Fig.11A). In particular, in HepG2 cancer cells, siRNA1 showed limited efficacy in addressing Trim28 mRNA silencing at 24h(Fig.11A). These results were also verified by analyzing Trim28 protein expression at 48h and 72h hours by flow cytometry. In this case, TrIM28 protein levels were significantly decreased at both 48h and 72h for each experimental condition, in comparison with scramble control group. In addition, siRNA3 designed against exon 12, performed the most efficient silencing, both at transcript and protein level, as compared to the other experimental groups (Fig.11B). We also moved in validating the effects of Trim28 down- regulation in impacting cell survival. Proceeding with the absolute count of living cells, evaluated by Trypan Blue, cells treated with siRNA against exon 4, 6 and 12 showed a drastic reduction in the number of living cells compared to those treated with siRNA1 (against exon 3) and the relative scramble control, at 24h-48h- 72h (Fig.11C). These data were further verified by comparing the absorbance between the experimental groups, taking advantage of Cristal Violet staining at 24h-48h-72h (Fig.11D). After confirming the efficacy of down-regulation of TRIM28, we investigated how TRIM28 silencing could impacts cell death (assessed with Annexin / PI staining) and p21 expression, by flow cytometry analysis (Fig.12). Primary human HepG2 cells treated with siRNA3, siRNA2, siRNA8 showed an increase percentage of apoptotic events, compared to those treated with scramble control and siRNA1 (Fig.12A-B-C). These data, were also corroborated by the increased expression of p21 at both 48h and 72h (Fig.12D). Finally, siRNA3- treated cells showed significant differences in terms of proliferation rate, compared to their relative controls, with a significant reduction of Ki67 expression at 24h-48h and 72h as compared to those treated with scramble control and siRNA1. These trend was also confirmed for siRNA2 and siRNA8 in comparison with the siRNA1 targeting exon 3 (Fig.12E). The key role of TRIM28 in regulating DNA damage is well documented. To verify these mechanisms, we generated a MC38-pLucipherase TRIM28 KO cell lines, by CrispR\Cas9 technique. To detect if TRIM28 silencing could affect DNA damage in CRC (MC38 cells), as well as cancer cell biology and tumor progression, MC38 TRIM28 WT and KO cells were treated for 1h with Etoposide (Eto), an inducer of DNA damage, at 25 ^^M (Fig.13A). Next, we evaluated the levels of DNA-damage associated marker ^^H2AX by flow cytometry analysis, at 2h-3h. TRIM28 KO cell line accumulated higher ^^H2AX levels than the TRIM28 control WT. To support these results, we also considered the levels of p53 expression, since DNA damage is expected to promote p53 activation (44). TRIM28 KO displayed higher expression of oncosuppressor p53 (i.e. 3h after etoposide treatment), involved in both the control of cell cycle and DNA repair mechanisms (40), compared to the WT control cells. Since targeting DNA instability is an emerging anticancer strategies, such activity was compared with olaparib, a PARP-1 inhibitor currently in clinical development for the treatment of pancreatic, breast and prostate cancers (41). To this aim, WT and TRIM28 KO MC38-pLucipherase positive cells were pre-treated with olaparib (10 ^^M) for 4 hours, to provoke PARP- inhibition, and subsequently with etoposide for 1h to induce DNA damage. The accumulation of ^^H2AX in response to olaparib was significantly higher in TRIM28 KO cells as compared to the Wt counterpart, suggesting a possible synergism of actions between olaparib and siRNAs against TRIM28. As shown, siRNA3 TRIM28 treatment induced ^^H2AX expression in PANC1 cells, and enhanced the damaging effects of olaparib (Fig.13A,C,D), associated with enhanced p53 activation (Fig.13B, F). Finally, we investigated whether Trim28 silencing could interfere with tumor growth, in a xenograft model of pancreatic cancer (PANC1). Male Swiss Nude mice were divided into two experimental groups and injected with human PANC1 cells, in the right flank (Fig.14A). Mice were subsequently treated with 25μg / mouse of liposome-loaded siRNA3 (targeting exon 12), siRNA1 (targeting exon 3) or with scramble siRNA control, three times a week for four weeks, by intravenous administration. Two weeks after starting the treatment, mice were sacrificed, tumor explanted and weighted. Tumor samples were paraffin-embedded for further histological analysis. Both groups of mice, treated with siRNA1 and siRNA3, exhibited a significant reduced tumor burden in terms of tumor size (Fig.14A-B- C) and weight (Fig.14D), in comparison with the group treated with scramble siRNA control. These data highlight that siRNA3 treated-mice show a drastic and significant reduction of tumor growth, as compared to siRNA1-treated mice (Fig.14B-C), suggesting a higher antitumoral efficacy of siRNA targeting exon 12 of the TRIM28 gene.
[0002] References 1. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature.2001;411(6836):494-8. 2. Friedrich M, and Aigner A. Therapeutic siRNA: State-of-the- Art and Future Perspectives. BioDrugs. 2022;36(5):549-71. 3. Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A, and Bray F. Global patterns and trends in colorectal cancer incidence and mortality. Gut. 2017;66(4):683-91. 4. Aghamiri S, Jafarpour A, Malekshahi ZV, Mahmoudi Gomari M, and Negahdari B. Targeting siRNA in colorectal cancer therapy: Nanotechnology comes into view. J Cell Physiol. 2019;234(9):14818-27. 5. Chandramohan K, Balan DJ, Devi KP, Nabavi SF, Reshadat S, Khayatkashani M, et al. Short interfering RNA in colorectal cancer: is it wise to shoot the messenger? Eur J Pharmacol. 2023;949:175699.6. Yang Y, Tan S, Han Y, Huang L, Yang R, Hu Z, et al. The roleof tripartite motif-containing 28 in cancer progression and its therapeutic potentials. Front Oncol. 2023;13:1100134. 7. Shen LT, Chou HE, and Kato M. TIF1beta is phosphorylated at serine 473 in colorectal tumor cells through p38 mitogen- activated protein kinase as an oxidative defense mechanism. Biochem Biophys Res Commun. 2017;492(3):310-5. 8. Hu C, Zhang S, Gao X, Gao X, Xu X, Lv Y, et al. Roles of Kruppel-associated Box (KRAB)-associated Co-repressor KAP1 Ser-473 Phosphorylation in DNA Damage Response. J Biol Chem. 2012;287(23):18937-52. 9. Wang C, Ivanov A, Chen L, Fredericks WJ, Seto E, Rauscher FJ, 3rd, et al. MDM2 interaction with nuclear corepressor KAP1 contributes to p53 inactivation. EMBO J. 2005;24(18):3279-90.10. Tian C, Xing G, Xie P, Lu K, Nie J, Wang J, et al. KRAB-typezinc-finger protein Apak specifically regulates p53- dependent apoptosis. Nat Cell Biol. 2009;11(5):580-91. 11. Zhang PP, Ding DZ, Shi B, Zhang SQ, Gu LL, Wang YC, et al. Expression of TRIM28 correlates with proliferation and Bortezomib-induced apoptosis in B-cell non-Hodgkin lymphoma. Leuk Lymphoma. 2018;59(11):2639-49. 12. Qi ZX, Cai JJ, Chen LC, Yue Q, Gong Y, Yao Y, et al. TRIM28 as an independent prognostic marker plays critical roles in glioma progression. J Neurooncol. 2016;126(1):19-26. 13. Li F, Wang Z, and Lu G. TRIM28 promotes cervical cancer growth through the mTOR signaling pathway. Oncol Rep. 2018;39(4):1860-6. 14. Chen Y, Cheng H, and Long H. Tripartite motif containing 28 (TRIM28) promotes the growth and migration of endometrial carcinoma cells by regulating the AKT / mTOR signalingpathway. Gen Physiol Biophys. 2021;40(3):245-52. 15. Yu C, Zhan L, Jiang J, Pan Y, Zhang H, Li X, et al. KAP-1 is overexpressed and correlates with increased metastatic ability and tumorigenicity in pancreatic cancer. Med Oncol. 2014;31(7):25. 16. Chen L, Munoz-Antonia T, and Cress WD. Trim28 contributes to EMT via regulation of E-cadherin and N-cadherin in lung cancer cell lines. PLoS One. 2014;9(7):e101040. 17. Wei C, Cheng J, Zhou B, Zhu L, Khan MA, He T, et al. Tripartite motif containing 28 (TRIM28) promotes breast cancer metastasis by stabilizing TWIST1 protein. Sci Rep. 2016;6:29822. 18. Deng B, Zhang S, Zhang Y, Miao Y, Meng X, and Guo K. Knockdown of Tripartite Motif Containing 28 suppresses the migration, invasion and epithelial-mesenchymal transition inovarian carcinoma cells through down-regulation of Wnt / beta- catenin signaling pathway. Neoplasma. 2017;64(6):893-900. 19. Cheng B, Ren X, and Kerppola TK. KAP1 represses differentiation-inducible genes in embryonic stem cells through cooperative binding with PRC1 and derepresses pluripotency-associated genes. Mol Cell Biol. 2014;34(11):2075-91. 20. Oleksiewicz U, Gladych M, Raman AT, Heyn H, Mereu E, Chlebanowska P, et al. TRIM28 and Interacting KRAB-ZNFs Control Self-Renewal of Human Pluripotent Stem Cells through Epigenetic Repression of Pro-differentiation Genes. Stem Cell Reports. 2017;9(6):2065-80. 21. Miles DC, de Vries NA, Gisler S, Lieftink C, Akhtar W, Gogola E, et al. TRIM28 is an Epigenetic Barrier to Induced Pluripotent Stem Cell Reprogramming. Stem Cells.2017;35(1):147-57. 22. Klimczak M, Czerwinska P, Mazurek S, Sozanska B, Biecek P, Mackiewicz A, et al. TRIM28 epigenetic corepressor is indispensable for stable induced pluripotent stem cell formation. Stem Cell Res. 2017;23:163-72. 23. Czerwinska P, Shah PK, Tomczak K, Klimczak M, Mazurek S, Sozanska B, et al. TRIM28 multi-domain protein regulates cancer stem cell population in breast tumor development. Oncotarget. 2017;8(1):863-82. 24. Parker KA, Gooding AJ, Valadkhan S, and Schiemann WP. lncRNA BORG:TRIM28 Complexes Drive Metastatic Progression by Inducing alpha6 Integrin / CD49f Expression in Breast Cancer Stem Cells. Mol Cancer Res. 2021;19(12):2068-80. 25. Czerwinska P, Jaworska AM, Wlodarczyk NA, and Mackiewicz AA. Melanoma Stem Cell-Like Phenotype and SignificantSuppression of Immune Response within a Tumor Are Regulated by TRIM28 Protein. Cancers (Basel). 2020;12(10). 26. Porcnik A, Novak M, Breznik B, Majc B, Hrastar B, Samec N, et al. TRIM28 Selective Nanobody Reduces Glioblastoma Stem Cell Invasion. Molecules. 2021;26(17). 27. Czerwinska P, Mazurek S, and Wiznerowicz M. The complexity of TRIM28 contribution to cancer. J Biomed Sci. 2017;24(1):63. 28. Wu GJ, Pen J, Huang Y, An S, Liu Y, Yang Y, et al. KAP1 inhibits the Raf-MEK-ERK pathway to promote tumorigenesis in A549 lung cancer cells. Mol Carcinog. 2018;57(10):1396-407. 29. Porta C, Ippolito A, Consonni FM, Carraro L, Celesti G, Correale C, et al. Protumor Steering of Cancer Inflammation by p50 NF-kappaB Enhances Colorectal Cancer Progression. Cancer Immunol Res. 2018;6(5):578-93. 30. Consonni FM, Bleve A, Totaro MG, Storto M, Kunderfranco P, Termanini A, et al. Heme catabolism by tumor-associated macrophages controls metastasis formation. Nat Immunol. 2021;22(5):595-606. 31. Bulbake U, Doppalapudi S, Kommineni N, and Khan W. Liposomal Formulations in Clinical Use: An Updated Review. Pharmaceutics. 2017;9(2). 32. Abraham S, Juel HB, Bang P, Cheeseman HM, Dohn RB, Cole T, et al. Safety and immunogenicity of the chlamydia vaccine candidate CTH522 adjuvanted with CAF01 liposomes oraluminium hydroxide: a first-in-human, randomised, double- blind, placebo-controlled, phase 1 trial. Lancet Infect Dis. 2019;19(10):1091-100. 33. Davidson EM, Barenholz Y, Cohen R, Haroutiunian S, Kagan L, and Ginosar Y. High-dose bupivacaine remotely loaded into multivesicular liposomes demonstrates slow drug release without systemic toxic plasma concentrations after subcutaneous administration in humans. Anesth Analg. 2010;110(4):1018-23. 34. Osborn MF, and Khvorova A. Improving siRNA Delivery In Vivo Through Lipid Conjugation. Nucleic Acid Ther. 2018;28(3):128-36. 35. Parashar D, Paingankar MS, Kumar S, Gokhale MD, Sudeep AB, Shinde SB, et al. Administration of E2 and NS1 siRNAs inhibit chikungunya virus replication in vitro and protectsmice infected with the virus. PLoS Negl Trop Dis. 2013;7(9):e2405. 36. Soldani C, and Scovassi AI. Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: an update. Apoptosis. 2002;7(4):321-8. 37. Nunes AS, Barros AS, Costa EC, Moreira AF, and Correia IJ. 3D tumor spheroids as in vitro models to mimic in vivo human solid tumors resistance to therapeutic drugs. Biotechnol Bioeng. 2019;116(1):206-26. 38. Dafflon C, Santamaria-Martinez A, and Ordonez-Moran P. An Intrasplenic Injection Model for the Study of Cancer Stem Cell Seeding Capacity. Methods Mol Biol. 2020;2171:293-302. 39. Digifico E, Erreni M, Colombo FS, Recordati C, Migliore R, Frapolli R, D'Incalci M, Belgiovine C and Allavena P. Optimization of a Luciferase-Expressing Non-InvasiveIntrapleural Model of Malignant Mesothelioma in Immunocompetent Mice. Cancers 2020, 12(8):2136 40. Liu J,Zhang C,Wang X, Hu W, Feng Z Tumor Tumor suppressor p53 cross-talk with TRIM28 proteins, Genes and Diseases, PMID: 34179310 PMCID: PMC8209353 41. Nannan Wang , Yan Yang , Dongdong Jin, Zhenan Zhang, Ke Shen, Jing Yang, Huanhuan Chen, Xinyue Zhao, Li Yang and Huaiwu Lu PARP inhibitor resistance in breast and gynecological cancer: Resistance mechanisms and combination therapy strategies 42. Zhi Shan, Xinqiang Wu, Shengfen Zhen, yaru Wi, Zhe Hong, Dingwei Ye. A systematic pan-cancer analysis identifies TRIM28 as an immunological and prognostic predictor and involved in immunotherapy resistence. J Cancer 2023; 14(15):2798-2810.doi:10.7150 / jca.86742 43. Zheng, Zhan,Chen, Weng, Rao and Fang. Machanism and current progress of Poly ADP-ribose Polymerase (PARP) inhibitors in the treatment of ovarian cancer. PMID 31931287; DOI: 10.1016 / .j.biopha.2019.109661 44. Yasser Abuetabh, H. Helena Wu, Chenseng Chai, Habib Al Yousef, Sujata Persad, Consolato M.Sergi and Roger Leng. DNA damage response revisited: the p53 family and its regulators provide endless cancer therapy opportunities. Nature, Exprimental e molecular Medicine, 54, 1658-1669 (2022).45. Bouwmann P., Jonkers J. Molecular Pathways: How can BRCA-Mutated Tumors Become resistant to PARP inhibitors? . Clinical Cancer Research.Molecular Pathways. doi.org. / 10.1158 / 1078-0432.CCR-13-0225. 46. Davis M.R., Manning L.S., Whitaker D., Garlepp M.J., Robinson B.W. Establishment of a murine model of malignant mesothelioma. International Journal Cancer, 1992. PMID: 1459729; DOI: 10.1002 / IJC.2910520609. 47. Tan M.H., Holyoke E.D., Goldrosen M.H. Murine Colon Adenocarcinomas: Methods for Selective Culture in vitro. Journal of the national Cancer institute,1976. Volume 56, Issue 4, Pages 871-873. https: / / doi.org / 10.1093 / jnci / 56.4.871. 48. Lieber M., Mazzetta J., Nelson-Rees W., Kaplan M., Todaro G. Estamblishment of a continous tumor-cell line (panc-1) from ahuman carcinoma of the exocrine pancreas. InternationaJounral Cancer, 1975. PMID: 1140870; DOI: 10.1002 / ijc.2910150505. 49. Zhou Y., Zhao S., Wu T., Zhang H. Comparison of Adverse Reaction Caused by Olaparib for DIfferent Indications. Frontiers in Pharmacology, 2022. PMID: 35910367. doi:10.3389 / fphar.2022.968163.
Claims
CLAIMS 1. A double-stranded small interfering RNA (siRNA) having a length of at least 19 nucleotides, targeting an exon of Trim28 gene mRNA having the nucleotide sequence set forth in ENST000000253024.10, wherein the exon is selected from the group consisting of exon 3, exon 4, exon 6 and exon 12, and wherein the double- stranded siRNA is capable of inhibiting TRIM28 protein.
2. The double-stranded siRNA according to claim 1, wherein the double-stranded siRNA is able to induce selective degradation of Trim28 transcripts containing one of exons 3, 4, 6 and 12.
3. The double-stranded siRNA according to claim 1 or claim 2, wherein the double-stranded siRNA has a length comprised between 19 and 29 nucleotides.
4. The double-stranded siRNA according to any one of the preceding claims, wherein the exon is selected from the group consisting of exon 4, exon 6 and exon 12, preferably exon 12.
5. The double-stranded siRNA according to any one of the preceding claims, wherein at least one strand of the double-stranded siRNA has an overhang at the 3' terminus.
6. The double-stranded siRNA according to any one of the preceding claims, wherein the double-stranded siRNA has a content of G-C bases lower than 52%.
7. The double-stranded siRNA according to any one of the preceding claims, wherein the double-strandedsiRNA has a content of G-C bases higher than 36%.
8. The double-stranded siRNA according to any one of the preceding claims, wherein at least one strand of the double-stranded siRNA has a melting temperature lower than 64 °C, wherein the melting temperature is measured as disclosed using the free software online tool OligoEvaluatorTM(Merck).
9. The double-stranded siRNA according to any one of the preceding claims, wherein the sense strand of the double-stranded siRNA has a nucleotide sequence selected from SEQ ID No.: 1 to 4 and 21, wherein the antisense strand has a sequence complementary and reverse thereto.
10. A double-stranded siRNA according to any one of the preceding claims for use in treating and / or preventing a neoplastic disease associated with an abnormality of Trim28 gene encoded protein TRIM28.
11. The double-stranded siRNA for use according to claim 10, wherein the abnormality of Trim28 gene encoded protein TRIM28 is upregulation and / or hyperphosphorylation of protein TRIM28.
12. The double-stranded siRNA for use according to claim 10 or claim 11, wherein the neoplastic disease is a primary cancer and / or a metastatic cancer.
13. The double-stranded siRNA for use according to any one of claims 10 to 12, wherein the neoplastic disease is selected from stomach, pancreas, kidney, ovary, melanoma, prostate, testis, liver, lymphoma, lung, thyroid, glioma, cervical, gastric, ovarian,glioma, colorectal, breast, mesothelioma and prostate cancer.
14. The double-stranded siRNA for use according to any one of claims 10 to 13 in a combination therapy with a poly ADP ribose polymerase (PARP) inihibitor.
15. A pharmaceutical composition comprising at least one double-stranded siRNA according to any one of claims 1 to 9 and a pharmaceutically acceptable excipient.
16. A pharmaceutical composition according to claim 15 for use in treating and / or preventing a neoplastic disease associated with an overexpression of Trim28 gene encoded protein TRIM28.