Cse inhibitor for use in the treatment of a tumor in combination with a mapk inhibitor

Abstract

The invention relates to cystathionine-γ-lyase (CSE) inhibitor for use in the treatment of a cancer, preferably a tumor in a patient, in combination with a (one or more) MAPK inhibitor, in particular an inhibitor of a BRAF V600 mutant, preferably for use in the prevention or delaying the onset or development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor, in particular the inhibitor of the BRAF V600 mutant. The invention also relates to combination treatments, if desired with diagnosis, as well as pharmaceutical compositions, combinations and kits for such therapies.

Description

[0001] CSE inhibitor for use in the treatment of a tumor in combination with a MAPK inhibitor

[0002] FIELD OF THE INVENTION

[0003] The invention relates to cystathionine-y-lyase (CSE) inhibitor for use in the treatment of a cancer, preferably a tumor in a patient, in particular a melanoma, in combination with a (one or more) MAPK inhibitor, in particular an inhibitor of a BRAF V600 mutant, preferably for use in the prevention or delaying the onset or development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor. The invention also relates to combination treatments, if desired with diagnosis, as well as pharmaceutical compositions, combinations and kits for such therapies.

[0004] TECHNICAL BACKGROUND

[0005] Cutaneous melanoma is the deadliest form of skin cancer. Although early diagnosis increases the chance of survival, the overall poor prognosis is due to rapid progression of the disease and frequent appearance of distant metastases. The most common oncogenic mutations that drive tumor development occur in the BRAF, NRAS and NF1 genes. Approximately 50% of skin melanoma patients carry the V600E activating mutation of the Serine / threonine-protein kinase B-raf (Braf) oncogene, which leads to overactivation of the MAPK / ERK pathway and therefore to uncontrolled cancer cell proliferation (Davies et al., 2002). Vemurafenib (V-treatment), the first FDA-approved targeted therapy for BrafV 600E mutant melanoma, has a high response rate, but unfortunately tumors rapidly acquire resistance (Sosman et al., 2012). Combined inhibition of V600E mutant Braf with dabrafenib and the downstream Dual specificity mitogen-activated protein kinase kinase 1 / 2 (MEK1 / 2, also known as MAP2K1 / 2) with trametinib (DT-treatment) prolong progression-free survival and overall survival, but resistance to this combination therapy is also mostly inevitable (Manzano et al., 2016; Prahallad et al., 2012; Robert et al., 2015; Sosman et al., 2012; Sun et al., 2014).

[0006] It is increasingly recognized that therapy resistance in various cancers is associated with extensive reprogramming of metabolic pathways in cancer cells (Luis et al., 2020; Yoo and Han, 2022). The ability of melanoma cells to proliferate rapidly is supported by increased aerobic glycolysis (Hall et al., 2013), which is promoted by BRAFV600E mutation-induced activation of the Braf / MEK / ERK pathway (Haq et al., 2013). On the other hand, BrafV600E inhibition induces major metabolic changes in melanoma cells. This includes a shift from aerobic glycolysis towards increased mitochondrial respiration (Corazao-Rozas et al., 2016), which triggers the production of reactive oxygen species (ROS) and leads to an altered redox environment (Khamari et al., 2018; Wang et al., 2018). The aim of the current work was to uncover potential mechanistic aspects that may link this elevated ROS production to the development of resistance to dabrafenib / trametinib (DT) and vemurafenib (V) therapies.

[0007] The present inventors found that the transsulfuration pathway, which is dedicated to produce cysteine from methionine, plays a major role in this process. Apart from their canonical functions to produce cysteine, the transsulfuration enzymes cystathionine- -synthase (CBS) and cystathionine-y-lyase (CSE) are key players in the biogenesis of small signaling molecules including hydrogen sulfide and cysteine persulfide (Ida et al., 2014; Kumar and Banerjee, 2021). Recently uncovered vital functions of these reactive sulfur species (RSS) in human physiology and pathology places them in the focus of redox biomedical research (Cirino et al., 2023; Cortese-Krott et al., 2017; Wallace and Wang, 2015; Wang et al., 2021). Among others, their oncogenic functions are increasingly recognized (Coletta et al., 2012; Czikora et al., 2022; Erdelyi et al., 2021; Pavlova et al., 2022; Szabo, 2016).

[0008] In most targeted therapies that block a driver oncogene (such as BRAF V600E), cancer cells can develop acquired resistance with continuous dosing (Sosman et al., 2012). In cancer, for example in melanoma, acquired resistance to treatment is still an unsolved problem, and solutions that can overcome or prevent such a resistance is critical to further advances in the treatment of melanoma and other tumors.

[0009] EP3563870A1 discloses a PD-1 axis binding antagonist for use in treating or delaying progression of melanoma that is resistant to a BRAF antagonist, wherein the PD-1 axis binding antagonist is administered in combination with a MEK inhibitor. However, this combination treatment does not prevent development of resistance to BRAF inhibitors.

[0010] W02015004636A1 discloses a method of treating melanoma comprising administering a subject in need thereof a CDK (cyclin dependent kinase) inhibitor and a BRAF inhibitor and / or MEK inhibitor. The melanoma being treated may be a resistant BRAF mutant melanoma. However, this method does not prevent the development of resistance to BRAF / MEK inhibitors either.

[0011] W02015161230A1 discloses a method of treating cancer in an individual comprising administering a MAPK inhibitor and one or more of an AXL inhibitor, a Met inhibitor and a PI3K inhibitor. In one aspect, the invention is directed to a method of reducing resistance to a MAPK inhibitor, wherein the method comprises administering the MAPK inhibitor and an AXL inhibitor. The cancer may be a carcinoma, sarcoma, leukemia, breast cancer, melanoma, lung cancer, etc.

[0012] WO2021171260A2 discloses a triple pharmaceutical combination comprising dabrafenib, an ERK inhibitor and a RAF inhibitor or a PD-1 inhibitor for use in the treatment of cancers, for example breast cancer, melanoma, or non-small cell lung cancer. The triple combination is particularly useful in the treatment of colorectal cancer (including advanced or metastatic colorectal cancer) which is a BRAF gain-of-function mutant or BRAF V600E / D / K mutant. ERK inhibitors can target multiple mechanism of resistance to BRAF and MEK inhibitors and thus may circumvent resistance.

[0013] WO2022259157A1 discloses a triple pharmaceutical combination comprising dabrafenib, trametinib and a SHP2 inhibitor for the treatment of cancers, for example breast cancer, melanoma, or non-small cell lung cancer. The SHP2 inhibitor is (3S,4S)-8-(6-amino-5-((2-amino-3-chloropyridin-4-yl)thio)pyrazin-2-yl)-3-methyl-2-oxa- 8-azaspiro[4.5]decan-4-amine. The triple combination is particularly useful in the treatment of colorectal cancer (including advanced or metastatic colorectal cancer) which is a BRAF gain-of-function mutant or BRAF V600E mutant. The triple combination has the potential to uniquely target mechanisms of intrinsic and acquired resistance in BRAF V600-driven cancer cells.

[0014] Nowadays, combinations of vemurafenib with cobimetinib, dabrafenib with trametinib or encorafenib with binimetinib are the most widely used combined targeted therapies in melanoma patients with V600 mutations (based on Giunta et al., 2020).

[0015] Jiang et al. (Jiang et al., 2023) showed that AOAA enhances the antitumor (colorectal cancer) effect of regorafenib. However, the authors used AOAA to inhibit PSAT1, and pointed out that a more specific PSAT1 inhibitor would be needed, as AOAA is not specific enough. In the paper, it was confirmed that AOAA acts through PSAT1 and affects cellular metabolism at several points. It is also important to note that AOAA is not a selective CSE inhibitor, as evident from Jiang et al. Thus, AOAA in the context of Jiang et al. cannot be considered as a CSE inhibitor and a skilled person could not obtain a different guidance from Jiang et al. Moreover, the present inventors found that therapy-naive BRAF V600 mutant melanoma is not sensitive to AOAA even in a 10-20-fold higher concentration than was used by Jiang et al.

[0016] Sun et al (Sun et al., 2016) suggested that PAG with CSEi activity enhances the anticancer effect of sorafenib in hepatocellular carcinoma (HCC), but also showed that the mechanism underlying this phenomenon is through the metallothionein-lG (MT-1G) protein. The results allow the conclusion that sorafenib induces MT-1G, which is critical for the development of acquired resistance to sorafenib in HCC cells through the inhibition of sorafenib-induced cell death (ferroptosis); and it was also shown that PAG inhibits the synthesis of metallothionein, and PAG treatment led to reduced levels of MT-1G.

[0017] The canonical and non-canonical functions of CSE inhibited by PAG were not investigated at all.

[0018] Moreover, Sorafenib is not specific to Braf V 600E, which would inhibit the proliferation-promoting mutant protein in melanoma cells but inhibits the wild-type Braf protein as well that performs essential physiological functions and its mechanism of action is radically different from that of specific BRAF V600 inhibitors. In addition to this, Sorafenib also targets several other signaling proteins including VEGFR, PDGFR, c-Kit and RET that play crucial role in the regulation of cell proliferation and vascularization. Moreover, Sorafenib was also shown to inhibit the cystine-glutamate antiporter responsible for the uptake of cystine, which is crucial for the cysteine supply of the cells. Therefore, in the work published by Sun et al they use sorafenib which might inhibit the uptake of cysteine, combined with an inhibitor of CSE which is responsible for the production of cysteine in case of extracellular limitation or the inhibition of its uptake. Consequently, Sun et al are silent about the inhibition of resistance that may develop to targeted therapy, because the mechanism of action of the two agents is radically different.

[0019] Thus, the beneficial effect of CSE inhibition of resistance cannot be inferred in respect of Braf V 600 / MAPK inhibitors.

[0020] Liu et al. (Liu et ah, 2021) showed that 1194496 inhibits the growth of triple negative breast cancer (TNBC). Wang et al. (Wang et al. 2019) that compound 1157172 inhibits metastasis in breast cancer.

[0021] Li et al. (Li et al., 2021) reviewed the progress made in the control of breast cancer by using inhibitors on HzS-producing enzymes and showed that the CSE inhibitors 1194496, 1157172, PAG, BCA, AVG have anti-cancer activity.

[0022] While Liu et al (Liu et al., 2021), Wang et al. (Wang et al., 2019) and Li et al. (Li et ah, 2021) report the anticancer effects of CSE inhibition in some tumors, none of these publications describe the antitumor effects of CSE inhibitors either in BRAF V600 mutant tumors or in melanoma.

[0023] The present inventors have found that inhibition of CSE had no antitumor effect in therapy-naive BRAF V600 mutant melanoma or in combination with BRAF V600E / MAPK inhibitors.

[0024] However, surprisingly, it was found that inhibition of CSE delays the onset of acquired resistance to BRAF V600E and MAPK inhibitors.

[0025] While in the prior art progress is made in finding treatments for resistant cancers or for preventing development of resistance to anticancer agents. However, there is still a need for solutions that can prevent or at least delay the development of resistance in cancer therapies.

[0026] The present invention provides novel solutions for treating cancers, in particular by preventing and / or delaying the development of resistance to known cancer therapies. The solution is based on the discovery of the molecular mechanism behind the development of resistance to MAPK inhibitors (in particular BRAF inhibitors and / or MEK inhibitors).

[0027] BRIEF DESCRIPTION OF THE INVENTION

[0028] The prior art is silent about the use of a CSE inhibitor in combination with a MAPK inhibitor in a BRAF V600 mutation positive cancer for use in the prevention or delaying the onset of or development of acquired resistance of a patient to a treatment of the BRAF V600 mutation positive cancer. The present inventors have surprisingly found that inhibition of CSE is beneficial in prevention of resistance caused by MAPK inhibitor treatment in BRAF V600 mutation positive cancer, whereas the CSE inhibitors in themselves had no antitumor effect in therapy-naive BRAF V600 mutant melanoma or in combination with BRAF V600E / MAPK inhibitors.

[0029] 1. The invention relates to a cystathionine-y-lyase (CSE) inhibitor for use in the treatment of a BRAF V600 mutation positive cancer, preferably a BRAF V600 mutation positive tumor in a patient, in combination with a (one or more) MAPK inhibitor, in particular a MAPK inhibitor of a BRAF V600 mutant, preferably for use in preventing or delaying the onset or development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor.

[0030] Preferably the MAPK inhibitor comprises a BRAF V600 inhibitor, in particular a specific inhibitor of the BRAF V600 mutant. More preferably the mutation is selected from the group consisting of V600D, V600K, V600R or V600E; more preferably V600K or V600E; more preferably V600E.

[0031] Preferably said MAPK inhibitor comprises a BRAF inhibitor, in particular an inhibitor of a BRAF V600 mutant, and / or a MEK inhibitor.

[0032] The invention also relates to a cystathionine-y-lyase (CSE) inhibitor for use in the prevention or delaying the onset or development of resistance to a treatment of cancer with one or more MAPK inhibitor preferably in a patient treated with said one or more MAPK inhibitor.

[0033] The invention also relates to a cystathionine-y-lyase (CSE) inhibitor for use in the treatment of a patient treated with one or more MAPK inhibitor, said patient being resistant to or being in danger of developing resistance to said one or more MAPK inhibitor.

[0034] The invention also relates to a combination of cystathionine-y-lyase (CSE) inhibitor and one or more MAPK inhibitor for use in the treatment of cancer in a patient for the prevention or delaying the onset or development of resistance to said one or more MAPK inhibitor.

[0035] The term one or more MAPK inhibitors can be replaced with a MAPK inhibitor. Resistance to said one or more MAPK inhibitors is to be understood preferably as at least one of the said one or more MAPK inhibitors and includes resistance to each of said one or more MAPK inhibitors. Preferably, the cancer is a tumor.

[0036] Preferably the patient is a mammalian patient, preferably a human patient.

[0037] In a particular embodiment the BRAF inhibitor is different from Sorafenib.

[0038] In a particular embodiment the CSE inhibitor is different from aminooxyacetic acid (AOAA).

[0039] 2. In a preferred embodiment the CSE inhibitor for use according to paragraph 1, wherein the cancer, preferably a tumor, is selected from the group consisting of melanoma, skin cancer, epithelial cancer, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumor, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilms tumor), histiocytosis, Langerhans cell histiocytosis and Erdheim-Chester disease, preferably melanoma, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, particularly melanoma.

[0040] 3. In a preferred embodiment the MAPK inhibitor is a BRAF V600 mutant inhibitor and / or a MEK inhibitor. Preferably the one or more MAPK inhibitor comprises a BRAF inhibitor, in particular an inhibitor of a

[0041] BRAF V600 mutant.

[0042] Preferably wherein the MAPK inhibitor comprises an inhibitor of the BRAF V600 mutant, and / or wherein said MAPK inhibitor comprises a BRAF V600 mutant inhibitor and / or a MEK inhibitor.

[0043] Thus, the invention preferably relates to the cystathionine-y-lyase (CSE) inhibitor for use in the prevention or delaying the onset or development of resistance to a treatment of cancer with the BRAF V600 inhibitor preferably in a patient treated with the BRAF inhibitor; and / or the cystathionine-y-lyase (CSE) inhibitor for use in the treatment of a patient treated with the BRAF V600 inhibitor, said patient being resistant to or being in danger of developing resistance to said one or more BRAF V600 and MEK inhibitor; and / or a combination of the cystathionine-y-lyase (CSE) inhibitor and the BRAF inhibitor for use in the treatment of cancer in a patient for the prevention or delaying the onset or development of resistance to said BRAF inhibitor.

[0044] Preferably the cancer is a tumor, preferably a BRAF mutation positive tumor, more preferably a BRAF V600 mutation positive tumor.

[0045] Resistance the BRAF inhibitor is to be understood preferably as at least one of the said one or more BRAF inhibitors and includes resistance to each of said one or more BRAF inhibitors.

[0046] Preferably the patient is a mammalian patient, preferably a human patient, preferably a patient with a BRAF V600 mutation positive tumor.

[0047] 4. In a preferred embodiment the MAPK inhibitor, preferably the BRAF inhibitor is an inhibitor of a BRAF V600 mutant and the tumor is a BRAF V600 mutation positive cancer, preferably the mutation being V600D, V600K, V600R or V600E; more preferably V600K or V600E; more preferably V600E, wherein preferably the patient is a mammalian patient, preferably a human patient.

[0048] Preferably the patient is resistant to or being in danger of developing resistance to said one or more BRAF V600 inhibitor, preferably an inhibitor of BRAF V600 mutant.

[0049] 5. In a preferred embodiment the CSE inhibitor is for use in the prevention or delaying the onset and / or development of resistance of said patient to said cancer, preferably tumor, wherein the tumor is a BRAF V600 mutation positive cancer. Resistance is preferably acquired resistance. Preferably the cancer or tumor is selected from the group as defined in paragraph 2, particularly preferably the cancer is melanoma. Preferably the CSE inhibitor for use is as defined in any of paragraphs 1 to 4 or given herein. Preferably the CSE inhibitor is selective for CSE or selective over CBS.

[0050] Preferably the tumor is a BRAF V600 mutation positive cancer, preferably with BRAF V600D, V600K, V600R or V600E mutation. Preferably the tumor or cancer is melanoma.

[0051] 6. In a preferred embodiment the BRAF V600 mutant inhibitor is selected from vemurafenib (PLX4032), dabrafenib (GSK2118436), dabrafenib mesylate, encorafenib (LGX818), , agerafenib (RXDX-105, CEP-32496), regorafenib (BAY 73-4506), GDC-0879, RO5212054 (PLX3603), PLX-4720, PLX8394, SB590885, L-779450, RAF265, RAF709, naporafenib (LXH254), LY3009120 (DP-4978), belvarafenib (HM95573), CH5126766 (RO5126766), TAK-632, lifirafenib (BGB-283), AZ628, AZ304, ARQ-736, XL281 (BMS-908662) or CCT196969.

[0052] The inhibitors are understood to include any pharmaceutically acceptable salt, hydrate or tautomeric from, if any.

[0053] Preferably the BRAF inhibitor is a BRAF V600 inhibitor, preferably selected from vemurafenib (PLX4032), dabrafenib (GSK2118436), dabrafenib mesylate, encorafenib (LGX818), agerafenib (RXDX-105, CEP-32496), PLX-4720, PLX8394, RAF265, RAF709, LY3009120 (DP-4978), lifirafenib (BGB-283), AZ628 or AZ304. Preferably the BRAF inhibitor is selected from vemurafenib, dabrafenib or encorafenib.

[0054] Preferably the BRAF inhibitor is selected from vemurafenib, dabrafenib or encorafenib.; more preferably vemurafenib or dabrafenib.

[0055] Preferably the invention relates to a CSE inhibitor for use according to any of paragraphs 3 to 5, wherein the BRAF inhibitor is selected from vemurafenib, dabrafenib or encorafenib.

[0056] 7. In a preferred embodiment the MEK inhibitor is selected from trametinib (GSK1120212), cobimetinib (XL518, GDC-0973), binimetinib (MEK162), selumetinib (AZD6244), mirdametinib (PD-0325901), CI-1040 (PD184352), TAK-733, pimasertib (AS703026), refametinib, AZD8330, E6201, GDC-0623, RO-4987655 (CH4987655), CH5126766 (RO5126766), HL-085, SHR7390, TQ-B3234, CS-3006, FCN-159, WX-554, PD318088, PD98059, BI-847325, U0126, myricetin, CInQ-03, G-573, PD184161, PD98059, R05068760 or SL327.

[0057] Preferably the MEK inhibitor is selected from trametinib (GSK1120212), cobimetinib (XL518, GDC- 0973), binimetinib (MEK162) or selumetinib (AZD6244), more preferably selected from trametinib, cobimetinib or binimetinib, more preferably the MEK inhibitor is trametinib.

[0058] Preferably the invention relates to a CSE inhibitor for use according to any of paragraphs 3 to 5, wherein the MEK inhibitor is selected from trametinib, cobimetinib, binimetinib or selumetinib, more preferably selected from trametinib, cobimetinib or binimetinib, more preferably the MEK inhibitor is trametinib.

[0059] 8. In an embodiment, in particular in an embodiment according to any of paragraphs 3 to 7, the MAPK inhibitor comprises a BRAF inhibitor, in particular BRAF V600 mutant inhibitor and a MEK inhibitor, or a combination thereof.

[0060] Preferably the CSE inhibitor is for use in the prevention or delaying the onset of acquired resistance to MAPK inhibitors in BRAF V600 mutant cancer, wherein preferably the MAPK inhibitor comprises a BRAF V600 inhibitor (in particular vemurafenib, dabrafenib, encorafenib) and a MEK inhibitor (in particular cobimetinib, trametinib, binimetinib).

[0061] Preferably the combination of BRAF inhibitor and MEK inhibitor is selected from the group consisting of dabrafenib + trametinib, vemurafenib + cobimetinib, or encorafenib + binimetinib; more preferably dabrafenib + trametinib.

[0062] Preferably the BRAF inhibitor is selected from any of the groups listed in paragraph 6 above, and / or the MEK inhibitor is selected from any of the groups listed in paragraph 7 above.

[0063] More preferably wherein the BRAF inhibitor is selected from the group consisting of vemurafenib, dabrafenib or encorafenib, and the MEK inhibitor is selected from trametinib, cobimetinib, binimetinib or selumetinib.

[0064] Preferably the combination of BRAF inhibitor and MEK inhibitor is dabrafenib + trametinib, vemurafenib + cobimetinib, or encorafenib + binimetinib; more preferably dabrafenib + trametinib.

[0065] 9. In a preferred embodiment, in particular in an embodiment according to any of paragraphs 3 to 8, the CSE inhibitor is selected from propargylglycine (PAG), P-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG), hydroxylamine, 1194496, 1157172, S-3-carboxpropyl-L-cysteine (CPC), NSC4056 (aurintricarboxylic acid), L-aminoethoxyvinylglycine, 2-arylidene-hydrazinecarbodithioates or cystathionine-y-lyase-IN-1 (CAS No. 2165706-30-7).

[0066] Preferably the CSE inhibitor is for use in the prevention or delaying the onset of acquired resistance to BRAF V600 and MEK inhibitors in BRAF V600 mutant cancer, wherein the inhibitor is selective for CSE. Preferably the CSE inhibitor is selected from the group consisting of P-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG) and propargylglycine (PAG), more preferably D,L-propargylglycine (2- aminopent-4-ynoic acid or H-DL-Pra-OH) or N-Propargylglycine (2-propyn-l-ylamino)acetic acid).

[0067] Combined inhibition of BRAF and MEK results in a better therapeutic response with increased overall survival and progression free survival and even reduced adverse effects by avoiding the paradoxical activation of MAPK pathway.

[0068] 10. In a particular embodiment the patient is a mammal, preferably a human.

[0069] 10a. In a preferred embodiment the invention relates to a CSE inhibitor for use according to any of paragraphs 1 to 9, wherein the treatment prevents or delays the onset / development of resistance to a BRAF inhibitor therapy, or a MEK inhibitor therapy or a combination therapy of a BRAF inhibitor and a MEK inhibitor in BRAF V600 mutant patients, wherein preferably the development of resistance is delayed by at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more.

[0070] In a preferred embodiment the treatment comprising the CSE inhibitor and MAPK inhibitor delays the onset of acquired resistance. Preferably, the treatment comprising the CSE inhibitor and MAPK inhibitor prevents the onset of acquired resistance. Preferably, the treatment comprising the CSE inhibitor and MAPK inhibitor increase the efficacy of MAPK targeted therapy.

[0071] 10b. In a preferred embodiment the invention relates to a CSE inhibitor for use according to any of paragraphs 1 to 10, wherein the CSE inhibitor in combination with the MAPK inhibitor is administered to a patient having a tumor, who has not been previously treated, or who has not been previously given MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor), or who has been previously treated with MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor) but remained sensitive to the MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor).

[0072] Preferably, the tumor is a tumor comprising a V600 mutation in the serine-threonine protein kinase B-RAF (BRAF).

[0073] More preferably the mutation is V600; more preferably V600D, V600K, V600R or V600E; more preferably V600K or V600E; more preferably V600E.

[0074] In a preferred embodiment the tumor of the patient is selected from the group consisting of melanoma, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumor, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilms tumor), histiocytosis, Langerhans cell histiocytosis and Erdheim-Chester disease.

[0075] Preferably the tumor is a melanoma, particularly preferably a BRAF V600 mutant melanoma (such as unresectable or metastatic melanoma).

[0076] 11. In a preferred embodiment the invention relates to a CSE inhibitor for use according to any of paragraphs 1 to 10 (including 10a or 10b), wherein wherein the CSE inhibitor is administered prior to the administration of the MAPK inhibitor, in particular BRAF V600 mutant inhibitor or wherein the CSE inhibitor is administered concurrently with the MAPK inhibitor, in particular BRAF V600 mutant inhibitor, or wherein the CSE inhibitor is administered after the administration of the MAPK inhibitor, in particular

[0077] BRAF V600 mutant inhibitor. Preferably, the MAPK inhibitor, preferably the BRAF V600 mutant inhibitor and / or MEK inhibitor, more preferably a combination thereof, are administered separately, sequentially, simultaneously, or concurrently with the CSE inhibitor.

[0078] 12. In a preferred embodiment the invention relates to a CSE inhibitor for use according to any of paragraphs 1 to 11 , wherein the CSE inhibitor and the MAPK inhibitor is administered in a sequential, intermittent or continuous therapy. Preferably the therapy comprises prevention or delaying the onset of acquired resistance to MAPK inhibitors, wherein the CSE inhibitor and the MAPK inhibitor are administered in a sequential, intermittent or continuous therapy.

[0079] Preferably the therapy is an intermittent therapy, such as an 8 -week period therapy, wherein the CSE inhibitor and MAPK inhibitor is administered for 5 weeks and then not administered for 3 weeks.

[0080] Preferably the therapy is a continuous therapy, wherein the CSE inhibitor and MAPK inhibitor may be administered simultaneously / concurrently for a period of time; or the CSE inhibitor and MAPK inhibitor may be administered alternately.

[0081] Preferably, the therapy is a continuous therapy, wherein the MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor) is administered to the patient daily and the CSE inhibitor is administered at least once a week, preferably at least twice a week to the patient.

[0082] 13. The invention also relates to a combination, in particular a pharmaceutical kit comprising a cystathionine-y-lyase (CSE) inhibitor and a MAPK inhibitor for use in the treatment of a BRAF V600 mutation positive cancer, preferably a BRAF V600 mutation positive tumor in a patient, in combination with a (one or more) MAPK inhibitor, preferably for use in the prevention or delaying the onset / development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor.

[0083] Preferably the combination or kit comprises a CSE inhibitor, a BRAF inhibitor in particular a BRAF V600 mutant inhibitor and / or a MEK inhibitor, preferably a CSE inhibitor, a BRAF inhibitor and a MEK inhibitor, each as defined herein, e.g. in the above paragraphs.

[0084] Preferably the combination or kit is for use in a treatment method as defined in paragraph 2, or paragraph 3, 4 or 5; and / or paragraph 10, 11 or 12.

[0085] In a preferred embodiment the combination or kit comprises a cystathionine-y-lyase (CSE) inhibitor in combination with a BRAF inhibitor as defined in paragraph 6, and / or with a MEK-inhibitor as defined in paragraph 7, and / or the combination as defined in paragraph 8.

[0086] In any of these combinations in a preferred embodiment the CSE-inhibitor is as defined in paragraph 9.

[0087] 14. The invention also relates to a pharmaceutical composition comprising a cystathionine-y-lyase (CSE) inhibitor and a MAPK inhibitor for use in a BRAF V600 mutation positive cancer, in particular a BRAF V600 mutation positive cancer, and a pharmaceutically acceptable excipient.

[0088] Preferably the pharmaceutical composition is for use in the treatment of a cancer, preferably a tumor in a patient. Preferably, the pharmaceutical composition is for use in the prevention or delaying the onset or development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor.

[0089] Preferably the pharmaceutical composition comprises a CSE inhibitor, a BRAF inhibitor, in particular a BRAF V600 mutant inhibitor, and / or a MEK inhibitor, preferably a CSE inhibitor, a BRAF inhibitor and a MEK inhibitor, each as defined herein, e.g. in the above paragraphs.

[0090] Preferably the pharmaceutical composition is for use in a treatment method as defined in paragraph 2, or paragraph 3, 4 or 5; and / or paragraph 10, 11 or 12. In a preferred embodiment the combination or kit comprises a cystathionine-y-lyase (CSE) inhibitor in combination with a BRAF inhibitor as defined in paragraph 6, and / or with a MEK-inhibitor as defined in paragraph 7, and / or the combination as defined in paragraph 8.

[0091] In any of these combinations in a preferred embodiment the CSE-inhibitor is as defined in paragraph 9.

[0092] 15. In a further embodiment the invention relates to a method for treating cancer in a subject, preferably a tumor in a BRAF V600 mutation positive subject, preferably patient, said method comprising administering to the subject a cystathionine-y-lyase (CSE) inhibitor in combination with a MAPK inhibitor. Preferably the MAPK inhibitor is a BRAF inhibitor, in particular a BRAF V600 mutant inhibitor, or MEK inhibitor or a combination of BRAF inhibitor and MEK inhibitor, as defined herein. Preferably the method is for prevention or delaying the onset or development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor. Preferably the subject is a patient diagnosed as having BRAV V600 mutation positive cancer, preferably tumor.

[0093] In an alternative embodiment the invention relates to a method for prevention or delaying the onset or development of resistance a subject, preferably patient to a treatment of a tumor in said patient with a MAPK inhibitor, said method comprising administering to the subject a cystathionine-y-lyase (CSE) inhibitor in combination with the MAPK inhibitor. Preferably the MAPK inhibitor is a BRAF inhibitor or MEK inhibitor or a combination of BRAF inhibitor and MEK inhibitor, as defined herein. Preferably the subject is a patient diagnosed as having BRAV V600 mutation positive cancer, preferably tumor.

[0094] In the method of the invention the cancer, preferably tumor, comprises a V600 mutation in the serinethreonine protein kinase B-RAF (BRAF V600 mutation).

[0095] More preferably the mutation is V600D, V600K, V600R or V600E; even more preferably V600K or V600E; highly preferably V600E.

[0096] In a preferred embodiment the tumor of the patient is selected from the group consisting of BRAF V600 mutant melanoma, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumor, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilms tumor), histiocytosis, Langerhans cell histiocytosis and Erdheim-Chester disease.

[0097] Preferably the tumor is a melanoma, particularly preferably a BRAF V600 mutant melanoma (such as unresectable or metastatic melanoma).

[0098] Preferably, a combination or kit as defined in paragraph 13 or a pharmaceutical composition as defined in paragraph 14 is administered to the subject in a treatment method as defined in paragraph 2, or paragraph 3, 4 or 5; and / or paragraph 10, 11 or 12. Preferably the subject is a mammalian, preferably a human patient, preferably as defined in paragraph 10.

[0099] In a preferred embodiment the method comprises, detecting the presence of a BRAF mutation in a tumor sample derived from the subject prior to the administering step.

[0100] Thus, preferably before the start of the combination treatment, a diagnostic step is carried out for detecting the presence or absence of a BRAF mutation in a tumor sample. Preferably the BRAF mutation (preferably V600 mutation) is determined using a method comprising (a) performing PCR or sequencing on nucleic acid (e.g., DNA) extracted from a sample of the patient's melanoma; and / or (b) determining expression of BRAF mutant protein in the sample and / or by Sanger sequencing method.

[0101] Preferably the BRAF mutation (preferably V600 mutation) is as defined in paragraph 10.

[0102] In a preferred embodiment the patient is sensitive to MAPK inhibitor therapy, preferably a BRAF inhibitor and / or a MEK inhibitor or a combination thereof. 16. In a preferred embodiment in the treatment method the CSE inhibitor is administered prior to the administration of the MAPK inhibitor, in particular the V600 mutant inhibitor, or the CSE inhibitor is administered concurrently with the MAPK inhibitor, in particular the V600 mutant inhibitor, or the CSE inhibitor is administered after the administration of the MAPK inhibitor, in particular the V600 mutant inhibitor.

[0103] Preferably, the MAPK inhibitor, preferably the BRAF inhibitor, in particular the BRAF V600 mutant inhibitor, and / or MEK inhibitor, preferably a combination thereof, is administered separately, sequentially, simultaneously, or concurrently with the CSE inhibitor. Preferably the BRAF inhibitor, in particular the BRAF V600 mutant inhibitor, and the MEK inhibitor are administered simultaneously, preferably from the start of the treatment, in particular as soon as possible after diagnosis.

[0104] Preferably, treatment with the CSE inhibitor is started within one month, preferably within one week, preferably within 6, 5, 4, 3, 2 or 1 day(s) after diagnosis of the patient as having BRAF 600 mutation positive cancer.

[0105] Preferably the CSE inhibitor in combination with the MAPK inhibitor is administered to a patient having a tumor who has not been previously treated, or who has not been previously given MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor), or who has been previously treated with MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor) but remained sensitive to the MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor.

[0106] In a preferred embodiment the CSE inhibitor for use according to paragraph 1, wherein the cancer, preferably a tumor, is selected from the group consisting of melanoma, skin cancer, epithelial cancer, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumor, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilms tumor), histiocytosis, Langerhans cell histiocytosis and Erdheim-Chester disease, preferably melanoma, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, particularly melanoma.

[0107] 17. In a preferred embodiment the invention relates to a CSE inhibitor for use according to any of paragraphs 1 to 10, wherein the CSE inhibitor and the MAPK inhibitor are administered in a sequential, intermittent or continuous therapy.

[0108] Preferably the therapy is an intermittent therapy, such as an 8 -week period therapy, wherein the CSE inhibitor and MAPK inhibitor is administered, preferably daily, for 5 weeks and then not administered for 3 weeks.

[0109] Preferably the therapy is a continuous therapy, wherein the CSE inhibitor and MAPK inhibitor may be administered simultaneously / concurrently for a period of time; or the CSE inhibitor and MAPK inhibitor may be administered alternately.

[0110] In a preferred embodiment the treatment prevents or delays the onset / development of resistance to a BRAF inhibitor therapy, or a MEK inhibitor therapy or a combination therapy of a BRAF inhibitor and a MEK inhibitor, wherein preferably the development of resistance is delayed by at least 1 month, 2 months, 3 months...

[0111] In a preferred embodiment the treatment comprising the CSE inhibitor and MAPK inhibitor delays the onset of acquired resistance compared to MAPK treatment alone. Preferably, the treatment comprising the CSE inhibitor and MAPK inhibitor prevents the onset of acquired resistance. Preferably, the treatment comprising the CSE inhibitor and MAPK inhibitor increase the efficacy of MAPK targeted therapy. DEFINITIONS

[0112] A “subject” as used herein is an individual of an animal species, preferably a vertebrate, more preferably a mammalian species, highly preferably the individual is a primate, a hominid or a human. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. In one embodiment, the mammal is a human.

[0113] A “patient” is a subject who is or intended to be under medical or veterinarian observation, supervision, diagnosis or treatment.

[0114] A “neoplasm” is a type of abnormal and excessive or uncontrolled growth of tissue in a subject’s body. (The process that occurs to form or produce a neoplasm is called “neoplasia”.) The growth of a neoplasm is uncoordinated with that of the normal surrounding tissue, and persists in growing abnormally, even if the original trigger is removed. A number of neoplasms of each type are listed in (Kumar et al., 2017).

[0115] A “tumor” is a neoplasm forming a mass of cells having an abnormal growth. In an embodiment the tumor is formed by a malignant neoplasm and thus is a malignant tumor. Preferably the tumor is a solid tumor.

[0116] The term “cancer” is understood herein as a malignant neoplasm caused by an uncontrolled division of neoplastic cells in a part of the body; preferably a cancer is ready to spread to other parts of the body, i.e. forming cancer in a different tissue (metastasis). Preferably the cancer is a tumor.

[0117] The term “melanoma” relates to a type of cancer that develops from the pigment-producing cells known as melanocytes. In a particular embodiment melanoma is a type of skin cancer.

[0118] The term “inhibitor” refers herein to a substance, in particular a molecular substance or a molecule which reduces or lowers e.g. blocks the activity of a protein in a subject’s body. Such protein is the target of the inhibitor. In a preferred embodiment the inhibitor is inhibitor of a signaling pathway, and is a substance that reduces or lowers, e.g. blocks signals passed from one molecule to another inside a cell. In a particular embodiment the signal transduction inhibitor is involved in the process of cancer. The term “inhibit” or “inhibiting” or “inhibition” refer to the effect, preferably effect, of an inhibitor on the target protein.

[0119] The term “BRAF V600” or “V600” refers to a mutation of the BRAF gene in which valine (V) is substituted by another amino acid at position 600. For example, “BRAF V600E” or “V600E” is a mutation, wherein the valine (V) at position 600 is substituted by glutamic acid (E). V600E is a driver mutation in certain diseases, such as melanoma, hairy cell leukemia, colorectal cancer, non-small cell lung cancer, etc.

[0120] A “BRAF inhibitor” is a chemical or drug or compound that inhibits the serine / threonine-protein kinase B-Raf and / or its mutant. A BRAF inhibitor is preferably able to inhibit V600 mutant B-Raf.

[0121] A “MEK inhibitor” is a chemical or drug or compound that inhibits the mitogen-activated protein kinase kinase enzymes MEK1 and / or MEK2. MEK inhibitors can be used to affect the MAPK / ERK pathway.

[0122] A “CSE inhibitor” is a compound or chemical or drug that inhibits cystathionine-y-lyase (CSE) protein. The term “CSE inhibitor” encompasses a full or partial inhibitor of CSE enzymatic activity in the synthesis of hydrogen sulfide.

[0123] A “selective CSE inhibitor” is understood herein as a CSE inhibitor selective for CSE over at least other enzyme involved in cancer development. For example, the CSE inhibitor selective for CSE inhibition over an enzyme selected from the group consisting of PS ATI, VEGFR, PDGFR, c-Kit and RET.

[0124] In a highly particular embodiment, the “selective CSE inhibitor” is selective of CBS. A “composition” of the invention is a composition of matter which comprises at least one compound of the invention as an active agent and at least one further substance. Preferably the compound of the invention is present in an effective amount. Compositions may also comprise further biologically active substances useful e.g. in a combination therapy. Furthermore, the compositions may comprise biologically acceptable carriers, formulation agents, excipients, etc. which may be known in the art. Pharmaceutical compositions comprise any composition with the purpose of treatment of a subject, and in particular include medicaments, medicines, tailor- made medicines and pharmacy preparations.

[0125] A “treatment” of a subject refers to any process, action, in particular therapy, wherein the subject or patient is under aid, in particular medical or veterinarian aid with the object of improving the subject’s or patient’s condition, either directly or indirectly. Improving the subject’s condition may include restoring or maintaining normal function of an organ or tissue, and include partial improvement, in particular improvement or amelioration of disease status caused by a cancer, in particular melanoma. Treatment typically refers to the administration of an effective amount of a compound or composition described herein, in particular a combination of compounds as disclosed herein. Unless specified differently, a therapeutic treatment includes both medical or veterinarian treatment and prevention (or prophylaxis) i.e. prevention of the onset or development of a condition, e.g. resistance to a treatment or therapy as well.

[0126] The term “therapy” means the treatment of a disease or disorder or condition.

[0127] The term “combination therapy” is a therapy which combines more than one method of treatment. For example, it is a treatment in which a patient is given two or more drugs or therapeutic agents for a single disease or disorder.

[0128] A “combination” according to the invention is understood as comprising at least two active agents (in the present invention preferably inhibitors) for administration to a subject or patient. Active agents of a combination can be administered simultaneously or consecutively or in any therapeutic regime useful to provide an effective amount from both or each therapeutic agent.

[0129] Co-administration” or the like, as used herein, are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same or different route of administration or at the same or different time.

[0130] The terms “effective amount” or “therapeutically effective amount,” as used herein, refer to a sufficient amount of an agent or a compound being administered which will relieve to some extent one or more of the symptoms of the disease or condition being treated. The result can be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system, in particular, a cancer or a tumor. For example, an “effective amount” for therapeutic uses is the amount of the composition comprising a compound as disclosed herein required to provide a clinically significant decrease in disease symptoms, preferably the regression of the cancer or tumor, in particular melanoma. An appropriate “effective” amount in any individual case may be determined using techniques, such as a dose escalation study.

[0131] The term “effective amount” qualifies the amount of a compound required to exert the effect of the active agent in a composition. A “therapeutically effective amount” is sufficient to relieve or prevent (or prevent worsening of) one or more of the symptoms or characteristic parameters of a condition, e.g. a disorder or disease.

[0132] The singular forms “a”, “an” and “the”, or at least “a”, “an”, include plural reference unless the context clearly dictates otherwise.

[0133] The term “comprises” or “comprising” or “including” are to be construed here as having a non- -exhaustive meaning and allow the addition or involvement of further features or method steps or components to anything which comprises the listed features or method steps or components. “Comprising” can be substituted by

[0134] “including” if the practice of a given language variant so requires or can be limited to “consisting essentially of’ if other members or components are not essential to reduce the invention to practice.

[0135] ABBREVIATIONS

[0136] A375-X A375 cell line-derived xenograft

[0137] ABCG2 ATP-binding casette (ABC) transporter G family member 2

[0138] Akt Protein kinase B

[0139] APOE apolipoprotein E

[0140] Asn asparagine

[0141] Asp aspartate

[0142] ATP6V0D2 V-type proton ATPase subunit d 2

[0143] Braf Serine / threonine-protein kinase B-raf

[0144] CARS2 cysteine-tRNA ligase, mitochondrial

[0145] CBS cystathionine-P-synthase

[0146] CDO cysteine dioxygenase

[0147] CYP cytochrome P450

[0148] Cys cysteine

[0149] Cys-SSH cysteine persulfide

[0150] CySSyC cystine

[0151] CSAD cysteine sulfinic acid decarboxylase

[0152] CSE cystathionine-y-lyase

[0153] CTH cystathionine

[0154] DLST dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex

[0155] DT dabrafenib-trametinib

[0156] DTR dabrafenib-trametinib resistant

[0157] ECAR extracellular acidification rate

[0158] ERK Mitogen-activated protein kinase kinase

[0159] ETHE1 persulfide dioxygenase

[0160] G6PD glucose-6-phosphate dehydrogenase

[0161] GAPDH glyceraldehyde-3-phosphate dehydrogenase

[0162] GCLC glutamate— cysteine ligase catalytic subunit gGluCys gamma glutamyl cysteine

[0163] Gin glutamine

[0164] GLS glutaminase

[0165] Glu glutamate

[0166] GLUL glutamine synthetase

[0167] GOT aspartate aminotransferase

[0168] GPX glutathione peroxidase

[0169] GS glutathione synthetase

[0170] GSH glutathione

[0171] GSSG oxidized glutathione GSSH glutatione persulfide

[0172] HzS hydrogen sulfide

[0173] H2S2 hydrogen disulfide

[0174] HCys homocysteine

[0175] Hlanth homolanthionine

[0176] HMW high molecular weight

[0177] HSPB 1 heat shock protein B 1

[0178] IDH isocitrate dehydrogenase

[0179] Lanth lanthionine

[0180] LMW low molecular weight

[0181] MAPK mitogen activated protein kinase

[0182] MEK Mitogen-activated protein kinase kinase kinase

[0183] Met methionine

[0184] MPST mercaptopyruvate sulfurtransferase

[0185] Nrf2 nuclear factor erythroid 2-related factor 2

[0186] OCR oxygen consumption rate

[0187] OGDH 2-oxoglutarate dehydrogenase complex

[0188] OXPHOS oxidative phosphorylation

[0189] PAG D,L-propargylglycine

[0190] PDH pyruvate dehydrogenase

[0191] PDX patient-derived xenograft

[0192] PFKFB 6-phosphofructo-2-kinase / fructose-2, 6-biphosphatase

[0193] Pyr pyruvate

[0194] Ras Ras GTPase

[0195] ROS reactive oxygen species

[0196] SDHA succinate dehydrogenase flavoprotein subunit A

[0197] Ser serine

[0198] SO sulfite oxidase

[0199] SOD superoxide dismutase

[0200] SQOR sulfiderquinone oxidoreductase

[0201] TRP14 thioredoxin domain-containing protein 17

[0202] Trx thioredoxin

[0203] TrxRl thioredoxin reductase 1

[0204] TST thiosulfate sulfurtransferase xCT cystine / glutamate transporter

[0205] BRIEF DESCRIPTION OF THE FIGURES

[0206] Figure 1. Dabrafenib-trametinib resistant A375 cells overexpress genes involved drug-resistance and genes involved in redox balance. Beside activating the PI3K / Akt pathway, dabrafenib-trametinib-resistant cells overexpress ABC -transporters and cytochrome P450 proteins

[0207] (A) To investigate the molecular and metabolic background of melanomas resistant to MAPK inhibitors (MAPKi), the present inventors generated a DT-resistant line of BRAF V600E-mutant A375 human melanoma cells (A375- DTR) by long-term culturing in the presence of increasing doses of dabrafenib (BRAF inhibitor) and trametinib (MEK1 / 2 inhibitor). Figure A is a simplified figure showing how dual inhibition of V600E mutant Braf with dabrafenib and MEK1 / 2 with trametinib leads to blockage of the MAPK-ERK pathway.

[0208] (B) Proliferation assay was used to follow the sustained viability of resistant cells in the presence of the drugs. A375 Ctrl and DTR cells were cultured in the presence or absence of DT. Plate were fixed each day and relative cell amount was measured by Sulforhodamine B (SRB) assay. Dilution and pathlength corrected absorbance values are shown.

[0209] (C) Activity of the MAPK-Erk pathway was examined by measuring the amount of phospho-MEKl / 2 and phospho-ERKl / 2 via Western blot analysis in A375 Ctrl cells and DT-resistant (DTR) cells cultured with or without DT for 0, 24, 48 or 72 hours. P-actin was used as loading control.

[0210] (D) Levels of phosphorylated Akt were measured by Western blot analysis in A375 Ctrl cells and DT-resistant (DTR) cells cultured with or without DT for 0, 24, 48 or 72 hours. Inhibition of the MAPK-ERK pathway resulted in increased phosphorylation of Akt (Fig 3A), which was consistent with previous reports demonstrating that increased activity of the PI3K-Akt pathway contributes to DT-resistance (Liu et al., 2020; Sun et al., 2014). - actin was used as loading control.

[0211] (E-F) Using Qiagen’s real-time quantitative PCR (RT-qPCR)-based arrays, the present inventors found overexpression of several genes involved in the development of cancer drug resistance. Gene expression of untreated Ctrl and DT-treated DTR A375 cells were compared using RT-qPCR based arrays from Qiagen named Human drug metabolism (E) and Cancer drug resistance (F).

[0212] (G) Elevated expression of genes responsible for the neutralization of xenobiotics were measured by RT-qPCR using custom-designed oligonucleotides. Values were normalized to GAPDH, P-actin and b2M. Fold increase compared to untreated Ctrl was calculated.

[0213] (H-J) Levels of proteins involved in redox balance were measured via Western blot analysis in A375 Ctrl cells DT-resistant (DTR) cells cultured with or without DT. GAPDH was used as loading control.

[0214] Each Western blot experiment was repeated at least three times, representative images are shown.

[0215] *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown-Forsythe test (n = 2 technical repeats from 3 biological replicates (E)).

[0216] Figure 2. Altered energy metabolism in DT-treated and DT-resistant (DTR) cells.

[0217] (A) Mitochondrial function of cells was analyzed by measuring oxygen consumption rate (OCR) of cells with Seahorse Cell Analyzer using Mito Stress Test kit. After the assay, cells were fixed, and total protein levels were measured by Sulforhodamine B (SRB) assay. Measured OCR values were normalized to dilution and pathlength corrected absorbance.

[0218] (B) Glycolytic activity of cells was analyzed by measuring extracellular acidification rate (ECAR) with Seahorse Cell Analyzer using Glycolysis Stress Test kit. After the assay cells were fixed and total protein levels were measured by Sulforhodamine B (SRB) assay. Measured ECAR values were normalized to dilution and pathlength corrected absorbance.

[0219] (C) Protein levels of citric acid cycle enzymes responsible for NADH production were measured by Western blot analysis in A375 Ctrl cells and DT-resistant (DTR) cells cultured with or without DT. DT-treated Ctrl cells were treated with DT for 6 days. GAPDH was used as loading control.

[0220] (D-E) Levels of amino acids from cell lysates (D) and from culture media on cells (E) were measured after 48 hours of culturing in the presence or absence of DT using EZrfaast amino acid analysis kit followed by LC-MS / MS measurements. Amino acid levels in lysates were normalized to total protein content, culture media measurements were compared to fresh media. (F) Simplified figure showing metabolic pathways involved in the conversion of glutamate (Glu).

[0221] (G) Gene expression was analyzed by RT-qPCR. Detected values were normalized to GAPDH, -actin and b2M. Fold increase compared to untreated Ctrl was calculated.

[0222] (H) Protein levels were analyzed by Western blot analysis in A375 Ctrl cells and DT-resistant cells cultured with or without DT. DT-treated Ctrl cells were treated with DT for 6 days. Protein levels of GOT1 and 2 were measured by Western blot. GAPDH was used as loading control.

[0223] Each Western blot experiment was repeated at least three times, representative images are shown.

[0224] *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown-Forsythe test (A, B, D, E, G), representative figure from n = 15 technical repeats from 2 independent experiments (A, B) and n = 2 technical repeats from 3 biological replicates (D, E, G).

[0225] Figure 3. Dabrafenib-trametinib resistant A375 cells overexpress genes involved in redox balance Cysteine metabolism is reprogrammed in DT-resistant melanoma cells due to DT-treatment.

[0226] (A) Cells were cultured with different concentrations of cystine with or without of 100 nM sodium selenite, with or without DT. Cell viability was measured after 72 hours using SRB assay. Dilution and pathlength corrected absorbance values are shown.

[0227] (B) Cells were cultured in the absence of sodium selenite (Se) for 24, 48 or 72 hours, lysed and levels of selenoproteins were measured by Western blot analysis.

[0228] (C) Cystine (CySSyC) and glutamate (Glu) levels were measured from the culture media above cells after 72 hours of culturing using EZrfaast amino acid analysis kit. Changes in CySSyC and Glu levels were compared to the fresh culture media. Fold increase compared to untreated Ctrl was calculated. Negative values mean decreased levels (uptake), positive values mean increased levels (efflux) compared to fresh media.

[0229] (D) Glutathione levels were measured from cell lysates using HPE-IAM alkylating agent followed by LC-MS / MS detection. Measured values were normalized to total protein content and fold increase compared to untreated Ctrl was calculated.

[0230] (E) GSTpi levels were measured via Western blot analysis in A375 Ctrl cells and DT-resistant (DTR) cells cultured with or without DT. GAPDH was used as loading control.

[0231] (F) Simplified figure showing sources and sinks of intracellular cysteine (Cys).

[0232] (G) LMW cysteine, cystine and cysteine persulfide levels were measured from cell lysates using HPE-IAM alkylating agent and LC-MS / MS detection. Measured values were normalized to total protein content and fold increase compared to untreated Ctrl was calculated.

[0233] (H) Gene expression was analyzed by RT-qPCR. Data were normalized to GAPDH, P-actin and b2M. Fold increase compared to untreated Ctrl was calculated.

[0234] (I) Levels of proteins involved in Cys metabolism were measured via Western blot analysis in A375 Ctrl cells and DT-resistant (DTR) (1 / 1) and SK-MEL28 (1 / 2) cells cultured with or without DT.

[0235] (J) Levels of LMW thiols and persulfides were measured by alkylation with HPE-IAM followed by LC-MS / MS detection. Detected values were normalized to total protein levels and fold increase compared to untreated Ctrl was calculated.

[0236] Each Western blot was repeated at least three times, representative images are shown. GAPDH was used as loading control.

[0237] *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown-Forsythe test and Welch test (A, C, D), n = 2 repeats from 4 biological replicates (A), n = 2 repeats from 2 biological replicates (C) and n = 3 repeats from 3 biological replicates (D); and *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown- Forsythe test (G, H, J), n = 3 technical repeats from 3 biological replicates (G, J) and n = 2 technical repeats from 3 biological replicates (H).

[0238] Figure 4. Analysis of enzymatic functions of CSE and CBS relevant in A375 cells and enzymes of the sulfide catabolic pathway.

[0239] (A) Total steady-state levels of cysteine metabolism intermediates were measured by alkylation with HPE-IAM followed by LC-MS / MS detection. Detected values were normalized to total protein content. Fold increase compared to untreated A375 Ctrl are shown.

[0240] (B) Chemical reactions of CBS and CSE proteins were followed using stable methionine isotope. Heavy atoms are marked with stars.

[0241] (C-D) Cells were treated with heavy Met (34S) for 0, 18, 24, 48 hours, lysed and normal and heavy analytes were measured using EZ:faast amino acid kit, followed by LC-MS / MS detection. Detected values were normalized to total protein content. Methionine-derived heavy analytes are signed with *. Ratio of heavy / total (C) and steadystate levels (D) are shown.

[0242] (E) Simplified figure showing the canonical and the sulfide / persulfide producing reactions of CSE and CBS.

[0243] (F) Chemical reactions of CBS and CSE proteins were followed using stable cystine isotope. Heavy atoms are marked with stars.

[0244] (G-H) Cells were treated with heavy CySSyC (I3C,15N) for 0, 18, 24 or 48 hours, lysed and measured using EZ:faast amino acid kit followed by LC-MS / MS detection. Detected values were normalized to total protein content. CySSyC-derived heavy analytes are signed with *. Ratio of heavy / total (G) and steady-state levels of heavy analytes (H) are shown.

[0245] (I) Persulfidation of Cys residues of proteins measured by alkylation with HPE-IAM followed by LC-MS / MS detection. Fold increase compared to untreated Ctrl are shown.

[0246] *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown-Forsythe test from n=3 technical repeats from 3 biological replicates (A) and n=3 repeats from 2 biological replicates (I).

[0247] Figure 5. Cys and H2S metabolism is re-shaped in vemurafenib-treated and resistant melanoma cells

[0248] (A) Simplified figure showing how Braf V600E inhibitor vemurafenib blocks the MAPK / ERK pathway.

[0249] (B) To find out whether the present inventors’ observations regarding Cys and PLS metabolic rewiring is a general adaptive response in melanoma cells to BrafV600E inhibition, the inventors generated a vemurafenib-resistant A375 cell line by long-term culturing of the cells in the presence of increasing doses of vemurafenib. Vemurafenib (V)-treated A375 Ctrl and vemurafenib resistant (VR) cells were grown with or without V. After 72 hours cells were fixed, and relative cell amounts were measured by SRB assay.

[0250] (C) V-treated Ctrl cells were cultured with V for 6 days. By measuring MEK1 / 2 and ERK1 / 2 phosphorylation, the present inventors found that V-treatment effectively blocked MEK1 / 2 phosphorylation and that in VR cells MEK1 / 2 phosphorylation was completely restored. Protein levels of enzymes involved in redox balance, Cys and HzS metabolism were measured by Western blot analysis from untreated, V-treated and V-resistant cells. GAPDH was used as loading control.

[0251] (D) Intracellular levels of LMW thiols were measured by alkylation with HPE-IAM followed by LC-MS / MS detection. Measured values were normalized to total protein content. Fold increase compared to untreated control or ratios are shown.

[0252] Each Western blot was repeated at least three times, representative images are shown.

[0253] *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown-Forsythe test from n=3 technical repeats from 3 biological replicates (B, D). Figure 6. Metabolome analysis (analysis of LMW thiols and persulfides) in DT-treated cell-line derived and patient-derived xenograft tumors.

[0254] (A) A375 cell line-derived xenograft tumors (A375-X) were grown in NOD SCID mice and treated with DT for 4 days per os. After 24 hours of the last treatment mice were sacrificed and tumor weight was measured.

[0255] (B) Snap frozen homogenized A375 xenograft tumor samples were alkylated with ice-cold HPE-IAM / methanol and lysed. LMW thiols were measured by LC-MS / MS detection. Fold increase compared to untreated Ctrl was calculated.

[0256] (C) Patient-derived xenograft (PDX) tumors were grown in NOD SCID mice and treated with DT 4 times within 6 days per os. After 24 hours of the last treatment mice were sacrificed and tumor weight was measured.

[0257] (D) Snap frozen homogenized patient-derived xenograft (PDX) tumor samples were alkylated with ice-cold HPE- IAM / methanol and lysed. LMW thiols were measured by LC-MS / MS detection. Fold increase compared to untreated Ctrl was calculated.

[0258] *p < 0.05, **p < 0.01, ***p < 0.001 by Ordinary one-way ANOVA or Brown-Forsythe test from n=6 biological replicates.

[0259] Figure 7. Higher levels of persulfides are favorable for DT-treated A375 cells. Combination of Braf and / or MEK inhibitors with CSE-inhibitor results in a more effective therapeutic response

[0260] (A-B) Protein levels of enzymes of the sulfide catabolic pathway measured by Western blot analysis in Ctrl (cultured with or without DT for 6 days) and DTR cells cultured with or without DT (A) and in Ctrl (cultured with or without V for 6 days) and VR cells cultured with or without V (B). GAPDH was used as loading control.

[0261] (C) Thiosulfate (S2O3) levels per total protein amount, measured using a monobromobimane-based alkylation protocol followed by fluorescent detection.

[0262] (D) ETHE1 protein levels in shCtrl (marked with C) and shETHEl single clones (1-9) were measured via Western blot. Cells grown from clone 9 were used for further experiments.

[0263] (E) Ethe silenced (shETHEl) and lentiviral control (shCtrl) A375 cells were cultured with or without DT for 6 days and then lysed. Levels of proteins involved in Cys and H2S metabolism were analyzed by Western blot. GAPDH was used as loading control.

[0264] (F) Proliferation of untreated (7F / 1) and DT-treated (7F / 2) shCtrl and shETHEl cells were measured by SRB assay. Dilution and pathlength corrected absorbance values are shown.

[0265] (G) Intracellular levels of LMW thiols and H2S metabolism intermediates were measured from cell lysates using HPE-IAM alkylating agent followed by LC-MS / MS detection. Measured values were normalized to total protein content and fold increase compared to untreated Ctrl was calculated.

[0266] (H) Extracellular levels of GSSH were measured from culture media above cells and compared to fresh media using HPE-IAM alkylating agent followed by LC-MS / MS detection.

[0267] (I) Persulfidation of proteins was measured from cell lysates using HPE-IAM alkylating agent followed by LC- MS / MS detection.

[0268] Figure 8. CSE is upregulated in melanoma patients’ tumors who received DT-therapy

[0269] (A) CSE levels were measured by immunohistochemistry from a malignant skin melanoma removed from the same patient before (left) and after (right) DT-therapy.

[0270] (B) CSE levels measured by immunohistochemistry in lymphatic melanoma metastases from the same patient before (left) and after (right) DT-therapy.

[0271] (C) CSE levels in tumors removed from different patients before (without border) and after (with border) DT- therapy. Figure 9. Therapy-naive melanoma cells are not sensitive to PAG and AOAA treatment

[0272] (A) Therapy-naive A375 cells were treated with 0.5 mM PAG for 9 days. Culture plates were fixed each day and proliferation was measured by SRB assay.

[0273] (B) Therapy-naive A375 cells were treated with 250 or 500 u.VI AOAA for 48 hours. Relative cell amount was measured by SRB assay.

[0274] Figure 10. Inhibition of CSE by PAG delays the onset of acquired resistance to MAPK inhibitors in vitro

[0275] (A-B) A375 cells were cultured with vemurafenib (A) or dabrafenib-trametinib (B) in the presence and absence of 0.5 mM PAG for 2 months. Fresh media was added every three days. Proliferation of V-treated and V + PAG- treated cells were compared to untreated A375 cells (A). Proliferation of DT-treated cells to DT + PAG treated cells were compared to DT-resistant and untreated A375 cells (B) in a 4-day proliferation assay. Plates were fixed each day, SRB assay was performed. Dilution and pathlength corrected absorbance values are shown.

[0276] (C) A375 cells were cultured with encorafenib (BRAF V600E inhibitor) and binimetinib (MEK1 / 2 inhibitor) (EB) for 16 weeks in the presence and absence of 0.5 m PAG. Proliferation of EB-treated cells to EB + PAG treated cells were compared in a 7-day proliferation assay. Plates were fixed each day and SRB assay was performed. Dilution and pathlength corrected absorbance values are shown.

[0277] (D) A375 cells were cultured with cobimetinib (MEK1 / 2 inhibitor) and vemurafenib (Braf V600E inhibitor) (CV) in the presence and absence of 0.5 mM PAG for 10 weeks. Representative microscopic images are shown.

[0278] (E-H) Levels of phospho-MEKl / 2, phospho-ERKl / 2 and phospho-Akt were measured from A375 cells cultured with V (E) or DT (F) with or without PAG for 2 months, or with EB for 10 (G) or 16 (H) weeks and compared to untreated Ctrl (E-H) and to previously generated DT-resistant line marked with R (F).

[0279] Each Western blot was repeated at least three times, representative images are shown. GAPDH was used as loading control.

[0280] Figure 11. Inhibition of CSE delays the onset of acquired resistance to dabrafenib-trametinib (DT) therapy in vivo

[0281] (A) A375 melanoma cell line-bearing xenograft model has been established. Tumor-bearing mice were randomized and treated with DT five times a week. Mice in the DT + PAG group received PAG treatment 3 times a week in addition to the DT treatment. Tumors were measured 2 or 3 times a week by manual caliper.

[0282] (B) Progression free survival of each group was calculated. Therapy was considered ineffective when tumors exceeded their volumes before the start of the treatment.

[0283] (C) When 11 out of 12 mice were resistant in the DT group, mice were sacrificed, and tumor weights were measured.

[0284] Figure 12. Preparation of a CSE knockout cell line using CRISPR-Cas9 technology

[0285] (A) CSE levels were measured from CRISPR control and CSE knock out A375 cell line with or without 48 hours of DT treatment. Knock-out was successful, the levels of CSE were almost undetectable in the CSE knockout cell population. DT treatment for 48 hours significantly increased CSE level in control cells, while a low background level only was detected in CSE KO cells.

[0286] (B) CSE levels were measured from CRISPR control and CSE knock out A375 cell line after 1.5 month of DT treatment. No significant difference was found.

[0287] GAPDH was used as loading control. DETAILED DESCRIPTION OF THE INVENTION

[0288] The present inventors have demonstrated the positive effect of a CSE inhibitor in combatting resistance of a cancer, or tumor against a MAPK inhibitor treatment, in particular in a treatment of cancer with a Braf V600 mutation. The cancer is preferably melanoma.

[0289] Certain results in the prior art [Sun et al: Metallothionein-IG facilitates sorafenib resistance through inhibition of ferroptosis, Hepatology, 64(2), 488-500 (2016)] suggest that PAG (a CSE inhibitor) may enhance the effect of kinase inhibitors, like sorafenib in certain cancers, like hepatocellular carcinoma (HCC).

[0290] However, the present inventors have tested PAG and also non-specific CSE-inhibitor AOAA in BRAF V600 mutant melanoma where these compounds had no antiproliferative effects.

[0291] Surprisingly, the present inventors have found that combined administration of the CSE inhibitor D,L- Propargylglycine (PAG) with DT, V, CV or EB effectively delayed the onset of acquired drug resistance, which provide for more efficient combination therapies for patients carrying BrafV 00 mutations, in particular BrafV600E mutations, such as in melanoma patients.

[0292] The present inventors carefully dissected the altered energy landscape and redox environment in dabrafenib / trametinib treated (DT-treated) or vemurafenib treated (V-treated) control, as well as resistant (VR or DTR) melanoma cells and uncovered crucial roles and novel mechanistic details for reprogrammed cysteine and hydrogen sulfide metabolism in cellular adaptation to these drugs (both in vitro and in vivo), in DT-treated and DTR cells, respectively. The present results were also confirmed in vivo by transsulfuration metabolome analyses of treated and untreated and patient derived xenograft mouse models. It has been surprisingly found that among many immediate adaptive changes to treatment, elevated expression of CSE plays a pivotal role in cancer cell survival upon DT or V treatment and in the development of drug resistance. Elevated CSE expression resulted in increased GSH- and protein Cys-persulfidation, which aided cancer cell survival and tumor growth, among other factors by providing extra protection against Braf mutation, in particular BrafV 600E inhibition-induced oxidative stress. Increased production of RSS is also utilized to realign mitochondrial energy production in melanoma cells in order to compensate for the cells’ elevated energy demand in the presence of these drugs and allow them to survive and proliferate. The present inventors’ targeted metabolome analyses revealed a number of important details of how altered transsulfuration is linked to other metabolic processes such as the TCA cycle or glutaminolysis to further support cellular protection.

[0293] More closely, the inventors have found that elevated oxidative stress upon inhibition of the MAPK / ERK pathway in melanoma cells by DT treatment is counteracted by Nrf2-mediated overexpression of several antioxidant genes. In DT-resistant cells a more balanced redox environment and recovery of glycolysis is predicted by the expression patterns of enzymes that regulate cellular antioxidant response and glucose metabolism.

[0294] In further experiments metabolic pathways involved in cellular energetics were found to be reprogrammed in melanoma cells resistant to BrafV 600Ei and MEKl / 2i. Along with the upregulation of OXPHOS with increased expression of CAC enzymes that produce NADH (to fuel the electron transport chain) these pathways the present inventors found increased glutaminolysis in DT-treated and DT-resistant cells, which refers to the increased demand for Glu.

[0295] DT-treated and DT-resistant cells also require increased levels of CySSyC to fuel GSH synthesis, which is utilized to counteract oxidative stress and neutralize anticancer drugs.

[0296] Back to the inhibition of the MAPK / Erk pathway by DT, while inhibition in control cells resulted in an immediate increase in CSE levels and a decrease in CBS levels, surprisingly, in DT-resistant cells an opposite pattern was observed with restored CBS expression and a decline in CSE below untreated control levels to an almost non-detectable level. Elevated HJSJ in DT resistant cells and higher concentrations of H2S and GSSH in both DT-treated and DTR cells suggested that DT-treatment induced changes in CSE and CBS expression levels are functionally related to their reactive sulfur species (RSS) producing activities. These RSS are heavily involved in cellular protection against oxidative stress. Plausibly, the observed adaptive changes in CSE and CBS expression levels upon DT treatment is likely to contribute to the protection and survival of melanoma cells against DT targeted therapy and hence to the development of drug resistance.

[0297] These observations explain why rapid induction of otherwise low CSE levels in control cells upon DT treatment likely represents an important adaptive response to protect the cell upon drug exposure. The inventors have drawn the conclusion that this adaptive response plays an important role in laying the foundations for survival of drug resistant cells. CSE is indeed a highly inducible protein and several transcription factors, including Nrf2, which orchestrates the antioxidant response in melanoma cells upon DT treatment (see above) as well as other stress response factors have binding sites on the CSE promoter and thereby regulate CSE expression levels (Renga et al., 2009). Thus, induction of CSE expression is a rapid adaptive response of cancer, in particular melanoma cells to counteract cellular damage by drug induced immediate oxidative stress and provide extra fuel for energy production via an increased generation of RSS. When drug resistance develops, CSE levels drop and increased CBS levels take over to provide a balanced, but increased RSS flux, which restores glycolysis and promotes cancer cell proliferation and tumor progression.

[0298] Thiosulfate is an end product of the sulfide metabolic pathway, which is an accepted marker of increased sulfide flux in this field. The present inventors have found that the level of thiosulfate increases due to DT treatment (Figure 7C). This result provides further evidence for the fact that due to DT treatment, besides increased sulfide / persulfide production, also the catabolism of sulfide and persulfide is increased. Therefore, it follows that the sulfide flux is increased due to DT treatment.

[0299] Cys levels are generally tightly regulated by oxidative catabolic pathways. As a further surprising finding, despite the high Cys demand of DT-treated cells, DT-treatment largely induced the oxidative catabolism of Cys. Increased expression of the gene of cysteine dioxygenase 1 (CDO1), a Cys metabolizing enzyme, in DTR cells was confirmed on the protein level. Therefore, oxidative Cys catabolism is likely a major cause of the low steadystate Cys levels in DT-treated and in DT-resistant cells.

[0300] In another experiment (data not shown) it has been found that the ratio of oxidative variants of protein thiols has been increased due to DT treatment, which provides direct evidence of the increased oxidative stress due to DT treatment.

[0301] The metabolite patterns discovered herein indicate that in DT-treated control cells the canonical CBS activity is extremely low but partially restored in DT-resistant cells compared to control, which is in line with measured CBS protein levels, but the canonical CSE activity is not prominent in any of these systems including in DT-treated Ctrl cells, where it was found to be overexpressed. From the fluxomics analysis it can also be concluded that the increased RSS production in DT-treated and DTR cells are not explained by CSE or CBS-mediated metabolism of Cys to produce H2S.

[0302] The present inventors have also shown that DT-treated Ctrl cells are characterized by increased oxidative burden and both DT-treated Ctrl and DT-resistant cells have elevated CySSyCrCys ratios; and found that oxidative catabolism of Cys is activated in DT-treated and DT resistant cells. This latter observation is particularly surprising in light of the facts that these cells take up more CySSyC and have elevated levels of intracellular GSH, GSSH, H2S, which all suggest an increased demand for Cys and speaks against its oxidative catabolism. Figure 3F summarizes major pathways, including synthesis of GSH, RSS (HjS and cysteine persulfide) and also oxidative metabolism to taurine, that based on our data are responsible for the elevated flux of Cys in melanoma cells when they are exposed to DT treatment. As mentioned above an increased level of thiosulfate due to DT treatment provides a further evidence of this effect (see Figure 7C).

[0303] As an additional example the present inventors have checked the above concept by experiments with Vemurafenib, the first FDA-approved Braf V600E inhibitor. It has been found that metabolic reprogramming mechanisms similar to DT resistance operate in the development of V -resistance. Consistent with the metabolome analyses, the development of vemurafenib resistance in in vitro cell culture proliferation assays took less time than that of dabrafenib-trametinib resistance, which is logical since dual inhibition of Braf and MEK results in a more complete blockage of the MAPK / ERK pathway.

[0304] DT-treatment also induced metabolic changes confirmed in vivo using xenograft models; this result is also in line with the present inventors’ in vitro results.

[0305] In a further set of experiments (ETHE1 silencing experiments which ameliorates the effects of DT- treatment in A375 cells) levels of enzymes involved in the sulfide catabolic chain were restored in DT-resistant cells to what was observed in untreated Ctrl cells (Figures 7D to 7F).

[0306] All these, mostly unexpected findings lead the present inventors to test CSE inhibition against resistance in the present setting. In this test, A375 cells maintained in V-containing media acquired full resistance after two months, whereas the proliferation of cells receiving the combination of V and PAG, a CSE inhibitor, was significantly reduced (Figure IDA). In the case of DT-treatment, the development of resistance takes approximately 4 months in vitro. However, after 2 months combined treatment of DT with PAG more effectively inhibited tumor cell growth compared to DT treatment alone (Figure 10B). Similar results were obtained in the case of other BrafV600i / MEKl / 2i, CV and EB (Figure 10C-D).

[0307] As another example, combining CSE inhibitor PAG with Braf V600E and MEK1 / 2 inhibitors proved to be beneficial in other melanoma cell line carrying Braf V600E mutation, SK-Mel28 cell line. In the case of this cell line, it takes more time to gain acquired resistance than with the A375 cell line, however, initial results showed that those SK-Mel28 cells that receive PAG in addition to Braf V600E and MEK1 / 2 inhibitors proliferate at a smaller rate.

[0308] Restored levels of phospho-MEKl / 2 is (at least) partially needed for acquired resistance. Thus, the present inventors compared phospho-MEKl / 2 levels in cells cultured with V or DT in the presence and absence of PAG for two months and, importantly found lower levels of phospho-MEKl / 2 in PAG-treated cells. Moreover, phospho-Akt was significantly decreased in cell lines (V, DT and EB) receiving PAG as a cotreatment, which is crucial in the development of acquired resistance to BrafV600i / MEKl / 2i as shown by the present inventors and others. The present inventors confirmed that CSE levels are increased upon DT treatment in a different Braf V600 mutant cell line and in melanoma patients’ samples as well. Moreover, they also showed that dual administration of DT and PAG delayed the onset of acquired resistance in mouse model (Figure 11A-C), strengthening the significance of the present invention.

[0309] Another experiment was carried out with CSE knock-out melanoma cells to confirm that PAG exerts its effect via CSE inhibition in overcoming resistance. CSE knock-out resulted in a heterogeneous cell population, wherein knock-out was successful, however, a low ratio of cell remained CSE positive. It has been observed that practically no CSE protein levels could be detected in the beginning of the experiment (Figure 12A), however, after about one and a half months DT treatment the level of CSE is nearly the same in control and gene knock-out cell line (Figure 12B). Thus, it can be concluded that cells in which the gene knock-out was incomplete, overgrow knock-out cells due to DT selection pressure. This experiment provides further evidence that process is CSE specific and therefore CSE specific inhibitors are to be applied in the present invention.

[0310] Thus, CSE is a vital stress response element upon MAPK inhibitor treatment and serves as a secondary drug target to increase the efficacy of BRAF inhibitor and / or a MEK inhibitor, like V and DT targeted therapy.

[0311] BrafV 600E mutant melanoma, one of the deadliest forms of skin cancer remains a serious healthcare issue, as the previously introduced, initially highly effective targeted therapies rapidly become ineffective due to acquired drug resistance. Combined inhibition of Braf and the downstream MEK 1 / 2 kinase by dabrafenib and trametinib (DT) leads to extensive metabolic reprogramming including increased glutaminolysis and a shift from aerobic glycolysis to oxidative phosphorylation, where the latter together with increased activity of CYPs induce oxidative stress. This is counteracted by an elevated PPP activity and an Nrf2-mediated stress response leading to the overexpression of several redox enzymes, to increased GSH, as well as to sulfide and persulfide production as a result of more cystine uptake together and a largely reprogrammed cysteine metabolism. Upon Braf-inhibition, CBS is downregulated and CSE along with enzymes of the sulfide catabolic pathway are strongly upregulated, whereas cells with acquired resistance have restored CBS and downregulated CSE levels. These were in line with an immediate stress response upon drug exposure and restoration of anabolic pathways in resistant cells. Enzyme activities of these two transsulfuration proteins were dissected using stable isotope tracing. Based on the present inventors’ fluxomics data, drug-induced rapid CSE overexpression does not support the increased Cys demand of the cells, but utilize cystine, which is transported through glutamate-supported xCT activity to elevate persulfide and indirectly sulfide levels. The present inventors’ data show that in melanoma cells BrafV600E inhibition induced persulfide / sulfide production is essential to survive the drug-induced stress via providing antioxidant protection and a backup electron source for the ETC to feed the cells’ elevated energy demand. Most importantly these observations led to the identification of CSE as a vital immediate stress response element in melanoma cells upon drug exposure, which can be utilized in drug development endeavors as a secondary drug target to increase the efficacy of Braf-inhibitor therapy.

[0312] Methods to determine BRAF V600 mutation in cancer are well known and is at hand of a person skilled in the art.

[0313] BRAF V600, e.g. BRAF V600E / K mutation status can be for example determined on archived tissue.

[0314] A well-known method to find BRAF V600 mutation is by PCR. For example, the cobas® 4800 BRAF V600 Mutation Test (Roche) is a real-time polymerase chain reaction (PCR) test for the detection and identification of BRAF V600 mutations in formalin-fixed paraffin-embedded tissue (FFPET) of human melanoma (Mourah S. et al., 2015).

[0315] Sanger sequencing is also a suitable method for diagnosing V600 mutations and may even provide a better result than the PCR test. The two methods also can be combined to arrive at a more reliable result (Qu, Kevin et al., 2013).

[0316] It is also preferred if histologic diagnosis of the cancer or tumor, e.g. melanoma is confirmed by an expert. Treatment methods of V600 mutant cancers or tumors in particular melanoma are well known in the art and are reviewed e.g. in e-book by Yushak, M. et al. Systemic therapy options for patients with unresectable melanoma (Yushak, M. et al. 2017).

[0317] However, besides melanoma, BRAF V600 mutations are also common in several other types of cancers, like thyroid, and non-small-cell lung cancers.

[0318] Treatment protocols for treating a patient with MAPK inhibitors, in particular with BRAF V600 mutant inhibitors and optionally additionally with a MEK inhibitor are well known in the art. Without limitation an example is treatment of patients having BRAF V600 mutation, with dabrafenib and trametinib have been assessed in the BELIEVE trials and are reviewed by Shimoi T. et al. (Shimoi T. et al., 2024). In these trials patients with solid tumours received dabrafenib (150 mg) twice daily and trametinib (2 mg) once daily until disease progression or intolerable toxicity was observed. The study confirmed promising efficacy against BRAF V600-mutant tumors and concluded that dabrafenib and trametinib would offer a new therapeutic option for rare cancers, such as high-grade gliomas, biliary tract cancer, and thyroid cancer of BRAF V600 mutant patients. This conclusion may be extended to other combination treatments with BRAF V600 mutant inhibitors and preferably with MEK inhibitors.

[0319] As disclosed above resistance is a frequent problem in such treatments. Florent L. et al. in their recent review (Florent L. et al. 2023) collect recent data on cellular and microenvironment-induced resistance to targeted therapies for BRAF V600-mutated metastatic melanoma. The discovery of targetable mutations and the understanding of the mechanisms involved in the development of metastatic melanoma has allowed for the improvement in patient treatments, however, the authors refer to other non-elucidated mechanisms of resistance and hope that in the future understanding such mechanisms might contribute to improving melanoma patients’ management. They review in particular the mechanisms responsible for resistance to targeted therapies in BRAFV600E-mutated metastatic melanoma. Treatment methods described in these publications are incorporated herein by reference.

[0320] Treatment methods with cystathionine-y-lyase (CSE) inhibitors may be fitted well in these existing protocols. Treatment of cancers other than those with BRAF V600 mutations have been suggested by CSE inhibitors.

[0321] For example, Liu et al. (Liu et al., 2021) and Wang et al. (Wang et al., 2019) report the anticancer effects of CSE inhibition in certain tumors. Li et al. (Li et al., 2021) summarizes strategies in the control of breast cancer by using inhibitors on ILS-prodiicing enzymes and teach that CSE inhibitors 1194496, 1157172, PAG, BCA, AVG have anti-cancer activity.

[0322] Typically, a therapeutically effective amount a CSEi compound can be determined by standard experiments in the field. Once an animal model exists, liken the one set up, like the (A375 melanoma cell line-bearing xenograft model prepared by the present inventors, the appropriate dose range for the animals can be determined.

[0323] In one embodiment of the invention, administration of a compound or pharmaceutical composition of the present invention is started at lower dosages, which are increased until the desired effect of preventing / treating the relevant medical indication is achieved. This would define a therapeutically effective amount.

[0324] The skilled person, e.g. a clinician would be aware of various factors to be taken into consideration when determining an optimal dosage for a given subject. Such considerations are known to the skilled person. Basically, the FDA Guidelines (Rockville, M.D., 2005) can be used. A more detailed discussion of the matter is provided by Nair and Jacob (Nair A.B. and Jacob S., 2016).

[0325] For the CSE inhibitors of the present invention, such human doses, e.g. daily doses may be, without limitation to such doses e.g. between 0,01 mg / kg to 100 mg / kg body weight or between 0,05 mg / kg to 50 mg / kg body weight, in particular between 0, 1 mg / kg to 10 mg / kg in case of PAG or an equivalent dose in case of another CSE inhibitor.

[0326] Pharmaceutical compositions and use of CSE inhibitors are well known in the art and disclosed e.g. in US9725426B2 and in US10227314B2 assigned to SOVA Pharmaceuticals.

[0327] Selective inhibitors of cystathionine y-lyase (CSE) have long been known including PAG as an often used example. Selectivity of commonly used pharmacological inhibitors for cystathionine P synthase (CBS) and cystathionine y lyase (CSE) is reviewed by Asimakopoulou, A. et al. (Asimakopoulou, A. 2013).

[0328] Li, M et al. (Li, M. et al. 2021) provide an analysis and review of CSE inhibitors with a particular view on their selectivity. They also refer to NSC4056, also known as aurintricarboxylic acid, which was identified as the most potent inhibitor with an IC50 of 0.6 pM for CSE up to 2021. (Hu, Y. et al., 2018). Another compound 2- arylidene hydrazinecarbodithioates was revealed to have higher selectivity for CSE compared to CBS and to be more active than the usual inhibitors (Bhattacharjee A. et al., 2017).

[0329] EXAMPLES

[0330] EXAMPLE 1: METHODS

[0331] Reagents

[0332] Unless specified otherwise all reagents were obtained from Sigma and have the minimum purity of 97%. Organic solvents from Merck used for chromatography were gradient grade, water was deionized and ultra-filtered by an Androna B30 HPLC system. Stable isotopes were produced by Cambridge Isotope Laboratories. HPE-IAM (P-(4-hydroxyphenyl)ethyl iodoacetamide) was purchased from Santa Cruz Biotechnology. Dabrafenib, trametinib and vemurafenib were obtained from MedChemExpress.

[0333] Cell culturing

[0334] A375 cell line was obtained from Sigma (#88113005) and was treated with increasing doses of dabrafenib and trametinib until 62.5 nM dabrafenib and 10 nM trametinib concentration was reached or with vemurafenib until 2 M was reached. After approximately 3-5 months, cells proliferated in the presence of the inhibitors, they were considered as resistant, and they were further maintained in the presence of the drugs. Cells were maintained in a 5% COz incubator at 37 °C using high-glucose DMEM (Thermo #21969035) containing 100 U penicillinstreptomycin (Lonza #DE17-602E), 2 mM L-glutamine (Lonza #17-605E), 10% fetal bovine serum (Sigma #F0392) and 100 nM sodium selenite with or without dabrafenib and trametinib or vemurafenib.

[0335] SK-Mel28 cell human melanoma cell line was a kind gift of the Department of Experimental Pharmacology, National Institute of Oncology, Budapest, Hungary and maintained in a 5% CO2 incubator at 37 °C using RPMI 1640 medium (RPMI 1640, Gibco 11875093) containing 100 U penicillin-streptomycin (Lonza #DE17-602E), 2 mM L-glutamine (Lonza #17-605E), 10% fetal bovine serum (Sigma #F0392) and 100 nM sodium selenite with or without 62.5 nM dabrafenib and 10 nM trametinib. SK-MEL-28 expresses mutant B-Raf (V600E) and wildtype N-Ras, is able to form tumors in nude mice, and is established from patient-derived tumor samples.

[0336] To examine the effect of PAG in the development of drug resistance, A375 and SK-MEL28 cells were cultured in DMEM or RPMI as indicated above with 100 nM dabrafenib and 10 nM trametinib with or without 0.5 mM PAG.

[0337] Cystine deprivation

[0338] Cystine and methionine-free DMEM (Thermo #21013024) supplemented with 30 mg / L L-methionine, dialyzed FBS (Sigma #F0392), 100 U penicillin-streptomycin (Lonza #DE17-602E), 2 mM L-glutamine (Lonza #17-605E), 1 mM sodium pyruvate (Sigma #S8636) and 100 nM sodium selenite. L-Cystine was added in different concentrations prior to experiment.

[0339] Cellular viability and proliferation

[0340] Cells were seeded in 12 or 24 well plates. Following treatments cells were washed with HBSS then fixed with cold 10% trichloroacetic acid (TCA) and incubated at 4 °C for minimum 1 hour then washed with MilliQ water 4 times. Sulforhodamine B stain (0.4% in 1% acetic acid) was added to each well and incubated for 15 min at RT. Plates were rinsed four times with 1% acetic acid and air dried. To solubilize the protein bound SRB, 10 mM unbuffered Tris solution was added. Absorbance values were measured by a plate reader spectrophotometer at 570 nm.

[0341] Western blot

[0342] Cells were washed with HBSS and harvested in RIPA buffer supplemented with protease and phosphatase inhibitors. After 15 sec of sonication, cellular debris was removed by centrifugation at 14000g for 10 min at 4 °C. Protein concentration was determined by bicinchoninic acid (BCA) assay using bovine serum albumin (BSA) as standard. Protein samples were denatured in SDS-loading buffer and reduced using 100 mM dithiothreitol (DTT) at 95 °C for 5 min. 15 pg protein sample per well was loaded to polyacrylamide gels. After size separation by electrophoresis, proteins were transferred onto nitrocellulose membranes using Trans-Blot Turbo Blotting System (BioRad). Transfer efficiencies were verified by Ponceau staining. Membranes were blocked with 5% nonfat-milk and 0.5% BSA in TBST (0.05% Tween20) for 1 hour at room temperature. Primary antibodies against Akt (ab8805), catalase (ab52477), CBS (abl40600), CDO1 (ab232699), CSE (abl89916), DLST (abl77934 ), ETHE1 (abl74302), G6PD (ab993), GAPDH (abl81602), GCLC (ab53179), GPX1 (abl08427), GPX4 (abl25066), GS (abl24811), GSTpi (ab233112), IDH1 (abl72964), Nrf2 (abl37550), OGDH (abl37773), PFKFB3 (abl81861), PFKFB4 (abl37785), SO (abl29094), SOD1 (ab52950), SOD2 (abl3533), Trx (abl85329), TST (abl66625) were purchased from Abeam; CARS2 (HPA041776), MPST (HPA001240), SQOR (HPA017079) from Sigma; betaactin (3700S), ERK1 / 2 (4695T), MEK1 / 2 antibody (8727), PDH (2784), phospho-(Ser473)- Akt (927 IS), phosphor-ERKl / 2 (Thr202 / Tyr204) (9101L),phosphoo-MEKl / 2 (S217 / 221) (9121), SDHA (5839) from Cell Signaling; TRP14 (MAB3504) from R&D Systems; GOT1 (MA531527), GOT2 (PA527572) from Invitrogen and TrxRl (sc-28321) from Santa Cruz Biotechnology. Antibodies were diluted in TBST in a 1: 1000 ratio and incubated with the membranes overnight at 4 °C. After washing in TBST (3x20 min) membranes were incubated with a secondary antibody (horseradish peroxidase conjugated anti mouse / rabbit IgG (DAKO) at a 1 :4000 dilution for 2 h at room temperature. After washing, membranes were incubated with the ECL reagent (BioRad) for 2 min and the signal was detected using a gel documentation system (Syngene).

[0343] RNA isolation and RT-qPCR

[0344] Cells were cultured in T25 flasks and total RNA was isolated using TRIzol Reagent (Applied Biosystem) according to the manufacturer’s instructions. Concentrations and purities were measured spectrophotometrically using a Nanodrop machine. 3 pg RNA samples were treated with 2U of Dnase I (ThermoScientific) at 37 °C for 30 min. Reactions were stopped by adding 20 mM EDTA followed by heat inactivation at 70 °C for 10 min and placing the samples on ice immediately. RNA samples were reverse transcribed using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions. DNA-RNA hybrid products were diluted 10-fold in Rnase free water and used as a template for real time quantitative PCR. Analyses were performed by using a 2x qPCRBIO SyGreen Mix reagent (PCRBiosystems) according to the manufacturer’s instructions in a Roche Light Cycler 480 machine. Relative abundances of mRNA were calculated by the ACT method using GAPDH, beta-2-microglobubulin (P2M) and actin as invariant controls. The p2M primer was purchased from Qiagen (#PPH01094E). All other primer sequences are listed in Table 1. RT2Profiler™ PCR Array Human Cancer Drug Resistance (PAHS-004ZF) and RT2Profiler™ PCR Array Human Cancer Drug Resistance (PAHS-004ZF) were purchased from Qiagen. For PCR arrays, 2 pg RNA was transcribed according to the manufacturer’ s instructions using RT2First Strand Kit (330404) and measurements were performed on a Roche Light Cycler 480 machine. Table 1. Oligonucleotide sequences

[0345] Preparation of CSE-knockout melanoma cell lines

[0346] Cas9 and sgRNA expressing plasmids (kind gifts from Mazhar Adli Ph.D., Northwestern University) were used in all CRISPR experiments. 20 nucleotide sgRNAs were designed using the Benchling.com software. Overhangs of 5’-CACC-3’ and 5’-AAAC-3’ were added to the 5’ of the forward and reverse complementary oligos, respectively. Forward and reverse sgRNA oligos were mixed in NEBuffer 2 (NEB #B7002S, New England Biolabs), then heated to 95°C, annealed in a stepwise thermal decrease and finally ligated with a BsmBI cut sgRNA expressing plasmid before transformation. Positive sequences were confirmed through Sanger sequencing. Vector controls include two non-targeting 20 nucleotide control guide sequences. HEK293T cells were transfected with PsPAX2, Pmd2G and the target sequence containing plasmid with FuGene6 (Promega E2691) in a 4:1:5 ratio inside OptiMem media (Gibco #31985070). Virus containing media was collected and replaced after 24 and 48 hours and fresh complete high glucose DMEM media was added (see above). The collected media was then syringe filtered through 0.22 pM fdters, and then stored at 4°C for immediate use or -80°C for long term storage. Wild type Cas9 expressing A375 melanoma cell line were seeded at 40-60% confluency and allowed to attach. Cells were then infected with the lentiviral mix with 8 pg / mL polybrene or a control media and after 14+ hours subjected to puromycin (2 pg / mL) selection until all the non-transfected cells died. After selection, clones from single cells were grown to get homogenous cell culture. SgRNA sequences used are as follows: Sg Cont.: 1. TCATGCTTGCTTGGGCAAAA; SEQ ID NO: 31 2. GCCAGCGGGGATATGGTGAA SEQ ID NO: 32 Sg CSE: 1. TCCAGAGCAATGGACCTCCA; SEQ ID NO: 33 2. AGGCGCCCCTTGCTTGAACG. SEQ ID NO: 34. For all cloning purposes competent DH5a E. coli strain was used.

[0347] Mitochondrial activity measurements

[0348] Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an Extracellular Flux Analyzer (Seahorse Biosciences, Seahorse XFp Analyzer). Cells were seeded into Seahorse culture plate (Seahorse Biosciences, Seahorse XFp FluxPak). For the characterization of mitochondrial functions Mito Stress Test kit (103015) and glycolytic functions Glycolysis Stress Test (103020) were used. After each experiment, cell culture plates were fixed with 10% TCA and SRB assay was performed. OCR and ECAR data were normalized with the measured absorbance data.

[0349] In vivo models

[0350] For the cell line-based xenografts, 106A375 cells in 200 pl DMEM were subcutaneously injected into 8- 10 weeks old \OD.CB l 7- / 7TA ' '7\CrCrl (NOD-SCID) or NOD. Cg-PrkdcscidIl2rg,mlwi, / SzJ (NSG) mice. Patient-derived tumor xenograft (PDTX) model was gifted from KINETO Lab Ltd, Budapest. The model was established from a surgically freshly removed BRAF V600E-mutant, treatment naive melanoma sample in NOD. Cg-PrkdcsadI!2rg!" "d! 7.\ (NSG) mice (The Jackson Laboratory, Bar Harbor, ME, USA), as formerly described. For the PDTX experiment, an approximately 2x2x2 mm tumor sample from fourth generation (G4) of the subcutaneously (s.c.) growing model was implanted s.c. into NOD-SCID mice. The width and length of the tumors were measured twice a week with digital vernier caliper. The volume was estimated by using the following formula: volume = (width)2x length / 2. When tumors reached an estimated 200 mm3volume, mice were randomized and treated with 30 mg / kg dabrafenib and 1 mg / kg trametinib per os 4 times in total. For cell line- derived xenografts, mice were treated daily for 4 consecutive days. PDTX-bearing mice were treated on days 1, 4, 5 and 6. 24 hours after the last treatment, mice were sacrificed, weight of the tumors was measured, and tumors were snap frozen in liquid nitrogen. Frozen tissues were disrupted using a dismembrator.

[0351] For the long-term treatment with DT or DT+PAG 1.5 x 10sA375 cells were s.c. injected into NSG mice. When tumors reached an estimated 100 mm3volume, mice were randomized and treated with 30 mg / kg dabrafenib and 1 mg / kg trametinib 5 times a week per os (37 times altogether) and in the DT+PAG group mice received intraperitoneal injection of 5 mg / kg PAG 3 times a week (23 times altogether). After acquired resistance developed in the DT-group, all mice were sacrificed, and tumor weight was measured.

[0352] Licenses:

[0353] KINETO Lab Ltd. has licenses for animal housing (PEI / 001 / 1715 / 2015) and PDTX sample collection, handling, model generation and use (IV / 10147-1 / 2020 / EKU). The provided PDTX cryopreserved samples were transferred on dry ice to the experimental animal house of the National Institute of Oncology, where the permissions for animal housing (PEI / 001 / 1738-3 / 2015) and tumor xenograft experiment with anticancer agents (PE / EA / 1461-7 / 2020) were covering all activities during the study. All ethical permissions were given by the Scientific and Research Ethics Committee, a national board in Hungary.

[0354] Immunohistochemical analysis of patient samples

[0355] Formalin-fixed paraffin-embedded melanoma tumor samples were collected from the biobank of the National Institute of Oncology and the procedure was approved by the Hungarian National Ethics Committee under file number IV / 10441-1 / 2020 / EKU. After preparing 2 m thick tissue sections, sections were deparaffinized and underwent antigen retrieval in Roche ULTRA Cell Conditioning (CC1) Solution (pH 6.0) for 20 min at 95 °C. Anti-CSE antibody (Abeam #ab!89916) was used in 250-fold dilution for 20 min at 37 °C. Deparaffinization, antigen retrieval and staining were carried out using Roche’s BenchMark ULTRA IHC / ISH System. Staining was carried out using ultraView Universal Alkaline Phosphatase Red Detection Kit (Roche #760-501) according to the manufacturer’s instructions followed by hematoxylin counter-staining. Images were acquired using an Olympus BX43 microscope equipped with a DP74 camera.

[0356] Lentiviral Transduction

[0357] For shRNA-mediated stable knockdown of ETHE1 the present inventors used MISSION shRNA Lentiviral Transduction Particles (SHCLNV-NM_014297, ID: TRCN0000083454) in 5 multiplicity of infection (MOI). Its corresponding control was MISSION pLKO.l-puro empty vector control transduction particle (#SHC001V). Single clones were grown from the full populations and assessed for ETHE1 expression using Western blot analysis. Clone 9, which had the lowest levels of ETHE1 was used for further experiments (Figure 9).

[0358] Isotope tracing experiments

[0359] For isotope tracing experiments the same media was used as in cystine deprivation (see above) but supplemented with either heavy methionine or heavy cystine. For heavy methionine labeling, media contained 30 mg / L L-[34S]-Met (Cambridge Isotopes #sc-482584A) and 200 pM unlabeled L-cystine (Sigma #C7602); for heavy cystine labeling, media contained 30 mg / L unlabeled L-methionine (Sigma #M9625) and 200 pM L-U[13C], U[15N] -cystine (Cambridge Isotopes #CNLM-4244-H-PK) (see SFig 3C). After plating and reaching 80% density, media was removed, cells were rinsed with HBSS, and cultures were treated with heavy isotope-containing media for indicated times.

[0360] HPLC-MS / MS measurement of amino acids

[0361] Cells were seeded in 6 well plates, after washing with HBSS, they were harvested in CHAPS buffer (150 mM KC1, 50 mM HEPES pH 7.4, 0.1 % CHAPS, protease inhibitors) and sonicated for 10 seconds. After centrifugation (14000g, 10 min, 4°C) protein concentration from the supernatant was measured using the BCA method. 50 pl of the samples at 1 mg / ml protein concentration was derivatized with the EZ:Faast kit (Phenomenex, Torrance, CA, USA) following the manufacturer’s instructions and measured with a Thermo Vanquish UHPLC system coupled to a Thermo Q Exactive Focus mass spectrometer, m / z values recommended by the EZ:Faast kit were used, supplemented with the isotope labeled versions. Monitored transitions can be found in Table 2.

[0362] Table 2.

[0363] HPLC-MS / MS measurement of low molecular weight (LMW) metabolites

[0364] Measurement is based on the method published by Akaike et al. (Akaike et al., 2017) as described here: Cells were seeded in 6 well plates, after washing with HBSS two times, they were harvested in ice-cold methanol containing 5 mM P-(4-hydroxyphenyl)ethyl iodoacetamide (HPE-IAM). For measurements from xenograft tumors, approximately 10-40 mg frozen pulverized tissue sample was homogenized in 5 mM HPE-IAM. Between each preparation step, samples were kept on ice. After sonication the alkylation was carried out at 37 °C for 20 min followed by centrifugation (14000 g, 10 min, 4 °C). The supernatant was acidified with 10% formic acid and diluted two-fold with 0.1% FA / HiO before injection. Cell pellets were dissolved in 1% SDS / PBS, sonicated and protein content was measured using BCA assay. HPLC-MS / MS measurements were carried out on a Thermo Q- Exactive Focus Orbitrap mass spectrometer coupled to a Thermo Vanquish UHPLC. The samples were measured with two different methods.

[0365] To measure extracellular metabolites, 50 pl culture media was alkylated with 5 mM HPE-IAM at 37°C, for 20 min. The samples were acidified with 10% TCA and centrifuged at 14000g for 10 min, 4°C. First method was carried out on a Phenomenex Kinetex C18 (50 x 2.1 mm, 2.6 pm) column with eluents 0.1% FA / HzO (A) and 0.1% FA / MeOH (B). The initial 5% B was linearly increased first to 13% in 2 min, then to 95% in 4 min, held there for 0.5 min, then lowered back to 5% B in 0.1 min and held there for 3.4 min before the next injection. Flow rate was 0.5 ml / min at 40°C. MS / MS detection was carried out in positive ionization mode, higher-energy collisional dissociation (HCD) was used to detect the analytes described in Table 2.

[0366] A Phenomenex Hypercarb (100 x 2.1 mm, 3pm) column was used for the second technique, with eluents of 0.5% FA / H2O (A) and 0.5% IP AIN 1: 1. (B). Initial 0% B was linearly increased to 30% in 15 minutes, then 100% in 1 minute, kept for 5 minutes, then decreased to 100% A in 1 minute, held for 8 minutes. Temperature was 40°C and the flow rate 0.2 ml / min. The analytes were detected by MS / MS in positive ionization mode using higher-energy collisional dissociation (HCD).

[0367] HPLC -MS / MS measurement of taurine and hypotaurine

[0368] Cells were seeded in 6 well plates, after washing with HBSS two times, they were harvested in ice-cold 75% methanol solution. For measurements from xenograft tumors, approximately 10-40 mg frozen pulverized tissue sample was homogenized in ice-cold methanol. Between each preparation step, samples were kept on ice. After sonication the precipitated proteins were removed by centrifugation (14000 g, 10 min, 4 °C). The supernatant was acidified with 10% formic acid (FA) and diluted two-fold with 0.1% FA / ACN before injection. Cell pellets were dissolved in 1% SDS / PBS, sonicated and protein content was measured using BCA assay. HPLC -MS / MS measurements were carried out following a previously published method using a Thermo Scientific LTQ-XL mass spectrometer coupled to a Thermo Vanquish UHPLC and a Phenomenex Kinetex HILIC column (100x2.1mm, 2.6 pm).

[0369] HPLC -MS / MS measurement for protein persulfides

[0370] Measurements were based on the method published by Akaike et al. (Akaike et al., 2017) and performed as described here: Cells were seeded in 6 well plates, washed with HBSS, harvested in 5 mM HPE-IAM in RIPA buffer and sonicated. After centrifugation (14000g, 10 min, RT), 100 pl of the supernatants were desalted using Zeba spin-columns (7K MWCO, 0.5 mL). Protein content was measured from the flow-through using BCA method, then 100 mM HPE-IAM in DMSO was added to the desalted solution. Protein levels of the desalted samples were brought to equal using RIPA buffer and digested with pronase (3 mg / ml) in 35 mM Na-acetate buffer (pH 5.0) at 37°C for Ih. Undigested proteins were precipitated with the addition of 10% TCA and centrifuged (14000g, 10 min, RT). The supernatants were injected on the LC -MS / MS and the derivatized analytes were measured by using the same HPLC-MS / MS method mentioned above for the LMW species using the Kinetex C18 column. MS / MS detection was carried out in positive ionization mode, higher-energy collisional dissociation (HCD) was used to detect the cysteine and cysteine-persulfide.

[0371] Measurement of thiosulfate (S2O3) using a monobromobimane-based alkylation protocol

[0372] Cells were seeded in 12-well plates, washed with PBS once. After the addition of 100 pl PBS pH 8.0 containing 1 mM monobromobimane cell were scraped, collected and incubated at 37°C for Ih to label thiol groups. The reaction was quenched using 10 pl 50% TCA, precipitated proteins were removed by centrifugation at 4000g 5 min at RT and redissolved in 4% SDS containing 0.1 M NaOH for BCA protein assay.

[0373] Detection of the derivatives from the supernatants were done using a Thermo Ultimate 3000 HPLC system equipped with a fluorescent detector. 5 pl of the derivatized sample was injected onto a Phenomenex Kinetex XB- C18 150x3mm 2.6 pm column to be separated using 0.1%TFA / H2O (A) and 0.1%TFA / MeOH (B) with the following gradient elution: The flow was set to 0.6 ml / min with an initial composition of 10% B. After 3 minutes, a linear increase was introduced for 9 minutes to 15% B. After that, the column was washed with 75% B for 2 minutes and equilibrated for 3 minutes at 10% B before the next injection.

[0374] Monobromobimane labeled hydrogen-sulfide was measured using a different chromatographic method from the same samples on a Phenomenex Luna Cl 8(2) 250x2mm 2.6um column using 0.1% TFA / H2O (A) and 0.1%TFA / ACN (B) with the following gradient elution: The flow was set to 0.25 ml / min with an initial composition of 15% B increased to 35% B in 3 minutes. At 8.5 minutes, another linear increase was introduced to 90% B in 2 minutes. 90% B was held for 1 minute, returned to 15% B in 1 minute and equilibrated for another 2 minutes at 15% B before the next injection.

[0375] For the fluorescent detection of labeled analytes, 390 nm excitation and 475 nm emission wavelength were selected, quantitation was done by establishing a calibration curve produced from standard solutions.

[0376] EXAMPLE 2

[0377] 2.1. Beside activating the PI3K / Akt pathway, dabrafenib-trametinib-resistant cells overexpress ABC- transporters and cytochrome P450 proteins

[0378] To investigate the molecular and metabolic background of melanomas resistant to MAPK inhibitors (MAPKi), the present inventors generated a DT-resistant line of BRAF V600E-mutant A375 human melanoma cells (A375-DTR) by long-term culturing in the presence of increasing doses of dabrafenib (BRAF inhibitor) and trametinib (MEK1 / 2 inhibitor) (Figure 1A). Proliferation assay was used to follow the sustained viability of resistant cells in the presence of the drugs (Figure IB). Decreased activity of the MAPK / ERK pathway was confirmed by measuring phosphorylated (active) MEK1 / 2 and ERK1 / 2 (Figure 1C). After 48 hours treatment of control (A375-Ctrl) cells with DT, MEK1 / 2 phosphorylation was inhibited, while DT-resistant cells partially regained MEK1 / 2 phosphorylation. Moreover, inhibition of the MAPK-ERK pathway resulted in increased phosphorylation and activation of Akt (Figure ID), which was consistent with previous reports demonstrating that increased activity of the PI3K-Akt pathway contributes to DT-resistance (Liu et al., 2020; Sun et al., 2014). Using Qiagen’s real-time quantitative PCR (RT-qPCR)-based arrays, the present inventors found overexpression of several additional genes that are involved in the development of cancer drug resistance (Figure 1E,F). Elevated expressions of these genes were confirmed using custom-designed oligonucleotides (Figure IE). Beside increased expressions of ATPase H+ transporting V0 subunit d2 (ATP6V0D2), Apolipoprotein E (APOE), Heat shock protein Bl (HSPB1) and ATP binding cassette subfamily G member 2 (ABCG2) genes (Figure 1G), which are generally involved in the neutralization and efflux of xenobiotics, the present inventors found overexpression of the Cytochrome P450 family (CYP) members CYP1B1, CYP2C13, CYP2F1 and CYP17A1 (Figure 1G). CYP proteins play versatile roles in cellular metabolism by oxidizing steroids, fatty acids and also drugs and xenobiotics. As CYPs are heme proteins and act as terminal oxidases, they are important players in the production of endogenous Reactive Oxygen Species (ROS) (Veith and Moorthy, 2018).

[0379] 2.2. Altered redox environment in DT-treated and DT-resistant (DTR) melanoma cells

[0380] The present inventors created dabrafenib and trametinib resistant (DTR) A375 cells (Fig 1 A-C), in which they investigated drug resistance-related gene expressions (Fig ID, 1G and Fig 8A, 8B). Among others they found overexpression of Cytochrome P450 (CYP) family members (Fig IE), which while neutralizing xenobiotics, produce reactive oxygen species (ROS) (Veith and Moorthy, 2018). Overexpression of CYP enzymes might contribute to the previous observation that A375 cells resistant to Braf and MEK inhibitors produce increased levels of ROS (Corazao-Rozas et aL, 2013; Wang et aL, 2018). Overexpression of CYP enzymes - in addition to the heated oxidative phosphorylation - likely contributes to the observed increased oxidative flux in Braf inhibitor (BRAFi) resistant A375 cells (Corazao-Rozas et al., 2016; Corazao-Rozas et al., 2013; Wang et al., 2018). In addition, increased OXPHOS in DT-treated and DT-resistant cells likely also contributes to the elevation in ROS production (see later). To counteract oxidative stress, (BRAFi)-resistant melanoma cells exhibit strong activation of the nuclear factor-erythroid factor 2-related factor 2 (Nrf2) transcription factor leading to increased activation of the pentose phosphate pathway (PPP) and xCT expression (Khamari et al., 2018). Here, the present inventors found highly elevated levels of Nrf2 in DT-treated cells and confirmed the slight accumulation of Nrf2 in DT- resistant cells (Fig IF). Thus, the present inventors confirmed the accumulation of Nrf2 in DTR cells and showed that it declined upon drug deprivation and found that Nrf2 levels even more markedly increased over 7 days in DT-treated Ctrl cells. Hence, the Nrf2-mediated antioxidant response was immediate upon DT exposure, which partially remained active in DTR cells (Fig IF). This protein expression pattern was found to be similar for a number of key antioxidant proteins including catalase (CAT), superoxide dismutase 2 (SOD2) as well as members of the thioredoxin (Trx) and the glutathione (GSH) systems, such as thioredoxin reductase 1 (TrxRl), 14-kDa human thioredoxin (Trx)-related protein (TRP14), glutathione peroxidase 1 and 4 (GPX1, 4), suggesting that the DT-induced changes in antioxidant gene expression levels are largely mediated by Nrf2 (Fig 1G). TrxRl was unique among these enzymes by being exceptionally elevated in DTR cells as well.

[0381] Further to elevated levels of intracellular glutathione, the present inventors found that levels of enzymes responsible for the neutralization of ROS are also overexpressed not only in resistant cells, but in DT-treated cells as well (Figure 1H). Elevated levels of peroxide and superoxide eliminating enzymes catalase (CAT) and superoxide dismutase 2 (SOD2) were observed in DT-treated Ctrl and DT-resistant cells compared to the untreated Ctrl with a gradual decline in DT-deprived resistant cells. The same tendency was measured for members of the thioredoxin (Trx) and the glutathione (GSH) systems, such as thioredoxin reductase 1 (TrxRl), 14-kDa human thioredoxin (Trx)-related protein (TRP14), glutathione peroxidase I and 4 (GPX1, 4). Of note, TrxRl was unique among these enzymes by being exceptionally elevated in DT-resistant cells. Enzymes of the Trx and GSH systems are generally responsible for maintaining cellular redox homeostasis via consecutive redox reactions on protein and peptide cysteine residues (Lu and Holmgren, 2014). The central hubs of the two systems are TrxRl and glutathione reductase (GR), which convert the cellular reducing power coming from nicotinamide-adenine dinucleotide phosphate (NADPH) to reduction of oxidative Cys modifications. The majority of NADPH is produced by the pentose phosphate pathway (PPP), which is a metabolic pathway parallel to glycolysis. Glucose- 6-phosphate dehydrogenase (G6PD), an enzyme of the PPP, is responsible for the conversion of NADP+to NADPH and by measuring its levels the present inventors observed the same tendency in their melanoma cell model as in the case of the previous redox enzymes (Figure II), further confirming the elevated need of these cells for increased antioxidant capacity.

[0382] The majority of the reducing power utilized by the Trx and GSH systems is coming from nicotinamideadenine dinucleotide phosphate (NADPH), which is mostly produced by the PPP enzyme Glucose-6-phosphate dehydrogenase (G6PD). In line with the expected antioxidant capacity-need of treated melanoma cells, G6PD expression levels showed a similar trend in the present inventors’ model as the above redox enzymes (Fig 1G).

[0383] During glucose metabolism, the flux between glycolysis and the PPP is controlled by bifunctional 6- phosphofructo-2-kinase / fructose-2, 6-bisphosphatase (PFKFB) family members. The kinase activity of PFKFB3 shunts glucose towards glycolysis, whereas the fructose-bisphospatase activity of PFKFB4 redirects glucose towards the PPP (Yi et al., 2019). These enzymes are gaining increased attention in cancer biology. For example, depletion of PFKFB4 inhibited tumor growth of prostate cancer cells in a xenograft model by allowing a catastrophic buildup of ROS (Ros et al., 2012). Moreover, the present inventors previously showed, that PFKFB4 expression was elevated in CBS -silenced breast cancer cells which is potentially related to the elevated oxidative stress in these cells (Erdelyi et al., 2021). By measuring protein levels of PFKFB3 and PFKFB4, the present inventors found that in DT-treated Ctrl cells PFKFB3 levels decrease and PFKFB4 levels increase, consistent with a redirected glucose flux towards the PPP to support an increased NADPH demand of the cell upon DT treatment (Fig 1H). Whereas in DT-resistant (DTR) cells, both PFKFB3 and 4 levels are almost restored to the levels observed in untreated Ctrl cells, which together with the antioxidant protein expression profiles suggests a more balanced redox environment and reactivation of glycolytic pathways (Figure 1J).

[0384] Taken together, elevated oxidative stress upon inhibition of the MAPK / ERK pathway in melanoma cells by DT treatment is counteracted by Nrf2-mediated overexpression of several antioxidant genes. This antioxidant response is supported by a shift from glycolysis to PPP and a concomitant increase in the production of NADPH to fuel the antioxidant machineries. In DT-resistant cells a more balanced redox environment and recovery of glycolysis is predicted by the expression patterns of enzymes that regulate cellular antioxidant response and glucose metabolism.

[0385] 2.3. Cellular energy metabolism is re-shaped in DT-treated and DT-resistant cells

[0386] Nrf2, which is elevated in DT-treated and DTR cells (see above) is also responsible for the redirection of glucose and glutamine into anabolic pathways (Mitsuishi et al., 2012). Moreover, it is widely accepted that BRAF mutations can reprogram cellular metabolism, for example V600E mutant BRAF upholds the activity of glycolysis and therefore the addiction to glycolysis de facto becomes an addiction to BRAF V600E itself (Hall et al., 2013). Therefore, BRAF inhibitors deeply alter metabolism in melanoma cells. Other groups have already shown that melanomas exposed to BRAFi rapidly became dependent on oxidative phosphorylation (OXPHOS) for survival as demonstrated by the high sensitivity of BRAFi-treated cells to the induction of apoptosis in response to several mitochondrial respiratory chain inhibitors (Corazao-Rozas et al., 2016; Corazao-Rozas et al., 2013). Therefore, the present inventors measured oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) in their cellular model system using a Seahorse Cell Analyzer and found that DT-resistant cells have higher basal respiration, but both DT-treated and DT-resistant cells have higher non-mitochondrial oxygen consumption, maximal respiration, and higher spare respiratory capacity (Figure 2A). The present inventors also investigated glycolytic activity of these cells and found that DT-treated Ctrl cells have lower glycolytic activity, capacity, and reserve, while in DT-resistant cells these are (partially) restored (Figure 2B). A fundamental characteristic of cancer cell metabolism is increased aerobic glycolysis supporting macromolecule synthesis to fulfill the metabolic demands of rapidly proliferating cells (DeBerardinis and Chandel, 2016). Therefore, it is not surprising that resistant cells need a restored glycolytic activity to regain their ability to proliferate. This is in line with a more balanced redox environment and less need for an excessive NADPH production through the PPP as shown above, which allows the cells to restore their anabolic machineries.

[0387] In line with the antioxidant response, increased mitochondrial respiration and decreased glycolytic activity accompanied with increased levels of citric acid cycle proteins were observed in DT-treated Ctrl cells to balance drug-induced oxidative stress (Fig 2C) (Corazao-Rozas et al., 2016; Corazao-Rozas et al., 2013). In DTR cells the present inventors found increased mitochondrial respiration, increased levels of pyruvate dehydrogenase (PDH) and succinate dehydrogenase (SDHA) and restored glycolytic activity (Fig 2C) consistent with a balanced redox environment which together allows the restoration of anabolic machineries and cell proliferation (DeBerardinis and Chandel, 2016).

[0388] Next, the present inventors measured protein levels of citric acid cycle (CAC) enzymes responsible for providing electron donors for the electron transport chain (ETC), such as NADH. The present inventors found highly elevated levels in DT-treated control and moderately elevated levels in DTR cells of pyruvate dehydrogenase (PDH), oxoglutarate dehydrogenase (OGDH), dihydrolipoamide S-succinyltransferase (DLST) responsible for NADH production. Succinate dehydrogenase (SDHA) - which is not only a CAC enzyme, but also a member of the ETC and responsible for coenzyme Q reduction - was also highly elevated in DT-treated cells, but its levels did not drop, rather further increased in DTR cells (Figure 2C).

[0389] This enzyme pattern is consistent with an increased flux through the ETC in the presence of DT treatment to support the cells’ increased energy demand.

[0390] Next, the present inventors performed mass spectrometry metabolome analyses to measure intra- and extracellular amino acid levels. Targeted amino acid metabolome analyses found increased levels of intracellular glutamine (Gin), asparagine (Asn) and aspartate (Asp) in DT-treated Ctrl cells and slightly increased Asp in DT- resistant cells (Figure 2D). Moreover, both DT-treated Ctrl and DTR cells take up more Gin (Figure 2E), which is in line with the previous observations that the Nrf2 pathway is upregulated in these cells because Nrf2 also promotes Gin consumption (Mitsuishi et al., 2012). Interestingly, the present inventors found increased extracellular levels of Asn in the culture media of DT-treated Ctrl and DTR cells and increased levels of Asp in DTR cells (Figure 2E), suggesting that metabolic pathways involved in the conversion of these amino acids are also specifically reprogrammed. Therefore, the present inventors checked the expression of genes involved in glutamate (Glu) metabolism. Glu is a nonessential amino acid, which is a central player in cancer cell antioxidant defense, metabolic reprograming and oncogenic signaling (Zhu and Thompson, 2019). In relation to the present inventors’ previous observations, Glu can be converted to alpha ketoglutarate (otKG) to feed the CAC, it is a building block in GSH synthesis, and it is used by the xCT antiporter to export cystine into the intracellular matrix. Glutamine synthetase (GLUL) converts Glu to Gin, while glutaminase 1, 2 (GLS1,2) enzymes synthesize Glu from Gin through glutaminolysis (Figure 2F). It has been found that DT-treated Ctrl cells upregulate the expression of GLS 1 and 2 genes, while resistant cells upregulate the expression of GLS1 and strongly suppress GLUL expression (Figure 2G), suggesting that DT-treated cells upregulate glutaminolysis to meet their extra need for Glu, while DT-resistant cells suppress the conversion of Glu to Gin to feed their increased Glu demand (Fig 2G) consistently with the increased Gin uptake as shown above and in line with previous studies (Baenke et al., 2016; Khamari et al., 2018). Previous studies also suggested an Nrf2-mediated redirection of glucose and glutamine metabolism in cells resistant to MAPK inhibitors (Baenke et al., 2016; Khamari et al., 2018), which albeit using V-resistant cells, correlate with the present inventors’ findings. Glutamate oxaloacetate transaminase 1 (GOT1, cytoplasmic) and 2 (GOT2, mitochondrial) facilitate the reaction of aspartate with a-ketoglutarate to yield glutamate and oxaloacetate (Recasens et al., 1980). They are members of the malate-aspartate shuttle and therefore play an important role in metabolite exchange between the mitochondria and the cytosol, in amino acid metabolism and in the regulation of intracellular NAD(H) redox balance. However, in the present cell model system no significant difference was found in their expression levels (Figure 2H).

[0391] Taken together the data presented herein suggest that metabolic pathways involved in cellular energetics are deeply reprogrammed in melanoma cells resistant to BrafV600Ei and MAPKi. This includes the upregulation of OXPHOS with increased expression of CAC enzymes that produce NADH to fuel the electron transport chain (ETC). Along with the upregulation of these pathways the present inventors found increased glutaminolysis in DT-treated and DT-resistant cells, which refers to the increased demand for Glu.

[0392] It was previously reported that melanoma cells resistant to MAPK inhibitors are more vulnerable to transcriptional inhibition of the xCT antiporter responsible for the uptake of cystine (CySSyC) via extracellular trafficking of Glu (Wang et al., 2018). In line with this notion, the inventors found increased sensitivity of DT- resistant (DTR) cells to CySSyC-deprivation induced ferroptotic cell death, but only if selenite was absent from the culture media (Figure 3A). As selenocysteine-containing enzymes (selenoproteins) need selenite for selenocysteine synthesis, for consistency the present inventors supplemented the culture media of cells with 100 nM sodium selenite unless indicated otherwise. The reason behind the fact that DTR cells were only more sensitive (compared to Ctrl) to CySSyC-deprivation in the absence of selenite supplementation, could be related to an adaptive overexpression of the selenoprotein GPX4 in both cell lines (see Fig II), which is one of the main protecting factors against ferroptotic cell death (Dixon et al., 2012). Indeed, when cells were cultured in media without extra selenite, GPX4 levels (along with the other two major selenoenzymes TrxRl and GPX1) dropped significantly within 24 hours making the cells more vulnerable to CySSyC-deprivation (Figure 3B). Consistent with this observation and with previous reports (Khamari et aL, 2018; Wang et al., 2018), the present inventors found elevated uptake of CySSyC by DT-resistant cells via measuring a decrease in CySSyC levels and an increase in Glu levels in the culture media above cells. In addition, the present inventors found that DT-treated Ctrl cells also exhibit elevated CySSyC uptake (Figure 3C). This is in line with the present inventors’ previous observations, that increased production of Glu by glutaminolysis is present in DT-resistant as well as DT-treated cells to (among other factors) support the elevated activity of the xCT antiporter. The present inventors measured an elevated influx of CySSyC through the xCT not only in DTR, but also in Ctrl cells (Fig 3C), which is in line with increased production of Glu by glutaminolysis in both cell lines (Fig 2D-G). The observed elevated levels of intracellular glutathione in DTR cells (Figure 3D) (Wang et al., 2018) is likely utilized not only in its redox buffer capacity (among others via feeding GPX catalyzed reactions), but also to provide more substrate for the cell protecting and xenobiotics neutralizing activities of glutathione-S-transferase (GST) enzymes. Indeed, along with the elevated GSH levels the present inventors also found elevated expressions of the most prominent xenobiotic catabolizing GST isoform, GST pi, in DT-treated and DT-resistant (DTR) cells (Figure 3E).

[0393] Taken together the data presented herein highlight that DT-treated and DT-resistant cells require increased levels of CySSyC to fuel GSH synthesis, which is utilized to counteract oxidative stress and neutralize anticancer drugs.

[0394] 2.4. MAPK inhibitors reprogram Cys metabolism

[0395] Next, it was investigated how the increased uptake of CySSyC in DT-treated and DT-resistant (DTR) cells alter Cys metabolism. After entering the cell, CySSyC is readily reduced to Cys in the cytosolic environment by the Trx system (Pader et al., 2014). DTR cells require more Cys to feed their increased GSH production and therefore surely contributes to the increased CySSyC uptake. However, Cys is not only utilized for the synthesis of GSH; other Cys utilizing cellular pathways can produce taurine, hydrogen sulfide or Cys-SSH (Figure 3F). Interestingly, despite the increased uptake of CySSyC, the present inventors found lower intracellular Cys levels in DT-treated and in DT-resistant cells compared to untreated Ctrl (Figure 3G), which suggested a higher flux of Cys through its metabolic events. In addition, the present inventors found that intracellular levels of CySSyC is 2.5-fold higher in DT-treated Ctrl cells than in untreated cells and that CySSyC / Cys ratios are significantly higher in DT-treated Ctrl and in DT-resistant cells compared to untreated Ctrl, which demonstrate a shift towards the oxidized state. These observations are in line with the increased oxidative stress and elevated uptake of CySSyC in the presence of BrafV 600E inhibitors. Although, the uptake of Cys mostly occurs in its oxidized form (CySSCy) via the xCT, it can also be synthetized from methionine (Met) via transsulfuration pathways and therefore considered a semi-essential amino acid. In this process, homocysteine (HCys) is generated from Met through multiple steps followed by the conversion of HCys to cystathionine (CTH) by cystathionine beta-synthase (CBS) (Figure 4B Reaction 1) which is then utilized for Cys production by cystathionine gamma-lyase (CSE) (Figure 4B Reaction 2) (Kumar and Banerjee, 2021; Sbodio et al., 2019). The present inventors next investigated whether the elevated Cys demand upon DT treatment and the sensitivity of resistant cells to CySSyC deprivation is accompanied by an altered pattern of Cys producing transsulfuration enzymes. It was found that inhibition of the MAPK / Erk pathway by DT in Ctrl cells triggered a rapid and marked expression of CSE accompanied by a decrease in CBS levels (Fig 31 / 1). Interestingly, in DT-resistant (DTR) cells an opposite pattern was observed with restored CBS expression and a decline of CSE to an almost non-detectable level (Figure 31 / 1). Upregulation of CSE upon 5-day DT-treatment was also observed in another Braf V600-mutant cell line SK-MEL28 (Figure 31 / 2). Because the consecutive action of CBS and CSE is required for intracellular synthesis of Cys, these enzyme patterns do not support the notion that transsulfuration is reprogrammed upon DT treatment in order to feed the elevated Cys demand of the cell. However, both CBS and CSE can concomitantly produce reactive sulfur species (RSS) independently from each other’s activity via reverse transsulfuration pathways (Ida et al., 2014; Yadav et al., 2016). Indeed, the increased ratio of Cys-SSH / Cys in DT-treated Ctrl cells, the elevated H2S2 in DTR cells and the higher concentrations of H2S and GSSH in both DT-treated and DTR cells (Fig 3G&J) suggest that DT- treatment induced changes in CSE and CBS expression levels are functionally related to their RSS producing activities. In addition to CSE and CBS, another enzyme, mercaptopyruvate sulfur transferase (MPST) is also involved in H2S production (Ida et al., 2014; Modis et aL, 2013; Nandi et al., 2000) and Cys persulfidation (Pedre and Dick, 2021; Pedre et al., 2023). The present inventors found that cytosolic MPST (upper band) is slightly increased in DT-treated Ctrl cells (Fig 31 / 1), indicating a potential contribution of MPST to the observed increased levels of RSS in these cells (Figure 3G&J). However, for MPST-mediated RSS production 3-mercaptopyruvate (3MP) is needed, which is produced from Cys by GOT enzymes. Given that Asp is the preferred substrate of GOTs over Cys, in DT-treated Ctrl and DT-resistant cells where Asp levels are elevated (see Fig 2D) and no increase in GOT expressions were observed (see Fig 2H), GOT-mediated 3MP production and therefore MPST-mediated sulfide production is likely not a major factor in the observed increases in RSS levels (Pedre and Dick, 2021; Ubuka et al., 1992).

[0396] RSS are heavily involved in cellular protection against ferroptosis and other oxidative stress (Barayeu et al., 2022; Doka et aL, 2020; Zivanovic et al., 2019), in supplying the energy production of the ETC (Akaike et al., 2017; Hanna et al., 2022; Libiad et al., 2019; Szabo et al., 2014), as well as in regulation of aerobic glycolysis (Vitvitsky et al., 2021). Therefore, the present inventors propose that the observed adaptive changes in CSE and CBS expression levels upon DT treatment are likely to contribute to the protection and survival of melanoma cells against DT targeted therapy and hence to the development of drug resistance.

[0397] Panza et al. have shown previously that A375 cells are sensitive to sulfur donors as these downregulate both MAPK / Erk and PI3K / Akt pathways and that overexpression of CSE in A375 cells inhibits cellular proliferation (Panza et al., 2015). In addition, Leikam et al. have shown that knockdown or pharmacological inhibition of CSE in A375 cells leads to reduced proliferation and senescence (Leikam et al., 2014). These observations explain why CSE levels are low in Ctrl and in proliferating DTR cells and that its rapid induction in Ctrl cells upon DT treatment likely represents an important adaptive response to protect the cell upon drug exposure. This adaptive response surely plays an important role in laying the foundations for survival of drug resistant cells. CSE is indeed a highly inducible protein which is regulated by a wide range of stimuli including oxidative stress. Several transcription factors, including Nrf2, which orchestrates the antioxidant response in melanoma cells upon DT treatment (see above) (Sbodio et al., 2019), as well as other stress response factors SP1 and ATF4 have binding sites on the CSE promoter and thereby regulate CSE expression levels (Renga et aL, 2009).

[0398] Taking together, the present inventors’ data in light with previous observations suggest that induction of CSE expression (Fig 31) is a rapid adaptive response of melanoma cells to counteract cellular damage by drug induced immediate oxidative stress (see Fig 1F-H) and provide extra fuel for energy production (Fig 2A-B) via an increased generation of RSS (Fig 3J). When drug resistance develops, CSE levels drop and increased CBS levels (Fig 31) takes over to provide a balanced, but increased RSS flux (Fig 3J), which restores glycolysis (Fig 2A-B) and promote cancer cell proliferation and tumor progression, similar to a number of tumor types, where elevated CBS was shown to contribute to tumor progression (Ascencao and Szabo, 2022; Coletta et al., 2012; Czikora et al., 2022; Erdelyi et al., 2021).

[0399] This observation may explain why CSE levels are low in Ctrl and in proliferating DTR cells and that its rapid induction in Ctrl cells upon DT treatment likely represents an adaptive response upon drug exposure. CSE is indeed a highly inducible protein which is regulated by a wide range of stimuli including oxidative stress (Sbodio et al., 2019).

[0400] Intracellular Cys levels are tightly regulated by oxidative catabolic pathways through cysteine dioxygenase (CDO), where CDO converts Cys to cysteine sulfinic acid (CSA) which is either decarboxylated by cysteine sulfinic acid decarboxylase (CSAD) to yield hypotaurine and taurine or deaminated to release P-sulfinyl pyruvate. CDO is extremely sensitive to steady-state levels of Cys (Stipanuk and Ueki, 2011)and upon excessive Cys exposure, CDO concentrations can in some cells be increased up to 45-fold (Dominy et al., 2006). To the present inventors’ great surprise, despite the high Cys demand and low intracellular steady-state Cys concentrations of DT-treated cells, they found that DT-treatment largely induced the oxidative catabolism of Cys. The present inventors measured a 20-fold increase in the expression of CDO on the mRNA level in DT-resistant cells and a 7- fold and a 1.5-fold increase of the downstream cysteine sulfinic acid decarboxylase (CSAD) enyzme in DT-treated and DTR cells, respectively (Figure 3H). Increased expression of CDO1 in DTR cells was confirmed on the protein level by Western blot (Figure 31). These observations suggest that oxidative Cys catabolism is likely a major cause of the low steady- tate Cys levels in DT-treated and in DT-resistant cells.

[0401] Figure 3F summarizes major pathways, including synthesis of GSH, RSS (FES and cysteine persulfide) and also oxidative metabolism to taurine, that based on our data are responsible for the elevated flux of Cys in melanoma cells when they are exposed to DT treatment.

[0402] 2.5. Insights into how Cys metabolism is reprogrammed in A375 cells by fluxomic approaches using stable isotopes

[0403] In order to gain deeper insights into how Cys metabolic pathways are realigned upon DT-treatment in melanoma cells and to explain the above observations the present inventors undertook a comprehensive targeted metabolome analysis of transsulfuration pathways.

[0404] First, the present inventors measured the total levels of intermediates of Cys metabolism in the absence of heavy isotopes and found that total levels of HCys, CTH and Lanth were decreased in DT-treated Ctrl cells, but it was accompanied by a significant increase in Hlanth levels (Fig 4A). CTH levels were almost abolished in DT- treated Ctrl cells, which, considering the canonical Cys producing pathways, is in line with the fact that CTH- producing CBS levels are low and CTH-consuming CSE levels are high and suggest that the non-canonical activity of CSE (despite being elevated) to produce CTH and FES from Cys and HCys (Fig 4E Reaction VI) is negligible. On the other hand, Hlanth can only be produced by CSE from 2 HCys (Fig 4E Reaction VII), therefore, the increased levels of Hlanth together with the decrease in HCys cells suggest that this reaction might to some extent contribute to the observed elevation of sulfide levels in DT-treated Ctrl (Fig 3 J) . Lanth is another metabolite, which may indicate CSE or CBS catalyzed production of HjS reactions using 2 Cys molecules as substrates (Fig 4E Reaction V). However, Lanth was lower in DT-treated control cells, which implies that these reactions cannot account for the observed increase in RSS. In DT-resistant cells CTH and Lanth levels are still significantly lower than in untreated Ctrl cells, but higher than in DT-treated Ctrl cells, which - although reflects a partially restored CBS-activity compared to DT-treated Ctrl cells - indicate that the increased RSS levels in DT-treated and DTR cells are not produced via CBS / CSE catalyzed conversion of Cys and HCys to CTH and PLS (Fig 4E Reaction VI) or 2 Cys to Lanth and H2S (Fig 4E Reaction V).

[0405] Next, the present inventors measured fluxes through metabolic pathways using Met or CySSyC isotopes in culture in culture media (they measured metabolic profiles of normal and heavy LMW thiols of the transsulfuration pathway in their cellular model systems when stable Met or CySSyC isotopes were used in their culture media). First, to investigate the canonical functions of CSE and CBS, the present inventors treated cells with heavy sulfur (34S) containing Met (Met*). 18 hours of treatment was enough to fully exchange Met and HCys pools to heavy Met and HCys. Under these conditions the present inventors found that Cys synthesis from Met is negligible in all tested systems even after 48 hours of cell growth (Figure 4C), which is consistent with the large supply of CySSyC that is available for the cells from the media as well as the differential expression patterns of CBS and CSE (Fig 31). By measuring the ratio of heavy CTH to total, the present inventors found that in untreated Ctrl and DT- resistant cells approximately 60% of CTH is derived from the canonical pathway (Figure 4B Reaction 1) whereas in DT-treated Ctrl cells it was only 30%. These data support the present inventors’ previous finding, that DT- treated Ctrl cells overexpress CSE and downregulate CBS (Fig 31), so they cannot synthesize as much CTH from HCys by CBS actions (Figure 4B Reaction 1) as untreated Ctrl cells, but they are able to synthesize CTH from Cys (Figure 4F Reaction 8) (which will show up as light CTH in this experiment), because this reaction is catalyzed not only by CBS but by CSE as well. Importantly, generation of CTH from Cys also produces H2S (Figure 4F Reaction 8) so these data suggest that elevated CSE-induced metabolism of Cys to CTH might contribute to the increased RSS production in DT-treated Ctrl cells. However, this is not supported by the fact that in DT-treated Ctrl cells the heavy HCys levels (not their ratios to the sum of heavy and light analytes as above) are lower and the heavy CTH is almost completely abolished compared to Ctrl cells, while in DT-resistant (DTR) cells these are restored to Ctrl levels (Figure 4D). This latter observation is explained by the fact that DT-resistant cells have restored levels of CBS and low levels of CSE compared to untreated Ctrl cells (Fig 31), so they can synthesize CTH from HCys and Ser (via CBS) (Figure 4B Reaction 1) but have a deficit to convert this CTH to Cys (due to low CSE) (Figure 4B Reaction 2). These observations are also consistent with the data and conclusions drawn based on total metabolite measurements in the absence of isotopic labelling (see above and Fig 4A).

[0406] Taken together, these metabolite patterns indicate that in DT-treated Ctrl cells the canonical CBS activity is extremely low but partially restored in DTR cells compared to Ctrl which is in line with measured CBS protein levels (Fig 31), but the canonical CSE activity is not prominent in any of these systems including in DT-treated Ctrl cells, where it was found to be overexpressed (Fig 31). It can also be concluded that the increased RSS production in DT-treated and DTR cells are not explained by CSE or CBS-mediated metabolism of Cys to produce H2S.

[0407] In the following experiments the present inventors used CySSyC containing heavy carbon (13C) and heavy nitrogen (15N) in cell culture media and measured the levels of normal and heavy (*) analytes with the aim to better understand the RSS-producing functions of CSE and CBS in these cellular systems. By calculating the ratios of heavy analytes compared to total levels, the present inventors found that after 18 hours of treatment intracellular CySSyC and Cys pools were completely exchanged to heavy CySSyC and Cys (Figure 4G). Next, the present inventors calculated the incorporation of the carbon backbone coming from CySSyC (not from Met on the canonical pathway) to CTH, Lanth and Ser by comparing the heavy analytes to their corresponding total levels. The present inventors found that under normal cell culture conditions (200 ii M CySSyC), Lanth and CTH production from Cys is substantial, while Ser synthesis from Cys is negligible (Figure 4G). By analyzing the steady-state levels of heavy metabolites (and not their ratios to the sum of light and heavy metabolites), the present inventors found that untreated Ctrl cells synthetize more CTH (Figure 4F Reaction 8) and Lanth (Figure 4F Reaction 9) from heavy Cys than DT-treated or DT-resistant cells (Figure 4G), consistently with the present inventors’ previous results that untreated Ctrl cells have higher intracellular concentrations of Cys (Fig 3G), which is a substrate in these reactions, as well as higher total Lanth and CTH levels (Fig 4A). These results also corroborate that reactions V and VI (Fig 4E) do not contribute to the elevated RSS in DT-treated and DTR cells.

[0408] Ida et. al. have shown that CySSyC can also be directly used by CBS and CSE to produce CySSH (Ida et al., 2014), which could persulfidate other Cys derivatives via transpersulfuration reactions (Ida et al.) as well as increase sulfide concentrations via the actions of Trx or GSH systems (Doka et al., 2020; Wedmann et al., 2016). However, kinetic simulations by the Banerjee group suggested that under physiological conditions, due to low concentrations of intracellular CySSyC and high levels of Cys, this pathway is not prominent and an increase in CySSCy to Cys ratio is required for it to play a role in CySSH synthesis (Yadav et al., 2016). As the present inventors have shown above, DT-treated Ctrl cells are characterized by increased oxidative burden and both DT- treated Ctrl and DT-resistant cells have elevated CySSyC to Cys ratios. In addition, the present inventors found that oxidative catabolism of Cys is activated in DT-treated and DTR cells (Fig 3H, I). This latter observation seemed largely counterintuitive in light of the facts that these cells take up more CySSyC (Fig 3C) and have elevated levels of intracellular GSH, GSSH and H2S (Fig 3J), which all suggest an increased demand for Cys and speaks against its oxidative catabolism. However, a viable mechanism, which could reconcile this anomaly together with the fact that the utilization of Cys by CSE or CBS cannot explain the observed increased levels of RSS in DT exposed cells is the following: Activated oxidative Cys catabolism and elevated oxidative stress together with increased uptake of CySSCy in DT-treated and DTR cells increase CySSyC to CyS ratios to the extent, which allows CySSCy to become the prominent substrate for CBS and / or CSE and directly produce Cys- SSH under these conditions. It also has to be acknowledged that CySSCy is a roughly two orders of magnitude better substrate to these enzymes than Cys and the fact that this reaction is not supported under normal conditions is only because of the largely reducing atmosphere of the cytosol (Ida et al., 2014).

[0409] Nevertheless, the higher steady-state levels of H2S and GSSH in DT-treated and DTR cells could protect them against oxidative stress induced ferroptosis (Barayeu et al., 2022; Wu et al., 2022) or metalloprotein induced oxidative stress (Doman et al.). In addition, persulfidation of Cys residues can conserve protein functions under oxidative stress, because oxidatively modified persulfides (perthiosulfenic / sulfinic / sulfonic acid) can be reversibly reduced back to thiols (Doka et al., 2020; Filipovic et al., 2018). Therefore, the present inventors measured the total levels of high molecular weight (HMW) persulfides to assess whether DT-induced elevated RSS could protect protein Cys residues against the drug induced oxidative stress (to investigate the potential of this thiol protecting mechanism against drug-induced oxidative damage). Indeed, the present inventors found elevated levels of protein-Cys-SSH and protein-Cys-SSSH in DT-treated Ctrl cells after 6-days of treatment, but the present inventors observed no significant difference in protein persulfidation between untreated Ctrl and DT-resistant cells (Figure 41). This might be related to the fact that DT-treated Ctrl cells need to deal with an unexpected oxidative stress (they have the highest levels of oxidative stress), which could trigger increased persulfidation of protein Cys residues via CSE-mediated rapid response to protect the most oxidant sensitive protein thiols before cells adapt to stress conditions.

[0410] As explained herein, upon Braf V600E and MEK1 / 2 inhibition using dabrafenib and trametinib (DT) enzymes of the sulfide catabolic pathway are upregulated. This pathway is responsible for sulfide clearance, and it also donates electrons to the electron transport chain and therefore it regulates mitochondrial energy metabolism. In a further set of experiments, it has been confirmed the increased activity of this pathway upon DT treatment by measuring its final product, thiosulfate (S2O3) using a monobromobimane-based alkylation protocol followed by fluorescent detection. Treatment of A375 cells has been carried as described above.

[0411] In accordance with the previous findings, upon DT treatment the activity of the sulfide catabolic pathway is increased, which potentially donates electrons to the electron transport chain, while in Dabrafenib-trametinib (DT) treated DT resistant A375 cells its activity is restored to normal (Figure 7C).

[0412] It may be noted here that apparently the enzymes in the sulfide degradation pathway show the same pattern. Their levels correlate with the levels of the end product of the pathway (thiosulfate).

[0413] In these experiments we give DT to resistant cells, too, to maintain their resistant phenotype. This follows from the nature of cellular level experiments as cells can easily change their phenotype in altered environment. In these experiments, we are interested in what DT does to control cells (acute effect) and how they differ from resistant cells, which, although they receive DT, are able to divide in the same way as controls. In these and other experiments, e.g. those when mitochondrial function, CSE / CBS levels, etc. are measured, the resistant cells show a similar pattern to the untreated controls, despite the DT being present in the medium throughout.

[0414] 2.6. Inhibition of BrafV600E with vemurafenib results in similar redox changes in melanoma cells

[0415] Vemurafenib was the first FDA-approved Braf V600E inhibitor (Figure 5A), but tumors quickly develop acquired resistance to this drug largely due to downstream overactivation of the MEK kinase (Manzano et al., 2016; Robert et al., 2015), which led to combined inhibition with the MAPK / ERK pathway as the common practice in medical oncology (see the combination of dabrafenib and trametinib). However, to find out whether the present observations regarding Cys and H2S metabolic rewiring is a general adaptive response in melanoma cells to BrafV600E inhibition, the present inventors investigated how Cys and H2S metabolism is altered in vemurafenib (V)-treated and vemurafenib resistant (VR) cells. First, the present inventors generated a vemurafenib -resistant A375 cell line by long-term culturing of the cells in the presence of increasing doses of vemurafenib. Proliferation of the cells was investigated by SRB assay confirming that VR cells completely regained their proliferative ability (Figure 5B). By measuring MEK1 / 2 and ERK1 / 2 phosphorylation, it was found that V-treatment effectively blocked MEK1 / 2 phosphorylation and that in VR cells MEK1 / 2 phosphorylation was completely restored. Next, such as in the case of DT therapy the present inventors measured levels of proteins that are involved in cellular defense against oxidative stress and / or in Cys metabolism (Figure 5C). Similarly to DT-treatment, the present inventors found that V-treatment of Ctrl cells resulted in decreased levels of CBS, whereas CSE, MPST, PDH, G6PD, TrxRl and GPX1, 4 proteins were overexpressed. Moreover, in V-resistant cells these enzyme levels were mostly restored to the untreated Ctrl levels similar to what the present inventors observed in the case of DTR cells. However, in VR cells TrxRl levels were also restored, which is in contrast with DTR cells, where the present inventors detected even higher TrxRl concentrations in DTR cells compared to DT-treated Ctrl cells. In line with the previous results, vemurafenib treatment in Ctrl cells induced a decrease in steady-state Cys, CTH and HCys levels and increased CySSyC, H2S, GSSH and Hlanth levels. Whereas in VR cells, the present inventors found significant differences only in Cys-SSH levels and CTH levels. Interestingly, in VR cells Cys, CySSyC, H2S, HCys and Lanth levels are completely restored, in fact CTH levels are even higher than in the untreated Ctrl cells (Figure 5D). These data suggest that similar metabolic reprogramming mechanisms operate in the development of V- resistance as the present inventors found for DT-resistance, but the observed differences caused by DT-treatment were more notable and resistance as well as metabolic balance to V treatment developed faster. Consistent with the metabolome analyses, the development of vemurafenib resistance in in vitro cell culture proliferation assays took less time than that of dabrafenib-trametinib resistance, which is not surprising, since the dual inhibition of Braf and MEK results in a complete blockage of the MAPK / ERK pathway.

[0416] 2.7. DT-treatment induced metabolic changes upon BRAF inhibition were confirmed in vivo using xenograft models and upon V-treatment of cells

[0417] To investigate metabolic changes upon DT-treatment in melanoma tissue in vivo, the present inventors established two xenograft mouse models with (1) subcutaneous injection of A375 cells (A375-X) and (2) the implantation of patient-derived tumor samples into immune-deficient mice (PDX). Dual treatment of mice with dabrafenib and trametinib resulted in a quick drop in tumor volumes (Figure 6A and 6C) showing the high efficacy of this targeted therapy. To obtain insights into the metabolic differences in the DT-treated tumors, the present inventors performed metabolome analyses from both the A375 cell line-derived xenografts (A375-X) as well as the patient-derived xenograft (PDX) tumor samples. In both models, quick drop in tumor volumes demonstrated the high initial response rate to DT-treatment (Fig 6A and 6C). In the DT-treated A375-X tumors, tissue metabolome analyses showed lower steady-state levels of Cys, CTH and Lanth, increased persulfidation of Cys and GSH, while increased levels of CySSyC and GSSH were observed in accordance with the present inventors’ in vitro results. Moreover, the present inventors found a shift of Cys and GSH speciation towards their oxidized dimeric states in DT-treated A375-X tumors (Figure 6B). In the DT-treated PDX tumors, the present inventors also found decreased steady-state levels of Cys, CTH and Lanth, while steady-state levels of CySSyC, Hlanth and Cys-SSH were elevated. A shift towards the oxidized forms of Cys and GSH (more pronounced oxidation of Cys and GSH) upon DT treatment was also noticeable in the case of PDX tissues (Figure 6D). These together provided in vivo evidence to the present inventors’ in vitro findings (Fig 6D). As in vitro, in both tumor models the greatest influence of DT treatment was on CTH by causing an over 90% drop in the levels of this metabolite compared to what were measured in the untreated tumor tissues. This together with the observed low steady-state Cys levels imply that the elevation of RSS levels in DT-treated tumors are not due to reverse HjS producing transsulfuration activities of CSE and / or CBS using Cys as substrate (Fig 4E, Reaction VI). The present inventors’ in vitro fluxomics results showed that under sufficient CySSyC availability, the canonical Cys-producing function of CBS and CSE is negligible and their sulfide / persulfide producing function is more prominent. However, in the xenograft tumor, nutrients are not equally available for all tumor cells and nutrient availability depends on the vascularization of the tumor tissue. In tumor cells where CySSyC availability is not sufficient, the Cys producing function of CBS and CSE might also be vital to survive. To obtain deeper insights into these details would require an in vivo fluxomics approach, which would require considerable effort and outside the scope of the present work. Furthermore, in mice xenografts the detection of human proteins is also rather challenging, because murine tissues infiltrate the human tumors and protein sequences of human and murine CBS and CSE show high sequence homology, which confines the specificities of available antibodies and renders their differentiation by shot-gun proteomics close to impossible. These in vivo metabolome analyses are therefore fully consistent with results that were obtained with the present inventors’ cell model systems.

[0418] Moreover, the present inventors found that another BrafV 600E inhibitor vemurafenib (V), which was the first FDA-approved drug to treat Braf-mutant melanoma patients, induces similar changes in the Cys metabolism of melanoma cells. Importantly, the downregulation of CBS, overexpression of CSE along with the increased production of RSS were also confirmed in V-treated cells (Figure 5).

[0419] 2.8. ETHE1 silencing ameliorates the effects of DT-treatment in A375 cells

[0420] Because intracellular levels of sulfide are strictly regulated by catabolic pathways and Cys-persulfide species also feed these machineries (Akaike et al., 2017; Combi et al., 2023; Fujii et al., 2019; Marutani et al., 2021) , the present inventors checked the levels of proteins responsible for sulfide catabolism, including sulfide: quinone oxidoreductase (SQOR), which oxidizes HzS to GSSH, persulfide dioxygenase (ETHE1 or PDO) catalyzing the oxidation of GSSH to give sulfite and GSH, thiosulfate sulfurtransferase (TST), which oxidizes GSSH and sulfite to thiosulfate, and sulfite oxidase (SO) responsible for sulfite clearance. The present inventors found strongly elevated levels of all four enzymes in DT- as well as in V-treated Ctrl cells (Figure 7A&B, respectively), which along with the increased levels of CSE suggested a higher flux of RSS through melanoma cells upon BrafV600E inhibition. Although high ILS concentrations inhibit mitochondrial respiration (complex IV), at lower concentrations it can provide electrons to the ETC via SQOR and CoQ to stimulate mitochondrial respiration (Goubem et al., 2007; Szabo et al., 2014). Therefore, SQOR is not only responsible for sulfide detoxification, but it could also stimulate mitochondrial respiration. In addition, recently LMW persulfides were also suggested to be potent electron donors for the ETC (Akaike et al., 2017; Fujii et al., 2019). These results together with the present inventors’ mitochondrial energetic experiments (see above) suggest that the increased intracellular flux of RSS is involved in feeding the larger energy demand of melanoma cells upon BrafV600E inhibition. Levels of enzymes involved in the sulfide catabolic chain were restored in DT-resistant cells to what was observed in untreated Ctrl cells. This is also consistent with all of the present inventors’ previous data suggesting that upon the development of resistance the cell is under less stress and restores its anabolic machineries with lowered OXPHOS and restored glycolysis (Figure 1J, 2A-B). Either via inhibition of complex IV or due to an overreduced CoQ pool it was proposed that elevated levels of H2S can also uncouple mitochondrial respiration and promote reverse electron transport (RET), which was associated with increased production of ROS (Banerjee and Kumar, 2022; Jia et al., 2020; Kumar et al., 2022). In DT-treated and DTR cells only a slight (1.5-fold) elevation of endogenously produced H2S levels were detected and previous studies suggested that BrafV600E inhibitor- treated melanoma cells are particularly sensitive to respiratory chain inhibitors (Corazao-Rozas et al., 2016), which together imply that the increased endogenous sulfide levels in this system indeed promote mitochondrial respiration. However, the possibility that electron acceptor insufficiency causes RET to some extent under these conditions cannot be ruled out.

[0421] Taken together, the present inventors’ data suggest that the boost in the intracellular RSS flux is not only important in protection against oxidative stress, but also linked to the observed higher electron flow through the ETC to feed the increased energy demand of melanoma cells upon BrafV600E inhibition (also see section 2.3), which might be needed to operate transporters to efflux DT, for example ABCG2 (see Fig 1G). In DTR cells, sulfide catabolic enzymes were restored to untreated Ctrl levels, which is consistent with the previously proposed notion that upon the development of resistance, cells are under less stress (Fig 1G-I, 3G) and restitute their anabolic machineries with lowered OXPHOS and restored glycolysis (Fig 2A-B).

[0422] In order to further confirm the role of mitochondrial RSS in the development of DT-resistance, the present inventors established a lentiviral ETHE1 -silenced A375 cell line from single clones (Figure 7D). The present inventors found no significant changes in the expressions of Cys and H2S metabolic pathway enzyme upon ETHE1 silencing (Figure 7E). However, when cells were treated with DT, levels of SQOR, SO and TST were lower and TrxRl was higher in shETHEl cells compared to shCtrl cells. Moreover, the present inventors found increased expression of TrxRl in DT-treated shETHEl cells compared to DT-treated shCtrl. The Trx system is important in the reduction of per- and polysulfides (Doka et al., 2016) so the overexpression of TrxRl might be a compensatory effect in Ethel -silenced cells to diminish persulfide levels escaping to the cytosol. Overexpression of TrxRl might be due to adaptation of ETHE1 -silenced cells to increased persulfide levels in the cytosol (Doka et al., 2016). The present inventors also examined the proliferation of these cells and interestingly found that shETHEl cells proliferated slightly slower compared to untreated Ctrl cells in a 1-week proliferation assay in vitro (Figure 7E). However, when cells were treated with DT, the proliferation of shETHEl cells became much more prominent in a 3-week in vitro proliferation assay, demonstrating that low levels of ETHE1 is favorable for A375 cells when they are treated with DT and hence implying the importance of persulfides in cell survival upon DT-therapy (Figure 7F).

[0423] Next, LMW thiols and GSSH (the substrate of ETHE1) were also measured in shCtrl and shETHEl cell lysates (Figure 7G). GSSH is the most abundant LMW persulfide in the cells, which is oxidized to sulfite and GSH by ETHE1 under normal conditions. The present inventors compared untreated shETHEl, DT-treated Ctrl and DT-treated shETHEl cells to untreated shCtrl and also compared DT-treated shETHEl cells to DT-treated shCtrl cells to unravel differences that might contribute to the increased tolerance to DT treatment. Compared to untreated shCtrl cells, the present inventors found higher levels of GSH, gGluCys, GSSH and GSSG in DT-treated shETHEl cells, while lower levels of CTH were measured in both DT-treated shCtrl and shETHEl cells. Surprisingly, lower levels of Lanth were found in shETHEl cells, but not in DT-treated shETHEl cells. Compared to DT-treated Ctrl cells, higher levels of Cys, GSH, gGluCys and GSSG were found in DT-treated ETHE1 cells, while intracellular levels of CySSyC were lower. The present inventors also measured LMW thiols from the culture media and found that GSSH levels are increased up to 3-fold in the media above DT-treated ETHE1 cells compared to all other cells (Figure 7H). Taken together, increased intracellular levels of GSSH are accompanied by elevated levels of GSH, GSSG and also the precursor of GSH synthesis, gGluCys. The present inventors’ data suggest that since ETHE1- silenced cells are impaired to recover GSH from GSSH, these cells might need to boost their intracellular GSH synthesis machinery to maintain GSH homeostasis for antioxidant defense via Gpxl, drug metabolism through GSTpi and for protection against ferroptosis by Gpx4 (see before). Furthermore, the excess GSSH that is generated upon DT treatment is excreted by the cells into the extracellular space when ETHE1 is not available for GSSH degradation. Although the present inventors found no significant elevation in the total levels of protein persulfides in DT-resistant cells (see above), the present inventors found higher levels of protein persulfidation in DT-treated Ctrl and in shETHEl cells, especially in DT-treated shETHEl compared to the untreated shCtrl (Figure 71). These observations are consistent with the present inventors’ proposed mechanism that CSE-produced persulfides also provide protein thiol protection upon DT-treatment-induced oxidative stress.

[0424] 2.9. CSE is overexpressed in melanoma patients’ samples upon DT-therapy

[0425] To assess physiological credence for the therapeutic potential of combined inhibition of CSE with BRAF V600E targeted therapy, the present inventors measured CSE expression levels upon DT treatment in patient samples. Clinical specimen collection from patients who received targeted therapy at time of the sampling is extremely challenging, as surgical removal of melanomas is only performed in rare scenarios when treatment is still effective. In the biobank of the Hungarian National Institute of Oncology, treating among the largest number of melanoma patients in Europe, the present inventors found only one patient from whom skin melanoma samples before and after therapy were available. Immunohistochemistry clearly demonstrated that CSE levels were strongly elevated in the tumor sample removed during DT-therapy (Fig. 8A). Across patient-derived samples, an elevation of CSE expression (magenta staining) was generally observed in metastatic patient samples. However, we found another patient with paired before- and after-treatment samples from lymphatic metastases and, although CSE levels were high in the metastasis, we observed even higher levels of CSE in the lymph node, which was removed during DT-therapy (Fig. 8B). By comparing lymphatic melanoma metastases from different patients, we found markedly lower CSE levels in 4 out of 5 untreated tumors, and high CSE in 1 out of 5 compared to patients who received DT therapy (Fig. 8C). These observations strongly suggest that CSE is indeed upregulated in melanomas exposed to DT-treatment, strengthening the notion that its upregulation is an important stress response mechanism upon BRAF V600E inhibition.

[0426] 2.10. CSE inhibition inhibits the development of resistance to BrafV600E inhibitors

[0427] According to the present inventors’ results detailed above, DT or V-treated A375 cells have elevated levels of RSS (Fig 3J & 5D) and upon silencing persulfide dioxygenase these cells had elevated proliferation rate in a 3- week proliferation assay (Fig 6D). Inhibition of BrafV 600E and MEK do not kill all melanoma cells in vitro, some remain alive in a quiescent state. The present inventors accumulated extensive data to show that reprogrammed Cys and RSS metabolism play major roles in protection of these cells against the BrafV600E and Mek inhibitors as well as against drug-induced oxidative stress. The present inventors demonstrated that an immediate adaptive response in this system is the elevation of CSE levels and its sulfide / persulfide producing activities to protect oxidation sensitive protein thiols and to feed the cells’ increased energy demand through providing electrons to the ETC (Fig 3I-J). To assess whether increased CSE expression upon targeted therapy could act as Achilles heel of persistent melanoma cells, the present inventors used selective CSE inhibitor in the upcoming experiments. Importantly, the present inventors found that therapy-naive A375 melanoma cells were not sensitive to the selective CSE inhibitor PAG (Fig 9A) nor the non-selective CSE inhibitor AOAA (Fig 9B). This could be reasoned by the fact that CSE is lower in therapy-naive melanoma cells and it is upregulated upon targeted therapy. In the following experiment, the present inventors used the CSE-inhibitor PAG and treated cells with V, CV, DT or EB in the presence and absence of PAG to assess how vital is the CSE-inducing stress response in the survival of melanoma cells upon BrafV 600E and MEK inhibition and in the development of drug resistance. A375 cells were maintained in V or DT-containing media with or without PAG for 2 months, and a 7-day proliferation assay was performed with these cells. The present inventors found that A375 cells maintained in media only containing V acquired full resistance after two months, whereas the proliferation of cells, which were maintained in the presence of both V and PAG was largely impaired (Fig 10A). Furthermore, after 2 months treatment of cells with DT, development of drug-resistance was also apparent although to a lesser extent (development of resistance takes approximately 4 months in vitro). However, development of resistance was prevented when DT was used in combination with PAG. After 2 months combined treatment of DT with PAG more effectively inhibited tumor cell growth compared to DT treatment alone (Fig 10B). In the case of CV treatment, a significant portion of cell died due to CV and CV+PAG treatment. After 10 weeks of treatment with CV + PAG, CV-treated cells partially regained their ability to proliferate, whereas CV+PAG treated cells remained in a quiescent state (Fig 10D). In the case of EB-treatment, which similarly to V, CV and DT also induces CSE overexpression, EB+PAG treatment was more effective after 4 months than EB alone (Fig 10C). There could be several different mechanisms involved in the background of this phenomenon. As the present inventors and others have previously shown CSE / CBS / MPST- or CARS2-induced persulfidation plays an important role in several processes involved in cancer cell survival including angiogenesis, hypoxia and protection against ferroptosis (Coletta et aL, 2012; Czikora et al., 2022; Erdelyi et al., 2021; Szabo, 2016).

[0428] Restored levels of phospho-MEKl / 2 is (at least) partially needed for acquired resistance, therefore, in order to look for specific effects in this system, the present inventors compared phospho-MEKl / 2 levels in cells cultured with V or DT in the presence and absence of PAG for two months and with EB in the presence and absence of PAG for 4 months. Importantly, the present inventors found lower levels of phospho-MEKl (lower band) in PAG+ V-treated cells than in V-treated cells (Fig 10E) and EB+PAG compared to EB (Fig 10G) which suggests that CSE-induced RSS may promote MEK1 phosphorylation in the presence of V600E inhibitors and contribute to the development of drug resistance (see Fig 10 E, F). Interestingly, MEK2 (upper band) phosphorylation was more intense in both V+PAG and DT+P AG-treated cells than in V or DT-only-treated cells, which the present inventors cannot explain at this point. The PI3K / Akt pathway is often upregulated in human melanomas resistant to Braf / MEK inhibitors (Sun et al., 2014) and consistent with this, increased phosphorylation of Akt was observed in the present inventors’ system as well (see Fig ID). Importantly, the present inventors found lower levels of phospho-(Ser473)-Akt in cells cultured with Braf and / or MEK inhibitors in combination with PAG compared to when the drugs were used alone (Fig 10E-H). This may be related to CSE-induced persulfidation of MEK1, which was proposed to induce ERK phosphorylation and activation (Zhao et al., 2014) and could (at least in part) explain the observed diminished cell proliferation in the presence of PAG (Fig 10A-D).

[0429] The present inventors’ in vitro data corroborate that in A375 cells CSE is a vital stress response element upon DT-treatment and serves as a secondary drug target to increase the efficacy of V, CV, DT and EB targeted therapy. Next, to reveal if combined inhibition of CSE and BRAF / MEKs is beneficial under in vivo conditions the present inventors established a A375-cell line derived xenograft model in NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice. Tumor-bearing mice were treated with DT or the combination of DT and PAG, and both therapies effectively diminished tumor growth (Fig. 11 A). On the DT only arm, the first tumor, which exceeded its size that was measured before treatment was at the 24thday of treatment, while on the DT+PAG arm this occurred on day 38 (Fig 11 A). Grouping together, after 25 -days of treatment tumors in DT-treated mice developed acquired resistance, while increase in average tumor volumes of DT+P AG-treated mice was only observed approximately 20 days later (Fig 11 A). Therapy was considered effective until tumors reached their volumes that was measured before the treatment started (progression free survival, PFS). PFS of DT+PAG-treated mice was significantly higher than for mice treated with DT alone (Fig. 1 IB). At the 50th day of treatment, PFS was apparent in 9 out of 11 mice on the DT+PAG arm, while only one mouse remained in the PFS state out of 12 on the DT only arm. Mice were sacrificed and tumors were removed and measured 50 days after the first treatment and tumor weight was significantly lower in the DT+PAG group (Fig 11C).

[0430] These results indicate that inhibition of CSE effectively delays the onset of acquired resistance to BrafV600 and MEK 1 / 2 inhibitors under in vivo conditions.

[0431] EXAMPLE 3

[0432] 3. Combined inhibition of the MAPK / ERK pathway and CSE could delay the onset of acquired resistance in SK-Mel28 cell line

[0433] To demonstrate that combining CSE inhibitor D-,L-propargylglycine (PAG) with Braf V600E and MEK1 / 2 inhibitors is beneficial in other melanoma cell line carrying Braf V600E mutation, we started to culture SK-Mel28 cell line with Braf V600E and MEK1 / 2 inhibitors with or without PAG. In the case of this cell line, it takes more time to gain acquired resistance than with the previously used A375 cell line, however, our preliminary results show that those SK-Mel28 cells that receive PAG in addition to Braf V600E and MEK1 / 2 inhibitors already proliferate at a smaller rate.

[0434] EXAMPLE 4

[0435] 4. Upon DT treatment CSE-expressing cells outgrow CSE-lacking cells in a polyclonal cell population

[0436] To demonstrate that the beneficial effect of PAG in delaying acquired resistance is evidently due to the important role of CSE in the survival of persistent cells, we generated stable CSE knockout A375 cell line using CRISPR-Cas9 technology (see Example . In general, CSE knock-out was successful, the levels of CSE were almost undetectable in the CSE knockout cell population (Figure 12A).

[0437] However, this cell population is polyclonal, the knockout of CSE might not have been successful in all cells. After 1.5 months of DT treatment, we found no difference in CSE protein levels between the control and the CSE knockout cell populations using western blot method (Figure 12B), which means that cells expressing CSE outgrow those cells in which CSE knockout was successful. This further strengthens our previous observations, that CSE is indeed pivotal in the development of acquired resistance, and that its inhibition is a viable approach to inhibit or delay the onset of acquired resistance.

[0438] EXAMPLE 5

[0439] 5.1 Exemplary diagnosis and treatment of a patient with BRAF V600E mutation

[0440] A patient with a dark naevus found to be increasing in the last two months visit our outpatient clinique. Biopsy is taken from dark naevus found and is sent to analysis wherein it is diagnosed as a malignant melanoma.

[0441] A further analysis is requested by the doctor responsible for the treatment to assess whether the melanoma is a BRAF V600 melanoma.

[0442] The patient is ordered to be treated with a combined Dabrafenib-trametinib treatment completed with a PAG-treatment wherein each of the drugs is applied in their usual treatment regimen.

[0443] 5.2 Exemplary diagnosis and treatment of a patient with BRAF V600E mutation

[0444] A patient with cutaneous melanoma with a strong metastatic potential is under vemurafenib treatment and experiences a regression of the tumor after 3 months of treatment. However, a recurrence is observed in the 6 months control visit.

[0445] A biopsy is taken and sent to tissue analysis by the doctor responsible for the treatment to assess whether the melanoma is a BRAF V600 melanoma. The melanoma is diagnosed to be BRAF V600K mutant.

[0446] The treatment regimen of the patient is updated to include trametinib and PAG, the latter is in a double dose compared with that described in Example. 5.1.

[0447] INDUSTRIAL APPLICABILITY

[0448] The invention is useful in particular in the prevention or delaying the onset or development of resistance of said patient to a treatment of a Braf V600 mutant cancer, in particular melanoma, with the MAPK inhibitor, in particular an inhibitor of a Braf V600 mutant. The invention also relates to combination treatments, if desired with diagnosis, as well as pharmaceutical compositions, combinations and kits for such therapies.

[0449] REFERENCES

[0450] Akaike, T., Ida, T., Wei, F.Y., Nishida, M., Kumagai, Y., Alam, M.M., Ihara, H., Sawa, T., Matsunaga, T., Kasamatsu, S., et al. (2017). Cysteinyl-tRNA synthetase governs cysteine polysulfidation and mitochondrial bioenergetics. Nat Commun 8, 1177.

[0451] Asimakopoulou, A., Panopoulos, P., Chasapis, C. T., Coletta, C., Zhou, Z., Cirino, G., ... & Papapetropoulos, A. (2013). Selectivity of commonly used pharmacological inhibitors for cystathionine synthase (CBS) and cystathionine y lyase (CSE). British journal of pharmacology, 769(4), 922-932.

[0452] Ascencao, K., and Szabo, C. (2022). Emerging roles of cystathionine beta-synthase in various forms of cancer. Redox Biol 53, 102331.

[0453] Baenke, F., Chaneton, B., Smith, M., Van Den Broek, N., Hogan, K., Tang, H., Viros, A., Martin, M., Galbraith, L., Girotti, M.R., et al. (2016). Resistance to BRAF inhibitors induces glutamine dependency in melanoma cells. Mol Oncol 10, 73-84.

[0454] Banerjee, R., and Kumar, R. (2022). Gas regulation of complex II reversal via electron shunting to fumarate in the mammalian ETC. Trends Biochem Sci 47, 689-698.

[0455] Barayeu, U., Schilling, D., Eid, M., Xavier da Silva, T.N., Schlicker, L., Mitreska, N., Zapp, C., Grater, F., Miller, A.K., Kappl, R., et al. (2022). Hydropersulfides inhibit lipid peroxidation and ferroptosis by scavenging radicals. Nat Chem Biol. Bhattacharjee A, Sinha A, Ratia K, Yin L, Delgado-Rivera L, Petukhov PA, Thatcher GRJ and W ardrop DJ : (2017) 2-Arylidene hydrazinecarbodithioates as potent, selective inhibitors of cystathionine y-lyase (CSE). ACS Med Chem Lett. 8:1241-1245..

[0456] Cirino, G., Szabo, C., and Papapetropoulos, A. (2023). Physiological roles of hydrogen sulfide in mammalian cells, tissues, and organs. Physiol Rev 103, 31-276.

[0457] Coletta, C., Papapetropoulos, A., Erdelyi, K., Olah, G., Modis, K., Panopoulos, P., Asimakopoulou, A., Gero, D., Sharina, I., Martin, E., et al. (2012). Hydrogen sulfide and nitric oxide are mutually dependent in the regulation of angiogenesis and endothelium-dependent vasorelaxation. Proc Natl Acad Sci U S A 109, 9161-9166.

[0458] Combi, Z., Potor, L., Nagy, P., Sikura, K.E., Ditroi, T., Juranyi, E.P., Galambos, K., Szerafin, T., Gergely, P., Whiteman, M., et al. (2023). Hydrogen sulfide as an anti-calcification stratagem in human aortic valve: Altered biogenesis and mitochondrial metabolism of H(2)S lead to H(2)S deficiency in calcific aortic valve disease. Redox Biol 60, 102629.

[0459] Corazao-Rozas, P., Guerreschi, P., Andre, F., Gabert, P.E., Lancel, S., Dekiouk, S., Fontaine, D., Tardivel, M., Savina, A., Quesnel, B., et al. (2016). Mitochondrial oxidative phosphorylation controls cancer cell's life and death decisions upon exposure to MAPK inhibitors. Oncotarget 7, 39473-39485.

[0460] Corazao-Rozas, P., Guerreschi, P., Jendoubi, M., Andre, F., Jonneaux, A., Scalbert, C., Garcon, G., Malet-Martino, M., Balayssac, S., Rocchi, S., et al. (2013). Mitochondrial oxidative stress is the Achille's heel of melanoma cells resistant to Braf-mutant inhibitor. Oncotarget 4, 1986-1998.

[0461] Cortese-Krott, M.M., Koning, A., Kuhnle, G.G.C., Nagy, P., Bianco, C.L., Pasch, A., Wink, D.A., Fukuto, J.M., Jackson, A.A., van Goor, H., et al. (2017). The Reactive Species Interactome: Evolutionary Emergence, Biological Significance, and Opportunities for Redox Metabolomics and Personalized Medicine. Antioxid Redox Signal 27, 684-712.

[0462] Czikora, A., Erdelyi, K., Ditroi, T., Szanto, N., Juranyi, E.P., Szanyi, S., Tovari, J., Strausz, T., and Nagy, P. (2022). Cystathionine beta-synthase overexpression drives metastatic dissemination in pancreatic ductal adenocarcinoma via inducing epithelial-to-mesenchymal transformation of cancer cells. Redox Biol 57, 102505.

[0463] Davies, H., Bignell, G.R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M.J., Bottomley, W., et al. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949-954.

[0464] DeBerardinis, R.J., and Chandel, N.S. (2016). Fundamentals of cancer metabolism. Sci Adv 2, el600200.

[0465] Dixon, S.J., Lemberg, K.M., Lamprecht, M.R., Skouta, R., Zaitsev, E.M., Gleason, C.E., Patel, D.N., Bauer, A.J., Cantley, A.M., Yang, W.S., et al. (2012). Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149, 1060-1072.

[0466] Doka, E., Ida, T., Dagnell, M., Abiko, Y., Luong, N.C., Balog, N., Takata, T., Espinosa, B., Nishimura, A., Cheng, Q., et al. (2020). Control of protein function through oxidation and reduction of persulfidated states. Sci Adv 6, eaax8358.

[0467] Doka, E., Pader, I., Biro, A., Johansson, K., Cheng, Q., Ballago, K., Prigge, J.R., Pastor-Flores, D., Dick, T.P., Schmidt, E.E., et al. (2016). A novel persulfide detection method reveals protein persulfide- and polysulfide- reducing functions of thioredoxin and glutathione systems. Sci Adv 2, el500968.

[0468] Doman, A., Doka, E., Garai, D., Bogdandi, V., Balia, G., Balia, J., and Nagy, P. (2023). Interactions of reactive sulfur species with metalloproteins. Redox Biol 60, 102617.

[0469] Dominy, J.E., Jr., Hirschberger, L.L., Coloso, R.M., and Stipanuk, M.H. (2006). Regulation of cysteine dioxygenase degradation is mediated by intracellular cysteine levels and the ubiquitin-26 S proteasome system in the living rat. Biochem J 394, 2 1-27 . Erdelyi, K., Ditroi, T., Johansson, H.J., Czikora, A., Balog, N., Silwal-Pandit, L., Ida, T., Olasz, J., Hajdu, D., Matrai, Z., et al. (2021). Reprogrammed transsulfuration promotes basal-like breast tumor progression via realigning cellular cysteine persulfidation. Proc Natl Acad Sci U S A 118.

[0470] Filipovic, M.R., Zivanovic, J., Alvarez, B., and Banerjee, R. (2018). Chemical Biology of H2S Signaling through Persulfidation. Chem Rev 118, 1253-1337.

[0471] Florent L, Saby C, Slimano F, Morjani H. BRAF V600-Mutated Metastatic Melanoma and Targeted Therapy Resistance: An Update of the Current Knowledge. Cancers. 2023; 15(9):2607.

[0472] Fujii, S., Sawa, T., Motohashi, H., and Akaike, T. (2019). Persulfide synthases that are functionally coupled with translation mediate sulfur respiration in mammalian cells. Br J Pharmacol 176, 607-615.

[0473] Giunta, E. F., De Falco, V., Napolitano, S., Argenziano, G., Brancaccio, G., Moscarella, E., Ciardiello, D., Ciardiello, F., & Troiani, T. (2020). Optimal treatment strategy for metastatic melanoma patients harboring BRAF-V600 mutations. Therapeutic advances in medical oncology, 12, 1758835920925219. https: / / doi.org / 10.1177 / 1758835920925219

[0474] Goubem, M., Andriamihaja, M., Nubel, T., Blachier, F., and Bouillaud, F. (2007). Sulfide, the first inorganic substrate for human cells. FASEB J 27, 1699-1706.

[0475] Hall, A., Meyle, K.D., Lange, M.K., Klima, M., Sanderhoff, M., Dahl, C., Abildgaard, C., Thorup, K., Moghimi, S.M., Jensen, P.B., et al. (2013). Dysfunctional oxidative phosphorylation makes malignant melanoma cells addicted to glycolysis driven by the (V600E)BRAF oncogene. Oncotarget 4, 584-599.

[0476] Hanna, D., Kumar, R., and Banerjee, R. (2022). A Metabolic Paradigm for Hydrogen Sulfide Signaling via Electron Transport Chain Plasticity. Antioxid Redox Signal.

[0477] Haq, R., Shoag, J., Andreu-Perez, P., Yokoyama, S., Edelman, H., Rowe, G.C., Frederick, D.T., Hurley, A.D., Nellore, A., Kung, A.L., et al. (2013). Oncogenic BRAF regulates oxidative metabolism via PGClalpha and MITF. Cancer Cell 23, 302-315.

[0478] Hellmich, M.R., Coletta, C., Chao, C., and Szabo, C. (2015). The therapeutic potential of cystathionine beta- synthetase / hydrogen sulfide inhibition in cancer. Antioxid Redox Signal 22, 424-448.

[0479] Hu, Y., Wang, L., Han, X., Zhou, Y., Zhang, T., Wang, L., ... & Wu, F. (2018). Discovery of a bioactive inhibitor with a new scaffold for cystathionine y-lyase. Journal of Medicinal Chemistry, 62(3), 1677-1683.

[0480] Ida, T., Sawa, T., Ihara, H., Tsuchiya, Y., Watanabe, Y., Kumagai, Y., Suematsu, M., Motohashi, H., Fujii, S., Matsunaga, T., et al. (2014). Reactive cysteine persulfides and S-polythiolation regulate oxidative stress and redox signaling. Proc Natl Acad Sci U S A 777, 7606-7611.

[0481] Jia, J., Wang, Z., Zhang, M., Huang, C., Song, Y., Xu, F., Zhang, J., Li, J., He, M., Li, Y., et al. (2020). SQR mediates therapeutic effects of H(2)S by targeting mitochondrial electron transport to induce mitochondrial uncoupling. Sci Adv 6, eaa75752.

[0482] Jiang J, Chen HN, Jin P, Zhou L, Peng L, Huang Z, Qin S, Li B, Ming H, Luo M, Xie N, Gao W, Nice EC, Yu Q, Huang C. (2023) Targeting PSAT1 to mitigate metastasis in tumors with p53-72Pro variant. Signal Transduct Target Ther. 8(1) 65.

[0483] Khamari, R., Trinh, A., Gabert, P.E., Corazao-Rozas, P., Riveros-Cruz, S., Balayssac, S., Malet-Martino, M., Dekiouk, S., Joncquel Chevalier Curt, M., Maboudou, P., et al. (2018). Glucose metabolism and NRF2 coordinate the antioxidant response in melanoma resistant to MAPK inhibitors. Cell Death Dis 9, 325.

[0484] Kumar, R., and Banerjee, R. (2021). Regulation of the redox metabolome and thiol proteome by hydrogen sulfide. Crit Rev Biochem Mol Biol 56, 221-235.

[0485] Kumar, R., Landry, A.P., Guha, A., Vitvitsky, V., Lee, H.J., Seike, K, Reddy, P., Lyssiotis, C.A., and Banerjee, R. (2022). A redox cycle with complex II prioritizes sulfide quinone oxidoreductase-dependent H2S oxidation. J Biol Chem 298, 101435.

[0486] Kumar, V., Abbas, A., and Aster, J. (2017). Basic pathology (Elsevier). Leikam, C., Hufnagel, A., Walz, S., Kneitz, S., Fekete, A., Muller, M.J., Eilers, M., Schartl, M., and Meierjohann. S. (2014). Cystathionase mediates senescence evasion in melanocytes and melanoma cells. Oncogene 33, 771- 782.

[0487] Li M, Liu Y, Deng Y, Pan L, Fu H, Han X, Li Y, Shi H, Wang T. (2021)Therapeutic potential of endogenous hydrogen sulfide inhibition in breast cancer (Review), Oncol. Rep., 45(5), 68.

[0488] Libiad, M., Vitvitsky, V., Bostelaar, T., Bak, D.W., Lee, H.J., Sakamoto, N., Fearon, E., Lyssiotis, C.A., Weerapana, E., and Banerjee, R. (2019). Hydrogen sulfide perturbs mitochondrial bioenergetics and triggers metabolic reprogramming in colon cells. J Biol Chem 294, 12077-12090.

[0489] Liu, R., Chen, Y., Liu, G., Li, C., Song, Y., Cao, Z., Li, W., Hu, J., Lu, C., and Liu, Y. (2020). PI3K / AKT pathway as a key link modulates the multidrug resistance of cancers. Cell Death Dis II, 797.

[0490] Liu Y, Wang L, Zhang X, Deng Y, Pan L, Li H, Shi X, Wang T. A novel cystathionine y-lyase inhibitor, 1194496, inhibits the growth and metastasis of human TNBC via downregulating multiple signaling pathways (2021) Sci. Rep., 11(1), 8963.

[0491] Lu, J., and Holmgren, A. (2014). The thioredoxin antioxidant system. Free Radic Biol Med 66, 75-87.

[0492] Luis, R., Brito, C., and Pojo, M. (2020). Melanoma Metabolism: Cell Survival and Resistance to Therapy. Adv Exp Med Biol 1219, 203-223.

[0493] Manzano, J.L., Layos, L., Buges, C., de Los Llanos Gil, M., Vila, L., Martinez-Balibrea, E., and Martinez-Cardus, A. (2016). Resistant mechanisms to BRAF inhibitors in melanoma. Ann Transl Med 4, 237.

[0494] Marutani, E., Morita, M., Hirai, S., Kai, S., Grange, R.M.H., Miyazaki, Y., Nagashima, F., Traeger, L., Magliocca, A., Ida, T., et al. (2021). Sulfide catabolism ameliorates hypoxic brain injury. Nat Commun 12, 3108.

[0495] Mitsuishi, Y., Taguchi, K., Kawatani, Y., Shibata, T., Nukiwa, T., Aburatani, H., Yamamoto, M., and Motohashi, H. (2012). Nrf2 redirects glucose and glutamine into anabolic pathways in metabolic reprogramming. Cancer Cell 22, 66-79.

[0496] Modis, K., Coletta, C., Erdelyi, K., Papapetropoulos, A., and Szabo, C. (2013). Intramitochondrial hydrogen sulfide production by 3-mercaptopyruvate sulfurtransferase maintains mitochondrial electron flow and supports cellular bioenergetics. FASEB J 27, 601-611.

[0497] Mourah S, Denis MG, Narducci FE, Solassol J, Merlin JL, Sabourin JC, Scoazec JY, Ouafik L, Emile JF, Heller R, Souvignet C, Bergougnoux L, Merlio JP. Detection of BRAF V600 mutations in melanoma: evaluation of concordance between the Cobas® 4800 BRAF V600 mutation test and the methods used in French National Cancer Institute (INCa) platforms in a real-life setting. PLoS One. 2015 Mar 19;10(3):e0120232.

[0498] Nair, A.B., Jacob, S. (2016). A simple practice guide for dose conversion between animals and human. J Basic Clin Pharm, 7(2), 27-31.

[0499] Nandi, D.L., Horowitz, P.M., and Westley, J. (2000). Rhodanese as a thioredoxin oxidase. Int J Biochem Cell Biol 32, 465-473.

[0500] Pader, I., Sengupta, R., Cebula, M., Xu, J., Lundberg, J.O., Holmgren, A., Johansson, K., and Arner, E.S. (2014). Thioredoxin-related protein of 14 kDa is an efficient L-cystine reductase and S-denitrosylase. Proc Natl Acad Sci U S A 111, 6964-6969.

[0501] Panza, E., De Cicco, P., Armogida, C., Scognamiglio, G., Gigantino, V., Botti, G., Germano, D., Napolitano, M., Papapetropoulos, A., Bucci, M., et al. (2015). Role of the cystathionine gamma lyase / hydrogen sulfide pathway in human melanoma progression. Pigment Cell Melanoma Res 28, 61-72.

[0502] Pavlova, N.N., Zhu, J., and Thompson, C.B. (2022). The hallmarks of cancer metabolism: Still emerging. Cell Metab 34, 355-377.

[0503] Pedre, B., and Dick, T.P. (2021). 3-Mercaptopyruvate sulfurtransferase: an enzyme at the crossroads of sulfane sulfur trafficking. Biol Chem 402, 223-237. Pedre, B., Talwar, D., Barayeu, U., Schilling, D., Luzarowski, M., Sokolowski, M., Glatt, S., and Dick, T.P. (2023). 3-Mercaptopyruvate sulfur transferase is a protein persulfidase. Nat Chem Biol.

[0504] Prahallad, A., Sun, C., Huang, S., Di Nicolantonio, F., Salazar, R., Zecchin, D., Beijersbergen, R.L., Bardelli, A., and Bernards, R. (2012). Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR. Nature 483, 100-103.

[0505] Qu, Kevin; Pan, Qiulu; Zhang, Xi; Rodriguez, Luis ... Waldman, Frederic, Detection of BRAF V600 Mutations in Metastatic Melanoma: Comparison of the Cobas 4800 and Sanger Sequencing Assays. (2013) The Journal of Molecular Diagnostics, 75(6), 790-795.

[0506] Recasens, M., Benezra, R., Basset, P., and Mandel, P. (1980). Cysteine sulfinate aminotransferase and aspartate aminotransferase isoenzymes of rat brain. Purification, characterization, and further evidence for identity. Biochemistry 19, 4583-4589.

[0507] Renga, B., Mencarelli, A., Migliorati, M., Distrutti, E., and Fiorucci, S. (2009). Bile-acid-activated farnesoid X receptor regulates hydrogen sulfide production and hepatic microcirculation. World J Gastroenterol 5, 2097- 2108.

[0508] Robert, C., Karaszewska, B., Schachter, J., Rutkowski, P., Mackiewicz, A., Stroiakovski, D., Lichinitser, M., Dummer, R., Grange, F., Mortier, L., et al. (2015). Improved overall survival in melanoma with combined dabrafenib and trametinib. N Engl J Med 372, 30-39.

[0509] Rockville, MD: US Food and Drug Administration; (2005). Guidance for Industry: Estimating the Maximum Safe Starting Dose in Adult Healthy Volunteer.

[0510] Ros, S., Santos, C.R., Moco, S., Baenke, F., Kelly, G., Howell, M., Zamboni, N., and Schulze, A. (2012). Functional metabolic screen identifies 6-phosphofmcto-2-kinase / fructose-2,6-biphosphatase 4 as an important regulator of prostate cancer cell survival. Cancer Discov 2, 328-343.

[0511] Sbodio, J. I., Snyder, S.H., and Paul, B.D. (2019). Regulators of the transsulfuration pathway. Br J Pharmacol 176, 583-593.

[0512] Shimoi T, Sunami K, Tahara M, Nishiwaki S, Tanaka S, Baba E, Kanai M, Kinoshita I, Shirota H, Hayashi H, NishidaN, Kubo T, MamesayaN, Ando Y, Okita N, Shibata T, Nakamura K, Yamamoto N. (2024 ) Dabrafenib and trametinib administration in patients with BRAF V600E / R or non-V600 BRAF mutated advanced solid tumours (BELIEVE, NCCH1901): a multicentre, open-label, and single-arm phase II trial. EClinicalMedicine. 69: 102447.

[0513] Sosman, J.A., Kim, K.B., Schuchter, L., Gonzalez, R., Pavlick, A.C., Weber, J.S., McArthur, G.A., Hutson, T.E., Moschos, S.J., Flaherty, K.T., et al. (2012). Survival in BRAF V600-mutant advanced melanoma treated with vemurafenib. N Engl J Med 366, 707-714.

[0514] Stipanuk, M.H., and Ueki, I. (2011). Dealing with methionine / homocysteine sulfur: cysteine metabolism to taurine and inorganic sulfur. J Inherit Metab Dis 34, 17-32.

[0515] Sun, C., Wang, L., Huang, S., Heynen, G.J., Prahallad, A., Robert, C., Haanen, J., Blank, C., Wesseling, J., Willems, S.M., et al. (2014). Reversible and adaptive resistance to BRAF(V600E) inhibition in melanoma. Nature 508, 118-122.

[0516] SunX, NiuX, Chen R, He W, Chen D, Kang R, Tang D. (2016) Metallothionein-IG facilitates sorafenib resistance through inhibition of ferroptosis. Hepatology. 64(2) 488-500.

[0517] Szabo, C. (2007). Hydrogen sulphide and its therapeutic potential. Nat Rev Drug Discov 6, 917-935.

[0518] Szabo, C. (2016). Gasotransmitters in cancer: from pathophysiology to experimental therapy. Nat Rev Drug Discov 75, 185-203.

[0519] Szabo, C., Ransy, C., Modis, K., Andriamihaja, M., Murghes, B., Coletta, C., Olah, G., Yanagi, K., and Bouillaud, F. (2014). Regulation of mitochondrial bioenergetic function by hydrogen sulfide. Part I. Biochemical and physiological mechanisms. Br J Pharmacol 777, 2099-2122. Ubuka, T., Ohta, J., Akagi, R., Hosaki, Y., Ishimoto, Y., Kiguchi, S., Ikeda, T., and Ishino, K. (1992). Metabolism ofL-cysteine via transamination pathway (3-mercaptopyruvate pathway). Amino Acids 3, 243-252.

[0520] Veith, A., and Moorthy, B. (2018). Role of Cytochrome P450s in the Generation and Metabolism of Reactive Oxygen Species. Curr Opin Toxicol 7, 44-51.

[0521] Vitvitsky, V., Kumar, R., Libiad, M., Maebius, A., Landry, A.P., and Banerjee, R. (2021). The mitochondrial NADH pool is involved in hydrogen sulfide signaling and stimulation of aerobic glycolysis. J Biol Chem 296, 100736.

[0522] Wallace, J.L., and Wang, R. (2015). Hydrogen sulfide-based therapeutics: exploiting a unique but ubiquitous gasotransmitter. Nat Rev Drug Discov 14, 329-345.

[0523] Wang, L., Leite de Oliveira, R., Huijberts, S., Bosdriesz, E., Pencheva, N., Brunen, D., Bosma, A., Song, J.Y., Zevenhoven, J., Los-de Vries, G.T., et al. (2018). An Acquired Vulnerability of Drug-Resistant Melanoma with Therapeutic Potential. Cell 173, 1413-1425 el414.

[0524] Wang L, Shi H, Liu Y, Zhang W, Duan X, Li M, Shi X, Wang T. (2019) Cystathionine-y-lyase promotes the metastasis of breast cancer via the VEGF signaling pathway. Int J Oncol. 55(2) 473-487.

[0525] Wang, R.H., Chu, Y.H., and Lin, K.T. (2021). The Hidden Role of Hydrogen Sulfide Metabolism in Cancer. Int J Mol Sci 22.

[0526] Wedmann, R., Onderka, C., Wei, S., Szijarto, I.A., Miljkovic, J.L., Mitrovic, A., Lange, M., Savitsky, S., Yadav, P.K., Torregrossa, R., et al. (2016). Improved tag-switch method reveals that thioredoxin acts as depersulfidase and controls the intracellular levels of protein persulfidation. Chem Sci 7, 3414-3426.

[0527] Wu, Z., Khodade, V.S., Chauvin, J.R., Rodriguez, D., Toscano, J.P., and Pratt, D.A. (2022). Hydropersulfides Inhibit Lipid Peroxidation and Protect Cells from Ferroptosis. J Am Chem Soc 144, 15825-15837.

[0528] Yadav, P.K., Martinov, M., Vitvitsky, V., Seravalli, J., Wedmann, R., Filipovic, M.R., and Banerjee, R. (2016). Biosynthesis and Reactivity of Cysteine Persulfides in Signaling. J Am Chem Soc 138, 289-299.

[0529] Yi, M., Ban, Y., Tan, Y., Xiong, W., Li, G., and Xiang, B. (2019). 6-Phosphofructo-2-kinase / fructose-2,6- biphosphatase 3 and 4: A pair of valves for fine-tuning of glucose metabolism in human cancer. Mol Metab 20, 1-13.

[0530] Yoo, H.C., and Han, J.M. (2022). Amino Acid Metabolism in Cancer Drug Resistance. Cells 11.

[0531] Yushak, M., Chapman, P., Robert, C., & Kudchadkar, R. (2017). Systemic therapy options for patients with unresectable melanoma. American Society of Clinical Oncology Educational Book, 37, 661-672.

[0532] Zhao, K., Ju, Y., Li, S., Altaany, Z., Wang, R., and Yang, G. (2014). S-sulfhydration of MEK1 leads to PARP-1 activation and DNA damage repair. EMBO Rep 75, 792-800.

[0533] Zhu, J., and Thompson, C.B. (2019). Metabolic regulation of cell growth and proliferation. Nat Rev Mol Cell Biol 20, 436-450.

[0534] Zivanovic, J., Kouroussis, E., Kohl, J.B., Adhikari, B., Bursae, B., Schott-Roux, S., Petrovic, D., Miljkovic, J.L., Thomas-Lopez, D., Jung, Y., et al. (2019). Selective Persulfide Detection Reveals Evolutionarily Conserved Antiaging Effects of S-Sulfhydration. Cell Metab 30, 1152-1170 el 113.

Claims

CLAIMS1. A cystathionine-y-lyase (CSE) inhibitor for use in the treatment of a BRAF V600 mutation positive cancer in a patient, in combination with one or more MAPK inhibitor, for use in the prevention or delaying the onset or development of acquired resistance of said patient to a treatment of said cancer with the one or more MAPK inhibitor, wherein the MAPK inhibitor comprises a BRAF V600 mutant inhibitor.

2. The CSE inhibitor for use according to claim 1, wherein the CSE inhibitor is selective for CSE.

3. The CSE inhibitor for use according to any of claims 1 and 2, for use in the prevention of or delaying the development of acquired resistance of said patient to a treatment of said cancer with the one or more MAPK inhibitor, wherein the cancer is a BRAF V600 mutation positive melanoma, and the MAPK inhibitor comprises a BRAF V600 inhibitor, wherein preferably the mutation in the BRAF V600 mutant inhibitor is selected from the group consisting of V600D, V600K, V600R or V600E; more preferably V600K or V600E; more preferably V600E, and wherein preferably the patient is a mammalian patient, preferably a human patient.

4. The CSE inhibitor for use according to claim 3, wherein said MAPK inhibitor comprises a BRAF inhibitor and preferably a MEK inhibitor.

5. The CSE inhibitor for use according to any of claims 1 to 4, for use in the prevention or delaying the onset of acquired resistance of said patient to said tumor, wherein the tumor is a BRAF V600 mutation positive cancer with BRAF V600D, V600K, V600R or V600E mutation.

6. The CSE inhibitor for use according to any of claims 3 to 5, wherein the BRAF inhibitor is selected from vemurafenib, dabrafenib or encorafenib.

7. The CSE inhibitor for use according to any of claims 3 to 6, wherein the MEK inhibitor is selected from trametinib, cobimetinib, binimetinib or selumetinib, more preferably selected from trametinib, cobimetinib or binimetinib, more preferably the MEK inhibitor is trametinib.

8. The CSE inhibitor for use according to any of claims 3 to 7, wherein the MAPK inhibitor comprises a BRAF V600 inhibitor selected from vemurafenib, dabrafenib and encorafenib, and a MEK inhibitor selected from cobimetinib, trametinib, binimetinib, wherein preferably the combination of BRAF inhibitor and MEK inhibitor is dabrafenib + trametinib, vemurafenib + cobimetinib, or encorafenib + binimetinib; more preferably dabrafenib + trametinib.

9. The CSE inhibitor for use according to any of claims 3 to 8, for use in the prevention or delaying the onset of acquired resistance to BRAF V600E and MEK inhibitors in BRAF V600E mutant cancer, wherein the inhibitor is specific to CSE.

10. The CSE inhibitor for use according to claim 9, wherein the CSE inhibitor is selected from propargylglycine (PAG), P-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG), hydroxylamine, 1194496, 1157172, S-3-carboxpropyl-L-cysteine (CPC), NSC4056 (aurintricarboxylic acid), L-aminoethoxyvinylglycine, 2- arylidene-hydrazinecarbodithioates or cystathionine-y-lyase-IN-1 (CAS No. 2165706-30-7), preferably p-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG) and propargylglycine (PAG), more preferably D,L-propargylglycine (2-aminopent-4-ynoic acid or H-DL-Pra-OH) or N-Propargylglycine (2-propyn- l-ylamino)acetic acid), highly preferably propargylglycine (PAG).

11. The CSE inhibitor for use according to any of claims 1 to 10, wherein the development of resistance is delayed by at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more.

12. The CSE inhibitor for use according to any of claims 1 to 11, wherein wherein the CSE inhibitor is administered prior to the administration of the MAPK inhibitor, or wherein the CSE inhibitor is administered concurrendy with the MAPK inhibitor, or wherein the CSE inhibitor is administered after the administration of the MAPK inhibitor, orwherein the CSE inhibitor and the MAPK inhibitor is administered in a sequential, intermittent or continuous therapy.

13. A pharmaceutical kit comprising a cystathionine-y-lyase (CSE) inhibitor and a MAPK inhibitor for use in the treatment of a BRAF V600 mutation positive cancer in a patient, in combination with a (one or more) MAPK inhibitor, preferably for use in the prevention or delaying the onset / development of resistance of said patient to a treatment of said cancer with the MAPK inhibitor, wherein the MAPK inhibitor comprises a BRAF V600 mutant inhibitor.

14. A pharmaceutical composition comprising a cystathionine-y-lyase (CSE) inhibitor and a MAPK inhibitor, and a pharmaceutically acceptable excipient, for use in the treatment of a BRAF V600 mutation positive cancer in a patient.

15. The kit for use according to claim 13 or the pharmaceutical composition for use according to claim 14 wherein said CSE-inhibitor is defined in claim 9 and / or the MAPK inhibitor is defined in claim 6 to 8.

16. The CSE inhibitor for use according to any of claims 1 or 2, the kit according to claim 13 or the pharmaceutical composition according to claim 14 wherein the cancer, preferably a tumor, is selected from the group consisting of melanoma, skin cancer, epithelial cancer, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumor, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilms tumor), histiocytosis, Langerhans cell histiocytosis and Erdheim-Chester disease; preferably melanoma, colorectal cancer, cancer of the colon, cancer of the rectum, lung cancer; particularly melanoma.

Images