Method for identifying 3'p RNA fragments as modulators of ribosomes and protein synthesis
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- IMMAGINA BIOTECH SRL
- Filing Date
- 2024-07-17
- Publication Date
- 2026-06-17
Smart Images

Figure IB2024056914_13022025_PF_FP_ABST
Abstract
Description
[0001] "Method for identifying 3'P RNA fragments as modulators of ribosomes and protein synthesis" * * * Field of the Invention The present invention concerns a method for the identification of RNA fragments comprising a 3' phosphate or a 2' / 3' cyclic phosphate as modulators of ribosomes and protein synthesis. Background Art Alterations in protein synthesis play a significant role in the development of various diseases, including cancer1and neurodegeneration2. The process of translation, which involves ribosomes translating RNA information into polypeptides, is central to cell biology. By being at the core of this process, ribosomes participate in numerous biological pathways, influencing cell growth, differentiation, and immune response3,4. As a consequence, their function is subject to tight regulation5, and any dysregulation or modulation can contribute to disease development or being a drug’s mode of function, respectively. Mutations in the mRNA sequence6,7can disrupt ribosome dynamics and lead to erroneous protein production. Such alterations are implicated in a considerable proportion of human diseases8. At the same time, drugs acting on ribosome decoding activity could lead to different protein isoforms9. Understanding and controlling ribosomes function is crucial in advancing our knowledge of disease pathogenesis and may pave the way for targeted therapeutic interventions. The use of RNA instead of small molecules to modulate ribosomes activity has several advantages. First, RNAs are more selective on specific RNA targets. Second, RNAs delivered into targeted cells can be fine-tuned in their half-life, thereby reducing toxicity and preventing side effects10. Among the RNA that could be used to modulate ribosomes, ribosome-associated non-coding RNAs (rancRNAs) represent a recently identified class of ribosome co-factors capable of modulating translation. Detecting rancRNAs in various species typically relies on deep sequencing, which presents a notable limitation, the need of a 3’OH for generating the library. Specifically, in mammals, the class of rancRNAs predominantly consists of tRNA fragments generated by enzymatic cleavage of full-length tRNA molecules11. The production of these RNA fragments, known as tRNA-related RNA fragments (tRFs), is done by specific nucleases, including angiogenin, mainly resulting in the formation of a phosphate or 2' / 3' cyclic phosphate group (3' P tRFs) at the 3' end of the RNA molecules12–14. Therefore, those fragments are either excluded or mixed up with other RNA species in current deep-sequencing approaches. Recent findings have revealed that certain tRFs can interfere with protein synthesis, highlighting their regulatory potential15,16. In particular, tRFs produced under stress conditions can induce a global inhibition of translation, while others may be functionally relevant in specific cellular contexts, such as hormone-dependent prostate and breast cancer17. Despite these important discoveries, current methods for profiling and quantifying ribosome-associated 3'P tRFs at the omics level are non-existent. As a result, there is a pressing need for dedicated and efficient methods to precisely profile and quantify 3'P RNAs and in particular 3’P tRFs, which could actively influence ribosome activity. By developing such methods, we can further unravel the regulatory mechanisms orchestrated by 3’P RNAs and gain deeper insights into their functional roles with the goal to generate ribosome modulator for drug development. Overall, advancing our understanding of 3′P RNAs and their impact on translation could have significant implications in the fields of molecular biology, disease research, drug discovery and development. OBJECT AND SUMMARY OF THE INVENTION Object of the present invention is to provide a method to identify RNA fragments comprising a 3' phosphate or a 2' / 3' cyclic phosphate useful as modulators of ribosomes and protein synthesis. According to the invention, the above object is achieved thanks to the steps specified in the ensuing claims, which are understood as forming an integral part of the present description. According to one embodiment, the present disclosure concerns a method to identify an RNA fragment comprising a 3' phosphate or a 2' / 3' cyclic phosphate as a modulator of ribosome and protein synthesis as defined in claim 1. BRIEF DESCRIPTION OF THE DRAWINGS The invention will now be described, by way of example only, with reference to the enclosed figures of drawing, wherein: - Figure 1. Schematic representation of subcellular fractionation experiment. - Figure 2. A. Reads length distribution of input and RSW samples (NT = no treated or control sample; Ars = arsenite treated or working sample). B. Percentage of reads mapping on different gene types. - Figure 3. Subcellular fractionation and immunoblotting of the input, FWS (salt- washed ribosomes), and RSW (pure ribosomes) fractions from MCF7 cells treated with 1 mM sodium arsenite (working sample) and not treated (NT, control sample). A. The ribosomal protein S6 and ribosomal protein L26 (RPL26) were used as marker of ribosomes sedimentation. Elongation factor eEF2 was used as marker of ribosome-associated protein. B. TIA1 was used as marker of stress granules. - Figure 4. Polysome profiling of MCF7 treated (Ars, working sample) or no treated (NT, control sample) with 1 mM arsenite. In light grey are highlighted the polysome fractions (on the left) and the 80s fractions (on the right) used for Dart-RNAseq. - Figure 5. Venn diagram of 3'P tRFs differentially expressed in both 80s fraction of polysome profiling and in Ars treated RSW samples (working samples) of subcellular fractionation experiments. - Figure 6. Schematic representation of tRNA-Ile_TAT. Black line highlights the region of the tRNA that generates the 3'P-tRFs_Ile_TAT. Grey triangles indicated the 5’ and 3’ end of the fragment. - Figure 7A Schematic representation of tRNA-Ile_TAT and Ile_AAT. Black line and grey triangles highlight the regions of the tRNAs that generate the 3'P_Ile_TAT and 3'P_Ile_AAT fragments respectively, used as target for 3'P- qPCR. B Polysome profiling of MCF7 treated (Ars, working sample) or not treated (NT, control sample) with 1 mM sodium arsenite. In light grey box are highlighted the polysome fractions (left) and the 80s fraction (right) used for 3'P-qPCR. C 3'P- qPCR analysis and relative expression of 3'P-Ile_TAT and 3'P-Ile_AAT in MCF7 total lysate (input). D 3'P-qPCR and enrichment analysis of 3'P-Ile_TAT and 3'P- Ile_AAT on 80s fractions. Enrichment was expressed as ratio between 80s of Ars treated (working sample) and polysome fractions of NT samples. Data are mean ± standard error of the mean (s.e.m.) of three biological replicates. Comparisons between two groups were performed using a Student's t test. * P<0.05. ** P< 0.01 and n.s.: not significant. - Figure 8. Relative GFP protein expression in Hela IVTT extract in no treated (NT, control sample) sample and treated with Ile_TAT synthetic oligo at different concentrations (0.1 nM and 1 nM) Puromycin treatment (Puro) was used as internal positive control. Data are mean ± standard error of the mean (s.e.m.) of three technical replicates. Comparisons between two groups were performed using a Student's t test. * P<0.05. ** P< 0.01 and n.s.: not significant. - Figure 9. Puromycilation assay. Histogram reporting relative quantification of puromycin immunoblotting of MCF7 no-treated (NT) and treated with Ile_TAT or Ile_AAT synthetic oligo (treated sample) at two different concentrations (1 nM and 100 nM, respectively). Data are mean ± standard error of the mean (s.e.m.) of three biological replicates. One-way ANOVA: * P<0.05. ** P< 0.01 and n.s.: not significant. - Figure 10. Schematic representation of the whole workflow to identify 3'P RNAs as ribosome modulators. The workflow comprises 7 steps, which include sample treatment (step1); ribosome purification (step 2); Dart-RNAseq for global 3’P RNA profiling (step 3); data analysis of Dart-RNAseq to identify a list of 3’P ribosome modulators (step 4); validation of ribosomal 3’P ribosome modulators by 3’P-qPCR (Step 5 – optional); performing and analysing an assay to monitor protein production (step 6); and identification of at least one 3’P ribosome modulators for the specific biological model used in step 6 (step 7). - Figure 11. A) Schematic representation of two step Dart-RNAseq method. B) Schematic representation of one step Dart-RNAseq method - Figure 12. Schematic representation of the 3'P-qPCR assay. DEFINITIONS By "3'P RNA" is meant an RNA fragment comprising a 3' phosphate or a 2' / 3' cyclic phosphate. By "Dart-RNAseq analysis" is meant the method for identifying a 3'P RNA as a ribosome modulator developed by the present inventors and disclosed herein. By "3'P-qPCR assay" is meant the method of confirming a 3'P RNA as ribosome modulator by determining the profile of the 3'P RNA in a cellular sample developed by the present inventors and disclosed herein. By "3’P ribosome modulator" or "3’PRM" or "PRM" or "protein synthesis modulator" is meant an RNA molecule comprising a 3' phosphate or a 2' / 3' cyclic phosphate identified by Dart-RNAseq screening and optionally confirmed by a dedicated in-vitro and / or in-vivo assay to monitor protein synthesis, able to alter the efficiency, accuracy, or speed of protein synthesis, thereby regulating the overall cellular protein output in cells. The PRM can be validated or not by 3’P qPCR. Ribosome modulators can have diverse functions and may affect different steps of translation, such as initiation, elongation, or termination. By "assay to monitor protein production" is meant an experimental technique used in biological and biomedical research to study the synthesis and localization of proteins over specific time periods and / or in particular cellular or organismal locations. These assays are valuable for understanding the basic molecular mechanisms of protein production and regulation and can be divided in the following categories: a. In vitro assays: In vitro assays are conducted outside the living organism, typically in a laboratory setting using isolated cellular components or purified proteins b. In vivo assays: In vivo assays are conducted within living organisms or cells, providing a more complex and physiological context to study protein production. By "working sample" is meant a cellular sample stressed with a treatment that influence the rate of protein synthesis on a broad scale, impacting multiple genes. Those treatments are divided in two main categories: 1. Up-regulator: stimuli acting as global inducer of proteins synthesis. It can involve the activation of specific transcription or translation factors or the removal of translational repressors, resulting in enhanced protein production. Within this category we can list the following up-regulators: A. mTOR Activator: chemicals, nutrient and Growth Factor activating mTOR protein complex. The mTOR pathway is a central regulator of cell growth, metabolism, and protein synthesis. When nutrients such as amino acids, glucose, and energy sources are abundant, and growth factors are present, mTOR becomes activated and global (cap- dependent) protein synthesis is stimulated. B. Growth Factors: signalling molecules that promote cell growth, division, and survival. When growth factors bind to their cell surface receptors, intracellular signalling pathways are activated, leading to an upregulation of protein synthesis to support cell growth and proliferation. C. Hormones: Hormones are chemical messengers produced by glands in the endocrine system. Certain hormones, such as insulin and insulin-like growth factors (IGFs), can activate signalling pathways that upregulate protein synthesis in various tissues, promoting growth and tissue repair. D. Cytokines and Inflammatory Signalling: In response to infection or tissue damage, immune cells release cytokines that activate inflammatory signalling pathways. These pathways can upregulate protein synthesis to support the immune response and tissue repair. E. Nucleolar Stress: Nucleolar stress, triggered by perturbations in ribosome biogenesis, can lead to activation of signalling pathways that upregulate ribosome synthesis and protein translation. F. Any other factor inhibiting a "Down-regulator". 2. Down-regulator: stimuli actin as global blocker of protein synthesis. This can involve the activation of regulatory pathways that suppress translation or promote the degradation of mRNA molecules. Within this category of we can list the following down-regulator: A. cellular stresses: i. Oxidative stress: caused by an imbalance between the production of reactive oxygen species (ROS) and the ability of cells to detoxify them. ROS are highly reactive molecules that can damage cell DNA, proteins, and lipids. The production of ROS can be induced by chemical reagents (e.g. sodium arsenite and hydrogen peroxide); ii. Hypoxia: a condition of reduced oxygen supply to cells. This can be caused by a number of factors, such as exposure to high altitude or blockage of blood vessels. Hypoxia can lead to a number of cellular problems, including decreased ATP production, impaired protein synthesis, and increased ROS production; iii. Heat shock: response to exposure to elevated temperatures. Heat shock proteins (HSPs) are a group of proteins that are induced by heat shock and help cells to protect themselves from damage; iv. Chemical stress: caused by exposure to toxic chemicals. These chemicals can damage cell DNA, proteins, and lipids, and can also interfere with cellular signalling pathways; v. Mechanical stress: caused by physical forces that damage cells. This can include exposure to shear forces, pressure, or vibration. Mechanical stress can damage cell membranes, organelles, and DNA B. Nutrient deprivation. C. Exposure to radiation. D. Infection with viruses or bacteria. E. mTOR inhibitors: chemicals inactivating the mTOR protein complex. F. Any other factor inhibiting an "Up-regulator". By "control sample" is meant a cellular sample not stimulated with a treatment that influence the rate of protein synthesis on a broad scale, impacting multiple genes and pathways involved in the process, or not treated with a 3’P ribosome modulator. By "treated sample" is meant a cellular sample treated with a synthetic version of the 3’P ribosome modulator. By "PCR" or "polymerase chain reaction" is meant the selective amplification of DNA or RNA targets using the polymerase chain reaction. During PCR, short single-stranded (ss) synthetic oligonucleotides or primers are extended on a target template using repeated cycles of heat denaturation, primer annealing, and primer extension. By "qPCR" or "quantitative polymerase chain reaction" is meant is a PCR- based technique that couples amplification of a target DNA or RNA sequence with quantification of the concentration of that DNA / RNA species in the reaction. This method enables calculation of the starting template concentration. By "sequencing platform adapter construct" is meant a nucleic acid construct utilized by a commercially available sequencing platform such as, e.g., Illumina® (e.g., the HiSeg™, MiSeg™ and NovaSeq™ sequencing systems); Element Bioscience™ (e.g., LoopSeq for AVITI™ sequencing systems); Singular genomics (e.g., the G4 system); Life Technologies™ (e.g., a SOLD sequencing system); Roche (e.g., the 454 GS FLX+ and / or GS Junior sequencing systems); MGI (e.g., E25, G400, G99, G50 and T7, T10, T20 systems). A sequencing platform adapter construct includes one or more nucleic acid domains. By "nucleic acid domain" is meant an oligonucleotide molecule having a length and sequence suitable for the sequencing platform of interest, i.e. enabling a polynucleotide employed by the sequencing platform of interest to specifically bind to the nucleic acid domain. The nucleic acid domains can have a length from 4 to 200 nts, from 4 to 100 nts, from 6 to 75, from 8 to 50, or from 10 to 40 nts. The nucleotide sequences of nucleic acid domains useful for sequencing on a sequencing platform of interest may vary and / or change over time. Adapter sequences are typically provided by the manufacturer of the sequencing platform (e.g., in technical documents provided with the sequencing system and / or available on the manufacturer's website). Based on such information, the sequence of adapter, reverse transcription primer, and / or amplification primers, may be designed to include all or a portion of one or more nucleic acid domains in a configuration that enables sequencing the nucleic acid insert object of the analysis on the platform of interest (in the present case the 3'P RNA). The nucleic acid domains can be selected from: a "capture domain" that specifically binds to a surface-attached sequencing platform oligonucleotide (e.g., the P5 or P7 oligonucleotides attached to the surface of a flow cell in an Illumina® sequencing system); a "sequencing primer binding domain" (e.g., a domain to which the Read 1 or Read 2 primers of the Illumina® platform may bind); a "barcode domain" (e.g., a domain that uniquely identifies the sample source of the nucleic acid being sequenced to enable sample multiplexing by marking every molecule from a given sample with a specific barcode or "tag"); a "barcode sequencing primer binding domain" (a domain to which a primer used for sequencing a barcode binds); a "molecular identification domain" (e.g., a molecular index tag, such as a randomized tag of 4, 6, or other number of nucleotides) for uniquely marking molecules of interest to determine expression levels based on the number of instances a unique tag is sequenced; or any combination of such domains. In certain aspects, a barcode domain (e.g., sample index tag) and a unique molecular identification (UMI) domain (e.g., a molecular index tag) may be included in the same nucleic acid domain. By "spacer allowing the arrest of a retrotranscriptase enzyme activity" is meant a chemical modification that can be used to mimic the presence of a naturally occurring abasic site resulting from depurination or other mechanisms. The modification involves the replacement of the deoxyribose sugar with a modified sugar molecule lacking the 2'-hydroxyl group. This modification disrupts the normal base pairing and hydrogen bonding interactions between nucleotides in the oligonucleotide. It can be selected among a 1,2'-dideoxyribose modification (dSpacer having the following chemical structure also known as abasic site), tetrahydrofuran (THF), or (AP) site. Alternatively, it can be a biotinylated blocking spacer, "Int Biotin dT", i.e., a deoxythymidine (dT) conjugated with a biotin molecule, having the following structure By "nucleobase", "nitrogenous base" or simply "base" is meant a nitrogen- containing biological compound that forms a nucleoside, which, in turn, is a component of a nucleotide. By "p-value" is meant a statistical measure of the significance of a result or observation. The p-value can be determined by means of different statistical parameters. The most known statistical parameter is the null hypothesis, that represents a statement of no effect or no relationship between variables. The p-value helps assess the evidence against the null hypothesis and supports the decision of whether to reject or fail to reject it. Specifically, the p-value represents the probability of obtaining a test statistic as extreme as, or more extreme than, the one observed in the data, assuming that the null hypothesis is true. If the p-value is very small (typically below a predefined significance level, such as 0.05 or 0.01), it suggests that the observed data is unlikely to have occurred under the null hypothesis alone. In such cases, the evidence against the null hypothesis is considered strong, and the null hypothesis is rejected in favor of the alternative hypothesis. Conversely, if the p-value is relatively large (greater than the chosen significance level, usually 0.05), it indicates that the observed data is not unusual or extreme under the null hypothesis. In this situation, there is insufficient evidence to reject the null hypothesis, and it is retained. Other statistical parameters to define a p-value are known to the skilled man, and among others are: − Test Statistic: The test statistic is a numerical summary of the data that is used to evaluate the hypothesis being tested. The choice of test statistic depends on the nature of the data and the research question. Examples of commonly used test statistics include t-statistics, chi- square statistics, F-statistics, and z-scores. − Alternative Hypothesis: The alternative hypothesis represents the opposite of the null hypothesis and reflects the effect or relationship that the researcher is interested in detecting. It is typically formulated as a statement of a specific effect size or a difference between groups. − Significance Level: The significance level, often denoted as α (alpha), is the predetermined threshold for determining statistical significance. It represents the maximum allowable probability of rejecting the null hypothesis when it is true. Commonly used significance levels are 0.05 (5%) and 0.01 (1%). Various statistical software packages and libraries provide built-in functions to calculate p-values for different tests, making the process more straightforward for researchers. The p-values should be interpreted in conjunction with effect sizes, confidence intervals, and other relevant measures to make informed conclusions about the data and the research question at hand. There are differences in how the p-value is calculated and interpreted in the 3'P-qPCR assay and the Dart-RNAseq analysis method. In 3'P-qPCR, the p-value is typically calculated using statistical tests such as the Student's t-test or analysis of variance (ANOVA). The 3'P-qPCR p-value assesses the likelihood that the observed differences in RNA expression between two groups (e.g., treatment vs. control) occurred by chance alone. A low p-value indicates that the observed differences in RNA expression are statistically significant, suggesting a real difference between the groups being compared. The threshold for significance (often denoted as alpha, α) is typically set at 0.05. If the p-value is below this threshold, the results are considered statistically significant. In the Dart-RNAseq analysis method, the p-value is usually associated with differential expression analysis, which aims to identify genes that show significant changes in expression between two conditions or groups. The p-value is often calculated using statistical methods like edgeR, DESeq2, or limma, which employ count-based models and account for the inherent variability in next-generation sequencing (NGS) data. The p-value represents the probability that the observed differential RNA expression is due to random variation alone. A low p-value indicates that the observed differential expression is statistically significant, suggesting true differences between the compared conditions. The significance threshold (α) for p-values is also commonly set at 0.05 or lower to determine statistically significant differential expression. It's important to note that the calculation and interpretation of p-values in 3'P-qPCR and Dart-RNAseq analysis depend on the specific statistical methods and algorithms used. Additionally, it's essential to consider other factors such as multiple testing corrections (e.g., Bonferroni correction) to control for false discovery rates when analyzing large-scale datasets in Dart-RNAseq analysis data. For the sake of clarity, we named "3'P-qPCR p-value" when the p-value is calculated in the 3'P-qPCR assay and we named "Dart-RNAseq p-value" when the p-value is calculated in Dart-RNAseq analysis. By "multimapping score" is meant a metric that quantifies the alignment ambiguity or the number of potential transcriptomic locations to which a read can be mapped. It assesses the level of uncertainty or multiple mapping possibilities associated with a given read. In sequencing data analysis (as in the Dart-RNAseq analysis), reads are short sequences obtained from the sequenced fragments of RNA molecules. The goal is to align or map these reads to a reference transcriptome to determine their origin or location. However, due to various factors such as the length of the reads, repetitive regions or highly similar sequences in the transcriptome, some reads may map to multiple locations with equal or similar alignment scores. The multimapping score provides a measure of the ambiguity associated with read mapping. It indicates the number of potential transcriptomic positions where a read can be mapped with similar alignment scores. A higher multimapping score implies a higher level of ambiguity, indicating that the read could originate from multiple transcriptomic regions or transcripts with comparable alignment qualities. The multimapping score is commonly used in sequencing data analysis pipelines to assess the reliability of read mapping results and to filter out reads with excessive mapping ambiguity. By considering the multimapping score, a skilled person can make informed decisions about the confidence of read alignments and their subsequent downstream analyses. By "normalized counts based on sequencing depth" or "a normalized parameter based on the number of counts" is meant counts for differences in sequencing depth and library size between samples to make the read count data comparable across samples and enable meaningful statistical analyses. It is calculated by dividing the raw read count for each gene or transcript by a normalization factor, which is typically based on the total number of reads in the sample or the median read count across all samples in the dataset. Normalization is important in sequencing data analysis because it allows for accurate comparisons between samples and identification of differentially expressed genes or transcripts. Without normalization, differences in sequencing depth and library size can lead to biased results and make it difficult to distinguish true biological changes from technical variation. Normalized counts are typically used for downstream analyses, such as differential gene expression analysis, pathway analysis, and clustering. Normalization is performed by: (i) calculating the reads per kilobase per million mapped reads (RPKM), that normalizes the read count by gene length and total number of mapped reads in the sample, and expresses the result as the number of reads per kilobase of gene length per million mapped reads; or (ii) calculating the transcripts per million (TPM), that similarly to RPKM, normalizes the read count by gene length and total number of mapped reads, but also takes into account the number of isoforms or transcript variants for each gene. Other normalization methods are available for sequencing data analysis, such as the "trimmed mean of M-values" (TMM), "quantile normalization," or "DESeq normalization." The choice of normalization method may depend on the specific analysis pipeline, data characteristics, and objectives. By "Ct value" is meant the cycle number at which the fluorescence signal of the target RNA reaches a detectable threshold level. By "fold change" is meant a measure of the relative change in gene expression levels between two conditions or samples. In other words, a measure of the upregulation or downregulation of RNA or protein in response to a specific treatment, condition, or experimental setting. It helps to understand the relative differences in RNA or protein expression levels and assess the impact of experimental variables. The fold change is usually calculated by comparing the expression levels of RNA or protein between two conditions or samples, often referred to as the "treatment" and "control" groups. It's important to note that the calculation of fold change may also involve normalization steps to correct for technical variations and to make the data comparable across samples or conditions. The specific normalization methods may differ between 3'P-qPCR and Dart-RNAseq analysis experiments. Overall, while both methods provide information about gene expression changes, the calculation and interpretation of fold change can vary between these methods due to their different principles and data output formats. For the sake of clarity, we named "3'P-qPCR fold change" when the fold change (FC) is calculated in the 3'P-qPCR assay and we named "Dart-RNAseq fold change" when the fold change (FC) is calculated in Dart-RNAseq data analysis. In the 3'P-qPCR the fold change can be calculated according to the following equation: 2^^ ^^( ^^ ^^ ^^ ^^ ^^) ^^ ^^ ^^ ^^ ^^ ^^− ^^ ^^( ^^ ^^ ^^ ^^ ^^) ^^ ^^ ^^ ^^ ^^ ^^3′P − qPCR fold change = 2^^ ^^( ^^ ^^ ^^ ^^ ^^) ^^ ^^ ^^− ^^ ^^( ^^ ^^ ^^ ^^ ^^) ^^ ^^ ^^2∆ ^^ ^^( ^^ ^^ ^^ ^^ ^^ ^^)= = 2∆∆ ^^ ^^2∆ ^^ ^^( ^^ ^^ ^^)wherein Ct(contr)target is the Ct value for the target gene determined in the control sample, Ct(treat)target is the Ct value for the target gene determined in the working sample, Ct(contr)ref is the Ct value for the reference determined in the control sample, Ct(treat)ref is the Ct value for the reference determined in the working sample. There are alternative mathematical methods for calculating the 3'P-qPCR fold change known to the skilled man. Here are a few examples: − Efficiency Correction Method: This method takes into account the differences in PCR amplification efficiency between the 3'P RNA (target gene) and the RNA-based adapter (reference gene). It involves calculating the relative amplification efficiency (E) for each RNA and using it to correct the Ct values before calculating fold change. The equation for the determination of the fold change according to this method is: fold change = (E_target)^(Ct(reference) - Ct(target)) wherein: E = amplification efficiency = 10^–1 / slope, Slope = the slope of the standard curve, plotted with the y axis as Ct and the x axis as log(quantity). − Standard Curve Method: This method utilizes a standard curve generated from a series of known template concentrations to determine the relative expression of the target gene. The Ct values of the target gene in each sample are interpolated onto the standard curve to obtain the corresponding template concentration (g / L). The template can be the treated or the control conditions. The "fold change based on the standard curve" is then calculated by comparing the template concentration between the treated and the control conditions according to the following equation18: fold change based on the standard curve = (g / L of treated condition) / (g / L control condition). − Comparative Ct Method: also known as the 2^-ΔCt method, this approach compares the Ct values of the target gene directly without using a reference gene. The Ct values of the target gene in each condition / sample are normalized to a calibrator sample, typically a reference condition or a control sample. Fold change is calculated as 2^(-ΔCt), where ΔCt represents the difference between the Ct value of each condition / sample and the Ct value of the calibrator. − Relative Expression Software Tool (REST)19: REST is a widely used software tool that calculates fold change based on PCR efficiencies and Ct values. It employs a mathematical model to estimate fold change and provides statistical analysis, including confidence intervals and p-values. In the Dart-RNAseq analysis the fold change is calculated by comparing the read counts or expression levels of genes between two conditions or samples. The fold change is determined by calculating the ratio of the expression levels of a gene in the treatment group to that in the control group according to the following equation: ^^ ^^ ^^ ^^ ^^ ^^ ^^ Dart-RNAseq Fold change = (^^ ^^ ^^ ^^ ^^^^ ^^ ^^ ^^ ^^ ^^ ^^^^ ^^ ^^ ^^) wherein nCountsTreat is the "normalized parameter based on the number of counts" for the target gene determined in the working sample, nCountsCTRL is the "normalized parameter based on the number of counts" for the target gene determined in the control sample. The expression levels in the Dart-RNAseq analysis are often based on "a normalized parameter based on the number of counts" represented as reads per kilobase of transcript per million mapped reads (RPKM) or fragments per kilobase of transcript per million mapped reads (FPKM). The Dart-RNAseq fold change values are typically logarithmically transformed, such as log2-fold change or log10- fold change. Log-transformed fold change values are commonly used to better represent the magnitude of change and to linearize the data distribution. By "ribonucleotide having a modified nucleobase conferring nuclease resistance" is meant a ribonucleotide with enhanced stability and resistance against nuclease activity. Various modifications have been developed to confer nuclease resistance to ribonucleotides. These modifications can involve chemical alternations to the nucleobase structure, such as the addition of specific functional groups or substitution of certain atoms. Examples of modified nucleobases that confer nuclease resistance include, but are not limited to: − 2'-O-Methyl (2'-OMe) Ribonucleotides: In this modification, the 2'- hydroxyl group of the ribose sugar is replaced with a methyl group. This modification enhances nuclease resistance and stability without significantly affecting RNA folding or function. − 2'-Fluoro (2'-F) Ribonucleotides: The 2'-hydroxyl group of the ribose sugar is replaced with a fluorine atom in this modification. It improves resistance to nucleases and enhances RNA stability. − Locked Nucleic Acids (LNAs): LNAs involve the introduction of a methylene bridge between the 2' oxygen and 4' carbon of the ribose sugar, effectively "locking" the ribose in the C3'-endo conformation. LNAs improve nuclease resistance and also enhance binding affinity to complementary RNA or DNA sequences. − Phosphorothioate Linkages: In this modification, one of the non- bridging oxygen atoms of the phosphodiester backbone is replaced with a sulfur atom. This modification enhances nuclease resistance by introducing a chiral center and altering the conformation of the backbone. − Peptide Nucleic Acids (PNAs): PNAs are synthetic nucleic acid analogs where the sugar-phosphate backbone is replaced with a peptide-like backbone. PNAs exhibit excellent nuclease resistance due to their nonionic nature and unique backbone structure. − 2'-O-(2-Methoxyethyl) (2'-MOE) Ribonucleotides: This modification involves replacing the 2'-hydroxyl group with a 2-methoxyethyl group. It confers increased nuclease resistance and improves stability while maintaining RNA hybridization properties. By “5-methylcytosine” (5mC) is meant a modified ribonucleotide, wherein the modification involves adding a methyl group at the 5-position of cytosine. By “Minor Groove Binder” or MGBs is meant a crescent-shaped molecules that selectively bind non-covalently to the minor groove of DNA, a shallow furrow in the DNA helix. By "Spacer Molecule" is meant a flexible molecule or stretch of molecules that are used to link 2 molecules of interest together. DETAILED DESCRIPTION OF THE INVENTION In the following description, numerous specific details are given to provide a thorough understanding of embodiments. The embodiments can be practiced without one or more of the specific details, or with other methods, components, materials, etc. In other instances, well-known structures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the embodiments. Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. The headings provided herein are for convenience only and do not interpret the scope or meaning of the embodiments. To specifically profile and quantify cellular 3'P RNAs as ribosome modulators the inventors developed a new method. They started by developing an approach based on combining i) a ribosome purification to ii) a novel Next Generation Sequencing (NGS) library preparation method named Dart-RNA sequencing (Dart-RNAseq, see methods) coupled with a dedicated 3’P-qPCR assay and iii) assays to monitor protein synthesis. More specifically, to uniquely identify 3'P RNAs as ribosome modulators the inventors combined several steps defined as follow (schematically shown in Figure 10): − Step 1: Treating the cellular sample with a stimulus causing global upregulation or downregulation of protein synthesis obtaining a working sample. − Step 2: Purifying ribosomes from both a control sample and the working sample. − Step 3: Applying Dart-RNAseq omic profiling to the purified ribosomes from the control and working samples. − Step 4: Analyzing the Dart-RNAseq data to identify a list of “3’P ribosome modulators." − Step 5 (optional): Refining the list of 3’P ribosome modulators by validating with 3’P qPCR to remove false positive and false negative leads. − Step 6: Performing an assay to monitor protein production using a synthetic analogue of the 3’P ribosome modulator. − Step 7: Analysing the assay results to monitor protein production in order to confirm and retrieve one or more drug-like RNA molecule named 3'P ribosome modulators (PRM). Both Dart-RNAseq and 3'P-qPCR were developed starting from the previously described circAID technology20, a method that allowed the selective capture of 3'P RNA fragments followed by nanopore sequencing. Dart-RNAseq was used for a global profiling of 3'P RNAs differentially expressed in different cellular conditions, while the 3'P-qPCR was used for a targeted and fast quantification of specific 3'P RNA fragments with a high resolution of the 3’ and 5’ RNA ends. By combining the purification of ribosomes with these two approaches, followed by validation with dedicated assays to monitor protein synthesis the inventors identified and validated a 3'P RNA able to suppress protein synthesis by modulating ribosomes, confirming the utility of this approach for leading new avenues of drug development. The Dart-RNAseq method schematically shown in Figure 11 essentially requires: a. the 5' phosphorylation of a 3'P RNA; b. a first ligation of the 3'P RNA with an RNA-based adapter. In some instances, the RNA-based adapter includes at least part of one nucleic acid domain of a sequencing platform adapter construct and optionally a unique molecular identifier or other barcode to mark each 3'P RNA from a specific source (i.e. unique type of cells or a single cell); c. a second ligation step, called intra-molecular circularization, to obtain a circular RNA; d. a single step retro-transcription, with a DNA primer annealing on part of the RNA-based adapter sequence, to obtain a cDNA copy of the circular RNA. It can contain none, or at least one nucleic acid domain of the sequencing platform adapter construct; e. a PCR amplification carried out in one step (see panel B. of figure 11) or in two sequential steps (see panel A. of figure 11), wherein: − the one step PCR is made with primers annealing on at least one portion of the RNA-based adapter sequence and containing all the nucleic acid domains of the sequencing platform adapter construct, - the two sequential steps comprise: a first PCR step carried out with primers annealing on at least one portion of the RNA-based adapter sequence (to amplify the cDNA copies of the circular RNA) and containing one or more nucleic acid domains of the sequencing platform adapter construct, and a second PCR step carried out with primers annealing on the first PCR primer sequences and containing one or more nucleic acid domains of the sequencing platform adapter construct; f. sequencing the amplification product; g. repeating steps (a) to (f) on at least one control sample; h. identifying the at least one 3'P RNA molecule as a ribosome modulator by determining the fulfilment of some specific conditions and thresholds. The 3'P-qPCR assay, schematically shown in figure 12, is based on an optimal design of hybrid primers for sequence-specific 3'P RNA ribosome modulator(s) amplification, detection and evaluation. The 3'P-qPCR assay requires steps "a – e" as described for the Dart-RNAseq analysis, but with different types of RNA-based adapter sequences and PCR primers. In particular, step "e" of the Dart- RNAseq analysis is substituted with two qPCR amplifications carried out in parallel, wherein the first qPCR is performed employing a pair of primers partially annealing on the defined RNA-based adapter sequence and partially on the 3'P RNA, and the second pair of primers anneals on the RNA-based adapter. Since at least one of the forward or reverse primers of the first qPCR are mapping at the junction between the RNA-based adapter and the 3'P RNA, the assay has a strong specificity for the 3' and 5' termini of the 3'P RNA, with a single nucleotide resolution on the 3' and 5' sequence of annealing. Following the qPCR amplification, some parameters of the 3'P RNA are evaluated and compared with some specific thresholds in order to determine whether the 3'P RNA is a ribosome modulator. The 3'P-qPCR assay has the advantages of being less time consuming and less expensive than other fluorescent and antibody-based methods, as well as sequencing methods. Moreover, the assay can be designed for high-throughput experiments on standard 96-well plates, by screening different samples against a specific 3'P RNA marker or by testing a panel of 3'P RNA markers against a specific sample. To further confirm that the 3’P RNA molecules identified by Dart-RNAseq (and validated by 3’P-qPCR) are effective modulators of protein synthesis, a synthetic version of at least one identified 3’P ribosome modulator is tested in at least one of the in-vitro / in-vivo assay to monitor protein production listed below. The choice of the method and the procedure is well is known by a skilled man and depends on the specific experimental requirements, the available resources and expertise. Examples of some assays to monitor protein production are listed below: - In vitro transcription / translation assay: The assay involves the use of cellular extracts containing transcription and translation machinery, allowing to monitor the synthesis of target proteins from exogenously added DNA templates. - Stable and Pulse Protein Labelling21: This technique involves introducing a labelled precursor (isotope labelling with amino acids in cell culture), such as radiolabelled amino acids or non-radioactive amino acid analogs, into the cell culture or organism. The labelled amino acids are incorporated into newly synthesized proteins during a steady state or a "pulse" phase. A chase phase could follow, where excess unlabelled amino acids are added to the medium to prevent further incorporation of the labelled amino acids. By analyzing the decay of the labelled proteins over time or the total labelled proteins, a skilled man can infer the rates of protein translation and degradation. An example is the Stable Isotope Labelling of Amino Acids in Cell Culture (SILAC), a mass spectrometry-based method used for relative quantification of newly synthesized proteins. Cells are cultured in media containing isotopically labelled amino acids, and newly synthesized proteins are distinguished from pre-existing proteins based on their isotopic composition. - Sucrose Density Gradient Centrifugation: This method separates ribosome subunits, monosomes (fully assembled 80S ribosomes), and polyribosomes (more than one ribosome bound to the same mRNA) based on their sedimentation rates in a sucrose density gradient. It provides information on the distribution of ribosomes on different mRNAs and their translation rates. The relative abundance of polyribosomes compared with monosomes and ribosome subunits is informative on the global state of translation and protein synthesis. - Ribosome Profiling (Ribo-seq): Ribosome profiling allows researchers to capture the position of translating ribosomes on mRNA transcripts. It involves treating cells with ribosome-stalling agents, followed by nuclease digestion to isolate ribosome-protected mRNA fragments. High-throughput sequencing of these fragments reveals the positions of ribosomes and allows quantification of ribosome density and translation efficiency (once couple to standard RNAseq) at a genome- wide scale. - AHARIBO (AHA-mediated RIBOsome profiling): it is a cutting-edge technique that integrates metabolic labelling to study translation in vivo, enabling a deeper understanding of the protein synthesis on coding and non-coding RNAs. - Fluorescence Resonance Energy Transfer (FRET): FRET is a technique that measures the distance between two fluorescently labelled molecules. For studying translation, FRET can be employed by tagging a ribosome with one fluorophore and the nascent polypeptide with another. The changes in FRET signal indicate the translation dynamics of individual ribosomes. - Single-Molecule Imaging of translation22: This technique involves visualizing the translation process at the level of individual molecules in real-time. Fluorescently labelled mRNAs and ribosomes are imaged using advanced microscopy techniques, providing insights into the spatial and temporal aspects of translation. - BONCAT (Bioorthogonal Noncanonical Amino Acid Tagging)23: BONCAT is a method that utilizes noncanonical amino acids containing bio- orthogonal functional groups. These amino acids are incorporated into nascent proteins during translation. Subsequent tagging with fluorophores or mass spectrometry analysis are used to infer protein abundance and relative protein changes after a stimulus. - Puromycin Labelling: Puromycin is a structural analog of aminoacyl- tRNA that can be incorporated into the nascent polypeptide chain, leading to premature termination of translation. Detection of puromycin-labelled proteins provides information about active translation and protein production by fluorescence or immunoblotting. A type of puromycin labelling is the OPP labeling, based on a cell-permeable variant of puromycin called O-propargyl-puromycin (OPP) that contains an alkyne group that can be covalently coupled to a biotin tag or fluorophore using click chemistry. - Quantitative Proteomics: Mass spectrometry-based quantitative proteomics methods, such as stable isotope labelling (e.g., TMT or iTRAQ) or label-free quantification, can be utilized to measure changes in protein synthesis levels. In one embodiment the present invention concerns a method of identifying at least one RNA fragment comprising a 3' phosphate or a 2' / 3' cyclic phosphate (3'P RNA) (see figures 10 and 11 for a schematic representation of the method object of the present invention) as a ribosome modulator comprising the following steps: (a) stressing a cellular sample comprising at least one 3'P RNA associated to a ribosome obtaining a working sample (step 1. of figure 10); (b) purifying at least one ribosome from the working sample obtaining a pure ribosome pellet, wherein the pure ribosome pellet comprises the at least one 3'P RNA associated to a ribosome (step 2. of figure 10), (c) extracting the at least one 3'P RNA from the pure ribosome pellet (step 3. of figure 10); (d) phosphorylating the at least one 3'P RNA at the 5' end obtaining at least one phosphorylated RNA fragment (step 1. of figure 11); (e) ligating the 3' end of the at least one phosphorylated RNA fragment to the 5' end of a first RNA-based adapter obtaining at least one first ligation product, wherein the first RNA-based adapter has formula (I) (step 2. of figure 11): 5' OH-Nx-C1-L1-Az-PR1-Ny-C2-B-OH 3' (I) wherein - N is a ribonucleotide, - x and y are integer numbers independently selected from 1 to 20, - L1 is a first oligoribonucleotide sequence having a length comprised between 15 and 30, - A is an abasic site or a spacer allowing the arrest of a retrotranscriptase enzyme activity, - z is an integer number from 1 to 5, - PR1 is a first portion of a first nucleic acid domain of a sequencing platform adapter construct having a length comprised between 10 and 80, - B is none, or a ribonucleotide having a 2'-fluoro-base, or a ribonucleotide having a modified nucleobase conferring nuclease resistance, and - C1 and C2 are none or a barcode sequence comprising up to 20 nucleotides, provided that at least one between C1 and C2 is none; (f) self-ligating the at least one first ligation product to form at least one first circular RNA molecule (step 3. of figure 11); (g) performing a reverse transcription of the at least one first circular RNA molecule obtaining at least one first single strand cDNA molecule comprising the sequence of the at least one 3'P RNA (step 4. of figure 11), wherein the reverse transcription is carried out using a first reverse transcription primer having formula (II): 5' OH-R2-Nz-D1-OH 3' (II) wherein - D1 is the reverse complement deoxyoligoribonucleotide of L1, wherein complementarity of D1 to L1 is comprised between 60% and 100%, - N is a ribonucleotide, - z is an integer number from 1 to 20, and - R2 is a second nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50; (h) performing a PCR amplification of the at least one first single strand cDNA molecule obtaining at least one first amplification product, wherein the PCR amplification is carried out alternatively: (1) in two sequential steps (steps 5. and 6. of figure 11A), wherein: − the first PCR amplification is carried out using a first pair of primers, the first forward primer and the first reverse primer having formula (III) and (IV), respectively: 5' OH-T1-T2-OH 3' (III) 5' OH-T3-OH 3' (IV) wherein ❖ T1 is a second portion of the first nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50, ❖ T2 is a first DNA oligonucleotide sequence having a length comprised between 10 and 30 annealing on at least one part of the first portion of the first nucleic acid domain of the sequencing platform adapter construct (PR1 of formula I), and ❖ T3 is a second DNA oligonucleotide sequence having a length comprised between 10 and 50 annealing on at least one part of the second nucleic acid domain of the sequencing platform adapter construct (R2 of formula II); - the second PCR amplification is carried out using a second pair of primers, the second forward primer and the second reverse primer having formula (V) and (VI), respectively: 5' OH-Q1-Q2-Q3-OH 3' (V) 5' OH-Q4-Q5-Q6-OH 3' (VI) wherein ❖ Q1 is a third nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50, ❖ Q2 is a fourth nucleic acid domain of the sequencing platform adapter construct having a length comprised between 6 and 20, ❖ Q3 is a third DNA oligonucleotide sequence having a length comprised between 10 and 50 annealing on at least one part of the first nucleic acid domain of the sequencing platform adapter construct (T1 + PR1 of formulas I and III), ❖ Q4 is a fifth nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50, ❖ Q5 is a sixth nucleic acid domain of the sequencing platform adapter construct having a length comprised between 6 and 20, ❖ Q6 a fourth DNA oligonucleotide sequence having a length comprised between 10 and 50 annealing on at least one part of the second nucleic acid domain of the sequencing platform adapter construct (R2 of formula II); or (2) in one single step (step 5. of figure 11B) using a third pair of primers, the third forward primer and the third reverse primer having formula (VII) and (VIII), respectively: 5' OH-Q1-Q2-Q7-OH 3' (VII) 5' OH-Q4-Q5-Q6-OH 3' (VIII) wherein ❖ Q1, Q2, Q4, Q5 and Q6 have the meaning set forth above, and ❖ Q7 is a fifth DNA oligonucleotide sequence having a length comprised between 10 and 50, comprising at the 5’ end a second portion of the first nucleic acid domain of the sequencing platform adapter construct (corresponding to T1 of formula (III)) and annealing at the 3' end on at least one part of the first portion of the first nucleic acid domain of the sequencing platform adapter construct (PR1 of formula (I)); (i) sequencing the at least one first amplification product obtaining the sequence of the at least one 3'P RNA comprised in the at least one first single strand cDNA molecule; (j) repeating steps (e) to (i) on at least one control sample, wherein the control sample is a not stressed cellular sample; (k) calculating for the at least one 3'P RNA contained in the first amplification products obtained from the working sample and the control sample: (i) a number of counts, (ii) a Dart-RNAseq p-value, (iii) a cleavage pattern and (iv) a Dart-RNAseq fold change of a normalized parameter based on the number of counts in the stressed cellular sample versus the control sample according to the following equation: ^^ ^^ ^^ ^^ ^^ ^^ ^^ Dart-RNAseq fold change = (^^ ^^ ^^ ^^ ^^^^ ^^ ^^ ^^ ^^ ^^ ^^^^ ^^ ^^ ^^) wherein - nCountsTreat is the normalized parameter based on the number of counts for the 3'P RNA determined in the working sample, - nCountsCTRL is the normalized parameter based on the number of counts for the 3'P RNA determined in the control sample; (l) identifying the at least one 3'P RNA associated to the ribosome as a ribosome modulator if: − the number of counts is > 200, − the Dart RNAseq p-value is ≤ 0.05, − the cleavage pattern is ≤ 40% per-base cleavage frequencies along the 3'P RNA length and ≥ 60% per-base cleavage frequencies on the 5' and 3' ends of the 3'P RNA, and − the Dart RNAseq fold change is ≥ 2 or ≤ 0.5. In one embodiment, the method comprises the further following steps: (m') ligating the 3' end of the at least one phosphorylated RNA fragment to the 5' end of a second RNA-based adapter obtaining at least one second ligation product (step 2. of figure 12), wherein the second RNA-based adapter has formula (IX): 5' OH-E1-Az-E2-OH 3' (IX) wherein - E1 is a second oligoribonucleotide sequence having a length comprised between 15 and 30, - A is an abasic site or a spacer allowing the arrest of a retrotranscriptase enzyme activity, - z is an integer number from 1 to 5, - E2 is a third oligoribonucleotide sequence having a length comprised between 15 and 30; (n') self-ligating the at least one second ligation product to form at least one second circular RNA molecule (step 3. of figure 12); (o') performing a reverse transcription of the at least one second circular RNA molecule obtaining at least one second single strand cDNA molecule comprising the sequence of the at least one 3'P RNA (step 4. of figure 12), wherein the reverse transcription is carried out using a second reverse transcription primer having formula (X): 5' OH-G-F1-OH 3' (X) wherein - F1 is the reverse complement deoxyoligoribonucleotide of E1, wherein complementarity of D1 to E1 is comprised between 60% and 100%, and - G is none or a sixth DNA oligonucleotide sequence having a length comprised between 10 and 30; (p') performing in parallel a first and a second qPCR amplifications of the at least one second single strand cDNA molecule obtaining a second and a third amplification product (step 5. of figure 12), wherein: - the first qPCR amplification is carried out using a fourth pair of primers annealing on at least one part of the 3'P RNA sequence, the fourth pair of primers being selected from pairs of primer Set1, Set2 and Set3, wherein each pair of primers comprises a forward and reverse primer, wherein the forward and reverse primers of the pair of primers Set1 have a sequence as set forth in formulas (XIa) and (XIIa), respectively, the forward and reverse primers of the pair of primers Set2 have a sequence as set forth in formulas (XIa') and (XIIa'), respectively, and the forward and reverse primers of the pair of primers Set3 have a sequence as set forth in formulas (XIa") and (XIIa"), respectively: Set1 5' OH-H2-N-OH 3' (XIa) 5' OH-H1-M-OH 3' (XIIa) Set2 5' OH-H2-N-OH 3' (XIa') 5' OH-H1-OH 3' (XIIa') Set3 5' OH-H2-OH 3' (XIa") 5' OH-H1-M-OH 3' (XIIa") wherein ❖ H1 is a seventh DNA oligonucleotide annealing on E1, wherein complementarity of H1 to E1 is comprised between 30% and 100%, and ❖ M is an eight DNA oligonucleotide having a length comprised between 6 and 30 and annealing on at least 6 nucleotides of the 3' end of the 3'P RNA sequence, ❖ H2 is a nineth DNA oligonucleotide annealing on E2, wherein complementarity of H2 to E2 is comprised between 30% and 100%, and ❖ N is a tenth DNA oligonucleotide having a length comprised between 6 and 30 and annealing on at least 6 nucleotides of the 5' end of the 3'P RNA sequence; - the second qPCR amplification is carried out using a fifth pair of primers annealing on the second RNA-based adapter sequence, the fifth pair of primers comprising a fifth forward and a fifth reverse primer having formula (XIII) and (XIV), respectively: 5' OH-H2-OH 3' (XIII) 5' OH-I1-OH 3' (XIV) wherein ❖ H2 has the meaning set forth above, and ❖ I1 is an eleventh DNA oligonucleotide annealing on G, wherein complementarity of I1 to G is comprised between 60% and 100%; and (q') repeating steps (m') to (o') on the control sample; (r') determining Ct values for the at least one 3'P RNA and for the second RNA-based adapter in the second and third amplification products for either the working sample and the control sample, (s') calculating a 3'P-qPCR fold change of the Ct values determined in step (r') according to the following equation: 2^^ ^^( ^^)3′ ^^− ^^ ^^( ^^)3′ ^^2∆ ^^ ^^(3′^^)3′P qPCR fold change =∆∆ ^^ ^^^= = 2 2^ ^^( ^^) ^^ ^^ ^^− ^^ ^^( ^^) ^^ ^^ ^^2∆ ^^ ^^( ^^ ^^ ^^)wherein Ct(A)3'P is the Ct value for the 3'P RNA determined in the working sample, Ct(B)3'P is the Ct value for the 3'P RNA determined in the control sample, Ct(A)adp is the Ct value for the second RNA-based adapter determined in the working sample, Ct(B)adp is the Ct value for the second RNA-based adapter determined in the control sample; (t') confirming that the at least one 3'P RNA is a ribosome modulator if 3'P- qPCR fold change is ≥ 2 or ≤ 0.5. In one embodiment, the method further comprises the following steps: (m") selecting at least one 3'P RNA identified in step (l) or step (t'); (n") administering at least one synthetic version of the 3'P RNA to the control sample obtaining a treated sample; (o") performing on the treated sample and in parallel on the control sample (i.e., the control cellular sample not treated with the synthetic version of the 3'P RNA) at least one of the following assays: - an in vitro transcription / translation assay; - a puromycilation assay; - Pulse-Chase Labeling; - Sucrose Density Gradient Centrifugation; - Ribosome Profiling; - AHARIBO; - FRET; - Single-Molecule Imaging of translation; - BONCAT; - SILAC; - Puromycin Labeling; - OPP labeling; - Quantitative Proteomics; (p") calculating an intensity value of a signal registered in the assay for the treated sample and the control sample, wherein the registered signal intensity is directly correlated to the rate of protein synthesis in the sample under analysis; the intensity signal measured in the assay to monitor protein synthesis can be (i) a fluorescent signal or a change in fluorescence intensity or emission wavelength (ii) a chemiluminescent signal, (iii) an absorbance signal (between 230 nm and 500 nm wavelength), (iv) a mass-to-charge ratio (m / z), (v) any signal output of a sequencing platform. (q") calculating a difference of the signal intensity values between the treated sample and the control sample (NT, no treated) and an assay fold change according to the following equation: assay fold change = signal intensity treated sample / signal intensity control sample; (r") confirming that the at least one 3'P RNA is a ribosome modulator if: - the difference in the signal intensity value between the treated sample and the control sample is at least ± 10% with a p-value < 0.05 (i.e., a significant reduction of -10% of protein synthesis or a significant increase of +10% of protein synthesis); and - the assay fold chance is > 1.1 or < 0.9. In one embodiment, step (k) further comprises at least one of the following operations: - mapping the sequence of the at least one 3'P RNA contained in the first amplification product obtained for the working sample and the control sample on the reference genome or transcriptome and calculating the multimapping score of the at least one 3'P RNA, - calculating the length of the at least one 3'P RNA, and - calculating a normalized counts based on sequencing depth of the at least one 3'P RNA, wherein the at least one 3'P RNA is a ribosome modulator if: − the length is > 15 and < 200 nucleotides, or − the normalized counts based on sequencing depth is > 5, or − the multimapping score is ≤ 100. The amplification product obtained at the end of phase (h) contains at least one DNA molecule having a composition as shown in figure 11A or figure 11B. The sense strand of the DNA molecule comprises from the 5' end to the 3' end the following elements: the third (Q1), the fourth (Q2), the first (T1 + PR1) nucleic acid domains of the sequencing platform adapter construct (the first nucleic acid domain being given by the combination of its first PR1 and second T1 portions), y deoxyribonucleotides (Ny), a barcode sequence or none (C2), none or a deoxyribonucleotide (B), the sequence of the 3'P RNA, x deoxyribonucleotides (Nx), none or a barcode sequence (C1), a random deoxyribonucleotide (D1), z deoxyribonucleotides (Nz), the second (R2), the sixth (Q5) and the fifth (Q4) nucleic acid domains of the sequencing platform adapter construct. In one embodiment, the sequencing platform is selected from those commercialized by Illumina (e.g., the HiSeg™, MiSeg™ and NovaSeq™ sequencing systems); Element Bioscience (e.g., LoopSeq for AVITI™ sequencing systems); Singular genomics (e.g., the G4 system); Life Technologies (e.g., a SOLD sequencing system); Roche (e.g., the 454 GS FLX+ and / or GS Junior sequencing systems); MGI (e.g., E25, G400, G99, G50 and T7, T10, T20 systems). Preferably the sequencing platform is selected from those commercialized by Illumina. In one embodiment, the combination of the third (Q1), the fourth (Q2), the first (T1 + PR1) nucleic acid domains of the sequencing platform adapter construct has a sequence selected from: (i) P1 adaptor by Life Technologies (as reported in "Applied Biosystems SOLiD™ 4 System Library Preparation Guide" April 2010, https: / / tools.thermofisher.com / content / sfs / manuals / SOLiD4_Library_Preparation_ man.pdf), (ii) GS adaptor A by Roche (as reported in "GS FLX Titanium General Library Preparation Method Manual", April 2009, USM-00048.B, https: / / dna.uga.edu / wp-content / uploads / sites / 51 / 2013 / 12 / GS-FLX-Titanium- General-Library-Preparation-Method-Manual-Roche.pdf), and (iii) MGI 5’ adapter by MGI (as reported in "MGIEasy RNA Directional Library Prep Set User Manual", Cat. No.: 1000006385(16 RXN), 1000006386(96 RXN), Kit Version: V2.1, Manual Version: 5.0). In one embodiment, the combination of the second (R2), the sixth (Q5) and the fifth (Q4) nucleic acid domains of the sequencing platform adapter construct has a sequence selected from : (i) P2 adaptor by Life Technologies (as reported in "Applied Biosystems SOLiD™ 4 System Library Preparation Guide" April 2010, https: / / tools.thermofisher.com / content / sfs / manuals / SOLiD4_Library_Preparation_ man.pdf), (ii) GS adaptor B by Roche (as reported in "GS FLX Titanium General Library Preparation Method Manual", April 2009, USM-00048.B, https: / / dna.uga.edu / wp-content / uploads / sites / 51 / 2013 / 12 / GS-FLX-Titanium- General-Library-Preparation-Method-Manual-Roche.pdf), and (iii) MGI 3’ adapter by MGI (as reported in "MGIEasy RNA Directional Library Prep Set User Manual", Cat. No.: 1000006385(16 RXN), 1000006386(96 RXN), Kit Version: V2.1, Manual Version: 5.0). It is indeed evident that the expert in the field knows how to "cut and sew" the sequences of the sequencing platform adapter constructs employed by the commercially available sequencing platforms in an appropriate manner to generate the sequences of the RNA-based adapter, reverse transcription primer and PCR primers (and consequently of the different nucleic acid domains as identified above) so that the DNA molecule obtained at the end of step (h) has a sequence as shown in figure 11 and can be sequenced by the sequencing platform that the expert has selected from those available. In one embodiment, when the sequencing step (i) is carried out on a sequencing platform by Illumina, then: - the sequence of first nucleic acid domain PR1 + T1 of the sequencing platform adapter construct is selected from the sequences SP1; - the second nucleic acid domain R2 of the sequencing platform adapter construct is selected from the sequences SP2; - the third nucleic acid domain Q1 of the sequencing platform adapter construct is the sequence P5; - the fourth nucleic acid domain Q2 of the sequencing platform adapter construct is selected from the sequences i5 (or index5); - the fifth nucleic acid domain Q4 of the sequencing platform adapter construct is the sequence P7; - the sixth nucleic acid domain Q5 of the sequencing platform adapter construct is selected from the sequences i7 (or index7). The sequences SP1, SP2, i5, i7, P5 and P7 are part of the common general knowledge of the skilled man and are fully disclosed in “Illumina Adapter Sequences" Document # 1000000002694 v11, May 2019; https: / / www.science.smith.edu / cmbs / wp- content / uploads / sites / 36 / 2020 / 01 / illumina-adapter-sequences-1000000002694- 11.pdf. In one embodiment, when the sequencing step (i) is carried out on a sequencing platform by Element Bioscience, then: - the sequence of first nucleic acid domain PR1 + T1 of the sequencing platform adapter construct is selected from the sequences read primer 1; - the second nucleic acid domain R2 of the sequencing platform adapter construct is selected from the sequences read primer 2; - the third nucleic acid domain Q1 of the sequencing platform adapter construct is the sequence outer adapter; - the fourth nucleic acid domain Q2 of the sequencing platform adapter construct is selected from the sequences index 2; - the fifth nucleic acid domain Q4 of the sequencing platform adapter construct is the sequence outer adapter; - the sixth nucleic acid domain Q5 of the sequencing platform adapter construct is selected from the sequences adapter. The sequences outer adapter, index 2, read primer 1, read primer 2, adapter and outer adapter are part of the common general knowledge of the skilled man and are fully disclosed in “Amplicon LoopSeq™ for AVITI™" Document # MA-00023 Rev. C June 2023, go.elementbiosciences.com / amplicon-loopseq-aviti-workflow- guide” and “Element Elevate™ Library Prep" Document # MA-00004 Rev. B, June 2023, go.elementbiosciences.com / elevate-library-prep-workflow-guide. In one embodiment, when the sequencing step (i) is carried out on a sequencing platform by Singular Genomics, then: - the sequence of first nucleic acid domain PR1 + T1 of the sequencing platform adapter construct is selected from the sequences SP1; - the second nucleic acid domain R2 of the sequencing platform adapter construct is selected from the sequences SP2; - the third nucleic acid domain Q1 of the sequencing platform adapter construct is the sequence S1; - the fourth nucleic acid domain Q2 of the sequencing platform adapter construct is selected from the sequences index 1; - the fifth nucleic acid domain Q4 of the sequencing platform adapter construct is the S2; - the sixth nucleic acid domain Q5 of the sequencing platform adapter construct is selected from the sequences index 2. The sequences S1, S2, SP1, SP2 index 1 and index 2 are part of the common general knowledge of the skilled man and are fully disclosed in “ADAPTING LIBRARIES FOR THE G4™ — INSERT ONLY" Document #600024 Rev. 0, May 2023 https: / / singulargenomics.com / wp-content / uploads / 2023 / 06 / Adapting- Library-Insert-600024.pdf). In one embodiment, the first and second DNA oligonucleotide sequences T2 and T3 anneal on at least 6 nucleotides of the first portion (PR1) of the first nucleic acid domain and second nucleic acid domain (R2) of the sequencing platform adapter construct, respectively. In one embodiment, the third and fourth DNA oligonucleotide sequences Q3 and Q6 anneal on at least 6 nucleotides of the second portion (T1) of the first nucleic acid domain and the second nucleic acid domain (R2) of the sequencing platform adapter construct, respectively. In one embodiment, the cellular sample is selected from bacterial cells, plant-cells, human and mouse tissues, an immortalized cell line, a primary cell line, Induced Pluripotent Stem Cells (iPSC), non-human embryonic stem cell (ESC). A non-binding example list of mammalian cells is reported here: - Immortalized Cell Lines: ^ HeLa (Cervical cancer-derived), ^ HEK293 (Human embryonic kidney-derived), ^ A549 (Lung carcinoma-derived), ^ MCF-7 (Breast cancer-derived), ^ U87MG (Glioblastoma-derived), ^ Jurkat (T-cell leukemia-derived), ^ PC-3 (Prostate cancer-derived), ^ SK-N-SH (Neuroblastoma-derived), ^ THP-1 (Monocytic leukemia-derived), ^ HCT116 (Colorectal cancer-derived); - Primary Cell Lines: ^ Human Dermal Fibroblasts (Skin-derived), ^ Human Peripheral Blood Mononuclear Cells (PBMCs), ^ Human Umbilical Vein Endothelial Cells (HUVECs), ^ Human Hepatocytes (Liver-derived), ^ Human Chondrocytes (Cartilage-derived), ^ Human Neurons (Brain-derived), ^ Human Cardiomyocytes (Heart-derived), ^ Human Islets of Langerhans (Pancreas-derived), ^ Human Alveolar Epithelial Cells (Lung-derived), ^ Human Renal Proximal Tubule Epithelial Cells (Kidney-derived). For iPSC and non-human ESC cell lines, there is no fixed or standardized list, as IPS cells are generated on a case-by-case basis in research laboratories or generated for specific research purposes. Each iPSC cell line is unique and may be derived from different somatic cell sources (e.g., skin cells, blood cells) and carry specific genetic or functional characteristics. In one embodiment, the stressing step (a) (step 1, Figure 10) is carried out by treating a cellular sample with a compound able to induce a global down- regulation or up-regulation of protein synthesis. In one embodiment, the compound able to induce down-regulation of protein synthesis is selected from sodium arsenate, rapamycin (immunosuppressive drug that inhibits the mammalian target of rapamycin (mTOR) pathway, which plays a central role in regulating protein synthesis), cycloheximide (an antibiotic that inhibits protein synthesis by blocking ribosome movement along the mRNA, leading to a global reduction in protein synthesis), anisomycin or harringtonine (antibiotics that inhibits protein synthesis by interfering with ribosomal translocation), Heme-regulated eIF2α kinase (HRI) inhibitors (these compounds reduce protein synthesis in erythroid cells and are being studied as potential treatments for certain types of anemias), Chloramphenicol (an antibiotic that inhibits protein synthesis by binding to the 50S subunit of the bacterial ribosome), Tetracyclines (a group of antibiotics that inhibit protein synthesis by binding to the 30S subunit of the bacterial ribosome), Actinomycin D (an anticancer drug that interferes with transcription by binding to DNA and inhibiting RNA polymerase, leading to reduced protein synthesis), Proteasome Inhibitors (compounds that block the activity of proteasomes, leading to the accumulation of ubiquitinated proteins and reduced protein synthesis due to decreased protein turnover), heat shock, nutrient deprivation, radiations or infections agents as viruses and bacteria. In one embodiment, the compound able to induce up-regulation (stimulation) of protein synthesis is selected from Insulin (an hormone that can activate the phosphatidylinositol 3-kinase (PI3K) / protein kinase B (Akt) pathway, leading to enhanced protein synthesis in various tissues), Leucine (an essential amino acid that activates the mTOR pathway, promoting protein synthesis and cell growth), Growth Factors (e.g., EGF, IGF-1, that can activate various signaling pathways that stimulate protein synthesis in response to growth and developmental signals), Creatine and Branched-Chain Amino Acids (BCAAs). In one embodiment, the purification of the pure ribosome pellet of step (b) is carried out by at least one of the following procedures known by a skilled man: - Polysome profiling24: a technique that uses sucrose density gradient ultracentrifugation to separate complexes of mRNAs associated with one or more ribosomes. This technique can be used to isolate ribosomes by collecting the fractions of the gradient that contain polysomes, monosomes, or ribosomes subunits; - Subcellular fractionation or salt wash method25: a method based on the principle that the ribosomes associated factors that are not strongly bound to ribosomes are sensitive to high salt concentrations. When ribosomes are incubated in a high-salt buffer, the associated factors will dissociate from the ribosomes. Ribosomes can then be purified from the cell lysate by differential centrifugation. Other names for the salt wash method: ribosome dissociation method, Ribosome purification method, High-salt buffer method, Discontinuous sucrose gradient method; - RiboLace ribosome isolation3: a method based on an original puromycin- containing molecule capable of isolating active ribosomes by means of an antibody- free and tag-free magnetic separation and pull-down approach; - Affinity purification methods: methods used to isolate ribosomes that are specifically bound to a particular protein or RNA. The ribosomes are incubated with a resin that is covalently linked to the protein or RNA of interest. Ribosomes that are bound to the resin will be retained, while the unbound ribosomes will be washed away. Ribosomes that are bound to the resin can then be eluted by changing the buffer conditions. There are a number of variants of affinity purification (antibody- based or antibody-free) that have been developed to improve the specificity and efficiency, such as the translating ribosome affinity purification method (TRAP). TRAP uses a GFP / FLAG-tagged26,27ribosome to specifically purify ribosomes that are actively translating cell-type specific mRNAs. In one embodiment, the extraction of the 3'P RNA from the pure ribosome pellet of step (c) is carried out by one or a combination of standard methods listed here and known by a skilled man: − Phenol-Chloroform Extraction (Traditional Method): This method involves the use of acid phenol and chloroform to extract RNA. Cells or tissues are first homogenized, and then the RNA is separated from other cellular components through phase separation. This method requires careful handling of hazardous chemicals and is more time-consuming than other methods. − Guanidinium Thiocyanate-Based Methods (TRIzol, TRI Reagent, etc.): These methods use guanidinium thiocyanate to denature and inactivate RNases, followed by organic extraction with phenol-chloroform. TRIzol is a popular commercial reagent for RNA extraction that simplifies the process and is suitable for various sample types. − Silica Column-Based Methods: These methods use silica columns to bind RNA in the presence of chaotropic salts. After washing away contaminants, the purified RNA is eluted from the column. − Magnetic Bead-Based Methods: This approach relies on magnetic beads coated with nucleic acid-binding matrices. The RNA binds to the beads, and contaminants are washed away. The RNA is then eluted from the beads. These kits offer fast and efficient RNA extraction with minimal hands-on time. − Solid-Phase Reversible Immobilization (SPRI) Method: This method uses paramagnetic beads to selectively capture RNA molecules and remove impurities. It is a rapid and efficient RNA extraction technique. The choice of RNA extraction method depends on factors such as the type of sample (e.g., cells, blood,), the RNA yield required, downstream applications, and the equipment available (e.g., centrifuges, magnetic separators, automated platforms). In one embodiment, before performing step (c) the working sample and / or the control sample are subjected to a small RNA enrichment operation, meaning that all the RNA fragments smaller than 200 nt are purified. Methods for small RNA enrichment are selected from any or a combination of, the methods listed below and known by a skilled man: − Affinity purification methods: These methods use a resin that is specifically designed to bind small RNAs. The small RNAs are then eluted from the resin and purified; − Size-exclusion chromatography: This method uses a column to separate small RNAs from other cellular components based on their size; − PAGE gel electrophoresis: This method uses a denaturing polyacrylamide gel (PAGE) electrophoresis to separate small RNAs based on their size. The small RNAs are then visualized using a stain or a fluorescent dye and then extracted from the gel with a dedicated gel excision and gel extraction buffers. In one embodiment, the phosphorylation step (d) is carried out using a phosphorylating enzyme selected from T4 PNK 3' minus, T4 PNK and recombinant versions of T4 PNK (e.g. OptikinaseTM). In one embodiment, the ligation steps (e) and (m') are carried out using a first ligase enzyme selected from RtcB, Archease, Arabidopsis Thaliana tRNA ligase, and eukaryotic tRNA ligase. In one embodiment, the self-ligation steps (f) and (n') are carried out using a second ligase enzyme selected from T4 Rnl1, T4 Rnl2, T4 Rnl2tr, T4 Rnl2 K227Q, Mth Rnl, and ATP-independent ligases that catalyze intramolecular ligation (e.g. CircLigaseTM, CircLigaseIITM). In one embodiment, the reverse transcription steps (g) and (o') are carried out using a reverse transcriptase (RT) enzyme selected from engineered M MLV- RT enzymes (Moloney Murine Leukemia Virus Reverse Transcriptase) and AMV- RT enzymes (Avian Myeoloblastosis Virus Reverse Transcriptase), preferably selected from Maxima H MinusTM, SuperscriptTMI-II-III-IV, SunscriptTM. In one embodiment, the PCR amplification step (h) is carried out using a DNA polymerase enzyme selected from engineered Taq DNA polymerase, preferably with high fidelity activity (e.g. Q5® High‑Fidelity DNA Polymerase, Platinum® Taq, KAPA HiFi HotStart). In one embodiment, the second RNA-based adapter of formula (IX) has a length comprised between 50 and 100 nt. In one embodiment, the second RNA-based adapter of formula (IX) comprises at least 1 abasic site or spacer. In one embodiment, the spacer A contained in the second RNA-based adapter of formula (IX) is selected from 1,2'-dideoxyribose modification (dSpacer), tetrahydrofuran (THF), apurinic / apyrimidinic (AP) site or a biotinylated blocking spacer. In one embodiment, the second reverse transcription primer has a length comprised between 10 and 100 nt. In one embodiment, the primers (both the fourth and the fifth primer pairs) employed in the two qPCR amplifications of step (p') have at least one of the following features: - they contain from 1 to 20 modified nucleotides; preferably the modification encompasses one of a phosphorothioate modification, a locked nucleic acid (LNA), a 2'-O-Methyl modification, a 5-methylcytosine modification, a minor groove binder, a spacer molecule. These modifications can be used individually or in combination to optimize primer performance, including primer specificity, stability, and melting temperature; - they have a length comprised between 15 and 25 nucleotides. - they have a minimum free energy comprised between -3 and -150 kcal / mol. - they do not contain strong or mild secondary structures and / or do not form dimers. - they have a melting temperature comprised between 57 and 70 °C. - they have a melting temperature difference between the forward and reverse primer of the pair less than or equal to 3 °C. In one embodiment, the forward and reverse primers of the fourth pair of primers used in the first qPCR amplification (step p'(1)) anneal on at least 6, preferably 10, nucleotides of the 3'P RNA at the 3' end and the 5' end, respectively. In one embodiment, the qPCR amplifications step (p') is carried out using a DNA polymerase enzyme selected from engineered Taq DNA polymerase enzymes, which preferably remain inactive during the reaction setup and are activated during the initial denaturation step. Examples of Taq DNA Polymerase enzymes usable in the 3'P-qPCR assay are: Platinum Taq DNA Polymerase, AccuPrime Taq DNA Polymerase, GoTaq DNA Polymerase, GoTaq Green and GoTaq Flexi DNA Polymerases,KAPA Taq DNA Polymerase, Phusion Taq DNA Polymerase, Q5 High-Fidelity DNA Polymerase. In one embodiment, the ribosome modulator is selected from 3'P RNAs having a sequence as set forth in any of SEQ ID No.: 1-119. In one embodiment, the method is carried out using at least one of: - a first RNA-based adapter having a sequence selected from the sequences set forth in SEQ ID No.: 120-124; - a first reverse transcription primer having a sequence set forth in SEQ ID No.: 125; - a first pair of primers comprising a first forward and a first reverse primer having a sequence as set forth in SEQ ID No.: 126 and 127, respectively, - a second pair of primers comprising a second forward and a second reverse primer having formula (XV) and (XVI), respectively: 5' OH- AATGATACGGCGACCACCGAGATCTACAC(i5)ACACTCTTTCCCTACAC GACGCTCTTCCGATCT-OH 3' (XV) 5' OH- CAAGCAGAAGACGGCATACGAGAT(i7)GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT-OH 3' (XVI) wherein (i5) is selected from the sequences i5 (or index5) by Illumina, and (i7) is selected from the sequences i7 (or index7) by Illumina; - a third pair of primers comprising a third forward and a third reverse primer having formula (XV) and (XVI) as set forth above; - a second RNA-based adapter having a sequence as set forth in SEQ ID No.: 132; - a second reverse transcription primer having a sequence as set forth in SEQ ID No.: 133; - a fifth pair of primers for performing the second qPCR amplification of step (p'), the fifth forward and fifth reverse primers having a sequence as set forth in SEQ ID No.: 138 and 139, respectively. In the following, a description of a protocol for carrying out the method object of the present description applied to the Illumina sequencing platform is provided. The following description should not be construed as limiting the present invention since other procedures for stressing the cellular sample, for ribosome purification as well as for monitoring protein production can be employed. Also, other sequencing platforms known in the art as exemplified above could be used and therefore the sequences of the first RNA-based adapter and the primers employed in the PCR amplifications (i.e., the different nucleic acid domains of the sequencing platform adapter construct) can take on different meanings known to the man skilled in the art. Schematic description for generation of a working sample This protocol is a general guideline for the generation of a working sample and may need to be optimized based on specific cell culture conditions and treatments. The appropriate controls to ensure the accuracy and validity of the experimental results is important. Example of generation of a working sample: − Seed MCF7 cells at a density of 1.5 × 10^6 cells per 100 mm cell culture dish. − Allow the cells to grow in the appropriate culture medium until they reach 80% confluence. − For treatment, add 1 mM of sodium arsenite to the cells and incubate them at 37°C for 1 hour. This treatment induces specific cellular responses. − After the sodium arsenite treatment, add 10 μg / mL (10-150 ug / mL) of cycloheximide (CHX) to the cells and continue incubation at 37°C for 5 minutes. CHX is used to stabilize the ribosome-bound RNA complexes. − For the control samples, treat cells only with 10 μg / mL (10-150 μg / mL) of cycloheximide (CHX) without sodium arsenite. − Prepare a hypotonic lysis buffer (IMMAGINA Biotechnology, cat. no. #RL001-1) for cell lysis. − Carefully aspirate the culture medium from the treated and control cells. − Wash the cells gently with ice-cold phosphate-buffered saline (PBS) to remove any residual medium. − Add the hypotonic lysis buffer to the cells, covering the dish entirely, and place the dish on ice. − Use a cell scraper or a rubber policeman to gently detach the cells from the dish. − Transfer the cell lysate into centrifuge tubes and centrifuge at 14,000 rpm for 5 minutes at 4°C. This step will remove cellular debris, nuclei, and mitochondria, leaving the supernatant containing ribosome-bound RNA complexes. − Carefully collect the supernatant, which now contains the cell lysates with ribosome-bound RNA complexes, and proceed with downstream applications such as polysome profiling or RNA extraction. Schematic description of ribosome purification Separation of ribosome by Polysome Profiling steps: − Prepare MCF7 cell lysates according to the experimental requirements. − Load the MCF7 cell lysates on a linear 15–50% sucrose gradient in ultracentrifuge tubes. Alternatively, the sucrose gradient can be 10–50%, 5– 50%, 20–50%, 20–40%, 10–40%, 15–40%, 15–50%. − Place the ultracentrifuge tubes containing the sucrose gradient into the SW41Ti rotor (Beckman). Alternatively, it can be a centrifuge with a similar rotor. − Centrifuge the tubes in a Beckman Optima LE-80K Ultracentrifuge at 40,000 rpm for 1 hour and 40 minutes at 4 °C. Alternatively 60,000 rpm for 1 hour at 4 °C, Alternatively, 30,000 rpm for 5 hours at 4 °C or 40,000 rpm for 3 hours at 4 °C. − After ultracentrifugation, carefully collect the gradients by fractionating into 1 mL volume fractions. Monitor the absorbance at 254 nm using an ISCO UA-6 UV detector or analogues during fractionation. Collected fractions are in a volume of 1 mL. Alternatively in fraction from 0.2 to 1 mL. − Extract small RNAs (smRNAs) from the 80s and polysome fractions using 1.8 mL of mirvana lysis buffer per mL of sucrose fraction. Follow the manufacturer's instructions for smRNA enrichment. Alternatively, can be used any other commercial kit for small RNA enrichment. − Quantify the extracted smRNAs using the Qubit™ miRNA Assay Kit to determine the yield of small RNAs that should be higher than 1 ng / µL. − Proceed with library preparation and 3' P qPCR for the smRNAs to analyze their characteristics. − Perform the entire polysome profiling experiment in biological triplicates to ensure robustness and reliability of the results. Please note that this protocol is a general guideline and should be adaptedpecific experimental conditions and equipment available. Subcellular Fractionation (Salt Wash) Protocol: − Prepare MCF7 cell lysates − Take 1 / 10 (or between ½ and 1 / 20) of the total lysate volume and use it directly for smRNA enrichment using the MirVana Kit (Thermo Fisher, cat. No. AM1560). This fraction will serve as the input sample for Dart- RNAseq. − Set aside the remaining lysate volume for subcellular fractionation using ultracentrifugation. − Perform the first ultracentrifugation step by centrifuging the cell lysate at 95,000 rpm for 2 hours (or between 1.5 and 5 hours) at 4°C in a TLA100.2 rotor. This step will yield two fractions: o S100 supernatant (containing soluble components) o R pellet (containing ribosomes plus associated factors) − Collect the R pellet and resuspend it in 200 μL (range 10- 300 μL) of high- salt resuspension buffer (5 mM Tris-HCl, pH 7.4, 500 mM KCl, 5 mM MgCl2, 2 mM DTT, and 290 mM sucrose). − Load the resuspended R pellet onto a 40–20% (or 40–10%, 40–5%, 30–5%, 30–10%) discontinuous sucrose gradient. − Centrifuge the sucrose gradient at 95,000 rpm for 2 hours (or between 1.5 and 5 hours) at 4°C using the TLA100.2 rotor. This step will separate the ribosomes into distinct fractions. − Collect the pure ribosomes fraction (RSW) obtained from the sucrose gradient and resuspend it in 200 μL (or in a range of 40 -350 μL) of mirvana lysis buffer (Thermo Fisher, cat. No. AM1561). − Perform smRNA enrichment on the RSW fraction using the MirVana Kit according to the manufacturer’s instructions. − Quantify the smRNAs extracted from both the input sample and the RSW fraction using the Qubit™ miRNA Assay Kit to determine the yield of small RNAs that should be higher than 1 ng / μL. − Proceed with library preparation for Dart-RNAseq using the input sample and RSW fraction. − Perform the entire subcellular fractionation experiment in biological triplicates to ensure robustness and reliability of the results. This protocol is a general guideline and should be adapted to specific experimental conditions and equipment available. The use appropriate controls to ensure the accuracy and validity of the experimental results is important. Other methods to isolate ribosomes known in the art are: − Antibody-Based Ribosome Pull-Down (e.g., TRAP) as described in Heiman, M. et al 201427, or similar protocol. − RiboLace purification according to Clamer et al., 20183− CLIP-like RiboSeq28: This method is suitable if you only require an indication of ribosome density. - Size Exclusion (e.g. Sepharose): ^ Equilibrate the size exclusion column or chromatography system with the appropriate buffer according to the manufacturer's instructions. Ensure that the column is free from air bubbles. ^ Load the cell lysates onto the size exclusion column or chromatography system. Allow the lysates to flow through the resin bed under gravity or at the recommended flow rate. ^ As the lysates pass through the size exclusion resin, the different biomolecules will be separated based on their size. Larger complexes, such as ribosomes and polysomes, will be excluded from the pores of the resin and elute earlier, while smaller molecules, such as smRNAs, will enter the pores and elute later. ^ Collect fractions from the column as they elute, typically in 1 mL (range 0.2 – 1 mL) or appropriate volume fractions, and store them in collection tubes on ice. Optional: Monitor the elution process using appropriate detection methods such as absorbance at 254 nm or specific assays to determine the presence of the molecules of interest. ^ Quantify the smRNAs in the collected fractions using the Qubit™ miRNA Assay Kit (Thermo Fisher, cat. no. Q32881) or other suitable quantification methods. ^ Optionally, analyze the separated fractions by other techniques, such as Western blotting or qPCR, to validate the separation and presence of specific biomolecules. ^ Use the fraction containing the ribosomes for downstream applications, such Dart-RNAseq. Perform the entire size exclusion experiment in biological triplicates to ensure robustness and reliability of the results. Schematic description Dart-RNAseq analysis Small RNA enrichment. Before starting with dart-RNA seq analysis, small RNA (smRNA) enrichment is performed using column-based or beads-based approach. Cell lines, flash frozen tissues and whole blood can be used as source for dart-RNA seq analysis. For smRNA enrichment, several commercial kits can be used, such as mirVana (ThermoFisher), miRNeasy (Qiagen), RNA Clean and Concentrator (Zymo), Agencourt beads (Beckman). Step (d). Phosphorylation. Upon small RNA enrichment (<200 nt), 3'P RNA will be subjected to 5' phosphorylation by T4 Polynucleotide kinase (T4 PNK 3' Minus), according to the protocol indicated in Table 1. Table 1 Incubate the reaction for 1h at 37 °C in a thermal cycler. Purify the reaction through the RNA Clean & Concentrator™-5 kit, following the protocol for small RNAs and performing the final elution in a volume of 6 µL of nuclease-free water (NFW). Step (e). Ligation. 3'P RNA phosphorylated at both termini is ligated to a first RNA-based adapter (having a sequence selected from SEQ ID No.: 120-124) containing 2-3 abasic sites, 8 degenerated nucleotides, a Fluor Uridine at 3' terminus and partial SP1 sequence, via RtcB ligase. The first RNA-based adapter has formula (I) as disclosed above. The elements constituting formula (I) reads on: - SEQ ID NO.: 120 as follows: Nx: 1-4 nt; L1: 5-28 nt; Az: 29-31; PR1 (the first nucleic acid domain of the Illumina adapter construct): 32-51 nt; Ny: 52-55 nt; B: 56 nt; - SEQ ID NO.: 121 as follows: Nx: 1-4 nt; L1: 5-28 nt; Az: 29-31; PR1 (the first portion of the first nucleic acid domain of the Illumina adapter construct): 32- 51 nt; Ny: 52-55 nt; C2: 56-63; B: 64 nt; - SEQ ID NO.: 122 as follows: Nx: 1-4 nt; L1: 5-28 nt; Az: 29-31, PR1 (the first portion of the first nucleic acid domain of the Illumina adapter construct): 32- 51 nt; Ny: 52-55 nt; C2: 56-63; B: 64 nt; - SEQ ID NO.: 123 as follows: Nx: 1-4 nt; C1: 5-12 nt; L1: 13-36 nt; Az: 37- 39; PR1 (the first portion of the first nucleic acid domain of the Illumina adapter construct): 40-59 nt; Ny: 60-63 nt; B: 64 nt; - SEQ ID NO.: 124 as follows: Nx: 1-4 nt; C1: 5-12 nt; L1: 13-36 nt; Az: 37- 39; PR1 (the first portion of the first nucleic acid domain of the Illumina adapter construct): 40-59 nt; Ny: 60-63 nt; B: 64 nt. RtcB ligase will join 5'OH termini of the first RNA-based adapter to a 3'P / 3'cP termini of small RNAs, when present, according to the protocol indicated in Table 2. Table 2 The amount of the first RNA-based adapter depends on the smRNAs amount starting material, as described in table 3 below. Table 3 Incubate 1 hour at 37 °C in a thermocycler. Add nuclease free water up to 50 µL final volume, then purify the reaction through the RNA Clean & Concentrator™-5 kit, following the protocol for small RNAs and performing the final elution in a volume of 8 µL of nuclease free water. Step (f). Circularization The RtcB ligation product is subjected to circularization trough the ligation of 5'P termini and 3'OH termini by T4 RNA ligase 1. Reaction conditions are indicated in Table 4. Table 4 RtcB lig. product 8uL 8 µL Incubation for 2h at 25 °C. Add nuclease free water up to 50 µL final volume, then purify the reaction through RNA Clean & Concentrator™-5 kit, following the protocol for small RNAs and performing the final elution in a volume of 10 µL of nuclease free water. OPTIONAL STOPPING POINT (store at -80°C). Step (g). Reverse Transcription (Superscript III) For the generation of single strand cDNA, the reverse transcription reaction is carried out using a first reverse transcription primer (SEQ ID No.: 125) having formula (II) as disclosed above. The elements constituting formula (II) reads on the SEQ ID NO.: 125 as follows: R2 (the second nucleic acid domain of the Illumina adapter construct): 1-34 nt; Nz: 35-38; D1: 39-59 nt. The reagents are mixed in the amounts indicated in Table 5 below. Table 5 Heat the circular RNA-primer mix at 70°C for 5 minutes, and then incubate on ice for at least 1 minute. Add to the annealed RNA the reagents in the amounts indicated in Table 6. Table 6 Incubate 40 mins at 50 °C, then heat the mix for 5 min at 80 °C. Step (h). PCR amplifications First PCR KAPA Master mix or Phusion Master mix can be used. The first PCR amplification is carried out using a first pair of primers (SEQ ID No.: 126 and 127) having formula (III) and (IV) as disclosed above. The elements constituting formula (III) reads on the SEQ ID NO.: 126 as follows: T1 (the second portion of the first nucleic acid domain of the Illumina adapter construct): 1-13 nt; T2: 14-33 nt. Element T3 of formula (IV) corresponds to the entire sequence SEQ ID No.: 127. The reagents are mixed in the amount indicated in Table 7 applying the reaction conditions indicated in Table 8. Table 7 Table 8 Purify the reaction using Ampure XP beads 1.6x ratio. Final product is eluted in a total volume of 40 µL of nuclease free water. Second PCR. KAPA Master mix or Phusion Master mix. The second PCR amplification is carried out using a second pair of primers having the formula (V) and formula (VI), respectively, as disclosed above. The elements constituting formula (V) are preferably the following ones: Q1 is the third nucleic acid domain of the Illumina adapter construct and has the nucleotide sequence set forth in SEQ ID No.: 128; Q2 is the fourth nucleic acid domain of the Illumina adapter construct and has a sequence selected from the sequences i5 by Illumina (10 nt); Q3 has the nucleotide sequence set forth in SEQ ID No.: 129. The elements constituting formula (VI) are preferably the following ones: Q4 is the fifth nucleic acid domain of the Illumina adapter construct and has the nucleotide sequence set forth in SEQ ID No.:130; Q5 is the sixth nucleic acid domain of the Illumina adapter construct and has a sequence selected from the sequences i7 by Illumina (10 nt); Q6 has the nucleotide sequence set forth in SEQ ID No.: 131. The reagents are mixed in the amount indicated in Table 9 applying the reaction conditions indicated in Table 10. Table 10 Use Agencourt XP beads (1.6x ratio) or NucleoSpin Gel and PCR CleanUp kit to purify the entire 100 µl PCR reaction. Agencourt XP beads: follow manufacturer's instructions and elute the sample in 40 µL of nuclease-free water. Nucleospin Gel columns: follow the standard protocol in Section 5.1 of the manufacture manual. Elute each sample in 20 µl of NFW. Run the final PCR on a native 10% acrylamide gel and cut out the band at around 200 nt (figure 8). The quality of the final library is checked at the bioanalyzer or similar (e.g. tapestation, QIAxcel) to test the length distribution of the PCR product and to define the average length of the library, which has to be between 190 nt and 300 nt. The final concentration of the library is tested by a qPCR with P5 (AATGATACGGCGACCACCGAGATCTACAC - SEQ ID No.: 140) and P7 primers (CAAGCAGAAGACGGCATACGAGAT - SEQ ID No.: 141). The concentration should be higher than 0.5 nM. The library quality check is performed as follows: 1.1 Evaluate each size selected library by Agilent 2100 Bioanalyzer using the Agilent High Sensitivity DNA Kit. 1.2 Use the library profile results to determine whether each sample is suitable for sequencing. Successful library production should yield a major peak at ~200 bp. 1.3 Perform a qPCR analysis using P5 and P7 primers on each final Dart- RNAseq library Successful library production should yield a final concentration of at least 0.1 nM. Step (i). Sequencing of the amplification product Sequencing of the amplified product is described by, but not limited to, the following steps: 1. Library denaturation and clustering: In this step, the library is denatured to separate the two DNA strands and then loaded onto a flow cell or sequencing chip. The library molecules are immobilized and amplified into clusters through bridge amplification or other cluster generation methods. Each cluster represents a cluster of identical DNA fragments. 2. Actual sequencing: Once the clusters are formed, sequencing is performed. The specific sequencing method may depend on the platform used (in the present case Illumina). The sequencing-by-synthesis method, where fluorescently-labeled nucleotides are added sequentially and their incorporation detected, is commonly employed. 3. Base calling and image analysis: During sequencing, the fluorescence signals or other detection signals are captured and converted into base calls. The base calls represent the nucleotide sequence of the DNA template. Image analysis software processes the raw data to generate base calls for each cluster. 4. Data processing and analysis: after sequencing, the raw data is processed to remove sequencing errors, adapter sequences, and low-quality reads. The resulting high-quality reads are then aligned to a reference transcriptome to generate the final sequence information. 5. Data Interpretation: The final step involves interpreting the sequenced data to extract meaningful biological information. This is performed as described in "NGS data analysis" in the section entitled "Materials and Methods". Step (j). The control Steps (e) to (i) are carried out on at least one control sample, wherein the control sample is a not stressed cellular sample. Steps (k-l). Identification of the 3'P RNA as ribosome modulator The identification of the 3'P RNA as ribosome modulator is carried out as follows: a. mapping on the reference genome or transcriptome the sequence of the at least one 3'P RNA contained in the amplification product obtained for the working sample and the control; and b. calculating for the at least one 3'P RNA contained in the amplification products obtained for the working sample and the control sample: (i) the number of counts, (ii) the Dart-RNAseq p- value, (iii) the Dart-RNAseq fold change of the number of counts or the Dart-RNAseq fold change of a normalized parameter based on the number of counts in the working sample versus the control sample, (iv) the cleavage pattern, (v) the normalized counts based on sequencing depth, (vi) the multimapping score and (vii) the length of the 3’P RA sequence. The 3'P RNA is a ribosome modulator if the 3'P RNA contained in the amplification product of the working sample fulfils the following conditions: − number of counts > 200, − Dart-RNAseq p-value: ≤ 0.05, − Dart-RNAseq fold change ≥ 2 or ≤ 0.5, and − cleavage pattern ≤ 40% per-base cleavage frequencies along the 3'P RNA length and ≥ 60% per-base cleavage frequencies on the 5' and 3' ends of the 3'P RNA. Further conditions useful for determining if the 3'P RNA is a ribosome modulator are: − normalized counts based on sequencing depth > 5, − multimapping score ≤ 100, − length > 15 and < 200 nt. Schematic description of 3'P-qPCR assay Step (m').3'P ligation. Small RNA phosphorylated at 5' termini, will be ligated to a second RNA- based adapter (SEQ ID No.: 132) having formula (IX) as disclosed above, with 3 abasic sites, via RtcB ligase. The elements constituting formula (IX) reads on the SEQ ID NO.: 132 as follows: E1: 1-24 nt; Az: 25-27, E2: 28-48 nt. RtcB ligase will join 5'OH termini of the second RNA-based adapter to a 3'P / 3'cP termini of small RNAs, when present, according to the protocol indicated in Table 12. Table 12 The amount of second RNA based adaptor (Linker_qPCR, SEQ ID No.: 132) depends on the smRNAs starting material, as described in table 13 below. Incubate 1 hour at 37 °C in a thermocycler. Add nuclease free water up to 50 µL final volume, then purify the reaction through the RNA Clean & Concentrator™-5 kit, following the protocol for small RNAs and performing the final elution in a volume of 8 µL of nuclease free water. Step (n'). Circularization The RtcB ligation product is subjected to circularization trough the ligation of 5'P termini and 3'OH termini by T4 RNA ligase 1. Reaction conditions are indicated in Table 14. Table 14 Incubation: 2h at 25 °C. Add nuclease free water up to 50 µL final volume, then purify the reaction through RNA Clean & Concentrator™-5 kit, following the protocol for small RNAs and performing the final elution in a volume of 10 µL of nuclease free water. OPTIONAL STOPPING POINT (store at -80°C). Step (o'). Reverse Transcription (Superscript III) For the generation of second single strand cDNA, the reagents are mixed in the amounts indicated in Table 15. The second reverse transcription primer (SEQ ID NO.: 133) has formula (X) as disclosed above. The elements constituting formula (X) reads on the SEQ ID NO.: 133 as follows: G: 1–19 nt; F1= 20-35 nt. Table 15 Heat the circular RNA-primer mix at 70°C for 5 minutes, and then incubate on ice for at least 1 minute. Add to the annealed RNA the reagents in the amounts indicated in Table 16. Table 16 Incubate 40 mins at 50 °C, then heat the mix for 5 min at 80 °C. Step (p').3'P-qPCR A first and a second qPCR amplification of the at least one second single strand cDNA molecule are carried out in parallel, wherein: (i) the first qPCR amplification is carried out using a fourth pair of primers selected from Set1, Set2 and Set3 as disclosed above. The elements H1, and H2 of formulas (XIa, XIa', XIa", XIIa, XIIa' and XIIa") have a fixed sequence, while the elements M and N must have a specific sequence annealing on the 3'P RNA under analysis; (ii) the second qPCR amplification is carried out using a fifth pair of primers comprising a fifth forward and a fifth reverse primer (SEQ ID No.: 138 and 139) having formula (XIII) and (XIV), respectively. The qPCR amplification was performed by SYBR™ Green PCR Master Mix for all qPCR amplification steps. Table 17 Table 18 The melting temperature must be adjusted depending on the specific primers used for amplification. Step (q'). The control Steps (m') to (p') are carried out on at least one control sample, wherein the control sample is a not stressed cellular sample. Step (r'). Determining the Ct values The quantitative analysis of qPCR is obtained through analysis of the quantification of cycle values (Ct or threshold cycles) given by the qPCR instrument. As the cycle value (Ct) increases, the detected fluorescence also increases. When the fluorescence crosses an arbitrary line, the device records the cycles value until then, which is known as the Ct value. The quantity of the 3'P RNA in a given sample is then determined using a relative or comparative quantification. The Ct values for the at least one 3'P RNA are determined in the second and third amplification products of each working sample. Steps (s'-t'). Calculation of the 3'P-qPCR fold change Relative or comparative quantification uses the difference in Ct as a determinant of the differences in concentration of the 3'P RNA in the working sample and the control sample. The calculation of the 3'P-qPCR fold change of the Ct values for the at least one 3'P RNA is done according to the formula: 3′P qPCR fold change wherein wherein - Ct(A)3'P is the Ct value for the 3'P RNA determined in the working sample, - Ct(B)3'P is the Ct value for the 3'P RNA determined in the control sample, - Ct(A)adp is the Ct value for the second RNA-based adapter determined in the working sample, - Ct(B)adp is the Ct value for the second RNA-based adapter determined in the control sample. The 3'P RNA is a ribosome modulator if the 3'P-qPCR fold change value ≥ 2 or ≤ 0.5. Schematic description of assays to monitor protein production This protocol is a general guideline for the generation of a treated sample and may need to be optimized based on treatments. The appropriate controls to ensure the accuracy and validity of the experimental results is important. Example of generation of a treated sample for puromycilation assay: − Seed MCF7 cells at a density of 2 × 105cells in a 6-well plate. − Allow the cells to grow in the appropriate culture medium until they reach 70% confluence. − For treated sample, 1nM or 100 nM of 3’P_Ile_TAT or Ile AAT (synthetic version) were transfected using Lipofectamine RNAiMAX (ThermoFisher) reagents in an Opti-MEM medium according to the manufacturer’s instructions. Alternatively, JetPRIME (Polyplus Transfection), Fugene HD (Promega), X- tremeGENE (Roche), Metafectene (Biontex), ViaFect (Promega), Effectene (Qiagen), PEI (Polyethylenimine), TransIT (Mirus Bio), Magnetofection (OZ Biosciences), GeneJammer (Agilent Technologies), NanoFect (Qiagen) can be used according to their manufacturer’s instructions. − For no-treated sample, add only Lipofectamine RNAiMAX reagents in an Opti- MEM medium according to the manufacturer’s instructions. Alternatively, all the transfection reagents listed above can be used. Puromycilation assay: − After 24 hours of treatment with synthetic version of the Ile_TAT or Ile_AAT, add to the cell culture media 10 µg / mL (alternatively between 1 and 30 µg / mL can be used) of Puromycin for 10 minutes to label puromycin-tagged proteins. − Lysate the cells by adding 60 uL of RIPA buffer supplemented with 1x Proteinase inhibitor cocktail to the cells. − Quantify the protein concentration in the cell lysate using the BCA protein quantification assay. Alternatively, can be used any other commercial kit for protein quantification. − Load 10 µg of total protein from each sample onto a 12% SDS-PAGE gel. − Transfer the proteins from the gel to a nitrocellulose membrane (GE Healthcare). − Stain the membrane with Ponceau buffer for 5 minutes at room temperature and scan it using an imaging system for western blot (e.g Chemidoc, iBright and similar) to determine the total protein levels in each lane. − Use the Ponceau signal intensity of total protein for each lane to normalize the data. − Detect puromycin-tagged proteins by incubating the membrane with anti- Puromycin antibody (1:1000) overnight at 4°C, followed by washing in TBS- Tween buffer and incubation with secondary antibody conjugated to HRP for 1 hour. − Visualize the protein signal using Pierce™ ECL Western Blotting Substrate (ThermoFisher) as instructed by the supplier. Alternatively, can be used any other commercial HRP substrate. − Compare signal intensity of puromycin-labeled proteins of the treated sample with the signal intensity of puromycin-labeled proteins of the no-treated sample. − Perform all experiments in triplicates for statistical analysis and to ensure reproducibility. IVTT assay: − Prepare the IVTT reaction mix using the 1-Step Human Coupled IVT Kit from Thermo Fisher, in a final volume of 25 µL (range 10-50 uL). Alternatively, can be used any other commercial kit for IVTT experiments. − Add 0.5 µg of pCFE-GFP plasmid to the IVTT reaction. Alternatively, any other plasmid encoding for one specific protein can be used. − Add the 3'P_Ile_TAT synthetic oligo at different concentrations (ranging from 0.01 nM and 1000 nM, preferably between 0.1 nM and 1 nM) to the respective IVTT reactions. These reactions mix will represent the treated samples. − As a no treated sample, prepare the IVTT reaction mix, supplemented with 0.5 µg of pCFE-GFP plasmid (alternatively between 0.1 µg and 3 µg can be used). − Incubate all the IVTT reactions at 37°C for 2 hours. Incubation time and temperature may vary according to the experimental setting. Incubation temperature can range between 25°C and 40°C. Incubation time can range from 30 min to 24 hours. − After the incubation, stop the reactions by adding an appropriate stopping buffer or transferring the reactions to -20°C for storage. − Load 3 uL of each IVTT reaction onto 12% SDS-PAGE gel. − Run the SDS-PAGE gel at 100V for 1 h and transfer the proteins from the gel to a nitrocellulose membrane using Western blotting. − Stain the nitrocellulose membrane with Ponceau buffer for 5 minutes at room temperature and scan it using an imaging system for western blot (e.g Chemidoc, iBright and similar) to visualize the total protein bands. This step is for data normalization. − Detect GFP expression using an anti-GFP antibody at a 1:1000 dilution. Incubate the membrane with the primary antibody for 1 hour at room temperature. − Wash the membrane and then incubate it with a secondary antibody conjugated to HRP for 1 hour. − Detect the protein signal using Pierce™ ECL Western Blotting Substrate (Thermo Fisher) according to the supplier's instructions. Alternatively, all commercially available HRP substrate can be used. − Compare signal intensity of GFP protein of the treated sample with the signal intensity of GFP protein of the no-treated sample. − Perform all experiments in triplicates to ensure reproducibility and statistical analysis. Other assays to monitor protein production are: - Pulse-Chase Labeling as described in Ong, S.-E. et al. 200221or similar protocols. - Sucrose Density Gradient Centrifugation as described in Héloïse Chassé at al.201724, or similar protocols. - Ribosome Profiling as described in Ingolia, N.T. 201629and Chothani, S., et al 201930, or similar protocols. - AHARIBO as described in Minati, L. et al.202131. - FRET as described in Wan-Jung, L. et al.201832, or similar protocols. - Single-Molecule Imaging of translation as described in Wu, B. et al 201622, or similar protocols. - BONCAT as described in Glenn, W. S. et al.201723, or similar protocols. - OPP labeling as described in Nagelreiter, F. et al. 201833, or similar protocols. RESULTS 3' P-tRFs enriched on ribosomes To understand if 3'P-tRFs affect translation through a direct association with ribosomes, we first assessed whether specific 3'P RNA fragments are enriched on ribosomes upon oxidative stress. We used MCF7 cells treated or not with arsenite, a compound that causes oxidative stress and global inhibition of protein synthesis. We compared Dart-RNAseq profiling from fractions collected upon subcellular fractionation, i.e., sequential ultracentrifugation steps leading to the purification of a clean ribosome pellet (RSW) (Figure 1), on both arsenite treated (working sample) and not-treated (control sample, NT) MCF7 cells (Ars+). To check whether changes on the ribosome pellet reflect an increasing global amount of 3'P tRFs in the cell, we also performed Dart-RNAseq on the whole lysate (named RNA input) as well. Reads length distribution on RNA inputs ranged from 15 nt to 50 nt (figure 2A), with two major peaks at around 20 nt and 35 nt. More than 50% of reads were mapping on tRNAs for both control and arsenite treated samples (Figure 2B). All RSW samples showed a length distribution between 15 nt and 50 nt (Figure 2A), with a major peak at 20 nt for non-treated sample and a more homogenous distribution for arsenite treated samples. By looking at the relative tRNAs amount, we observed a higher enrichment of tRNA in control sample compared to arsenite treated cells (25% vs 5%) (Figure 2B). After differential expression analysis, we observed no significant enrichment of 3'P RNA in inputs, while we identify 47 differentially expressed 3'P- tRFs in RSW (data were filtered for ncounts >300; p-val<0.05 and Log2FC>1 or <- 1), of which 17 leads enriched in the RSW of the control sample (table 19, positive 3’P ribosome modulator) and 30 leads enriched in RSW of arsenite treated sample (table 20, negative 3’P ribosome modulator). Table 19. List of 3'P tRFs enriched in Ribosome pellet (RSW) of control sample (NT). All 3’P tRFs are putative 3’P ribosome modulators deriving from human cell line (MCF7). Table 20. List of 3'P tRFs enriched in Ribosome pellet (RSW) of Arsenite treated sample (working sample). All 3’P tRFs are putative 3’P ribosome modulators deriving from human cell line (MCF7). A drawback of this experimental set-up (based on cushioning after arsenite treatment) is the formation of stress granules induced by oxidative stress, which could aggregate and co-sediment with ribosomes during ultracentrifugation (Figure 3), possibly leading to misinterpretations of our 3' P RNA analysis. This hypothesis was confirmed by the presence of TIA1 protein (a marker of stress granules) in the RSW pellet (Figure 3). To better identify 3'P-tRFs bound to ribosomes, we performed Dart- RNAseq after fractionation of the cell lysate on a sucrose gradient. We isolated both 80s and polysomes fractions (Figure 4) from both control and working samples. After Ars treatment, polysomes are no longer detectable, hampering the preparation of any library for sequencing. After sequencing of 80S from arsenite treated cells (working sample) as well as from polysome fractions of the control, we compared the 3' P tRFs expression profile. Only 14 tRfs were enriched in polysome fractions (table 21, filtered for ncounts >200; p-val<0.05 and log2FC>1), while 56 leads were enriched in 80s arsenite treated samples (working samples) (table 22). To further confirm our results, we matched all 3'P-tRFs enriched on subcellular and polysome profiling (RSW and 80s respectively), resulting in the identification of Ile-TAT fragment as the only fragment in common between the two experiments (negative 3’P ribosome modulator) (Figure 5). This fragment is a 23 nt long RNA spanning from position 36 (in the anticodon loop) to nucleotide 58 of the related tRNA (Figure 6). Table 21. List of 3'P tRFs enriched in polysome fractions of control sample (NT). All 3’P tRFs are putative 3’P ribosome modulators deriving from human cell line (MCF7). Table 22. List of 3'P tRFs enriched in 80s fraction of Arsenite treated samples (working sample). All 3’P tRFs are putative 3’P ribosome modulators deriving from human cell line (MCF7). 3'P-Ile_TAT qPCR validation To validate Dart-RNAseq data we performed a 3' P qPCR on 3'P-Ile_TAT fragment (Figure 7A). To precisely amplify our fragment of interest, we designed a couple of primers at the junction between the adaptor and the fragment). As negative control, we designed primers on another fragment (Figure 7A) derived from Ile-AAT (3'P-Ile_AAT), which expression is not changing upon arsenite treatment. We confirmed that both 3'P-Ile_TAT and 3'P-Ile_AAT are not differentially expressed when considering the total cell lysate (input) (figure 7B), while we observed a 3-fold enrichment of 3'P-Ile_TAT on 80S compared with polysomes of arsenite treated cells (Figure 7C). Overall, these results confirmed that 3'P-Ile_TAT is enriched on ribosomes after treatment, suggesting that this specific 3'P-tRF could be involved in ribosomes inactivation and inhibition of protein synthesis; therefore, we confirmed 3'P-Ile_TAT as 3’P ribosome modulator. In vitro-translation assay to monitor protein production Since 3'P-Ile_TAT is associated to non-translating ribosomes, we asked whether this fragment is a consequence of the reduced protein synthesis or is cooperating in inhibiting translation (actual "3’P ribosome modulator"). To answer this question, we performed an in-vitro transcription / translation (IVTT) assay, looking at the variation of GFP expression after addition of a synthetic 3'P-Ile_TAT. We noted that our tRFs mimic was able to reduce by itself the GFP expression after 2h of treatment at concentrations of 1 nM and 0.1 nM (Figure 8). Nascent peptide analysis Prompted by the evidence that 3'P-Ile_TAT inhibits translation in-vitro, we tested whether the fragment affects global protein synthesis in vivo. We transfected MCF7 with the synthetic 3'P-Ile_TAT, using 3'P-Ile_AAT as negative control, and we measured the effect on protein synthesis by a puromycilation assay34. Treatment with 3'P-Ile_TAT at 100 nM resulted in a 50% downregulation of global protein synthesis compared to the control sample (NT) (Figure 9), while no statistically significant effects on protein synthesis is observed at 1 nM. We did not observe significant reduction of protein synthesis upon treatment with the control oligo (3'P- Ile_AAT) at both 100 nM and 1 nM concentrations (Figure 9), confirming that the effect on translation is due to the specific 3'P-Ile_TAT fragment. We defined 3'P- Ile_TAT as "3’P ribosome modulator (or 3’PRM or PRM). Conclusion Little is known about RNAs able to modulate ribosomes function by direct interaction with the macromolecular complex. Among non-coding RNAs, tRFs are a class of RNAs derived from the global tRNA pool35. Recent findings demonstrated that tRFs can be used as inter cellular signalling molecules36(released in biological fluids) or intra cellular modulator of several cellular processes, to quickly adjust the environment to external stimuli37. For example, oxidative stress induces enzymatic tRNA cleavage, and fragments generated could contribute to the global inhibition of translation16. Nevertheless, the underline mechanism of action of tRFs is almost entirely unknown, due to the lack of accurate and high-resolution methods for fragments quantification. In this study, we focused our attention on the analysis of 3' P tRFs enriched on ribosome after oxidative stress. We leveraged on two ribosome-purification methods (subcellular fractionation and polysome profiling) coupled with Dart-RNAseq to specifically identify 3'P RNA fragments associated to ribosomes. Dart-RNAseq data used for target identification were validated by 3'P-qPCR. Both experiments showed an enrichment of 3'P_Ile_TAT upon arsenate treatment, suggesting a role of this specific fragment on the inactivation of ribosomes upon stress. To confirm that 3'P_Ile_TAT itself is a ribosome modulator (inhibiting protein synthesis), we tested a synthetic tRFs mimics on in-vitro and in-vivo assays. We confirmed that 3'P_Ile_TAT, but not its isoacceptor 3'P_Ile_AAT, is able to induce an inhibition of protein synthesis, suggesting a strong specificity of this non-coding RNA on ribosomes. Altogether our data (i) unravel the power of combining Dart-RNAseq and 3'P-qPCR to identify biologically relevant 3'P RNA fragments (3’P ribosome modulator, and (ii) describe the first example of a 3'P ribosome-associated (3’PRM) non-coding RNA able to modulate protein synthesis, opening new avenues for the development of PRM-based drug modulator. MATERIALS AND METHODS Cell culture and treatments MCF7 cells were seeded at 1.5 × 106cells per 100 mm dish and grown until they reached 80% confluence. Before lysis, cells were treated with 1 mM of sodium arsenite for 1h at 37°C, followed by 5 min at 37°C with 10 ug / mL of cycloheximide (CHX). The control samples were treated only with CHX. Cell lysates were obtained using a hypotonic lysis buffer (IMMAGINA Biotechnology, cat. no. #RL001-1) and centrifuged for 5 min at 14.000 rpm at 4°C to remove the cellular debris, nuclei and mitochondria. Subcellular fractionation (salt wash): MCF7 cell lysates were prepared as described above and 1 / 10 of total lysate volume was used directly for smRNA enrichment by means of Mirvana kit (Thermo Fisher, cat. n. AM1560), followed by Dart-RNAseq (input). The remaining lysates was subjected to two sequential ultracentrifugation steps as previously described in Francisco-Velilla et al., 201625. Briefly, cell lysate was centrifuged at 95000 rpm for 2 h at 4°C (in a TLA100.2 rotor) to obtain the S100 supernatant and the R pellet (ribosomes plus associated factors) fractions. The R pellet was resuspended in 200 μL of high-salt resuspension buffer (5 mM Tris-HCl, pH 7.4, 500 mM KCl, 5 mM MgCl2, 2 mM DTT, and 290 mM sucrose), loaded into a 40–20% discontinuous sucrose gradient and centrifuged at 4 °C and 95000 rpm for 2 h using a TLA100.2 rotor. The obtained pellet (pure ribosomes fraction, RSW) was resuspended in 200 μl of mirvana lysis buffer (Thermo Fisher, cat. N AM1561), followed by small RNA enrichment according to manufacturer’s instructions. Before starting with library preparation, smRNAs were quantified using the Qubit™ miRNA Assay Kit (Thermo Fisher, cat. no. Q32881). The experiment was performed in biological triplicates. Polysome profiling MCF7 cell lysates were loaded on a linear 15–50% sucrose gradient and ultracentrifuged in a SW41Ti rotor (Beckman) for 1 h and 40 min at 40.000 rpm at 4 °C in a Beckman Optima LE-80K Ultracentrifuge. After ultracentrifugation, the gradients were fractionated in 1 mL volume fractions with continuous monitoring absorbance at 254 nm using an ISCO UA-6 UV detector. smRNAs were extracted from 80s and polysome fractions using 1.8 mL of mirvana lysis buffer (Thermo Fisher, cat. N AM1561) per mL of sucrose fraction, followed by small RNA enrichment according to manufacturer’s instructions. Before starting with library preparation and 3' P qPCR, smRNAs were quantified using the Qubit™ miRNA Assay Kit (Thermo Fisher, cat. no. Q32881). The experiment was performed in biological triplicates. Dart-RNAseq 5’ phosphorylation and adaptor ligation smRNAs previously purified from cell lysate input, RSW or from polysome fractions, were used for library preparation. In particular, 50 ng of small RNA were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat no. M0236S), according to manufacturer's instructions. Small RNAs were purified using RNA Clean & Concentrator™-5 column (Zymo Research, cat. no. R1013) and ligated to an RNA adaptor, via RtcB (NEB cat. N° M0458S), according to the following conditions: 50 ng of small RNA, 0.1 pmol of adaptor, 15 pmol RtcB, 1x RtcB Buffer (50 mM Tris-HCl, 75 mM KCl, 10mM DTT), 150 μM GTP, 1.8 mM mM MnCl2 in a final volume of 10 μl. The reaction was incubated 1 h at 37°C and then purified by RNA Clean & Concentrator™-5 column. The first RNA adaptor (RNA based adaptor, listed in Table x) includes (i) part of SP1 sequence necessary for Illumina sequencing, (ii) 8 degenerated nucleotide used as unique molecular identifiers (UMIs), (iii) 3 abasic sites, that allow for RT enzyme stop and generation of single strand cDNA, and (iv) a final fluoro-uridine that prevents RNAse degradation. Circularization The circularization of the adaptor-ligated RNA (RNA:adaptor) was carried out at 25°C for 2 h, in a total volume of 20 μl containing 10 U of T4 RNA Ligase 1 (NEB, cat. no. M0204L), 1× T4 RNA ligase buffer (50 mM Tris-HCl, 1 mM MgCl2, 1 mM DTT), 20% PEG8000, 50 μM ATP. Circular RNA was purified by using RNA Clean & Concentrator™-5 column (Zymo research, cat. no. R1013). RT and PCR amplification For the generation of single strand cDNA, circular RNA was subjected to reverse transcription using Superscript III enzyme (Thermo Fisher cat. N° 18080093) according to the following conditions: 200 uM dNTPs mix, 10 uM RT primer (listed in table x), 1x RT buffer, 5 mM DTT. The RT primer include full SP2 sequence necessary for Illumina sequencing and 4 degenerated nucleotides for UMIs. The mix was incubated at 70°C for 5 min to allow circular RNA denaturation, followed by 2 min on ice, 40 min at 50°C and 5 min at 80°C to heat inactivate the RT enzyme. After linear single strand cDNA formation, RT reaction mix was amplified by two PCR step. The first PCR amplification led to cDNA amplification and inclusion of full SP1 sequence by forward primer. The second PCR amplification step is required for integration of Unique dual indexes (UDIs) adapter needed for Illumina sequencing. Briefly, first PCR step was performed according to following conditions: 20 uL of RT reaction, 0.8 uM SP1 Fw primer and 0.8 SP2 rev primer, 1x Phusion high- fidelity master mix (Thermo Fisher, cat. N° F531S), in a final volume of 100 uL. PCR mix was amplified in 0.2 tube in a thermocycler as follow: 1min 98°C, 8x cycles at 98°C for 30 sec, 61°C for 30 sec, 72°C for 10 sec. The reaction was then purified by 1.6x volume Agencourt AMPure XP beads (Agencort, cat. N° A63882) according to manufacturer’s instruction. Purified DNA was used for second PCR step: 40 uL of PCR 1, 1.5 uM UDIs adapter (Eurofins, set n°48 / 1), 1x Phusion high-fidelity master mix (Thermo Fisher, cat. N° F531S), in a final volume of 100 uL. PCR mix was amplified in 0.2 tube in a thermocycler as follow: 1min 98°C, 6x cycles at 98°C for 30 sec, 60°C for 30 sec, 72°C for 10 sec. The reaction was then purified by NucleoSpin Gel and PCR CleanUp kit. All the sequence used for Dart-RNAseq library preparation are listed in table x. Library gel purification and sequencing The final library was loaded on 10% TBE-gel (Thermo Fisher, cat n°EC6275BOX), run at 200 V for 1h, stained with Sybr™ Gold (Invitrogen, cat. no. S11494) and scanned using Chemidoc (GE Healthcare, Piscataway, NJ). To remove adapter dimer contamination, the correct band at 200 nt was isolated from the gel, crushed and soaked overnight in Buffer II (Immagina Biotechnology srl, cat. no. #KGE002) at room temperature with constant rotation. The aqueous gel debris was filtered with Millipore ultrafree MC tubes and then precipitated with isopropanol (Sigma, cat. no. I9516) at −80°C for 2 h or overnight. After precipitation, samples were centrifuged for 30 min at 12000 g, 4°C. The pellet was washed once with 70% ethanol, centrifuged at 12000 g for 5 min at 4°C, air-dried and resuspended in 12 uL of nuclease free water. To evaluate the correct length, each size selected library was checked by Agilent 2100 Bioanalyzer using the Agilent High Sensitivity DNA Kit, while a qPCR using P5 and P7 primers was used for high accurate library quantification. The final pool was sequenced with 100 cycles single-read on an Illumina Novaseq. NGS data analysis NGS data obtained from cell line or mouse liver tissues were trimmed with Cutadapt by removing 3′ terminal adapter. UMIs were extracted using UMI-tools extract (Smith, 2017). Trimmed reads of length under 10 nucleotides were discarded. The remaining reads were then aligned to the correspondent genome. The generated BAM file, used for following analysis using tRAX pipeline (Holmes AD et al 2022) published on bioRxiv (a free online archive and distribution service for unpublished preprints in the life sciences). Differential expression analysis was performed using DEseq238. Hits from differential expression analysis were selected according to the following filters: − Read counts: ≥ 200 counts − Dart-RNAseq Log2 FC: ≥ 1 for upregulated and ≤ -1 for downregulated compared with control sample. − Dart-RNAseq p-val: ≤ 0.05, or any statistical parameter that ensure a statistically robust threshold among samples. − cleavage pattern: the fragment of interest has to show clear cleavage site, i.e. ≤ 40% per-base cleavage frequencies along fragment length and ≥ 60% per-base cleavage frequencies on the 5' and 3' termini of the fragment. − Multimapping score: ^ (For all fragments): only fragments with ≤ 100 multimap are accepted ^ (for tRNA fragments): only fragments with ≤ 100 multimap are accepted. Of those we further classify tRFs as follow: ▪ transcript specific (reads that uniquely map to the corresponding tRNA transcript sequence); ▪ isodecoder specific (reads that map uniquely to the transcripts with the corresponding anticodon); ▪ isotype specific (reads that map only to transcripts of the corresponding tRNA isotype); ▪ not amino specific (reads that map to more than one tRNA isotype) ▪ In particular the following tRFs are preferred: transcript specific > isodecoder specific > isotype specific. Not amino specific are not taken into consideration. 3'P-qPCR 3'P-qPCR is based on 3'P RNA profiling methodology, in fact it shared all the step till RT reaction. The minimum amount of small RNA input material was 50 ng (quantified by QuBit miRNA assay). Specific RNA adaptor and RT primer used for 3' P qPCR are listed in table 23. For qPCR amplification, each couple of primers were designed according to following rules: − Forward and reverse primers have a length ranging between 15 and 23 nt and must be designed at the junction between the adaptor and the 3'P RNA fragment of interest, to maintain the specificity at 5’ and 3’ end of the RNA fragment. − Forward and reverse primers should anneal for at least 6 nt with the 3'P RNA fragment of interest, to confer sequence specificity. − The melting temperature should range between 58° and 63°C, with maximum 2° of differences between forward and reverse primer for each couple. − Forward and reverse primers should have minimum secondary structure and no possibility for hetero- and homo-dimer formation. The list of primers used for 3'P RNA fragments validation are listed in table y. All the qPCR amplification were performed by SYBR™ Green PCR Master Mix (Thermo Fisher, cat. N°: 4309155). Ct values for each 3'P RNA fragments are normalized using the total amount of adaptor (primers for normalization are listed in table 24). Table 23 − N are ribonucleotides that represents UMIs for PCR duplication removal after sequencing. − Underlined sequence in RNA-based adapter, linker_MC1, linker_MC2, linker_MC3, linker_MC4 correspond to part of SP1 sequence (or PR1 domain) − idSp: abasic sites to allow RT stop − 3FU: Fluoro_Uridine, to stabilize RNA from RNAse degradation. − Italic lowercase: 8nt barcode for multiplexing Table 24 In vitro transcription / translation assay (IVTT) and western blot analysis For IVTT experiment, 1-Step Human Coupled IVT Kit from Thermo Fisher (cat n.88881) was used. In particular, the reaction was carried for 2h at 37°C in a volume of 25 uL. In each reaction was added 0.5 ug of pCFE-GFP plasmid. 3'P_Ile_TAT mimic was added at different concentration (0.1 nM and 1 nM) in the reaction. Synthetic oligos were purchased by IDT and the sequences are listed in table 3. As positive control, 50 µM of Puromycin was added in the reaction, bringing to complete inhibition of translation. GFP expression was evaluated by Western blot analysis. After 2h of incubation, 3 uL of each IVTT condition was loaded on a 12% SDS PAGE and transferred to nitrocellulose membrane (GE Healthcare). Membrane was stained with Ponceau buffer (Sigma, cat n. #09189) for 5 min at room temperature and scanned using Chemidoc (GE Healthcare, Piscataway, NJ). Ponceau staining intensity of total protein for each lane was used for data normalization. For GFP detection, anti-TURBO-GFP antibody (Thermo Fisher, cat n. PA5-22688) (1:1000 dilution) was used and incubated 1h at room temperature, followed by washing and incubation for 1h with a secondary antibody conjugated to HRP (anti-rabbit, Abcam, cat n. ab99697). The protein signal was detected by using Pierce™ ECL Western Blotting Substrate (Thermo Fisher, cat n.32106) as instructed by the supplier. All experiments were performed in triplicates. Transient transfection and puromycilation assay For the transient transfection treatment, MCF7 cells were seeded at a density of 2 × 105cells in a 6-well plate and cultured for 24h in the DMEM complete medium. When 70% confluence was reached, cells were transfected for 24 h with 1nM or 100 nM of Ile_TAT or Ile AAT synthetic oligo (IDT-sequences are listed in table z) using Lipofectamine RNAiMAX reagents (Invitrogen) in an Opti-MEM medium according to the manufacturer’s instructions.24h post transfection, MCF7 cells were treated with 10 ug / mL of Puromycin for 10 minutes and then lysate with 60 uL of Ripa buffer (Thermo Fisher, cat. N. 89900) supplemented with 1x Proteinase inhibitor cocktail (Abcam, cat n°ab271306). Cell lysate was subjected to BCA protein quantification according to manufacturer’s instructions (Thermo fisher Cat n 23225) and 10 ug of total protein was loaded on 12% SDS PAGE and transferred to nitrocellulose membrane (GE Healthcare). Membrane was stained with Ponceau buffer (Sigma, cat n. 09276) for 5 min at room temperature and scanned using Chemidoc (GE Healthcare, Piscataway, NJ). Ponceau signal intensity of total protein for each lane was used for data normalization. For total protein abundance, puromycin-tagged proteins were detected by using anti- Puromycin antibody (1:1000) and incubated over night at 4°C, followed by washing and incubation for 1 h with secondary antibody conjugated to HRP (anti-mouse, Abcam, cat n. ab97023). Proteins signal was detected by using Pierce™ ECL Western Blotting Substrate (Thermo Fisher, cat n.32106) as instructed by the supplier. All experiments were performed in triplicates. Table 25
[0002] References 1. Song, P., Yang, F., Jin, H. & Wang, X. The regulation of protein translation and its implications for cancer. Signal Transduct Target Ther 6, 68 (2021). 2. Lauria, F. et al. SMN-primed ribosomes modulate the translation of transcripts related to spinal muscular atrophy. Nat Cell Biol 22, 1239–1251 (2020). 3. Clamer, M. et al. Active Ribosome Profiling with RiboLace. Cell Rep 25, 1097- 1108.e5 (2018). 4. Ingolia, N. T., Lareau, L. F. & Weissman, J. S. Ribosome Profiling of Mouse Embryonic Stem Cells Reveals the Complexity and Dynamics of Mammalian Proteomes. Cell 147, 789–802 (2011).5. Ramakrishnan, V. Ribosome Structure and the Mechanism of Translation. Cell 108, 557–572 (2002). 6. Wangen, J. R. & Green, R. Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides. Elife 9, (2020). 7. García-Rodríguez, R. et al. Premature termination codons in the DMD gene cause reduced local mRNA synthesis. Proceedings of the National Academy of Sciences 117, 16456–16464 (2020). 8. KARIJOLICH, J. & YU, Y.-T. Therapeutic suppression of premature termination codons: Mechanisms and clinical considerations (Review). Int J Mol Med 34, 355– 362 (2014). 9. Wangen, J. R. & Green, R. Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides. Elife 9, (2020). 10. Cheng, Q. et al. Selective organ targeting (SORT) nanoparticles for tissue-specific mRNA delivery and CRISPR–Cas gene editing. Nat Nanotechnol 15, 313–320 (2020). 11. Magee, R. & Rigoutsos, I. On the expanding roles of tRNA fragments in modulating cell behavior. Nucleic Acids Res 48, 9433–9448 (2020). 12. Emara, M. M. et al. Angiogenin-induced tRNA-derived Stress-induced RNAs Promote Stress-induced Stress Granule Assembly*. Journal of Biological Chemistry 285, 10959–10968 (2010). 13. Yamasaki, S., Ivanov, P., Hu, G. & Anderson, P. Angiogenin cleaves tRNA and promotes stress-induced translational repression. Journal of Cell Biology 185, 35– 42 (2009). 14. Saikia, M. & Hatzoglou, M. The Many Virtues of tRNA-derived Stress-induced RNAs (tiRNAs): Discovering Novel Mechanisms of Stress Response and Effect on Human Health. Journal of Biological Chemistry 290, 29761–29768 (2015). 15. Kim, H. K. et al. A transfer-RNA-derived small RNA regulates ribosome biogenesis. Nature 552, 57–62 (2017). 16. Ivanov, P., Emara, M. M., Villen, J., Gygi, S. P. & Anderson, P. Angiogenin- Induced tRNA Fragments Inhibit Translation Initiation. Mol Cell 43, 613–623(2011). 17. Honda, S. et al. Sex hormone-dependent tRNA halves enhance cell proliferation in breast and prostate cancers. Proceedings of the National Academy of Sciences 112, E3816–E3825 (2015). 18. Boulter, N. et al. A simple, accurate and universal method for quantification of PCR. BMC Biotechnol 16, 27 (2016). 19. Pfaffl, M. W. Relative expression software tool (REST(C)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30, 36e–336 (2002).20. Del Piano, A. et al. Phospho-RNA sequencing with circAID-p-seq. Nucleic AcidsRes 50, e23–e23 (2022). 21. Ong, S.-E. et al. Stable Isotope Labeling by Amino Acids in Cell Culture, SILAC, as a Simple and Accurate Approach to Expression Proteomics. Molecular & Cellular Proteomics 1, 376–386 (2002). 22. Wu, B., Eliscovich, C., Yoon, Y. J. & Singer, R. H. Translation dynamics of single mRNAs in live cells and neurons. Science (1979) 352, 1430–1435 (2016). 23. Glenn, W. S. et al. Bioorthogonal Noncanonical Amino Acid Tagging (BONCAT) Enables Time-Resolved Analysis of Protein Synthesis in Native Plant Tissue. Plant Physiol 173, 1543–1553 (2017).24. Chassé, H., Boulben, S., Costache, V., Cormier, P. & Morales, J. Analysis oftranslation using polysome profiling. Nucleic Acids Res gkw907 (2016) doi:10.1093 / nar / gkw907. 25. Francisco-Velilla, R., Fernandez-Chamorro, J., Ramajo, J. & Martinez-Salas, E. The RNA-binding protein Gemin5 binds directly to the ribosome and regulates global translation. Nucleic Acids Res 44, 8335–8351 (2016). 26. Simsek, D. et al. The Mammalian Ribo-interactome Reveals Ribosome Functional Diversity and Heterogeneity. Cell 169, 1051-1065.e18 (2017). 27. Heiman, M., Kulicke, R., Fenster, R. J., Greengard, P. & Heintz, N. Cell type– specific mRNA purification by translating ribosome affinity purification (TRAP). Nat Protoc 9, 1282–1291 (2014).28. Brannan, K. W. et al. Robust single-cell discovery of RNA targets of RNA-binding proteins and ribosomes. Nat Methods 18, 507–519 (2021). 29. Ingolia, N. T. Ribosome Footprint Profiling of Translation throughout the Genome. Cell 165, 22–33 (2016). 30. Chothani, S. et al. deltaTE: Detection of Translationally Regulated Genes by Integrative Analysis of Ribo‐seq and RNA‐seq Data. Curr Protoc Mol Biol 129, (2019). 31. Minati, L. et al. One-shot analysis of translated mammalian lncRNAs with AHARIBO. Elife 10, (2021). 32. Lai, W.-J. C. & Ermolenko, D. N. Ensemble and single-molecule FRET studies of protein synthesis. Methods 137, 37–48 (2018). 33. Nagelreiter, F. et al. OPP Labeling Enables Total Protein Synthesis Quantification in CHO Production Cell Lines at the Single-Cell Level. Biotechnol J 13, 1700492 (2018). 34. Marciano, R., Leprivier, G. & Rotblat, B. Puromycin labeling does not allow protein synthesis to be measured in energy-starved cells. Cell Death Dis 9, 39 (2018). 35. Watkins, C. P., Zhang, W., Wylder, A. C., Katanski, C. D. & Pan, T. A multiplex platform for small RNA sequencing elucidates multifaceted tRNA stress response and translational regulation. Nat Commun 13, 2491 (2022). 36. Zhu, L. et al. Exosomal tRNA-derived small RNA as a promising biomarker for cancer diagnosis. Mol Cancer 18, 74 (2019). 37. Akiyama, Y. et al. Selective Cleavage at CCA Ends and Anticodon Loops of tRNAs by Stress-Induced RNases. Front Mol Biosci 9, (2022). 38. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014).
Claims
Claims 1. A method of identifying at least one RNA fragment comprising a 3' phosphate or a 2' / 3' cyclic phosphate (3'P RNA) as a ribosome modulator comprising the following steps: (a) stressing a cellular sample comprising at least one 3'P RNA associated to a ribosome obtaining a working sample; (b) purifying at least one ribosome from the working sample obtaining a pure ribosome pellet, wherein the pure ribosome pellet comprises the at least one 3'P RNA associated to a ribosome, (c) extracting the at least one 3'P RNA from the pure ribosome pellet; (d) phosphorylating the at least one 3'P RNA at the 5' end obtaining at least one phosphorylated RNA fragment; (e) ligating the 3' end of the at least one phosphorylated RNA fragment to the 5' end of a first RNA-based adapter obtaining at least one first ligation product, wherein the first RNA-based adapter has formula (I): 5' OH-Nx-C1-L1-Az-PR1-Ny-C2-B-OH 3' (I) wherein - N is a ribonucleotide, - x and y are integer numbers independently selected from 1 to 20, - L1 is a first oligoribonucleotide sequence having a length comprised between 15 and 30, - A is an abasic site or a spacer allowing the arrest of a retrotranscriptase enzyme activity, - z is an integer number from 1 to 5, - PR1 is a first portion of a first nucleic acid domain of a sequencing platform adapter construct having a length comprised between 10 and 80, - B is none, or a ribonucleotide having a 2'-fluoro-base, or a ribonucleotide having a modified nucleobase conferring nuclease resistance, and - C1 and C2 are none or a barcode sequence comprising up to 20 nucleotides, provided that at least one between C1 and C2 is none; (f) self-ligating the at least one first ligation product to form at least one firstcircular RNA molecule; (g) performing a reverse transcription of the at least one first circular RNA molecule obtaining at least one first single strand cDNA molecule comprising the sequence of the at least one 3'P RNA, wherein the reverse transcription is carried out using a first reverse transcription primer having formula (II): 5' OH-R2-Nz-D1-OH 3' (II) wherein - D1 is the reverse complement deoxyoligoribonucleotide of L1, wherein complementarity of D1 to L1 is comprised between 60% and 100%, - N is a ribonucleotide, - z is an integer number from 1 to 20, and - R2 is a second nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50; (h) performing a PCR amplification of the at least one first single strand cDNA molecule obtaining at least one first amplification product, wherein the PCR amplification is carried out alternatively: (1) in two sequential steps, wherein: − the first PCR amplification is carried out using a first pair of primers, the first forward primer and the first reverse primer having formula (III) and (IV), respectively: 5' OH-T1-T2-OH 3' (III) 5' OH-T3-OH 3' (IV) wherein ❖ T1 is a second portion of the first nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50, ❖ T2 is a first DNA oligonucleotide sequence having a length comprised between 10 and 30 annealing on at least one part of the first portion of the first nucleic acid domain of the sequencing platform adapter construct, and ❖ T3 is a second DNA oligonucleotide sequence having a length comprised between 10 and 50 annealing on at least one part of the second nucleic acid domain of the sequencing platform adapterconstruct; - the second PCR amplification is carried out using a second pair of primers, the second forward primer and the second reverse primer having formula (V) and (VI), respectively: 5' OH-Q1-Q2-Q3-OH 3' (V) 5' OH-Q4-Q5-Q6-OH 3' (VI) wherein ❖ Q1 is a third nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50, ❖ Q2 is a fourth nucleic acid domain of the sequencing platform adapter construct having a length comprised between 6 and 20, ❖ Q3 is a third DNA oligonucleotide sequence having a length comprised between 10 and 50 annealing on at least one part of the first nucleic acid domain of the sequencing platform adapter construct, ❖ Q4 is a fifth nucleic acid domain of the sequencing platform adapter construct having a length comprised between 10 and 50, ❖ Q5 is a sixth nucleic acid domain of the sequencing platform adapter construct having a length comprised between 6 and 20, ❖ Q6 a fourth DNA oligonucleotide sequence having a length comprised between 10 and 50 annealing on at least one part of the second nucleic acid domain of the sequencing platform adapter construct; or (2) in one single step using a third pair of primers, the third forward primer and the third reverse primer having formula (VII) and (VIII), respectively: 5' OH-Q1-Q2-Q7-OH 3' (VII) 5' OH-Q4-Q5-Q6-OH 3' (VIII) wherein ❖ Q1, Q2, Q4, Q5 and Q6 have the meaning set forth above, and ❖ Q7 is a fifth DNA oligonucleotide sequence having a length comprised between 10 and 50, comprising at the 5’ end a second portion of the first nucleic acid domain of the sequencing platformadapter construct and annealing at the 3' end on at least one part of the first portion of the first nucleic acid domain of the sequencing platform adapter construct; (i) sequencing the at least one first amplification product obtaining the sequence of the at least one 3'P RNA comprised in the at least one first single strand cDNA molecule; (j) repeating steps (e) to (i) on at least one control sample, wherein the control sample is a not stressed cellular sample; (k) calculating for the at least one 3'P RNA contained in the first amplification products obtained from the working sample and the control sample: (1) a number of counts, (2) a Dart-RNAseq p-value, (3) a cleavage pattern and (4) a Dart-RNAseq fold change of a normalized parameter based on the number of counts in the working sample versus the control sample according to the following equation: ^^ ^^ ^^ ^^ ^^ ^^ ^^ Dart-RNAseq fold change = (^^ ^^ ^^ ^^ ^^^^ ^^ ^^ ^^ ^^ ^^ ^^^^ ^^ ^^ ^^) wherein - nCountsTreat is the normalized parameter based on the number of counts for the 3'P RNA determined in the working sample, - nCountsCTRL is the normalized parameter based on the number of counts for the 3'P RNA determined in the control sample; (l) identifying the at least one 3'P RNA associated to the ribosome as a ribosome modulator if: − the number of counts is > 200, − the Dart RNAseq p-value is ≤ 0.05, − the cleavage pattern is ≤ 40% per-base cleavage frequencies along the 3'P RNA length and ≥ 60% per-base cleavage frequencies on the 5' and 3' ends of the 3'P RNA, and − the Dart RNAseq fold change is ≥ 2 or ≤ 0.
5.
2. The method according to claim 1 comprising the further following steps: (m') ligating the 3' end of the at least one phosphorylated RNA fragment to the 5' end of a second RNA-based adapter obtaining at least one second ligation product, wherein the second RNA-based adapter has formula (IX):5' OH-E1-Az-E2-OH 3' (IX) wherein - E1 is a second oligoribonucleotide sequence having a length comprised between 15 and 30, - A is an abasic site or a spacer allowing the arrest of a retrotranscriptase enzyme activity, - z is an integer number from 1 to 5, - E2 is a third oligoribonucleotide sequence having a length comprised between 15 and 30; (n') self-ligating the at least one second ligation product to form at least one second circular RNA molecule; (o') performing a reverse transcription of the at least one second circular RNA molecule obtaining at least one second single strand cDNA molecule comprising the sequence of the at least one 3'P RNA, wherein the reverse transcription is carried out using a second reverse transcription primer having formula (X): 5' OH-G-F1-OH 3' (X) wherein - F1 is the reverse complement deoxyoligoribonucleotide of E1, wherein complementarity of F1 to E1 is comprised between 60% and 100%, and - G is a sixth DNA oligonucleotide sequence having a length comprised between 10 and 30; (p') performing in parallel a first and a second qPCR amplifications of the at least one second single strand cDNA molecule obtaining a second and a third amplification product, wherein: - the first qPCR amplification is carried out using a fourth pair of primers annealing on at least one part of the 3'P RNA sequence, the fourth pair of primers being selected from pairs of primer Set1, Set2 and Set3, wherein each pair of primers comprises a forward and reverse primer, wherein the forward and reverse primers of the pair of primers Set1 have a sequence as set forth in formulas (XIa) and (XIIa), respectively, the forward and reverse primers of the pair of primers Set2 have a sequence as set forth in formulas (XIa') and (XIIa'), respectively, and the forward and reverse primers of the pair of primers Set3 have a sequence as set forth in formulas (XIa") and (XIIa"), respectively:Set1 5' OH-H2-N-OH 3' (XIa) 5' OH-H1-M-OH 3' (XIIa) Set2 5' OH-H2-N-OH 3' (XIa') 5' OH-H1-OH 3' (XIIa') Set3 5' OH-H2-OH 3' (XIa") 5' OH-H1-M-OH 3' (XIIa") wherein ❖ H1 is a seventh DNA oligonucleotide having a length comprised between 6 and 30 and annealing on E1, wherein complementarity of H1 to E1 is comprised between 30% and 100%, and ❖ M is an eight DNA oligonucleotide having a length comprised between 6 and 30 and annealing on at least 6 nucleotides of the 3' end of the 3'P RNA sequence, ❖ H2 is a nineth DNA oligonucleotide having a length comprised between 6 and 30 and annealing on E2, wherein complementarity of H2 to E2 is comprised between 30% and 100%, and ❖ N is a tenth DNA oligonucleotide having a length comprised between 6 and 30 and annealing on at least 6 nucleotides of the 5' end of the 3'P RNA sequence; - the second qPCR amplification is carried out using a fifth pair of primers annealing on the second RNA-based adapter sequence, the fifth pair of primers comprising a fifth forward and a fifth reverse primer having formula (XIII) and (XIV), respectively: 5' OH-H2-OH 3' (XIII) 5' OH-I1-OH 3' (XIV) whereinH2 has the meaning set forth above, and❖ I1 is an eleventh DNA oligonucleotide annealing on G, wherein complementarity of I1 to G is comprised between 60% and 100%; and (q') repeating steps (m') to (o') on the control sample; (r') determining Ct values for the at least one 3'P RNA and for the second RNA-based adapter in the second and third amplification products for either the working sample and the control sample, (s') calculating a 3'P-qPCR fold change of the Ct values determined in step (r') according to the following equation: 2^^ ^^( ^^)3′ ^^− ^^ ^^( ^^)3′ ^^2∆ ^^ ^^(3′^^)3′P qPCR fold change =∆∆ ^^ ^^^^ ^^( ^^) − ^^ ^^( ^^)=∆ ^^ ^^( ^^ ^^ ^^)= 2 2^^ ^^ ^^ ^^ ^^ ^^2 wherein Ct(A)3'P is the Ct value for the 3'P RNA determined in the working sample, Ct(B)3'P is the Ct value for the 3'P RNA determined in the control sample, Ct(A)adp is the Ct value for the second RNA-based adapter determined in the working sample, Ct(B)adp is the Ct value for the second RNA-based adapter determined in the control sample; (t') confirming that the at least one 3'P RNA is a ribosome modulator if the 3'P-qPCR fold change is ≥ 2 or ≤ 0.
5.
3. The method according to claim 1 or claim 2 further comprising the following steps: (m") selecting at least one 3'P RNA identified in step (l) or step (t'); (n") administering at least one synthetic version of the 3'P RNA to the control sample obtaining a treated sample; (o") performing on the treated sample and in parallel on the control sample at least one of the following assays: - an in vitro transcription / translation assay; - a puromycilation assay; - Pulse-Chase Labeling; - Sucrose Density Gradient Centrifugation; - Ribosome Profiling;- AHARIBO; - FRET; - Single-Molecule Imaging of translation; - BONCAT; - SILAC; - Puromycin Labeling; - OPP labeling; - Quantitative Proteomics; (p") calculating an intensity value of a signal registered in the at least one assay for the treated sample and the control sample; (q") calculating a difference of the signal intensity values between the treated sample and the control sample and an assay fold change according to the following equation: assay fold change = signal intensity treated sample / signal intensity control sample; (r") confirming that the at least one 3'P RNA is a ribosome modulator if: - the difference in the signal intensity value between the treated sample and the control sample is at least ± 10% with a p-value < 0.05; or - the assay fold chance is > 1.1 or < 0.
9.
4. The method according to any one of the preceding claims, wherein step (k) further comprises at least one of the following operations: - mapping the sequence of the at least one 3'P RNA contained in the first amplification product obtained for the working sample and the control sample on the reference genome or transcriptome and calculating the multimapping score of the at least one 3'P RNA, - calculating the length of the at least one 3'P RNA, and - calculating a normalized counts based on sequencing depth of the at least one 3'P RNA, wherein the at least one 3'P RNA is a ribosome modulator if: − the length is > 15 and < 200 nucleotides, or − the normalized counts based on sequencing depth is > 5, or − the multimapping score is ≤ 100.
5. The method according to any one of the preceding claims, wherein the sequencing platform is selected from those commercialized by Illumina; Element Bioscience; Singular genomics; Life Technologies; Roche; MGI.
6. The method according to any one of the preceding claims, wherein when the sequencing step (i) is carried out on a sequencing platform by Illumina, then: - the first nucleic acid domain PR1 + T1 of the sequencing platform adapter construct has a sequence selected from the sequences SP1; - the second nucleic acid domain R2 of the sequencing platform adapter construct has a sequence selected from the sequences SP2; - the third nucleic acid domain Q1 of the sequencing platform adapter construct has the sequence P5; - the fourth nucleic acid domain Q2 of the sequencing platform adapter construct has a sequence selected from the sequences i5 (or index5); - the fifth nucleic acid domain Q4 of the sequencing platform adapter construct has the sequence P7; - the sixth nucleic acid domain Q5 of the sequencing platform adapter construct has a sequence selected from the sequences i7 (or index7).
7. The method according to any one of the preceding claims, wherein the first and second DNA oligonucleotide sequences T2 and T3 anneal on at least 6 nucleotides of the first portion (PR1) of the first nucleic acid domain and second nucleic acid domain (R2) of the sequencing platform adapter construct, respectively.
8. The method according to any one of the preceding claims, wherein the third and fourth DNA oligonucleotide sequences Q3 and Q6 anneal on at least 6 nucleotides of the second portion (T1) of the first nucleic acid domain and the second nucleic acid domain (R2) of the sequencing platform adapter construct, respectively.
9. The method according to any one of the preceding claims, wherein the cellular sample is selected from bacterial cells, plant cells, human and mouse tissues, immortalized cell lines, primary cell lines, Induced Pluripotent Stem Cells(iPSC), non-human embryonic stem cells (ESC).
10. The method according to any one of the preceding claims, wherein the stressing step (a) is carried out by treating a cellular sample with a compound able to induce a global down-regulation or up-regulation of protein synthesis.
11. The method according to any one of the preceding claims, wherein the purification of the pure ribosome pellet of step (b) is carried out by at least one of the following procedures: - Polysome profiling; - Subcellular fractionation or salt wash method; - RiboLace ribosome isolation; - Affinity purification methods.
12. The method according to any one of the preceding claims, wherein the extraction of the 3'P RNA from the pure ribosome pellet of step (c) is carried out by one or a combination of the following methods: − Phenol-Chloroform Extraction; − Guanidinium Thiocyanate-Based Methods; − Silica Column-Based Methods; − Magnetic Bead-Based Methods; − Solid-Phase Reversible Immobilization (SPRI) Method.
13. The method according to any one of the preceding claims, wherein before performing step (c) the working sample and / or the control sample are subjected to a small RNA enrichment operation.
14. The method according to any one of the preceding claims, wherein the second RNA-based adapter of formula (IX) has at least one of the following features: - it has a length comprised between 50 and 100 nt, - it comprises at least 1 abasic site or spacer A.
15. The method according to any one of the preceding claims, wherein the second reverse transcription primer of formula (X) has a length comprised between10 and 100 nt.
16. The method according to any one of the preceding claims, wherein the fourth and the fifth primer pairs employed in the two qPCR amplifications of step (p') have at least one of the following features: - they contain from 1 to 20 modified nucleotides; - they have a length comprised between 15 and 25 nucleotides; - they have a minimum free energy comprised between -3 and -150 kcal / mol; - they do not contain strong or mild secondary structures and / or do not form dimers; - they have a melting temperature comprised between 57 and 70 °C; - they have a melting temperature difference between the forward and reverse primer of the pair less than or equal to 3 °C.
17. The method according to any one of the preceding claims, wherein the forward and reverse primers of the fourth pair of primers used in the first qPCR amplification anneal on at least 6, preferably 10, nucleotides of the 3'P RNA at the 3' end and the 5' end, respectively.
18. The method according to any one of the preceding claims, wherein the ribosome modulator is selected from 3'P RNAs having a sequence as set forth in SEQ ID No.: 1-119, 142, 143.
19. The method according to any one of the preceding claims, wherein the method is carried out using at least one of: - a first RNA-based adapter having a sequence selected from the sequences set forth in SEQ ID No.: 120-124; - a first reverse transcription primer having a sequence as set forth in SEQ ID No.: 125; - a first pair of primers comprising a first forward and a first reverse primer having a sequence as set forth in SEQ ID No.: 126 and 127, respectively, - a second pair of primers comprising a second forward and a second reverse primer having formula (XV) and (XVI), respectively:5' OH- AATGATACGGCGACCACCGAGATCTACAC(i5)ACACTCTTTCCCTACAC GACGCTCTTCCGATCT-OH 3' (XV) 5' OH- CAAGCAGAAGACGGCATACGAGAT(i7)GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT-OH 3' (XVI) wherein (i5) is selected from the sequences i5 (or index5) by Illumina, and (i7) is selected from the sequences i7 (or index7) by Illumina; - a third pair of primers comprising a third forward and a third reverse primer having formula (XV) and (XVI) as set forth above, respectively; - a second RNA-based adapter having a sequence as set forth in SEQ ID No.: 132; - a second reverse transcription primer having a sequence as set forth in SEQ ID No.: 133; - a fifth pair of primers comprising a fifth forward and a fifth reverse primer having a sequence as set forth in SEQ ID No.:138 and 139, respectively.