Polynucleotide for the stable transfection of an animal cell, kit, host cell and use of the polynucleotide
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- UGA BIOPHARMA GMBH
- Filing Date
- 2024-07-25
- Publication Date
- 2026-06-10
AI Technical Summary
Current polynucleotides for stable transfection of animal cells, such as those using CMV or SV40 promoters, face challenges in achieving high and stable expression of target genes due to susceptibility to silencing effects, particularly DNA methylation, leading to suboptimal transgenic expression.
A polynucleotide design featuring a target gene expression cassette with a ubiquitin C promoter, flanked by two distinct Mar elements that differ by at least 70% in nucleic acid sequence, which includes a selection marker expression cassette, preventing homologous recombination and enhancing gene expression stability.
The polynucleotide achieves very high and stable expression of the target gene product by utilizing a ubiquitin C promoter and distinct Mar elements, preventing silencing and ensuring long-term genetic stability and high productivity in animal cells.
Smart Images

Figure 00000039_0000 
Figure 00000040_0000 
Figure 00000041_0000
Abstract
Description
[0001] Polynucleotide for stable transfection of an animal cell, kit, host cell and use of the polynucleotide
[0002] A polynucleotide is provided for the stable transfection of an animal cell. A cell transfected with the polynucleotide according to the invention
[0003] The host cell exhibits a very high expression of at least one target gene and a very high production of the gene product of the at least one target gene (peptide or protein). Furthermore, the invention provides a kit for transfecting a host cell and a host cell transfected with the polynucleotide according to the invention. The host cell is characterized by a strong production of at least one target gene. Furthermore, the use of the polypeptide according to the invention and the kit according to the invention for transfecting a host cell is proposed. Furthermore, the use of the host cell according to the invention for expressing at least one target gene is proposed. Polynucleotides for the stable transfection of an animal cell are known in the prior art.
[0004] Zhao, C.-P. et al. (Matrix attachment region combinations increase transgene expression in transfected Chinese hamster ovary cells, Scientific Reports, 6:42805, 2016) disclose polynucleotides for the stable transfection of an animal cell (CHO cell) which comprise at least two different MAR elements. The at least two MAR elements (e.g. iMAR and gMAR) in these polynucleotides flank the target gene expression region. Either the CMV promoter or the SV40 promoter was used as the promoter in the target gene expression region. Zhao et al. teach that the expression of the target gene (EGFP) was highest in the case of the SV40 promoter, presumably due to a higher susceptibility to silencing by DNA methylation in the CMV promoter. Although the results in Zhao et al. Although the observed transgene expression with the SV40 promoter was already high, there is still room for improvement regarding the level of transgene expression.
[0005] Based on this, the object of the present invention was to provide a polynucleotide for the stable transfection of an animal cell that enables higher expression of a transgene (target gene). Furthermore, a kit suitable for transfecting an animal cell with the polynucleotide was to be provided. Furthermore, a stably transfected host cell was to be provided, and uses of the polynucleotide, kit, and host cell were to be specified.
[0006] The object is achieved by the polynucleotide having the features of claim 1, the kit having the features of claim 12, the host cell having the features of claim 13 and the use having the features of claims 14 and 15. The dependent claims show advantageous developments.
[0007] According to the invention, a polynucleotide for the stable transfection of an animal cell is provided, comprising or consisting of: a) a target gene expression region which has or consists of at least one target gene expression cassette for the expression of a target gene, wherein the at least one target gene expression cassette has a promoter and a poly-A transcription terminator; b) a selection marker expression cassette for the expression of a selection marker, wherein the selection marker expression cassette is different from the target gene expression region and is arranged in the 5' direction of the target gene expression region or in the 3' direction of the target gene expression region; c) at least one first MAR element; d) at least one second MAR element which is different from the at least one first MAR element;wherein the at least one first MAR element and / or the at least one second MAR element comprises or consists of a nucleic acid sequence that is at least 70% identical to the sequence of SEQ ID NO: 2 (iMAR), characterized in that the at least one first MAR element and the at least one second MAR element flank a region on the polynucleotide that comprises or consists of the target gene expression region and the selection marker expression cassette, and the promoter of the at least one target gene expression cassette is a ubiquitin C promoter.;
[0008] The polynucleotide according to the invention is suitable for the stable transfection of an animal cell and has the advantage that it causes a very high gene expression in the transfected animal cell and thus a strong production of the gene product of the target gene (peptide or protein).
[0009] One reason for the high stability of the polynucleotide in the cell (stability of the transfection) is that the at least one second MAR element differs from the at least one first MAR element, i.e., it has a different nucleic acid sequence (see, for example, Figures 22-24). It is assumed that the difference between the two MAR elements can prevent homologous recombination between the two MAR elements, whereby the transfection is characterized by greater stability. The very high gene expression and thus strong production of the gene product of the target gene is due to the fact that the at least one first MAR element and the at least one second MAR element not (only) flank the target gene expression region, but both the target gene expression region and the selection marker expression cassette, i.e.a region on the polynucleotide that includes or consists of the target gene expression region and the selectable marker expression cassette (see, for example, Figure 5). Another reason for this is that, instead of a CMV promoter or SV40 promoter, a ubiquitin C promoter is present in the at least one target gene expression cassette in the target gene expression region (see, for example, Figures 18-20).
[0010] When reference is made below to a 5' direction, the 5' direction refers to a 5' direction that is determined by the at least one target gene expression cassette in the target gene expression region, i.e. the transcription direction of the at least one target gene expression cassette from 5' to 3' determines the 5' direction for the entire polynucleotide according to the invention. The 5' direction can also be referred to as the upstream direction. The same applies when reference is made below to a 3' direction, i.e. the 3' direction refers to a 3' direction that is determined by the at least one target gene expression cassette in the target gene expression region, i.e. the transcription direction in the at least one target gene expression cassette from 5' to 3' determines the 3' direction for the entire polynucleotide according to the invention. The 3' direction can also be referred to as a downstream direction.downstream direction). Thus, the 5' direction and the 3' direction do not necessarily refer to a transcription direction determined by the selectable marker expression cassette, i.e., the transcription direction of the selectable marker expression cassette may differ from the transcription direction of at least one target gene expression cassette (i.e., run in the opposite direction).
[0011] The difference between the at least one second MAR element and the at least one first MAR element is preferably understood to mean that the at least one second MAR element comprises or consists of a nucleic acid sequence which is at most 80%, preferably at most 70%, particularly preferably at most 60%, in particular at most 50%, optionally at most 45%, identical to the nucleic acid sequence of the at least one first MAR element.
[0012] An identity (or dissimilarity) of a nucleic acid sequence to another nucleic acid sequence (e.g., a specific SEQ ID NO) preferably refers to a determination of an identity (or dissimilarity) determined using the Needleman-Wunsch algorithm. The identity (or dissimilarity) is particularly preferably determined using a sequence alignment program, most preferably the "Global Alignment" sequence alignment program of the National Library of Medicine (USA) (see https: / / blast.ncbi.nlm.nih.gov / ), particularly with the default parameters of this program in July 2023 (i.e., the parameters Match / Mismatch Scores: "2.0-3" and Gap Costs: "Existence: 5, Extension: 2"). The dissimilarity (in percent) can be calculated from the identity (in percent) resulting from the Needleman-Wunsch algorithm using the following formula: Dissimilarity (in %) = 100% - Identity (in %).
[0013] The polynucleotide can be a circular or linear (e.g., linearized) polynucleotide. In a preferred embodiment, the polynucleotide is suitable for integration into the genome of an animal cell (e.g., a CHO cell).
[0014] The target gene expression cassette can contain, between the ubiquitin C promoter and the poly-A transcription terminator, a nucleic acid sequence of a target gene, which preferably encodes a peptide or protein selected from the group consisting of pharmaceutically active peptides and proteins. The pharmaceutically active peptide and / or protein is particularly preferably selected from the group consisting of antibodies, enzymes, hormones, receptors, and combinations thereof, and is in particular the light chain of adalimumab (abbreviated to Adi LC2). The nucleic acid sequence of the target gene can be at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 7 (Adi LC2).The ubiquitin C promoter may comprise or consist of a nucleic acid sequence that is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 1 (ubiquitin C promoter).
[0015] The at least one first MAR element can comprise or consist of a nucleic acid sequence that is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 2 (iMAR). The at least one second MAR element can comprise or consist of a nucleic acid sequence that is i) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 3 (MAR7); or ii) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 4 (sMAR).
[0016] Furthermore, the at least one second MAR element can comprise or consist of a nucleic acid sequence that is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 2 (iMAR). It has been shown that in this case, transgene expression is particularly high (see Figure 13). In this case, the at least one first MAR element can comprise or consist of a nucleic acid sequence that is i) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 3 (MAR7); or ii) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 4 (sMAR).
[0017] The at least one first MAR element can be arranged 3' to the target gene expression region, adjacent to the target gene expression region, and the at least one second MAR element can be arranged 5' to the selectable marker expression cassette, adjacent to the selectable marker expression cassette. In this way, the two MAR elements can flank a region on the polynucleotide that encompasses the target gene expression region and the selectable marker expression cassette.
[0018] In this case, the at least one first MAR element can have a distance from the target gene expression region, preferably from a 3' end of a nucleic acid sequence encoding the poly-A transcription terminator of the target gene expression region, of a maximum of 100 base pairs, preferably a maximum of 50 base pairs, particularly preferably a maximum of 30 base pairs. Furthermore, the at least one second MAR element can have a distance from the selection marker expression cassette, preferably from a 5' start of a promoter of the selection marker expression cassette, of a maximum of 200 base pairs, preferably a maximum of 100 base pairs, particularly preferably a maximum of 50 base pairs.
[0019] Alternatively, the at least one first MAR element can be arranged 5' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region, and the at least one second MAR element can be arranged 3' to the selectable marker expression cassette, adjacent to the selectable marker expression cassette. In this way, the two MAR elements can also flank a region on the polynucleotide that encompasses the target gene expression region and the selectable marker expression cassette.Investigations have shown that in the case of this arrangement of the two MAR elements, higher expression values of at least one target gene can be achieved than in the alternative in which the at least one first MAR element is arranged in the 3' direction of the target gene expression region next to the target gene expression region and the at least one second MAR element is arranged in the 5' direction of the selection marker expression cassette next to the selection marker expression cassette.
[0020] In this case, the at least one first MAR element can have a distance from the target gene expression region, preferably from a 5' start of a nucleic acid sequence encoding the ubiquitin C promoter of the target gene expression region, of a maximum of 10,000 base pairs, preferably a maximum of 1,000 base pairs, particularly preferably a maximum of 100 base pairs, very particularly preferably a maximum of 50 base pairs, in particular a maximum of 30 base pairs. Furthermore, the at least one second MAR element can have a distance from the selection marker expression cassette, preferably from a 3' end of a poly-A transcription terminator of the selection marker expression cassette, of a maximum of 10,000 base pairs, preferably a maximum of 1,000 base pairs, particularly preferably a maximum of 100 base pairs, very particularly preferably a maximum of 50 base pairs, in particular a maximum of 30 base pairs.
[0021] The target gene expression region of the polynucleotide can further comprise at least one further target gene expression cassette for expressing a further target gene. The further target gene expression cassette can comprise a ubiquitin C promoter and a poly-A transcription terminator. Preferably, the further target gene expression cassette contains a further target gene between the ubiquitin C promoter and the poly-A transcription terminator. The further target gene is optionally identical or different from the target gene of the target gene expression cassette. The further target gene can encode a peptide or protein selected from the group consisting of pharmaceutically active peptides and proteins. The pharmaceutically active peptide and / or protein is preferably selected from the group consisting of antibodies, enzymes, hormones, receptors, and combinations thereof, and in particular the heavy chain of adalimumab (abbreviated to Adi HC2).The nucleic acid sequence of the further target gene can be at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 8 (Adi HC2).
[0022] The polynucleotide may further comprise at least one third MAR element. The at least one third MAR element may be identical to or different from the at least one first MAR element and the at least one second MAR element. Preferably, the at least one third MAR element is located within the target gene expression region, preferably between the target gene expression cassette and another target gene expression cassette.
[0023] The at least one third MAR element can have a distance from the target expression cassette, preferably from a 3' end of a nucleic acid sequence encoding the poly-A transcription terminator of this target expression cassette, which is a maximum of 10,000 base pairs, preferably a maximum of 1,000 base pairs, particularly preferably a maximum of 100 base pairs, very particularly preferably a maximum of 50 base pairs, in particular a maximum of 30 base pairs.
[0024] Furthermore, the at least one third MAR element can have a distance from another target expression cassette in the target gene expression region, preferably from a 5' start of a nucleic acid sequence encoding the ubiquitin C promoter of this target expression cassette, which is a maximum of 200 base pairs, preferably a maximum of 100 base pairs, particularly preferably a maximum of 50 base pairs.
[0025] Apart from that, the at least one third MAR element can comprise or consist of a nucleic acid sequence that is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 2 (iMAR), the sequence of SEQ ID NO: 3 (MAR7), or the sequence of SEQ ID NO: 4 (sMAR). In particular, the third MAR element comprises or consists of a nucleic acid sequence that is at most 80%, preferably at most 70%, particularly preferably at most 60%, in particular at most 50%, optionally at most 45%, identical to the nucleic acid sequence of the at least one first MAR element and to the nucleic acid sequence of the at least one second MAR element.
[0026] The polynucleotide may further comprise a bacterial origin of replication, preferably a pUC Ori. The bacterial selection marker is preferably located between the bacterial origin of replication and the at least one first MAR element. Furthermore, the polynucleotide may comprise a bacterial selection marker, preferably an ampicillin selection marker.
[0027] The selection marker expression cassette can contain or consist of an expression cassette of a eukaryotic selection marker, wherein the selection marker is preferably suitable for neutralizing the effect of a eukaryotic antibiotic. In a preferred embodiment, the selection marker expression cassette contains or consists of a dihydrofolate reductase expression cassette. This allows selection with antibiotics whose conversion is catalyzed by the enzyme dihydrofolate reductase. The dihydrofolate reductase expression cassette preferably comprises a nucleic acid sequence that is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to SEQ ID NO: 5 (TK promoter).Furthermore, the dihydrofolate reductase expression cassette preferably comprises a nucleic acid sequence which is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to SEQ ID NO: 6 (DHFR sequence).
[0028] According to the invention, a kit is further provided comprising a) a polynucleotide according to the invention; and b) a transfection agent.
[0029] The kit preferably further contains a selection marker suitable for the selection marker expression cassette of the polynucleotide, preferably methotrexate.
[0030] Furthermore, the invention provides a host cell containing a polynucleotide according to the invention. The host cell is preferably an animal cell, particularly preferably a CHO cell. The host cell can be a dihydrofolate reductase-deficient host cell in which, for example, the dihydrofolate reductase gene has been knocked out in the genome (e.g., a CHO DG44 cell). Furthermore, the use of the polynucleotide according to the invention or the kit according to the invention for transfecting a host cell, preferably an animal host cell, particularly preferably a CHO cell, is proposed. The host cell can be a dihydrofolate reductase-deficient host cell in which, for example, the dihydrofolate reductase gene has been knocked out in the genome (e.g., a CHO DG44 cell).
[0031] Furthermore, the use of the host cell according to the invention for the expression of at least one target gene in the host cell is proposed, particularly preferably for the expression of at least one target gene in a host cell after gene amplification with methotrexate. The host cell is preferably an animal host cell, particularly preferably a CHO cell. The host cell can be a dihydrofolate reductase-deficient host cell in which, for example, the dihydrofolate reductase gene has been knocked out in the genome (e.g., a CHO DG44 cell).
[0032] The following examples and figures are intended to explain the subject matter of the invention in more detail, without wishing to restrict it to the specific embodiments shown here.
[0033] Figure 1 shows schematically the structure of a non-inventive polynucleotide (plasmid pUGA125) which has a target gene expression region with ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and further target gene expression cassette for expression of the Adi HC2 gene) and a selection marker expression cassette (dihydrofolate reductase expression cassette), but has no MAR elements.
[0034] Figure 2 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA341) that contains a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two identical MAR elements (iMAR). The first MAR element (iMAR) is located 5' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region. The second MAR element (iMAR) is located 5' to the selectable marker expression cassette, adjacent to the selectable marker expression cassette.
[0035] Figure 3 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA343) that contains a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two identical MAR elements (iMAR). The first MAR element (iMAR) is located 5' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region. The second MAR element (iMAR) is located 3'-direction of the selectable marker expression cassette, i.e., the two MAR elements flank a region on the polynucleotide that encompasses the target gene expression region and the selectable marker expression cassette.
[0036] Figure 4 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA225) that contains a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and three identical MAR elements (iMAR). The first MAR element (iMAR) is located 5' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region. The second MAR element (iMAR) is located 5' to the selectable marker expression cassette, adjacent to the selectable marker expression cassette. The third MAR element (iMAR) is located within the target gene expression region, here between the target gene expression cassette and the further target gene expression cassette.
[0037] Figure 5 shows the result of a determination of transgene expression using the vectors shown in Figures 1 to 4. It is clear from Figure 5 that the presence of at least two MAR elements increases transgene expression compared to just a single MAR element (see plasmid pUGA125). It is also clear that the vector pUGA343 (see Figure 3) shows the highest transgene expression values, i.e., it is advantageous for transgene expression if the second MAR element is arranged 3'-direction to the selectable marker expression cassette next to the selectable marker expression cassette, i.e., the polynucleotide has two MAR elements flanking a region on the polynucleotide that includes the target gene expression region and the selectable marker expression cassette.
[0038] Figure 6 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA365) that contains a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two identical MAR elements (iMAR). The first MAR element (iMAR) is located 3' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region. The second MAR element is located 5' to the selectable marker expression cassette (iMAR). The selection marker expression cassette also has a different orientation than in the vectors of Figures 1 to 4.
[0039] Figure 7 shows the result of a determination of transgene expression using the vectors shown in Figures 1, 3, and 6. Figure 7 clearly shows that the presence of at least two MAR elements increases transgene expression compared to just a single MAR element (see plasmid pUGA125). It is also clear that pUGA343 shows the highest transgene expression levels, i.e., it is advantageous for transgene expression if the first MAR element is positioned 5' to the selectable marker expression cassette, next to the selectable marker expression cassette, and the second MAR element is positioned 3' to the selectable marker expression cassette, next to the selectable marker expression cassette.Figure 8 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA375) that contains a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two identical MAR elements (MAR7). The first MAR element (MAR7) is located 5' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region. The second MAR element (MAR7) is located 3' to the selectable marker expression cassette, adjacent to the selectable marker expression cassette. The difference to pUGA343 (from Figure 3) is that the two MAR elements are MAR7 elements and not iMAR elements.
[0040] Figure 9 schematically shows the structure of a polynucleotide according to the invention (plasmid pUGA422), which has a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two different MAR elements (MAR7 and iMAR). The first MAR element (MAR7) is arranged 5' to the target gene expression region on the polynucleotide, next to the target gene expression region. The second MAR element (iMAR) is arranged 3' to the selectable marker expression cassette, next to the selectable marker expression cassette. The difference to pUGA343 (from Figure 3) is that the first MAR element is a MAR7 element and not an iMAR element.
[0041] Figure 10 schematically shows the structure of a polynucleotide according to the invention (plasmid pUGA423), which has a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two different MAR elements (iMAR and MAR7). The first MAR element (iMAR) is arranged in the 5' direction of the target gene expression region next to the target gene expression region on the polynucleotide. The second MAR element (MAR7) is arranged in the 3' direction of the selectable marker expression cassette next to the selectable marker expression cassette. The difference to pUGA343 (from Figure 3) is that the second MAR element is a MAR7 element and not an iMAR element.
[0042] Figure 11 schematically shows the structure of a polynucleotide according to the invention (plasmid pUGA428), which has a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two different MAR elements (iMAR and sMAR). The first MAR element (iMAR) is arranged in the 5' direction of the target gene expression region next to the target gene expression region on the polynucleotide. The second MAR element (sMAR) is arranged in the 3' direction of the selectable marker expression cassette next to the selectable marker expression cassette. The difference to pUGA343 (from Figure 3) is that the second MAR element is an sMAR element and not an iMAR element.
[0043] Figure 12 schematically shows the structure of a polynucleotide according to the invention (plasmid pUGA429), which has a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two different MAR elements (sMAR and iMAR). The first MAR element (sMAR) is arranged in the 5' direction of the target gene expression region next to the target gene expression region on the polynucleotide. The second MAR element (iMAR) is arranged in the 3' direction of the selectable marker expression cassette next to the selectable marker expression cassette. The difference to pUGA343 (from Figure 3) is that the first MAR element is an sMAR element and not an iMAR element.Figure 13 shows the result of a determination of transgene expression by the vectors shown in Figures 1, 3, and 9 to 12. Figure 13 clearly shows that the presence of at least two MAR elements increases transgene expression compared to just a single MAR element (see plasmid pUGA125). It also becomes clear that it is advantageous for transgene expression if the polynucleotide has at least one iMAR element (cf. pUGA343, pUGA422, pUGA423, pUGA428, and pUGA429 with pUGA375), although no particularly high increase can be achieved if the polynucleotide has two iMAR elements (cf. pUGA343, pUGA422, pUGA423, pUGA428, and pUGA429 with pUGA343).However, in the case of only one iMAR element on the polynucleotide, it seems to be somewhat advantageous in terms of the strength of transgene expression if said iMAR element is not located in the 5' direction of the target gene expression region next to the target gene expression region on the polynucleotide, but is located in the 3' direction of the selection marker expression cassette next to the selection marker expression cassette (pUGA422 and pUGA429 show slightly higher expression values than pUGA423 and pUGA428).
[0044] Figure 14 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA223) that contains a target gene expression region with a ubiquitin C promoter (first target gene expression cassette for expression of the Adi LC2 gene and a further target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and only a single MAR element (iMAR). The single MAR element (iMAR) is located 5' to the target gene expression region on the polynucleotide, adjacent to the target gene expression region.
[0045] Figure 15 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA487), which contains a target gene expression region with an SV40 promoter (first target gene expression cassette for expression of the Adi LC2 gene and a further target gene expression cassette for expression of the Adi HC2 gene) and a selectable marker expression cassette (dihydrofolate reductase expression cassette), but lacks MAR elements. The difference from pUGA125 (from Figure 1) is that the promoter in the target gene expression region is an SV40 promoter and not a ubiquitin C promoter.
[0046] Figure 16 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA488) that contains a target gene expression region with an SV40 promoter (first target gene expression cassette for expression of the Adi LC2 gene and a further target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and only a single MAR element (iMAR). The single MAR element (iMAR) is located 5' to the target gene expression region on the polynucleotide, next to the target gene expression region. The difference from pUGA223 (from Figure 14) is that the promoter in the target gene expression region is an SV40 promoter and not a ubiquitin C promoter.
[0047] Figure 17 schematically shows the structure of a non-inventive polynucleotide (plasmid pUGA489) that contains a target gene expression region with an SV40 promoter (first target gene expression cassette for expression of the Adi LC2 gene and another target gene expression cassette for expression of the Adi HC2 gene), a selectable marker expression cassette (dihydrofolate reductase expression cassette), and two MAR elements (iMAR and MAR7). The first MAR element (iMAR) is located 5' to the target gene expression region on the polynucleotide, next to the target gene expression region. The second MAR element (MAR7) is located 3' to the selectable marker expression cassette, next to the selectable marker expression cassette. The difference to pUGA423 (from Figure 10) is that the promoter in the target gene expression region is an SV-40 promoter and not a ubiquitin C promoter.
[0048] Figure 18 shows the result of a determination of transgene expression using the vectors shown in Figures 1, 10, and 14 to 17. Figure 18 clearly shows that the improvement in gene expression due to the presence of MAR elements, particularly two MAR elements flanking both the target gene expression region and the selectable marker expression cassette, is significantly more pronounced in the case of the ubiquitin C promoter than in the case of the SV40 promoter. Figure 19 shows the result of a determination of the specific productivity qP per cell and day and the polynucleotide copy number, respectively, as a function of the titer. The determination was carried out using CHO cells transfected with the linearized plasmid pUGA423 according to the invention (see Figure 10).Said polynucleotide has two different MAR elements (iMAR and MAR7) flanking a region on the polynucleotide that includes or consists of the target gene expression region and the selectable marker expression cassette. The target gene expression cassettes each contain a ubiquitin-C promoter. It can be seen from the linear regression in Figure 19 that, in this case (ubiquitin-C promoter), the specific productivity and copy number of the polynucleotide correlate with the titer.
[0049] Figure 20 shows the result of a determination of the amount of polynucleotide per cell per day and the copy number of polynucleotide, respectively, as a function of the titer. The determination was carried out with CHO cells transfected with the non-inventive, linearized plasmid pUGA489 (see Figure 17). Said polynucleotide has two different MAR elements (iMAR and MAR7) flanking a region on the polynucleotide that includes or consists of the target gene expression region and the selectable marker expression cassette, and the target gene expression cassettes each have an SV40 promoter. It is evident from the linear regression in Figure 20 that in this case (SV40 promoter), the specific productivity and the copy number of the polynucleotide do not correlate with the titer.
[0050] Figure 21 shows the result of a determination of transgene expression by the vectors shown in Figures 1 and 12 in the absence of and after gene amplification with methotrexate (MTX). Figure 21 clearly shows that gene amplification in the non-inventive reference vector pUGA125 has no influence on the strength of transgene expression. In contrast, this is different with the vector pUGA429 according to the invention: With this expression vector, the strength of transgene expression can be significantly increased after gene amplification with MTX. Figures 22 to 24 show the result of a determination of the genetic stability of cells transfected with the linearized vectors shown in Figures 1, 3, and 12. With the non-inventive reference vector pUGA125, which does not contain a MAR element, only one of six clones exhibits genetic stability over 90 generations (Figure 22).The same applies to the non-inventive vector pUGA343, which comprises two identical iMAR elements (Figure 23). In contrast, with the inventive vector pUGA429, whose first MAR element is an sMAR element, 5 out of 6 clones exhibit genetic stability, i.e., 5 out of 6 clones are genetically stable (Figure 24) over 90 generations. This result indicates that, with regard to genetic stability, it is advantageous if the nucleic acid sequences of the at least one first MAR element and the at least one second MAR element differ (here: only 44% identity, i.e., 56% diversity). It is assumed that the observed high genetic stability is due to the fact that the difference between the two MAR elements can prevent homologous recombination between the two MAR elements.
[0051] Example 1 - Preparation of the polynucleotides
[0052] The polynucleotides (expression plasmids) were generated using molecular biological methods. The cloning of the various expression vectors was performed by inserting the genetic elements into existing expression vectors. The plasmids and their components were cleaved with specific restriction enzymes to open the vector for the insertion of additional DNA elements. The plasmids were ligated either using classical T4 ligase or by seamless cloning of linear DNA fragments derived from gene synthesis or generated by PCR. Specific primers were designed for sequencing. All generated plasmids were verified by sequencing.
[0053] Example 2 - Cultivation of Animal Cells. In general, the CHO-DG44 cell line was cultivated at 37°C in a humidified incubator with 8% CO2. The host cell line (HCL) was cultured in First CHOice® medium supplemented with 6 mM L-glutamine, 1 mM HT solution, and 6 ml / L of Supplement S5.
[0054] For transfected cell lines, a medium without HT solution was used. All cell lines were handled under aseptic conditions in a laminar flow hood. The cells were seeded at a density of 2-3 x 10 5 Cells / ml passaged every two to three days.
[0055] After transfection, the cells were cultured in mini- or maxi-pools. Mini-pools were generated in 96-well plates with a seeding density of 20,000 cells / well and a volume of 200 μl. The pools were incubated for 14 days without shaking, and the medium was replaced.
[0056] 6-well plates were used to create maxi-pools. After transfection, 1 x 10 6 Cells were added to the well in 4 ml and incubated for 14 days without shaking. After 14 days, cell VCD and VIA were determined, and the cells were cultured at the usual two- to three-day interval with shaking in an orbital shaker at 120 rpm.
[0057] To generate high-density cell lines with high antibody yields, a 14-day fed-batch culture was performed. 3 x 10 5Cells in 4 ml volumes were seeded into a 6-well plate and cultured in an incubator on an orbital shaker at 120 rpm. The cell lines were fed daily with First CHOice® Feed Alpha and First CHOice® Feed Beta. Glucose concentration was monitored by mixing 10 μl of the sample with 1 ml of glucose / lactate hemolysin solution. Glucose and lactate concentrations were analyzed using Biosen C-Iine, and glucose was added to the cells according to the measured values.
[0058] Example 3 - Preparation for transfection and implementation of transfection
[0059] For transfection into animal cells (CHO cells), the circular plasmids were first linearized. Linearization was performed either with the restriction enzyme Smil or with NotI / Pvul or AasI / Pvul. All constructs within the respective transfection experiments were cleaved with the same restriction enzyme combination to avoid any bias.
[0060] The host cell line CHO DG44 was stably transfected by electroporation with a linearized polynucleotide shown in the figures (see plasmid maps in Figures 1 to 4, 6, 8 to 12, and 14 to 17). 1 x 10 6 Cells were used, with only host cell lines with a viability of more than 90% being used for transfection. Transfection was performed using the Cell Line Nucleofector™ Kit V or the 96-Well Nucleofector™ Kit. Electroporation was performed in the Nucleofector™ 2b device. In the case of the 96-Well Nucleofector™ Kit, the 96-Well Shuttle™ device was used for electroporation. The transfected cells were immediately transferred to prewarmed First CHOice® medium supplemented with 6 mM L-glutamine. The cells were then seeded onto 96-well plates or 6-well plates for further experiments.
[0061] A total of three transfections were performed per linearized plasmid. From each transfection, 40 minipools of 20,000 cells per well were deposited into 96-well plates, resulting in a total of 120 minipools per plasmid.
[0062] After 14 days of static incubation in a cell culture incubator, the medium was replaced with fresh medium (First CHOice®) containing 6 mM L-glutamine
[0063] Example 4 - Determination of target gene expression
[0064] The productivity of all pools with respect to their target gene expression was analyzed by ELISA from cell-free supernatants 5 days after medium exchange.
[0065] The ELISA was designed as a sandwich ELISA and used a goat anti-human IgG (F(ab')2) as the capture antibody and a peroxidase-coupled goat anti-human IgG and Fcy fragment-specific detection antibody. The capture antibody was diluted to a final concentration of 0.5 pg / ml in 50 mM carbonate-bicarbonate buffer and immobilized on the microtiter plates for 4 to 5 hours at 4°C. The plates were then washed, blocked with 300 pL of blocking buffer per well, and stored at 4°C until further use. Each analyzed plate contained a standard curve covering a concentration range of 0 to 200 ng / ml of original product. The samples were diluted 1:200 to 1:2000. Both samples and standards were loaded onto blocked plates and incubated for 1 hour at room temperature. The plates were then washed three times and incubated for 60 minutes after addition of the detection antibodies.Before detection, the plates were washed three times, and 100 pL of TMB substrate, mixed according to the manufacturer's instructions, was added to the wells. The reaction lasted 2 to 10 minutes and was stopped by adding 100 pL of stop solution once a sufficient color change was achieved. Absorbance at 450 nm was recorded using a multiwell reader, and concentrations were calculated using Skanlt software (Thermo Scientific) using 4-parameter logistic regression (4PL). Final graphs and statistics were generated using GraphPad Prism. Significant positive differences were analyzed by a one-way ANOVA approach using Dunnett's multiple comparison test. Family-wise significance and confidence intervals are indicated by * = p < 0.1; ** = p < 0.05; *** = p < 0.01; and **** = p < 0.001.
[0066] The results are shown in Figures 5, 7, 13 and 18.
[0067] Example 5 - Determination of the copy number of transgenic polynucleotide in transfected cells
[0068] Starting from an intermediate cell bank, a determination of the copy number of polynucleotide in transfected cells (clones) was carried out.
[0069] The clones were transfected with either the linearized plasmid pUGA423 or the linearized plasmid pUGA489 (see plasmid maps in Figures 10 and 17).
[0070] To determine copy number, a qPCR method was used, using the relative quantification of amplicons on the chromosome and the integrated transgenes. Generally, the genomic DNA of each sample was prepared using the NucleoSpin DNA RapidLyse Kit from Macherey Nagel. qPCR was performed in duplicate with 5 ng of extracted genomic DNA in a real-time PCR system (C1000 touch CFX96, Biorad) using iTaq™ Universal SYBR®Green Supermix (Biorad). Reference amplicons were generated with specific primers against the chromosomal genes actin, GAPDH, and HPRT1. Isolated genomic DNA from transfected cells was used for standard curve preparation and primer efficiency analysis. For this purpose, five serial dilutions ranging from 50 pg to 50 ng were prepared.
[0071] Copy number was determined per cell based on the Bio-Rad CFX Manager software algorithm as the ratio between the mean of the three reference genes and the transgene copy numbers, assuming a diploid set of chromosomes.
[0072] The results are shown in Figures 19 and 20. It was shown that the copy number of the transgenic polynucleotide correlates with the titer only in the case of the ubiquitin C promoter, but not in the case of the SV40 promoter.
[0073] Example 6 - Determination of target gene expression in the presence of selection markers
[0074] The host cell line CHO DG44 was transfected with a linearized polynucleotide. Cells from this host cell line were transfected with the linearized plasmids pUGA125 and pUGA429, respectively (see plasmid maps in Figures 1 and 12).
[0075] A total of 24 transfection reactions were performed, 12 with linearized pUGA125 and 12 with pUGA429.
[0076] Each transfected pool was initially cultured under static conditions in a 24-well plate until day 12. Subsequently, the transfected pools were transferred to a 6-well plate and cultured under shaking conditions. All 24 bulk pools recovered from the selection phase within 22 days post-transfection. A second round of selection was performed for all 24 bulk pools by treating all pools with 10–20 nM of the selectable marker methotrexate (MTX). This resulted in the formation of 24 additional bulk pools, which recovered within 35 days of the start of MTX treatment.
[0077] A bulk pool productivity assay was then performed in 6-well plates. Cells were cultured in First CHOice® medium supplemented with 1x HT supplement, 0.1x anti-clumping supplement, and 6 mM L-glutamine. The feeding regimen was as follows: Starting on day 3, daily feeding was performed with 1.0% First CHOice® Feed a and 0.10% First CHOice® Feed ß (of the initial culture volume). Starting on day 4, glucose was administered daily as needed up to a target value of 6 g / L.
[0078] The protein concentration (target protein) was determined by protein A affinity chromatography on days 7, 10, 12, and 14. For this purpose, an HPLC instrument with a MAbPac Protein A column and buffers A and B was used. For calibration purposes, the original preparation was diluted in a range of 2 to 300 pg / ml. Target molecules were detected by fluorescence by excitation at 295 nm and emission at 343 nm.
[0079] Buffer A: 50 mM NaH2PO4 / Na2HPO4 + 250 mM NaCl + 5% ACN, pH 6.8
[0080] Buffer B: 50 mM NaH2PO4 + 250 mM NaCl + 5% ACN pH 2.5
[0081] Figure 21 shows the measured final protein concentration in the supernatant over the 14 days of fed-batch cultivation and illustrates the sensitivity of the cells generated with a polynucleotide according to the invention to gene amplification by methotrexate.
[0082] Example 7 - Determination of the genetic stability of the transfected cells
[0083] Starting from an intermediate cell bank, an expression stability study was performed with clones. Six clones each were transfected with the linearized plasmid pUGA125, six clones each were transfected with the linearized plasmid pUGA343, and six clones each were transfected with the linearized plasmid pUGA429 (see plasmid maps in Figures 1, 3, and 12).
[0084] After thawing and cell recovery, the clones were cultured for 14 weeks and at least up to 90 generations without the addition of HT in a split cycle of 3 to 4 days. Furthermore, cells from starting week 1 were cryopreserved after 35 generations, 70 generations, and 90 generations. The productivity of the cells from the frozen time points was then compared in a fed-batch culture.
[0085] The fed-batch culture was inoculated after single passage of the cell banks and achieved a viability of > 93%. The cells were cultured in First CHOice® medium supplemented with 1x HT supplement, 0.1x anti-clumping supplement, and 6 mM L-glutamine.
[0086] The feeding regimen was as follows: Starting on day 3, daily feeding was performed with 1.5% First CHOice® Feed a and 0.15% First CHOice® Feed ß (of the initial culture volume). Starting on day 4, glucose was administered daily as needed up to a target value of 6 g / L.
[0087] For each culture, cell-free supernatants were collected on the 7th, 10th, and last day of culture for titer analysis by protein A HPLC.
[0088] The specific productivity qP of each clone during the fed-batch was used to calculate productivity differences between cells from the first and every other week sampled during the stability study. Therefore, the values were normalized to week 1 and expressed as a percentage of week 1 productivity. Clones were considered stable if they maintained a specific productivity of 100% ± 30% of their initial productivity after 14 weeks of culture.
[0089] Figures 22 to 24 show the results of this study. It is evident from the figures that the polynucleotide according to the invention, whose two MAR elements are different (pUGA429), exhibits higher genetic stability than a non-inventive polynucleotide that does not have any MAR element (pUGA125) or that has two identical MAR elements (pUGA343).
[0090] List of sequences
[0091] SEO ID NO: 1 (Ubiquitin C promoter)
[0092] GGCCTCCGCGCCGGGTTTTGGCGCCTCCCGCGCGCGCCCCCCTCCTCACGGCGAGC GCTGCCACGTCAGACGAAGGGCGCAGGAGCGTCCTGATCCTTCCGCCCGGACGCTC AGGACAGCGGCCCGCTGCTCATAAGACTCGGCCTTAGAACCCCAGTATCAGCAGAA GGACATTTTAGGACGGGACTTGGGTGACTCTAGGGCACTGGTTTTCTTTCCAGAGA GCGGAACAGGCGAGGAAAAGTAGTCCCTTCTCGGCGATTCTGCGGAGGGATCTCC GTGGGGCGGTGAACGCCGATGATTATATAAGGACGCGCCGGGTGTGGCACAGCTA GTTCCGTCG CAG CCG GG ATTTGG GTCG CG GTTCTTGTTTGTG G ATCG CTGTG ATCGT CACTTGGTGAGTAGCGGGCTGCTGGGCTGGCCGGGGCTTTCGTGGCCGCCGGGCC GCTCGGTGGGACGGAAGCGTGTGGAGAGACCGCCAAGGCTGTAGTCTGGGTCCGC GAGCAAGGTTGCCCTGAACTGGGGGTTGGGGGGAGCGCAGCAAAATGGCGGCTGT TCCCGAGTCTTGAATGGAAGACGCTTGTGAGGCGGGCTGTGAGGTCGTTGAAACAA GGTGGGGGGCATGGTGGGCGGCAAGAACCCAAGGTCTTGAGGCCTTCGCTAATGC GGGAAAGCTCTTATTCGGGTGAGATGGGCTGGGGCACCATCTGGGGACCCTGACG TGAAGTTTGTCACTGACTGGAGAACTCGGTTTGTCGTCTGTTGCGGGGGCGGCAGT TATGCGGTGCCGTTGGGCAGTGCACCCGTACCTTTGGGAGCGCGCGCCCTCGTCGT GTCGTGACGTCACCCGTTCTGTTGGCTTATAATGCAGGGTGGGGCCACCTGCCGGT AGGTGTGCGGTAGGCTTTTCTCCGTCGCAGGACGCAGGGTTCGGGCCTAGGGTAG
[0093] GCTCTCCTGAATCGACAGGCGCCGGACCTCTGGTGAGGGGAGGGATAAGTGAGGC GTCAGTTTCTTTGGTCGGTTTTATGTACCTATCTTCTTAAGTAGCTGAAGCTCCGGTT TTGAACTATGCGCTCGGGGTTGGCGAGTGTGTTTTGTGAAGTTTTTTAGGCACCTTT TGAAATGTAATCATTTGGGTCAATATGTAATTTTCAGTGTTAGACTAGTAAATTGTCC GCTAAATTCTGGCCGTTTTTGGCTTTTTTGTTAGACAATCC
[0094] SE ID NO: 2 (iMAR)
[0095] GAATTCAGCAAGGTCGCCACGCACAAGATCAATATTAACAATCAGTCATCTCTCTTT
[0096] AGCAATAAAAAGGTGAAAAATTACATTTTAAAAATGACACCATAGACGATGTATGA AAATAATCTACTTGGAAATAAATCTAGGCAAAGAAGTGCAAGACTGTTACCCAGAA
[0097] AACTTACAAATTGTAAATGAGAGGTTAGTGAAGATTTAAATGAATGAAGATCTAAAT
[0098] AAACTTATAAATTGTGAGAGAAATTAATGAATGTCTAAGTTAATGCAGAAACGGAG
[0099] AGACATACTATATTCATGAACTAAAAGACTTAATATTGTGAAGGTATACTTTCTTTTC
[0100] ACATAAATTTGTAGTCAATATGTTCACCCCAAAAAAGCTGTTTGTTAACTTGTCAACC
[0101] TCATTTCAAAATGTATATAGAAAGCCCAAAGACAATAACAAAAATATTCTTGTAGAA
[0102] CAAAATGGGAAAGAATGTTCCACTAAATATCAAGATTTAGAGCAAAGCATGAGATG
[0103] TGTGGGGATAGACAGTGAGGCTGATAAAATAGAGTAGAGCTCAGAAACAGACCCA
[0104] TTGATATATGTAAGTGACCTATGAAAAAAATATGGCATTTTACAATGGGAAAATGAT
[0105] GATCTTTTTCTTTTTTTAGAAAAACAGGGAAATATATTTATATGTAAAAAATAAAGG
[0106] GAACCCATATGTCATACCATACACACAAAAAAAATTCCAGTGAATTATAAGTCTAAAT
[0107] GGAGAAGGCAAAACTTTAAATCTTTTAGAAAATAATATAGAAGCATGCCATCATGAC
[0108] TTCAGTGTAGAGAAAAATTTCTTATGACTCAAAGTCCTAACCACAAAGAAAAGATTG
[0109] TTAATTAGATTGCATGAATATTAAGACTTATTTTTAAAATTAAAAAACCATTAAGAAA
[0110] AGTCAGGCCATAGAATGACAGAAAATATTTGCAACACCCCAGTAAAGAGAATTGTA
[0111] ATATGCAGATTATAAAAGAAGTCTTACAAATCAGTAAAAAATAAAACTAGACAAA
[0112] AATTTGAACAGATGAAAGAGAAACTCTAAATAATCATTACACATGAGAAACTCAATC
[0113] TCAGAAATCAGAGAACTATCATTGCATATACACTAAATTAGAGAAATATTAAAAGGC
[0114] TAAGTAACATCTGTGGCAATATTGATGGTATATAACCTTGATATGATGTGATGAGAA
[0115] CAGTACTTTACCCCATGGGCTTCCTCCCCAAACCCTTACCCCAGTATAAATCATGACA
[0116] AATATACTTTAAAAACCATTACCCTATATCTAACCAGTACTCCTCAAAACTGTCAAGG
[0117] TCATCAAAATAAGAAAAGTCTGAGGAACTGTCAAAACTAAGAGGAACCCAAGGA
[0118] GACATGAGAATTATATGTAATGTGGCATTCTGAATGAGATCCCGAACAGAAAAAG
[0119] AACAGTAGCTAAAAAACTAATGAAAATAAATAAAGTTTGAACTTTTAGTTTTTTTAA
[0120] AAAAGAGTAGCATTAACACGGCAAAGTCATTTTCATATTTTTCTTGAACATTAAGTAC
[0121] AAGTCTATAATTAAAAATTTTTTTAATGTAGTCTGGAACATTGCGAAAACAGAAGT
[0122] ACAGCAGCTATCTGTGCTGTCGCCTAACTATCCATAGCTGATTGGTCTAAAATGAGA
[0123] TACATCAACGCTCCTCCATGTTTTTTTGTTTCTTTTTAAATGAAAAAACTTTATTTTTTAA
[0124] GAGGAGTTTCAGGTTCATAGCAAAATTGAGAGGGAAGGTACATTCAAGCTGAGGAA
[0125] GTTTTCCTCTATTCCTAGTTTTACTGAGAGATTGCATCATGAATGGGTGTTAAATTTTG
[0126] TCAAATGCTTTTTCTGTGTCTATCAATATGACCATGTGATTTTCTTCTTTAACCTGTTG
[0127] ATGGGACAAATTACGTTAATTGATTTTCAAACGTTGAACCACCCTTACATATCTGGAA
[0128] TAAATTCTACTTGGTTGTGGTGTATATTTTTTGATACATTCTTGGATTCTTTTTGCTAA
[0129] TATTTTGTTGAAAATGTTTGTATCTTTGTTCATGAGAGATATTGGTCTGTTGTTTTCTT
[0130] TTCTTGTAATGTCATTTTCTAGTTCCGGTATTAAGGTAATGCTGGCCTAGTTGAATGA TTTAGGAAGTATTCCCTCTGCTTCTGTCTTCTGAAAGAGATTGTAGAAAGTTGATACA
[0131] ATTTTTTTTTCTTTAAATATCTTGATAG
[0132] SEO ID NO: 3 (MAR7)
[0133] ATTTCAGAAAATAAAATTCACATTCATTATGATATCTCATTAGTGAAAATTTCCATTAG
[0134] GGGATTGTAAATAATTTAAAGCTTTTTTTTTTTCAGTGCTATTTAATTATTTCAATATC
[0135] CTCTCATCAAATGTATTTAAATAACAAAAGCTCAACCAAAAAGAAAGAAATATGTAA
[0136] TTCTTTCAGAGTAAATTCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCA
[0137] CTTTGAATTTGGCATTAAATACCATTAAGGTATATTAACTGATTTTAAAATAAGATAT
[0138] ATTCGTGACCATGTTTTTAACTTTCAAAAATGTAGCTGCCAGTGTGTGATTTTATTTC
[0139] AGTTGTACAAAATATCTAAACCTATAGCAATGTGATTAATAAAAACTTAAACATATTT
[0140] TCCAGTACCTTAATTCTGTGATAGGAAAATTTTAATCTGAGTATTTTAATTTCATAATC
[0141] TCTAAAATAGTTTAATGATTTGTCATTGTGTTGCTGTCGTTTACCCCAGCTGATCTCA
[0142] AAAGTGATATTTAAGGAGATTATTTTGGTCTGCAACAACTTGATAGGACTATTTTAG
[0143] GGCCTTTTAAAGCTCTATTAAAACTAACTTACAACGATTCAAAACTGTTTTAAACTA
[0144] TTTCAAAATGATTTTAGAGCCTTTTGAAAACTCTTTTAAACACTTTTTAAACTCTATTA
[0145] AAACTAATAAGATAACTTGAAATAATTTTCATGTCAAATACATTAACTGTTTAATGTT
[0146] TAAATGCCAGATGAAAAATGTAAAGCTATCAAGAATTCACCACCCAGATAGGAGTATCTT
[0147] CATAGCATGTTTTTCCCTGCTTATTTTCCAGGTGATCACATTATTTTGCTACCATGGTTA
[0148] TTTTATACAATTATCTGAAAAAAATTAGTTATGAAGATTAAAAGAGAAGAAAATATT
[0149] AAACATAAGAGATTCAGTCTTTCATGTTGAACTGCTTGGTTAACAGTGAAGTTAGTT
[0150] TTAAAAAAAAAAAAAAC
[0151] SE ID NO: 4 (sMAR)
[0152] GAATTCCTTGTGATTTAGCTTTTAAGTCGTGACCTTATAAATAGTATATGAAATATTT
[0153] TATGTTGTCGATGTATATATTCGTCAAACTCTTGGAAAAAGGTGCATATTTACTCATG
[0154] TAGTAATGACATGACTTAATTGTATCATCTGGGTGTATTTTGGGGCTATATTTATACGC
[0155] TTGTTGTTAGCAAACCGTCTCGTATTTGTCCTTGATGTTAATTTGAGCTCTTAGTTTAG
[0156] ATTGAGAGGATTTCAGGTGTCAGAATACTTAAGTAAAAAAAGTTCAAATTTACCTTAG
[0157] CAACTTTGACTATGGTTTAACCAATTAATTACCTGCTAGTCTAATATACTTCAGATTG
[0158] GAGCTATGTTAGGGTCAAGGGCTAATATAAGACAATATGTTAACACAAGGATATGA
[0159] ATATCTGCTAAGTATAGCGGAAGATAAAATTAAGATAATTGGTATAGAGAGAGAGA
[0160] GAGAGAGAGAGTAGAGGTGCTTTTAATCCTTGTTCTCTCAACTCTTTGATGAAAGCA
[0161] GCTCGGTATACCAAGCATCCCATATTAGTAGGATACGAGAAAGGGCCACAGCCTAA GAGATGTGATGTAGACAATCTAATGCAAATTATGTCTATATATTTGAAAAAA CCAGAGATAAAATATTGTAATGCAAAATTAATACTACCTGCTGATTATGAAGTGGGC TTTGTTACTAGGAATTAATGGAAGCATGGCCTTGAGAGATGGGCGTTGATGCCTCAG GCAG G AAG CCCAAG GTTTGTTCTG CTTCTACCTTTG AT AT AT AT AT A AT A AT A ATT ATC A TTAATTAGTAATATAATTCAAATATTTTTTCAAATAAAAGGAATGTAGTAT ATAGCAATTGCTTTTCTGTAGTTTATAAGTGTGTATATTTTAATTTATAACTTTTCTAA TATATGACCAAAACATGGTGATGTTAGTGGAAAGGGTGTTACCAATATGTTGACA AATATGGAGCTAATGTTGATGGATACAGGTTGTTAAAAAACTTCTAATTTGTTTAAT GTAATGCTTCACTAATAGAAAAATGAAACAAATAATCTAATACTTTGTGTATTTTGA AAATGCAGTCCCATCTACAACACAGATGAGTGGTCTCCAAGTGGTGATGTCTATGTT GGAGGTATGACAATTTACTCGAACTTCCTTTTTTAACTCGAACTATGTATATACACAA CAACGTTAATAATTAAGTCGTACTCATTTTGAATCTACTGACTCTAGATCCTGATTCA CACATGTAATATAATTGCAGGTACTACTGGCTTAGCCATATGGGCCGTGACCTTGGT
[0162] TGGTATTCTTGCAGGAGGTGCTCTCCTTGTCTACAACACAAGTGCTTTGGCACAGTA GATGTTATCCTGTGTTGTACTATTTTAAGTTGTATTCGAGCTC
[0163] SEO ID NO: 5 (TK-Promoter)
[0164] CCCGTGGCCCGTTGCTCGCGTTTGCTGGCGGTGTCCCCGGAAGAAATATATTTGCAT GTCTTTAGTTCTATG ATG ACAC AAACCCCG CCCAG CGTCTTGTCATTG GCG AATCCG AACACGCAGATGCAGTCGGGGCGGCGGTCCCAGGTCCTAAGGTTCGCAT GACGCGCGTGTGGCCTCGAACACCGAGCGACCCTGCACCGACCCGCTTAACAGCGT CAACAG CGTG CCG CAG ATC
[0165] SE ID: 6 (DHFR)
[0166] ATGGTTCGACCATTGACTGCATCGTCGCGTGTCCCAAAATGGGGATTGGCAA GAACGGAGACCTACCCTGGCCTCCGCTCAGGAGTTCAATACTTCCAAAGAAT GACCACAACCTCTTCAGTGGAAGGGAAACAATCTGGTGATTATGGGTAGGAAAA CCTGGTTCTCCATTCCTGAGAAGAATCGACCCTTAAGGACAGAATCATATAGTTC TCAGTAGAGAACTCAAAACCACCACGAGGCGCTCATTTTCTTGCCAAAGTTTG ATGATGCTTTAGAGACTTATTGACAACCGGATTGGCAAGTAAGCCTAAGCTG AGTTGTAGGTTT G CC ATG AATC AACC AGG CC ACCTC AGACTCTTTGTGACAAGCTGATCATGCAGGAATTTGAAAGTGACACGTTTTTCCCAGAA ATTGATTTGGGGAAATATAACTTCTCCCAGAATCCAG SEOGGCTCCTCTCTGAGGTC (LC2)
[0167] ATGGAAACCGACACCCTGCTGCTGTGGGTGCTGCTGCTGTGGGTGCCAGGCTCTAC
[0168] CGGCGACATCCAGATGACCCAGTCCCCCAGCTCCCTGTCTGCCTCTGTGGGCGACAG
[0169] AGTGACCATCACCTGTCGGGCCTCCCAGGGCATCAGAAACTACCTGGCCTGGTATCA
[0170] GCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACGCTGCCTCCACACTGCAGT
[0171] CCG GCGTGCCCTCTAG ATTCTCCG GCTCTG G CTCTG G CACCG ACTTTACCCTG ACC AT
[0172] CTCCAGCCTGCAGCCCGAGGATGTGGCCACCTACTACTGCCAGCGGTACAACAGAG
[0173] CCCCCTACACCTTTGGCCAGGGCACCAAGGTGGAAATCAAGCGGACCGTGGCCGCT
[0174] CCCTCCGTGTTCATCTTCCCACCTTCCGACGAGCAGCTGAAGTCCGGCACCGCTTCTG
[0175] TCGTGTGCCTGCTGAACAACTTCTACCCCCGCGAGGCCAAGGTGCAGTGGAAGGTG
[0176] GACAACGCCCTGCAGAGCGGCAACTCCCAGGAATCCGTGACCGAGCAGGACTCCAA
[0177] GGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAA
[0178] GCACAAGGTGTACGCCTGCGAAGTGACCCACCAGGGCCTGTCTAGCCCCGTGACCA
[0179] AGTCTTTCAACCGGGGCGAGTGCTGATAA
[0180] SE ID NO: 8 (Adi HC2)
[0181] ATGGAAACCGACACCCTGCTGCTGTGGGTGCTGCTGCTGTGGGTGCCAGGATCTAC
[0182] AGGCGAGGTGCAGCTGGTGGAATCTGGCGGAGGACTGGTGCAGCCTGGCAGATCC
[0183] CTGAGACTGTCTTGTGCCGCCTCCGGCTTCACCTTCGACGACTACGCTATGCACTGG
[0184] GTGCGACAGGCCCCTGGCAAGGGACTGGAATGGGTGTCCGCCATCACCTGGAACTC
[0185] CGGCCACATCGACTACGCCGACTCTGTGGAAGGCCGGTTCACCATCTCTCGGGACA
[0186] ACGCCAAGAACTCCCTGTACCTGCAGATGAACAGCCTGCGGGCCGAGGACACCGCC
[0187] GTGTACTACTGTGCCAAGGTGTCCTACCTGTCCACCGCCTCCTCCCTGGATTATTGGG
[0188] GCCAGGGCACCCTCGTGACCGTGTCCTCTGCTTCTACCAAGGGCCCCTCCGTGTTCC
[0189] CTCTGGCCCCTTCCAGCAAGTCTACCTCTGGCGGCACAGCCGCTCTGGGCTGCCTCG
[0190] TGAAGGACTACTTCCCCGAGCCCGTGACAGTGTCTTGGAACTCTGGCGCCCTGACCT
[0191] CCGGCGTGCACACCTTTCCAGCTGTGCTGCAGTCCAGCGGCCTGTACTCCCTGTCCT
[0192] CCGTCGTGACTGTGCCCTCCAGCTCTCTGGGCACCCAGACCTACATCTGCAACGTGA
[0193] ACCACAAGCCCTCCAACACCAAGGTGGACAAGAAGGTGGAACCCAAGTCCTGCGAC
[0194] AAGACCCACACCTGTCCCCCTTGTCCTGCCCCTGAACTGCTGGGCGGACCCAGCGTG
[0195] TTCCTGTTCCCCCCAAAGCCCAAGGACACCCTGATGATCTCCCGGACCCCCGAAGTG
[0196] ACCTGCGTGGTGGTGGATGTGTCCCACGAGGACCCTGAAGTGAAGTTCAATTGGTA
[0197] CGTGGACGGCGTGGAAGTGCACAATGCCAAGACCAAGCCTAGAGAGGAACAGTAC AACTCCACCTACCGGGTGGTGTCCGTGCTGACCGTGCTGCATCAGGACTGGCTGAA
[0198] CGGCAAAGAGTACAAGTGCAAAGTGTCCAACAAGGCCCTGCCTGCCCCCATCGAAA
[0199] AGACCATCTCCAAGGCCAAGGGCCAGCCCCGGGAACCCCAGGTGTACACACTGCCC
[0200] CCTAGCAGGGACGAGCTGACCAAGAACCAGGTGTCCCTGACATGCCTCGTGAAAGG CTTCTACCCCTCCGATATCGCCGTGGAATGGGAGAGCAACGGCCAGCCCGAGAACA
[0201] ACTACAAGACCACCCCCCCTGTGCTGGACTCCGACGGCTCATTCTTCCTGTACAGCA
[0202] AGCTGACAGTGGACAAGTCCCGGTGGCAGCAGGGCAACGTGTTCTCCTGCTCCGTG
[0203] ATGCACGAGGCCCTGCACAACCACTACACCCAGAAGTCCCTGTCCCTGAGCCCCGGC AAGTGATAA
Claims
Patent claims 1. A polynucleotide for the stable transfection of an animal cell, comprising or consisting of: a) a target gene expression region which has or consists of at least one target gene expression cassette for expressing a target gene, wherein the at least one target gene expression cassette has a promoter and a poly-A transcription terminator; b) a selection marker expression cassette for expressing a selection marker, wherein the selection marker expression cassette is different from the target gene expression region and is arranged in the 5' direction of the target gene expression region or in the 3' direction of the target gene expression region; c) at least one first MAR element; d) at least one second MAR element which is different from the at least one first MAR element;wherein the at least one first MAR element and / or the at least one second MAR element comprises or consists of a nucleic acid sequence that is at least 70% identical to the sequence of SEQ ID NO: 2, characterized in that the at least one first MAR element and the at least one second MAR element flank a region on the polynucleotide that comprises or consists of the target gene expression region and the selection marker expression cassette, and the promoter of the at least one target gene expression cassette is a ubiquitin C promoter.; 2. Polynucleotide according to the preceding claim, characterized in that the target gene expression cassette contains a nucleic acid sequence of a target gene between the ubiquitin C promoter and the poly-A transcription terminator, wherein the target gene preferably encodes a peptide or protein selected from the group consisting of pharmaceutically active peptides and proteins, wherein the pharmaceutically active peptide and / or protein is particularly preferably selected from the group consisting of antibodies, enzymes, hormones, receptors and combinations thereof, and in particular is the light chain of adalimumab.
3. Polynucleotide according to one of the preceding claims, characterized in that the ubiquitin C promoter comprises or consists of a nucleic acid sequence which is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO:
1.
4. Polynucleotide according to one of the preceding claims, characterized in that the at least one first MAR element comprises or consists of a nucleic acid sequence which is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 2 and preferably the at least one second MAR element comprises or consists of a nucleic acid sequence which is i) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 3; or ii) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO:
4.
5. Polynucleotide according to one of the preceding claims, characterized in that the at least one second MAR element comprises a comprises or consists of a nucleic acid sequence which is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 2 and preferably the at least one first MAR element comprises or consists of a nucleic acid sequence which is i) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 3; or ii) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO:
4.
6. Polynucleotide according to one of the preceding claims, characterized in that the at least one first MAR element is arranged in the 3' direction of the target gene expression region next to the target gene expression region and the at least one second MAR element is arranged in the 5' direction of the selection marker expression cassette next to the selection marker expression cassette, wherein preferably i) the at least one first MAR element has a distance from the target gene expression region, preferably from a 3' end of a nucleic acid sequence encoding the poly-A transcription terminator of the target gene expression region, which is a maximum of 100 base pairs, preferably a maximum of 50 base pairs, particularly preferably a maximum of 30 base pairs;and / or ii) the at least one second MAR element has a distance from the selection marker expression cassette, preferably from a 5' start of a promoter of the selection marker expression cassette, which is a maximum of 200 base pairs, preferably a maximum of 100 base pairs, particularly preferably a maximum of 50 base pairs; 7. Polynucleotide according to one of claims 1 to 5, characterized in that the at least one first MAR element is arranged in the 5' direction of the target gene expression region next to the target gene expression region on the polynucleotide and the at least one second MAR element is arranged in the 3' direction of the selection marker expression cassette next to the selection marker expression cassette, wherein preferably i) the at least one first MAR element has a distance from the target gene expression region, preferably from a 5' start of a nucleic acid sequence which codes for the ubiquitin C promoter of the target gene expression region, which is a maximum of 10,000 base pairs, preferably a maximum of 1,000 base pairs, particularly preferably a maximum of 100 base pairs, very particularly preferably a maximum of 50 base pairs, in particular a maximum of 30 base pairs;and / or ii) the at least one second MAR element has a distance from the selection marker expression cassette, preferably from a 3' end of a poly-A transcription terminator of the selection marker expression cassette, which is a maximum of 10,000 base pairs, preferably a maximum of 1,000 base pairs, particularly preferably a maximum of 100 base pairs, very particularly preferably a maximum of 50 base pairs, in particular a maximum of 30 base pairs; 8. Polynucleotide according to one of the preceding claims, characterized in that the target gene expression region of the polynucleotide further comprises at least one further target gene expression cassette for expressing a further target gene, wherein the further target gene expression cassette comprises a ubiquitin C promoter and a poly-A transcription terminator, wherein the further target gene expression cassette preferably contains a further target gene between the ubiquitin C promoter and the poly-A transcription terminator, wherein the further target gene optionally i) is identical or different to the target gene of the target gene expression cassette; and / or ii) encodes a peptide or protein selected from the group consisting of pharmaceutically active peptides and proteins, wherein the pharmaceutically active peptide and / or protein is preferably selected from the group consisting of antibodies, enzymes, hormones, receptors and combinations thereof, and in particular is the heavy chain of adalimumab.
9. Polynucleotide according to one of the preceding claims, characterized in that the polynucleotide further comprises at least one third MAR element, wherein the at least one third MAR element is preferably i) identical or different from the at least one first MAR element and the at least one second MAR element; and / or ii) is arranged within the target gene expression region, preferably between the target gene expression cassette and another target gene expression cassette; and / or iii) has a distance from the target expression cassette, preferably from a 3' end of a nucleic acid sequence encoding the poly-A transcription terminator of this target expression cassette, which is a maximum of 10,000 base pairs, preferably a maximum of 1,000 base pairs, particularly preferably a maximum of 100 base pairs, very particularly preferably a maximum of 50 base pairs, in particular a maximum of 30 base pairs;and / or iv) has a distance from another target expression cassette, preferably from a 5' start of a nucleic acid sequence encoding the ubiquitin C promoter of this target expression cassette, of a maximum of 200 base pairs, preferably a maximum of 100 base pairs, particularly preferably a maximum of 50 base pairs; and / or; v) comprises or consists of a nucleic acid sequence which is at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to the sequence of SEQ ID NO: 2, the sequence of SEQ ID NO: 3, or the sequence of SEQ ID NO:
4.
10. Polynucleotide according to one of the preceding claims, characterized in that the polynucleotide further comprises a bacterial origin of replication, preferably a pUC Ori, and a bacterial selection marker, preferably an ampicillin selection marker, wherein the bacterial selection marker is preferably arranged between the bacterial origin of replication and the at least one first MAR element.
11. Polynucleotide according to one of the preceding claims, characterized in that the selection marker expression cassette contains or consists of a dihydrofolate reductase expression cassette, wherein the dihydrofolate reductase expression cassette preferably comprises or consists of a nucleic acid sequence which is i) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to SEQ ID NO: 5; and / or ii) at least 70%, preferably at least 80%, particularly preferably at least 90%, in particular at least 95%, optionally 100%, identical to SEQ ID NO:
6.
12. A kit comprising a) a polynucleotide according to any one of the preceding claims; and b) a transfection agent; wherein the kit preferably further contains a selection marker suitable for the selection marker expression cassette of the polynucleotide, preferably methotrexate.
13. A host cell containing a polynucleotide according to any one of claims 1 to 11, wherein the host cell is preferably an animal cell, particularly preferably a CHO cell.
14. Use of a polynucleotide according to any one of claims 1 to 11 or of a kit according to claim 12 for transfecting a host cell.
15. Use of a host cell according to claim 13 for the expression of at least one target gene in the host cell, particularly preferably for the expression of at least one target gene in a host cell after gene amplification with methotrexate.