Method for simultaneous gene expression and proteome analysis
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- UCL BUSINESS LTD
- Filing Date
- 2024-08-09
- Publication Date
- 2026-06-17
AI Technical Summary
Current methods are unable to simultaneously measure protein (including post-translational modifications) and RNA profiles in single cells, limiting the comprehensive analysis of cellular signaling and gene expression.
The development of the Split-pool Indexing-based siGNalling AnaLysis by sequencing (SIGNAL-seq) method, which enables parallel inter- and intra-cellular signaling analysis by combining protein and RNA measurements in a single assay at the single-cell level.
SIGNAL-seq allows for the deep interrogation of cell-cell communication and the comprehensive profiling of proteomic and transcriptomic landscapes in single cells, improving upon existing methodologies by enabling simultaneous protein and RNA analysis.
Smart Images

Figure GB2024052113_13022025_PF_FP_ABST
Abstract
Description
[0001] METHOD FOR SIMULTANEOUS GENE EXPRESSION AND PROTEOME ANALYSIS
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to a method for assaying the proteins and RNA at the single cell level. The invention also relates to kits for uniquely labelling proteins and RNA within a cell, plurality of cells and / or a tissue, such that the cells can be applied to a method of the invention.
[0004] BACKGROUND TO THE INVENTION
[0005] Several human diseases are the result of disrupted gene expression impinging on underlying genetic lesions. A case in point is represented by cancer. Gene expression is regulated both by changes in gene transcription and protein post-translational modifications (PTMs). Cells process extra-cellular signals via intra-cellular protein PTMs to regulate gene expression. Common PTMs include protein phosphorylation, acetylation, methylation, and protease cleavage - each regulating a range of cellular processes from proliferation to apoptosis. PTMs are phenotype changes that do not result from alteration of the DNA sequence itself.
[0006] Cancers are characterized by extensive inter-patient and intra-tumour heterogeneity, down to the single cell level. This fuels clonal evolution, leading to treatment resistance, both primary and acquired, which is the leading cause of death for cancer patients. Despite extensive studies, the mechanisms underlying this resistance are still largely unknown both for standard chemotherapeutic regimens and for the recently introduced immunotherapies. Increasingly detailed analysis of cancer genomes, before and after treatment, have so far failed to identify genetic causes, such as the acquisition of somatic mutations or copy number aberrations, which could explain the ensuing refractoriness to therapeutic regimens. Additionally, given the rampant heterogeneity that is present within cancer cell populations, single-cell approaches are emerging as truly revolutionary tools to reliably and comprehensively capture cancer heterogeneity and inform on treatment resistance mechanisms.
[0007] There is therefore a need to assess changes in gene expression in diseased tissue, such as cancer cells. Multimodal analysis, such as protein (including PTM) and RNA (including mRNA) analysis, would enable deep interrogation of cell-cell communication in healthy and pathological tissue microenvironments.
[0008] Next-generation sequencing (NGS) has transformed genomic research by reducing turnaround time and cost. Library construction plays an important role for high-throughput NGS. A plethora of library construction methods have been developed. Whilst significant improvements have been made in sequencing approaches, methodologies currently used for sequencing or detection of proteins and RNA suffer from various limitations. A plethora of RNA-seq methods exist which enable the determination of the RNA profile, including the mRNA profile, within cells. In particular, single cell RNA-seq (scRNA-seq) can reveal inter-cellular signalling via ligand-receptor pairing (Armingol et al., Nat Rev Genet, 2021, 22: 71–88). In addition, PTM signalling can be measured in single cells via anti-PTM antibodies using flow or mass cytometry, but these methods are limited to <40 PTMs per cell due to finite fluorophores or monoisotopic rare-earth metal channels (Spitzer and Nolan, Cell, 2016, 165: 780–91). Single-cell PTM mass cytometry data can be used to reconstruct intra-cellular signalling networks (Spitzer and Nolan, Cell, 2016, 165: 780–91). Single-cell antigen detection can be expanded indefinitely by using DNA-oligonucleotide conjugated antibodies that encode protein abundance as sequenceable antibody-derived tags (ADTs) (M. Stoeckius et al., Nat Methods, 2017, 14: 865–868). ADT-based multimodal technologies are typically used to analyse mRNA alongside extracellular proteins (e.g. CITE- seq), and are therefore more commonly used in immunophenotyping assays where canonical immune cell-types and cell-states can be inferred from extracellular protein abundance. However, it has recently been demonstrated that ADTs can also be used to detect intra- nuclear proteins via single-nucleus RNA sequencing (snRNA-seq) (H. Chung et al., Nat Methods, 2021, 18: 1204–1212; and Chen et al., Nat Methods, 2022, 19: 547–553) and cytoplasmic phospho-proteins, but at the expense of poor mRNA coverage (Rivello et al., Cell Rep Methods, 2021, 1: 100070; and Blair et al., bioRxiv, 2023). To date, no method can simultaneously measure both protein (e.g. intra-cellular PTM signalling) and broad transcriptome profiles in single cells. Thus, there is a significant need in the art for a tool which comprehensively audits, for example at the single cell level, both the protein and RNA profiles of cells. SUMMARY OF THE INVENTION The inventors have devised a protein and RNA profiling approach, termed “Split-pool Indexing- based siGNalling AnaLysis by sequencing” (SIGNAL-seq), which can be performed at the single-cell level. This approach combines protein (e.g. PTM) and RNA (e.g. mRNA) measurements such that parallel inter- and intra-cellular signalling analysis is possible in a single assay. The inventors have demonstrated that this SIGNAL-Seq approach can be successfully employed as a multimodal method that simultaneously measures protein (e.g. PTM, in particular PTM signalling) and RNA (e.g. mRNA transcriptomes) profiles in PFA-fixed single cells from solid-phase 3D cancer models. By measuring mRNA ligand-receptor pairs and PTMs at the single-cell level, SIGNAL-seq allows the deep interrogation of cell-cell communication (such as simultaneous analysis of both inter- and intra-cellular signalling) in healthy and pathological tissue microenvironments (e.g. tumour microenvironment (TME) organoids). The multiomics approach (i.e. an approach which combines multiple omics technologies), termed SIGNAL-seq devised by the inventors enables comprehensive proteomic and transcriptomic analyses. Thus, SIGNAL-seq, and in particular single-cell SIGNAL-Seq, may illuminate the dynamic and evolving proteomic and transcriptomic landscapes of single cell populations in physiology and human diseases. The method of the invention significantly improves the principle techniques currently used for sequencing of mRNA, such as for transcriptomic analysis, including CITE-seq and snRNA- seq. In particular, existing methodologies may not be suitable for single cell analysis, exclude epigenetic modifications of large portions of the genome and / or rely on complex custom manufactured microfluidic hardware which impacts costs and limits the throughput of cells. Further, much of the prior art methods involving the intracellular measurement of proteins typically requires a blocking step using e.g. EcoSSB protein (which binds an oligo attached to the antibody to prevent non-specific binding and enhance signal\noise ratio). Since in split- pool barcoding based chemistries a reverse transcription is performed “in-cell” (where the cell is intact) and not in lysis buffer, EcoSSB would negatively affect the capability of the reverse transcription enzyme to adequately bind its primed capture sequence site. Notably, the present inventors have demonstrated that SIGNAL-seq PTM measurements are comparable to gold standard mass cytometry assays for protein detection and transcriptomic coverage is equivalent to SPLiT-Seq (Rosenberg et al., Science, 2018, 360: 176–182). Accordingly, in a first aspect the present invention provides a method of making parallel RNA and protein-detection sequence libraries, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; and d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences. In another aspect, the invention provides a method of parallel single-cell RNA sequencing and protein-detection by sequencing, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences; and e. sequencing the mature oligonucleotide sequences. The invention further provides a kit for making parallel RNA and protein-detection sequence libraries, the kit comprising: a. a plurality of reverse transcription primers; b. a plurality of first oligonucleotide sequences, wherein each first oligonucleotide sequence comprises a primer binding sequence, a first barcode sequence and a first capture sequence; c. a plurality of second oligonucleotide sequences, wherein each second oligonucleotide sequence comprises a second capture sequence and a second barcode sequence; d. a plurality of third oligonucleotide sequences, wherein each third oligonucleotide sequence comprises a third barcode sequence; and e. a blocking solution; wherein each of the first barcode sequence, second barcode sequence and third barcode sequence is different from one another, and wherein the first and second capture sequences are complementary to each other. BRIEF DESCRIPTION OF THE FIGURES FIGURE 1: SIGNAL-seq workflow. FIGURE 2: 3D spheroids treated with either EGF and IGF growth factors (GF) or GF + inhibitors (GF + i), stained with pS6 [S240 / S244] (green), cCaspase3 [D175] (red) or Hoescht. Spheroids have a GF responsive core (pS6+), and an apoptotic periphery (cC3+). FIGURE 3: Spheroids from Figure 2 analysed using SIGNAL-Seq and mass cytometry demonstrate similar response to GF and GF + i. Earth mover’s distance (EMD) calculated for each PTM relative to control spheroids. FIGURE 4: CLR (Centered log ratio transformation) detection of pS6 and cCaspase3 across each condition by SIGNAL-seq. FIGURE 5: Single-cell PHATE driven by PTMs for each treatment (Figure 5A) and integrated single-cell PHATEs of all conditions annotated by either PTMs or RNA features (Figure 5B). FIGURE 6: Detection of early EGF target gene responses by SIGNAL-seq. FIGURE 7: mRNA gene counts per condition in cC3+ or cC3– populations. mRNA gene counts per condition in cC3+ or cC3– populations (Figure 7A) and proportion of poly-A transcripts per condition in cC3+ or cC3– populations (Figure 7B). FIGURE 8: pRB [S807 / S811] levels relative to cell-cycle phases predicted from gene expression. FIGURE 9: Diagrammatic illustration of oligonucleotide-conjugated binding moiety for use in the invention. FIGURE 10: SIGNAL-seq Analysis of TME Organoid Drug Response Identifies Protein PTM Signalling Regulation of Cell Plasticity. a). Schematic of experimental workflow. b) Single-cell PHATE by experimental condition PDOs and CAFs (30,892 cells) built on RNA modality. c) mRNA / protein expression of KRT18 / Cytokeratin 18 and VIM / Vimentin in PDOs and CAFs. FIGURE 11: SIGNAL-seq Analysis of Patient-Derived Organoids and Cancer Associated Fibroblasts During Therapy. a) Total RNA and ADT counts for PDOs and CAFs + / -SN-38. b) Total genes and ADTs per count for PDOs and CAFs + / -SN-38. c) Single-cell PHATE of all cells by PDO and CAF clusters. d) Canonical epithelial and mesenchymal genes expression per cell-type cluster. e) Single-cell PHATE of all PDO cells coloured by treatment. f) mRNA estimate of the proportion of PDO cells in S-phase + / -CAFs + / -SN-38. g) CAF pS6 [S240 / S244] and pP38 [T180 / Y182] + / -PDOs + / -SN-38. h) Single-cell PHATE of all CAFs coloured by VIM mRNA and Vimentin protein. i) Vimentin protein levels in CAFs + / -PDOs + / - SN-38. DETAILED DESCRIPTION OF THE INVENTION Method of RNA sequencing and protein-detection by sequencing The invention provides a method of parallel single-cell RNA sequencing and protein-detection by sequencing, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences; and e. sequencing the mature oligonucleotide sequences. Suitably, step e. generates RNA and protein detection sequences from a single cell. The present methods enable the high resolution profiling of both proteins and RNA (e.g. transcriptome) at a large scale. Advantageously, the present antibody labelling and blocking approach improves data generation by reducing technical noise in either the RNA detection (e.g. low resolution) or protein modalities (e.g. high noise). As such, the present methods advantageously allow high resolution profiling of both proteins and RNA (e.g. transcriptome) from a single cell. The detection of proteins is achieved by the sequencing of mature oligonucleotides generated from a split-pool barcoding methodology, starting from a binding moiety-conjugated oligonucleotide. Importantly, each specific binding moiety (i.e. a binding moiety that binds to a specific target protein) is conjugated to an oligonucleotide comprising a barcode sequence that is unique for the protein to be detected. Sequencing of the barcode in the mature oligonucleotide thus allows the identity of the underlying protein to be detected through a sequencing approach. As such, this is referred to herein as “protein-detection by sequencing”. RNA (e.g. transcriptome) analysis may be performed according to SPLiT-Seq or split-pool barcode labelling methods as known in the art (see e.g.,Rosenberg et al.; Science; 2018; 360(6385) and US20210189463). RNA may be assayed as cDNA or RNA molecules, according to the known methods for SPLiT-seq and as described herein. Preferably, RNA analysis according to the present methods is achieved by the generation and split-pool barcoding of cDNA – as described herein. Providing a plurality of fixed, permeabilized single-cells Fixed, permeabilized single-cells may be provided according to methods known in the art. In some embodiments, the methods may comprise fixing the plurality of cells prior to step (a). For example, components of a cell may be fixed or cross-linked such that the components are immobilized or held in place. The plurality of cells may be fixed using formaldehyde in phosphate buffered saline (PBS). The plurality of cells may be fixed, for example, in about 4% formaldehyde in PBS. In various embodiments, the plurality of cells may be fixed using methanol (e.g., 100% methanol) at about −20° C. or at about 25° C. In various other embodiments, the plurality of cells may be fixed using methanol (e.g., 100% methanol), at between about −20° C. and about 25° C. In yet various other embodiments, the plurality of cells may be fixed using ethanol (e.g., about 70-100% ethanol) at about −20° C. or at room temperature. In yet various other embodiments, the plurality of cells may be fixed using ethanol (e.g., about 70-100% ethanol) at between about −20° C. and room temperature. In still various other embodiments, the plurality of cells may be fixed using acetic acid, for example, at about −20° C. In still various other embodiments, the plurality of cells may be fixed using acetone, for example, at about −20° C. Other suitable methods of fixing the plurality of cells are also within the scope of this disclosure. In certain embodiments, the methods may comprise permeabilizing the plurality of fixed cells prior to step (a). For example, holes or openings may be formed in outer membranes of the plurality of cells. TRITON™ X-100 may be added to the plurality of cells, followed by the addition of HCl to form the one or more holes. About 0.2% TRITON™ X-100 may be added to the plurality of cells, for example, followed by the addition of about 0.1 N HCl. In certain other embodiments, the plurality of cells may be permeabilized using ethanol (e.g., about 70% ethanol), methanol (e.g., about 100% methanol), Tween 20 (e.g., about 0.2% Tween 20), and / or NP-40 (e.g., about 0.1% NP-40). In various embodiments, the methods of labelling nucleic acids in the first cell may comprise fixing and permeabilizing the plurality of cells prior to step (a). In some embodiments, the cells may be adherent cells (e.g., adherent mammalian cells). Fixing, permeabilizing, and / or reverse transcription may be conducted or performed on adherent cells (e.g., on cells that are adhered to a plate). For example, adherent cells may be fixed, permeabilized, and / or undergo reverse transcription followed by trypsinization to detach the cells from a surface. In some other embodiments, the adherent cells may be trypsinized prior to the fixing and / or permeabilizing steps. Preferably, the plurality of fixed, permeabilized single-cells are provided from a tissue sample; in particular from a tumour sample. In one embodiment, the plurality of single-cells are from a solid tumour sample. Suitably, the sample may be a solid tumour biopsy. Suitably, the sample may be a colorectal cancer (CRC) biopsy. In one embodiment, the plurality of single-cells are from a patient-derived organoid (PDO). Suitably, the PDO may be a CRC PDO. In one embodiment, the plurality of single-cells are from a TME. The cells may be any suitable cell from the TME such as CAFs, endothelial cells, immune cells or pericytes. Suitably, the cells may be cancer-associated fibroblasts (CAFs). Tissue samples may be taken from a patient and / or from diseases tissue, and may also be derived from other organisms or from separate sections of the same organism, such as samples from one patient, one sample from healthy tissue and one sample from diseased tissue. Suitably, the present methods are for use with tissue samples that have undergone a fixation procedure. Any suitable fixation procedure known in the art may be employed in the practice of the present invention. The person skilled in the art is aware of suitable fixation strategies to enable RNA library preparation and sequencing. Examples of suitable cross-linked samples are known in the art and include, but are not limited to, sample cross-linked with formalin and formaldehyde. Preferably, the sample is a formalin cross-linking sample. Suitably, the sample may be a paraffin embedded sample. Suitably, the sample may be a Formalin-Fixed Paraffin- Embedded (FFPE) sample, such as an FFPE tumour sample. The sample may be a slice or a puncture from a FFPE sample. Embodiments of the present methods in which the sample is paraffin embedded, for example an FFPE sample, may comprise an initial paraffin removal step. Suitable methods for paraffin removal are known in the art and include, for example, xylene treatment, sonication and / or boiling the sample for a short time period (e.g. at least 80°C for around 3 minutes). Tissue samples may be dissociated to single cells using methods which are known in the art; for example by enzymatic digestion and / or mechanical dissociation. Suitably methods, in particular when used in combination, include mincing (e.g. using scissors, a scalpel, and / or a blade), enzymatic digestion (e.g. dispase, collagenase, hyaluronidase and / or papain) and / or mechanical dissociation. Methods for preparing single cell suspensions from solid tissue samples are described in Reichard & Asosingh (Cytometry; 2019; 95(2); 219-226); for example. Blocking cells As discussed above, the method of the invention enables the high resolution profiling of both proteins and the transcriptome. For these two systems to work together a suitable protein labelling and blocking approach should be employed, to prevent the data generated demonstrating uninterpretable technical noise in either the RNA (low resolution) or protein modalities (high noise). The blocking step is important to reduce, preferably essentially prevent, the binding moiety-oligonucleotide conjugates binding non-specifically to cellular proteins (e.g. intracellular proteins). For example, non-specific binding of the binding moieties may result in too much noise to meaningfully measure the target protein levels, because each binding moiety is conjugated to an oligonucleotide and will be detected in downstream analyses. The blocking approach employed should reduce non-specific interactions between the cellular DNA and the oligonucleotide sequence conjugated to the binding moiety, enabling accurate intra-cellular detection of proteins. Suitably, any form of double stranded DNA may be used to achieve this. Examples of suitable double stranded DNA include, but are not limited to, salmon sperm DNA, herring sperm DNA, mammalian double-stranded DNA (e.g. placenta DNA), calf thymus DNA and polydI-dC. Preferably, the double-stranded DNA is salmon sperm DNA. In one embodiment, the blocking step uses a blocking solution comprising dextran sulphate and double-stranded DNA. Suitably, the double-stranded DNA may be at a concentration of about 0.5 mg / mL to about 2 mg / mL, about 0.5 mg / mL to about 1 mg / mL, about 0.5 mg / mL to about 0.8 mg / mL in the blocking solution. Suitably, the salmon sperm DNA may be at a concentration of about 1 mg / mL in the blocking solution. Suitably, the dextran sulphate may be at a concentration of up to about 0.1% in the blocking solution. Suitably the dextran sulphate may be at a concentration of up to about 0.01% to about 0.1%, about 0.01% to about 0.08%, about 0.01% to about 0.06%, about 0.01% to about 0.05% in the blocking solution. Suitably, the dextran sulphate may be at a concentration of about 0.05% in the blocking solution. Suitably, the blocking solution may comprise about 0.05% dextran sulfate and about 1 mg / mL double-stranded DNA. Suitably, the blocking solution may comprise about 0.05% dextran sulfate and about 1 mg / mL salmon sperm DNA. Suitably, the blocking solution may further comprise bovine serum albumin (BSA). Suitably, the blocking solution may further comprise detergent (e.g. Tween), an Fc receptor blocker (e.g. FcX TruStain – BioLegend) and / or RNase inhibitors. Suitably, the blocking solution may comprise dextran sulfate, double-stranded DNA, BSA, detergent, an Fc receptor blocker and RNase inhibitors. Suitably, the blocking solution may comprise dextran sulfate, salmon sperm DNA, BSA, Tween, an Fc receptor blocker and RNase inhibitors. Suitably, the blocking solution may comprise 0.05% dextran sulfate, 1 mg / mL salmon sperm DNA, 1% BSA, 0.1% Tween, 1:100 FcX TruStain and RNase inhibitors. Blocking may be performed by a suitable incubation of the cells a blocking solution as defined herein. For example, the incubation may be performed on ice for 10 to 30 minutes, suitably on ice for 15 minutes. Suitably, the blocking step may be performed prior to, preferably immediately prior to, the staining step. Suitably, the blocking step may be performed at essentially the same time (i.e. simultaneously) as the staining step. Suitably, the blocking step may be performed after, preferably immediately after, the straining step. Suitably, the blocking step may be performed prior to and after the staining step, preferably immediately prior to and immediately after the staining step. Suitably, the blocking step may be performed as described herein (see Example 1). Suitably, the blocking step and staining step may be performed as described herein (see Example 1). Staining cells with oligonucleotide-conjugated binding moieties To detect proteins using a sequencing approach according to the present invention, the fixed, permeabilized and blocked cells are stained with oligonucleotide-conjugated binding moieties. The binding moiety may be any suitable binding entity which is capable of binding specifically to a target protein and being conjugated to an oligonucleotide as defined herein. Suitably, the target entity may be a protein or a plurality of proteins. Numerous binding moieties are known in the art, including those based on the antigen binding site of an antibody, antibody mimetics, and T-cell receptors. For example, the binding moiety may comprise: an antibody, a single-chain variable fragment (scFv); a natural ligand of the target antigen; a peptide with sufficient affinity for the target; a single domain antibody; an artificial single binder such as a Darpin (designed ankyrin repeat protein); an aptamer; or a single-chain derived from a T-cell receptor. As used herein, “antibody” means a protein or polypeptide having an antigen binding site or antigen-binding domain which comprises at least one complementarity determining region CDR. The antibody may comprise 3 CDRs and have an antigen binding site which is equivalent to that of a domain antibody (dAb). The antibody may comprise 6 CDRs and have an antigen binding site which is equivalent to that of a classical antibody molecule. The remainder of the polypeptide may be any sequence which provides a suitable scaffold for the antigen binding site and displays it in an appropriate manner for it to bind the antigen. The antibody may be a whole immunoglobulin molecule or a part thereof such as a Fab, F(ab)’2, Fv, single chain Fv (ScFv) fragment, Nanobody or single chain variable domain (which may be a VH or VL chain, having 3 CDRs). The antibody may be a bifunctional antibody. The antibody may be non-human, chimeric, humanised or fully human. The antibody may be a monoclonal antibody or a polyclonal antibody. Preferably, the binding moiety is an antibody. Preferably, the antibody is a monoclonal antibody. Accordingly, in one embodiment, the oligonucleotide-conjugated binding moieties are oligonucleotide-conjugated antibodies. The antibodies used in the invention are not particularly limiting, and may comprise any antibody that is specific for a selected target protein. The method of the present invention can advantageously be used to detect both intracellular and extracellular proteins, permitting inter- and intra-cellular single cell analysis. As will be apparent, the binding moieties are suitably provided as a plurality of binding moieties, wherein each binding moiety within the plurality is specific for a different target protein. In one embodiment, the binding moieties are specific for intra-cellular proteins and / or extracellular proteins. Suitably, the binding moiety is specific for an intra-cellular protein. Suitably, the binding moiety is specific for an extracellular protein. Suitably, the binding moieties are comprised in a plurality binding moieties, wherein individual binding moieties are specific for an intracellular or extracellular protein. In one embodiment, the binding moieties are specific for different cell types. For example, one binding moiety may bind to a cancer cell and another binding moiety may bind to a TME cell. Cells process extra-cellular signals via intra-cellular protein PTMs to regulate gene expression. Common PTMs include protein phosphorylation, acetylation, methylation, and protease cleavage – each regulating a range of cellular processes from proliferation to apoptosis. In order to provide a more complete profile of the protein signalling within a cell, binding moieties which are specific for one or more post-translationally modified versions of a protein (or proteins) of interest may be used. Suitably, such binding moieties may be used in combination with binding moieties which are specific for the unmodified protein. Thus, in some embodiments, the proteins are post-translationally modified proteins. Post-translational modification can occur at any step in the life cycle of a protein. For example, many proteins are modified shortly after translation is completed to mediate proper protein folding or stability or to direct the nascent protein to distinct cellular compartments (e.g., nucleus, membrane). Hence, proteins which are subject to PTM may be found in the nucleus and / or cytoplasm of cells. In some embodiments, the proteins are post-translationally modified nuclear and / or cytoplasmic proteins. Suitable binding moieties, in particular antibodies, specific for PTM proteins are well known in the art. Illustrative antibodies are available from, for example, Rockland and Cell Signal (see e.g., Stokes et al; Molecular & Cellular Proteomics 11: 10.1074 / mcp.M111.015883, 187–201, Conjugation of the oligonucleotide sequences to the binding moieties, in particular the antibodies, may be performed using approaches that are known in the art (see e.g., van Buggenum et al.; Scientific Reports volume 6, Article number: 22675 (2016)). Single-cell antigen detection can be expanded indefinitely by using DNA-oligonucleotide conjugated antibodies that encode target entity abundance as sequenceable antibody-derived tags (ADTs) (M. Stoeckius et al., Nat Methods, 2017, 14: 865–868). ADT-based multimodal technologies are known in the art (e.g. CITE-seq; and snRNA-seq, see, e.g. H. Chung et al., Nat Methods, 2021, 18: 1204–1212; and Chen et al., Nat Methods, 2022, 19: 547–553). It is therefore well within the ambit of the skilled person to design suitable ADTs for use according to the present invention. In a preferred embodiment, the oligonucleotides of step c. comprise a primer binding sequence, suitably wherein the primer binding sequence is adjacent to the binding moiety. The primer binding sequence enables subsequent amplification (e.g., PCR amplification) of the oligonucleotide and the eventual mature oligonucleotide sequence and / or capture of the oligonucleotide using the primer binding sequence. The primer binding sequence may also be used in library preparation and sequencing steps. The inclusion of a primer binding sequence is particularly advantageous to allow sequencing of RNA and protein-detection libraries generated according to the present methods. For example, the use of a primer binding sequence which is specific for the oligonucleotides conjugated to a binding moiety may facilitate separate processing of the protein-detection library to enable effective sequencing. Suitably, the primer binding sequence may enable separation of the protein-detection mature oligonucleotides and RNA / cDNA molecules before and / or during sequencing library preparation, in order to allow specific library preparation for the protein-detection mature oligonucleotides and RNA / cDNA molecules. In addition, the primer binding sequence may be used to perform a specific library preparation on the protein-detection library, which may differ from the library preparation performed for the RNA / cDNA molecules. By way of example, the number of rounds of amplification performed for the protein-detection library may differ to that performed for the RNA / cDNA library, for example a greater number of amplification rounds may be required for protein-detection library. The primer binding sequence may also be referred to herein as a “PCR handle”. Suitably, the primer binding sequence is specific for the oligonucleotide-conjugated binding moieties. Suitably, the oligonucleotides used in step c. (the oligonucleotide conjugated to the binding moieties) comprise a primer binding sequence, a barcode sequence and a capture sequence. The capture sequence of the binding moiety-conjugated oligonucleotide may be referred to herein as the “first capture sequence”. Suitably, the primer binding sequence is located upstream (i.e.5’) of the barcode sequence and capture sequence; such that PCR amplification from the primer binding sequence encompasses the barcode sequence and a capture sequence. Suitably, the oligonucleotide has the structure 5’ - primer binding sequence - barcode sequence - capture sequence – 3’. The primer binding sequence may be any sequence that is suitable for facilitating amplification of the mature oligonucleotides generated from the oligonucleotides used in step c. (the oligonucleotide conjugated to the binding moieties). Suitably, the primer binding sequence is a sequence that enables sequencing of the library in downstream sequencing steps. As noted above, the primer binding sequence used for eventual sequencing should be a different sequence in the oligonucleotide conjugated to the binding moieties compared to oligonucleotides used as the cDNA amplification primer sequences used to amplify other target entities (e.g. RNA) for sequencing. As used herein a ”barcode sequence” refers to a series of nucleotides in a nucleic acid that can be used to identify the nucleic acid, a characteristic of the nucleic acid, or a manipulation that has been carried out on the nucleic acid. The barcode sequence can be a naturally occurring sequence or a sequence that does not occur naturally in the organism from which the barcoded nucleic acid was obtained. By way of example, the barcode may be from about 5 to about 50 nucleotides in length, from about 5 to about 30 nucleotides in length, from about 5 to about 20 nucleotides in length, from about 5 to about 15 nucleotides in length, from about 10 to about 15 nucleotides in length. Suitably, the barcode may be about 15 nucleotides in length. The use of barcodes which are about 5 nucleotides in length allows the generation of approximately 1,000 unique oligonucleotide barcodes, which can each be conjugated to a different binding moiety. It is within the ambit of the skilled person to design suitable barcodes (in terms of sequence and length) to appropriately identify the different binding moieties that are used in a given embodiment of the present invention. In the context of the present oligonucleotide (i.e. the first oligonucleotide sequence), the barcode is a sequence that enables the target (e.g. the specific protein) detected by the binding moiety to be uniquely identified in downstream sequencing steps. The barcode sequence of the binding moiety-conjugated oligonucleotide may be referred to herein as the “first barcode sequence”. Accordingly, the barcode sequence within the first oligonucleotide sequence (i.e. the first barcode sequence) may be referred herein to as a ”protein ID barcode”. Thus, the barcode sequence of the binding moiety-conjugated oligonucleotide is unique for each specific target protein. In some embodiments, the barcode sequence is unique for each protein target, for example each intra-cellular protein or extracellular protein target. The capture sequence may be any suitable sequence which is complementary to at least part, preferably all, of the second capture sequence present in the second oligonucleotide used in the in-cell reverse transcription and PCR step of the present method. In particular, the capture sequence of the binding moiety-conjugated oligonucleotide should be capable of hybridizing to the second capture sequence present in the second oligonucleotide sequence, such that PCR from the second oligonucleotide sequence results in re-generation of each of the protein ID barcode and primer binding site adjacent to the second capture sequence in the second oligonucleotide. Once the protein ID barcode and primer binding site are appropriately added to the second oligonucleotide sequence (e.g. as a product of the PCR extending from the second capture sequence) the resulting mature second oligonucleotide sequence comprising the protein ID barcode and primer binding site can be subjected to downstream SPLiT-Seq and / or split pool barcode processing to generate a split pool barcode unique for the individual cell. By way of example, the capture sequence may be about 10 to about 50 nucleotides in length, about 10 to about 30 nucleotides in length, about 10 to about 20 nucleotides in length, or about 20 to about 30 nucleotides in length. The capture sequence may be any predetermined sequence, so long as it is complementary to at least part, preferably all, of the second capture sequence present in the second oligonucleotide used in the in-cell reverse transcription and PCR step of the present method. In one embodiment, the capture sequence is a polyA sequence. Suitably, this permits the use of the same second capture sequence (i.e. a polyT sequence) for the protein-detection and capture of mRNA sequences within the cell during the in-cell reverse transcription and PCR. Without wishing to be bound by theory, the use of the same capture sequence for the protein- detection and RNA sequencing may provide a particularly efficient implementation of the method. In one embodiment, the capture sequence is not a polyA sequence. Suitably, this permits the use of a different second capture sequence for the protein-detection and capture of mRNA sequences within the cell during the in-cell reverse transcription and PCR. Split-pool barcoding Generation of the mature second oligonucleotide comprising the protein ID barcode and primer binding site may be performed as part of the combined reverse transcription (RT) and PCR step at the beginning of a split pool barcoding method. In particular, the PCR to generate the mature second oligonucleotide comprising the protein ID barcode and primer binding site may be performed alongside a reverse transcription reaction to generate cDNA for downstream split pool barcode processing, optionally Split Pool Ligation-based Transcriptome sequencing (SPLiT-Seq), using methods which are known in the art (see e.g., Rosenberg et al.; Science; 2018; 360(6385) and US20210189463). Suitably, the one or more rounds of split-pool barcoding of step d. may comprise a combined RT and PCR step followed by one or more rounds of split-pool ligation-based barcoding steps. For example, the one or more rounds of split-pool barcoding of step d. may comprise: i. splitting the sample into a plurality of partitions; ii. without lysing the cells, performing reverse-transcription (RT) and PCR in-cell in the presence of a plurality of second oligonucleotide sequences each comprising a second capture sequence and a second barcode sequence, wherein the second barcode sequence in each partition is unique to that partition; iii. pooling the sample and then splitting the sample into a plurality of partitions; iv. coupling a third oligonucleotide sequence to the second oligonucleotide sequence, wherein the third oligonucleotide sequence comprises a third barcode sequence, and wherein the third barcode sequence in each partition is unique to that partition; v. optionally, repeating steps iii. and iv. one or more times to couple a further oligonucleotide sequence(s) to the oligonucleotide sequence used in the previous round, wherein the further oligonucleotide sequence comprises a further barcode sequence unique to each partition, up to the addition of a terminal oligonucleotide sequence in order to generate a mature oligonucleotide sequence; and vi. pooling the sample. In some embodiments, step d. comprises the step of repeating steps iii. and iv. one or more times to couple a further oligonucleotide sequence(s) to the oligonucleotide sequence used in the previous round, wherein the further oligonucleotide sequence comprises a further barcode sequence unique to each partition, up to the addition of a terminal oligonucleotide sequence in order to generate a mature oligonucleotide sequence. Suitably, steps iii. and iv. are performed up to the addition of a terminal oligonucleotide sequence in order to generate a mature oligonucleotide sequence. As will be apparent, any oligonucleotide or primer used to prime a reverse transcription reaction or PCR may anneal to its target to generate a 5’ overhang to allow initiation of the reverse-transcription reaction or PCR. In step ii., RT and PCR are performed in-cell (e.g. in parallel, preferably simultaneously). As will be apparent, this step may therefore employ an enzyme(s) that can utilise either RNA or DNA as template, i.e. RNA template for the RNA modality and DNA template for the oligonucleotide-tagged protein modality. Suitably, this step may be performed as described herein (see Example 1) The second capture sequence acts to capture RNA molecules (including mRNA, non-coding RNA and immature RNAs such as long non-coding RNA (IncRNA)) as well as the oligonucleotide-tagged proteins formed in step c). Suitably, the plurality of second oligonucleotide sequences may each comprise the same second capture sequence or different second capture sequences. Suitably, the plurality of second oligonucleotide sequences may comprise different second capture sequences selected from a polyT sequence, a mixture of random sequences, a random hexamer sequence, a predetermined sequence which is complementary to the first capture sequence of the binding moiety-conjugated oligonucleotide or any mixture thereof. Hence, the capture of RNA and oligonucleotide-tagged proteins may be performed using the same second capture sequence in step d). Suitably, mRNA may be captured using a polyT sequence which is complementary to the polyA tail of the mRNA molecule. When the first capture sequence of the binding moiety-conjugated oligonucleotide is a polyA sequence, a polyT capture sequence may also be used to capture the oligonucleotide-tagged proteins. When the first capture sequence of the binding moiety-conjugated oligonucleotide is not a polyA sequence (e.g. the first capture sequence is a predetermined sequence), the capture of the RNA and oligonucleotide-tagged proteins may be performed simultaneously in step d) using two different second capture sequences. Non-coding RNA and immature RNAs typically do not comprise a polyA tail, and may instead be captured using a random hexamer sequence as the second capture sequence. The second barcode sequence in each partition is unique to that partition. By this it is meant that the second barcode sequence is known, such that it can be computationally assigned to the same partition during subsequent sequence analysis using the techniques described herein. Suitably, the plurality of second oligonucleotide sequences may each comprise the same second barcode sequence or different second barcode sequences. For example, the plurality of second oligonucleotide sequences may comprise different second capture sequences (e.g., a polyA capture sequence to capture mRNA, a random hexamer sequence to capture non-coding RNA and immature RNAs and a predetermined capture sequence to capture proteins) each with a unique second barcode sequence. The unique second barcode sequences can then be computationally assigned to the same partition during subsequent sequence analysis using the techniques described herein. Alternatively, the plurality of second oligonucleotide sequences may comprise different second capture sequences (e.g., a polyA capture sequence to capture mRNA, a random hexamer sequence to capture non-coding RNA and immature RNAs and a predetermined capture sequence to capture proteins) each with the same second barcode sequence. This single second barcode sequence can then be computationally assigned to the same partition during subsequent sequence analysis using the techniques described herein. In various embodiments, step (v) (i.e., steps (iii) and (iv))) may be repeated a number of times sufficient to generate a unique series of labelling sequences, referred to herein as a “cell barcode sequence”, for the cDNAs and protein ID barcode oligonucleotides in the cell. Stated another way, step (v) may be repeated a number of times such that the cDNAs and protein ID barcode oligonucleotides in a first cell may have a first unique series of labelling sequences (i.e. a first cell barcode sequence), the cDNAs and protein ID barcode oligonucleotides in a second cell may have a second unique series of labelling sequences (i.e. a second cell barcode sequence), the cDNAs and protein ID barcode oligonucleotides in a third cell may have a third unique series of labelling sequences (a third cell barcode sequence), and so on. The methods of the present disclosure may provide for the labelling of cDNA sequences and protein ID barcode oligonucleotides from single cells with unique cell barcode sequences, wherein the unique cell barcode sequences may identify or aid in identifying the cell from which the cDNA and protein ID barcode oligonucleotides originated. In other words, a portion, a majority, or substantially all of the cDNA and protein ID barcode oligonucleotides from a single cell may have the same cell barcode sequence, and that cell barcode sequence may not be repeated in cDNA and protein ID barcode oligonucleotides originating from one or more other cells in a sample (e.g., from a second cell, a third cell, a fourth cell, etc.). Accordingly, in one embodiment, sufficient rounds of split-pool barcoding are carried out in step d. to generate a unique series of mature oligonucleotide sequences in a single cell of the plurality of cells. The second oligonucleotide sequences may further comprise the RT primer or the RT primer may be provided separately in step ii.. Without wishing to be bound by theory, the use of a second oligonucleotide sequences comprising the RT primer may provide a particularly efficient implementation of the method. Each of the second and subsequent oligonucleotides may comprise a first strand including a 3′ hybridization sequence extending from a 3′ end of a labelling sequence. Each of the subsequent oligonucleotides (i.e. from the third oligonucleotide onwards) may also comprise a 5′ hybridization sequence extending from a 5′ end of the labelling sequence. Each oligonucleotide may also comprise a second strand including an overhang sequence. The overhang sequence may include (i) a first portion complementary to at least one of the 5′ hybridization sequence and the 5′ overhang sequence and (ii) a second portion complementary to the 3′ hybridization sequence. In some embodiments, the final oligonucleotide (i.e., the terminal oligonucleotide sequence) may comprise a capture agent such as, but not limited to, a 5′ biotin. A mature cDNA or protein ID barcode oligonucleotide with a 5′ biotin-comprising nucleic acid sequence may allow or permit the attachment or coupling to a streptavidin-coated magnetic bead. In some other embodiments, a plurality of beads may be coated with a capture strand (i.e., a nucleic acid sequence) that is configured to hybridize to a final sequence overhang of a barcode. In yet some other embodiments, cDNA may be purified or isolated by use of a commercially available kit (e.g., an RNEASY™ kit). In one embodiment, each of the oligonucleotide sequences further comprises a 3’ ligation linker, a 5’ ligation linker, or both. Suitably, each of the second, third and further oligonucleotide sequences further comprises a 3’ ligation linker, a 5’ ligation linker, or both. In one embodiment, the second oligonucleotide sequence comprises a 3’ ligation linker. In one embodiment, the third oligonucleotide sequence comprises a 5’ ligation linker (e.g., when the third oligonucleotide is the terminal oligonucleotide). In one embodiment, the third oligonucleotide sequence comprises a 5’ ligation linker and a 3’ ligation linker (e.g., when the third oligonucleotide is not the terminal oligonucleotide). Suitably, the second oligonucleotide sequence comprises a 3’ ligation linker only, the terminal oligonucleotide comprises a 5’ ligation linker only, and any intervening oligonucleotides comprise a 5’ ligation linker and a 3’ ligation linker. In one embodiment, coupling the oligonucleotide sequences in steps iv and v comprises ligating the oligonucleotide sequences. In some embodiments, the methods of labelling nucleic acids in the cell may comprise ligating at least two of the nucleic acid barcodes that are bound to the cDNA and protein ID barcode oligonucleotides. Ligation may be conducted before or after the lysing and / or the cDNA purification steps. Ligation can comprise covalently linking the 5′ phosphate sequences on the nucleic acid barcodes to the 3′ end of an adjacent strand or nucleic acid barcode such that individual tags are formed into a continuous, or substantially continuous, mature barcode sequence that is bound to the 3′ end of the cDNA sequence and protein ID barcode oligonucleotides. In various embodiments, a double-stranded DNA or RNA ligase may be used with an additional linker strand that is configured to hold a nucleic acid barcode together with an adjacent nucleic acid in a “nicked” double-stranded conformation. The double-stranded DNA or RNA ligase can then be used to seal the “nick.” In various other embodiments, a single-stranded DNA or RNA ligase may be used without an additional linker. In certain embodiments, the ligation may be performed within the plurality of cells. Suitably, splint oligonucleotides may be used to facilitate ligation of the adjacent oligonucleotides. As used herein, a “splint oligonucleotide” may refer to an oligonucleotide that is complementary to e.g. at least part of the 3’ ligation end of the second oligonucleotide and at least part of the 5’ ligation end of the third oligonucleotide, or at least part of the 3’ ligation end of the third oligonucleotide and at least part of the 5’ ligation end of the fourth oligonucleotide, and so on. As such, the splint oligonucleotide is capable of acting as a bridge or linker to bring adjacent oligonucleotides into proximity with one another for ligation. Accordingly, the use of splint oligonucleotides may improve the efficiency of the ligation. In one embodiment, the third oligonucleotide sequence and each further oligonucleotide sequence is pre-annealed to a splint oligonucleotide having complementarity to the 5’ ligation linker of said oligonucleotide sequence and to the 3’ ligation linker of the oligonucleotide sequence used in the previous round. The final oligonucleotide sequence added during the split pool barcode labelling may be referred to as the “terminal oligonucleotide sequence” or “terminal oligonucleotide”. In one embodiment, the terminal oligonucleotide sequence may comprise a capture agent, preferably wherein the capture agent is biotin. The terminal oligonucleotide sequence may also comprise a Unique molecular identifier (UMI). UMI are commonly used in library preparation and sequencing applications and are a type of molecular barcoding that provides error correction and increased accuracy during sequencing. These molecular barcodes are short sequences (e.g. 10 random nucleotides per molecule) used to uniquely tag each molecule in a sample library. This acts to discriminate PCR duplicated sequences in subsequent amplification reactions during e.g. preparation of Illumina compatible libraries sequencing libraries. The terminal oligonucleotide may further comprise a primer binding site for subsequent library amplification and sequencing. Preferably, the primer binding site of the terminal oligonucleotide is different to the primer binding site of the binding moiety-conjugated oligonucleotide, to enable separate library preparation and, optionally, sequencing; as described herein. Accordingly, the terminal oligonucleotide may further comprise a UMI, a primer binding site and a capture agent. An aliquot or group of cells can be partitioned, i.e. separated, into different reaction vessels or containers and a first set of oligonucleotides (containing the third oligonucleotide sequences) can be added to the plurality of cDNA transcripts and protein ID barcode oligonucleotides. The aliquots of cells can then be regrouped, mixed, and separated again and a second set of oligonucleotides (containing the fourth oligonucleotide sequences) can be added to the first set of oligonucleotides, and so on. In various embodiments, the same oligonucleotide may be added to more than one aliquot of cells in a single or given round of labelling. However, after repeated rounds of separating, tagging with a new unique barcode sequence, and repooling, the cDNAs and protein ID barcode oligonucleotides of each cell may be bound to a unique combination or sequence of nucleic acid barcode sequences that form a cell barcode sequence. In some embodiments, cells in a single sample may be separated into a number of different reaction vessels. For example, the number of reaction vessels may include multiple 1.5 ml microcentrifuge tubes, a plurality of wells of a 96-well or 384-well plate, or another suitable number and type of reaction vessels. Accordingly, part v may be repeated another suitable number of times to generate a unique series of mature oligonucleotide sequences in each single cell of the plurality of cells. Suitably, the number of times the part v is performed may be selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, etc. In one embodiment, part v is performed 1, 2 or 3 times. Suitably, the protein-detection library preparation may be performed in combination with a direct RNA sequencing preparation. In such embodiments, the method comprises the step of coupling an adapter sequence, or universal adapter sequence, to the RNA molecules within the plurality of fixed, permeabilized single cells after step a. and prior to step d.. Suitably, the RNA molecules and the adapter sequence may be single-stranded. Suitably, the step of coupling an adapter molecule to the RNA molecules may comprise ligating a 5' end of the single-stranded adapter sequence to a 3' end of the RNA and / or ligating a 3' end of the single- stranded adapter sequence to a 5' end of the RNA. Suitably, the step of coupling an adapter molecule to the RNA molecules may comprise hybridizing the adapter sequence to the RNA. Methods related to binding or coupling an adapter sequence to an RNA can be used, for example, in RNA transcriptome sequencing, ribosome profiling, small RNA sequencing, non- coding RNA sequencing, and / or RNA structure profiling. In certain embodiments, the ligation may be conducted or performed by T4 RNA Ligase 1. In certain other embodiments, the ligation may be conducted by T4 RNA Ligase 1 with a single-stranded adapter sequence including a 5′ phosphate. In various embodiments, the ligation may be conducted by THERMOSTABLE 5′ APPDNA / RNA LIGASE™ (NEW ENGLAND BIOLABS®). In various other embodiments, the ligation may be conducted by THERMOSTABLE 5′ APPDNA / RNA LIGASE™ with a 5′ pre-adenylated single-stranded adapter sequence. Other suitable ligases and adapter sequences are also within the scope of this disclosure. In some embodiments, the RNA can be labelled with an adapter sequence using hybridization, for example, via Watson-Crick base-pairing. After the labelling steps, as discussed above, the adapter sequence may be configured to prime reverse transcription to form or generate cDNA. Lysis and washing Suitably, the methods may comprise lysing the plurality of cells (i.e., breaking down the cell structure) to release the mature oligonucleotides from within the plurality of cells, for example, after step (d). In some embodiments, the plurality of cells may be lysed in a lysis solution (e.g., 10 mM Tris-HCl (pH 7.9), 50 mM EDTA (pH 7.9), 0.2 M NaCl, 2.2% SDS, 0.5 mg / ml ANTI- RNase (a protein ribonuclease inhibitor, AMBION®) and 1000 mg / ml proteinase K (AMBION®)), for example, at about 55° C. for about 3 hours with shaking (e.g., vigorous shaking). In some other embodiments, the plurality of cells may be lysed using ultrasonication and / or by being passed through an 18-25 gauge syringe needle at least once. In yet some other embodiments, the plurality of cells may be lysed by being heated to about 70-90° C. For example, the plurality of cells may be lysed by being heated to about 70-90° C. for about one or more hours. The mature oligonucleotides may then be isolated from the lysed cells. In some embodiments, RNase H may be added to the cDNA to remove RNA. The methods may comprise ligating at least two of the barcode sequences that are bound to the released cDNAs and protein ID barcode oligonucleotides, in particular if splint oligonucleotides have been used during the split pool barcoding procedure. In some other embodiments, the methods may comprise ligating at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, etc. of the barcode sequences that are bound to the cDNAs and protein ID barcode oligonucleotides. Suitably, the methods may comprise removing one or more unbound barcode sequences (e.g., washing the plurality of cells). For example, the methods may comprise removing a portion, a majority, or substantially all of the unbound barcode sequences. Unbound barcode sequences may be removed such that further rounds of the disclosed methods are not contaminated with one or more unbound barcode sequences from a previous round of a given method. In some embodiments, unbound barcode sequences may be removed via centrifugation. For example, the plurality of cells can be centrifuged such that a pellet of cells is formed at the bottom of a centrifuge tube. The supernatant (i.e., liquid containing the unbound barcode sequences) can be removed from the centrifuged cells. The cells may then be resuspended in a buffer (e.g., a fresh buffer that is free or substantially free of unbound barcode sequences). In another example, the plurality of cells may be coupled or linked to magnetic beads that are coated with an antibody that is configured to bind the cell membrane. The plurality of cells can then be pelleted using a magnet to draw them to one side of the reaction vessel. In some other embodiments, the plurality of cells may be placed in a cell strainer (e.g., a PLURISTRAINER® cell strainer) and washed with a wash buffer. For example, the plurality of cells may remain in the cell strainer while the wash buffer passes through the cell strainer. Wash buffer may include a surfactant, a detergent, and / or about 5-60% formamide. Library preparation Following the split-pool barcoding steps, sequencing libraries may be prepared according to any suitable method. General library preparation and sequence methods are known in the art and are applicable to the present invention. Suitably, the mature oligonucleotides generated from the oligonucleotides conjugated to the protein binding moieties may be separated from the mature oligonucleotides generated from RNA detection prior to library preparation, such that each library can be prepared independently. By way of example, the number of rounds of amplification performed for the protein-detection library may differ to that performed for the RNA / cDNA library, for example a greater number of amplification rounds may be required for protein-detection library. The mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties may be separated from the mature oligonucleotides generated from RNA using size differentiation, for example. In particular, the mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties will generally be smaller than than the mature oligonucleotides generated from RNA. For example, the mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties may include a first, second, third etc. oligonucleotide sequence as described herein. In contrast, the mature oligonucleotides generated from the RNA detection will comprise the cDNA corresponding to the directed product of the reverse-transcription reaction in addition to the oligonucleotides used for the split-pool barcoding. Suitably, the mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties may be less than about 300 nucleotides in length. Suitably, the mature oligonucleotides generated from reverse-transcription of RNA may be greater than about 300 nucleotides, suitably greater than 400 nucleotides, greater than 500 nucleotides, greater than 750 nucleotides, greater than 1000 or greater than 2000 nucleotides in length. In an illustrative embodiment, the mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties may be separated from the mature oligonucleotides generated from RNA using a bead separation protocol, for example using SPRI bead (KAPA pure beads, Roche). An indicative method is provided in the present Examples. Suitably, an amplification of the mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties and / or the mature oligonucleotides generated from RNA may be performed before the separation step. Suitably, different amplifications may be performed for the oligonucleotides conjugated to the protein binding moieties compared to the mature oligonucleotides generated from RNA Amplification of the mature oligonucleotides generated from oligonucleotides conjugated to the protein binding moieties may be performed, for example, using primers complementary to the specific primer binding sequence of the oligonucleotides conjugated to the protein binding moieties, as described herein. Suitable cDNA amplifications (i.e. targeting the mature oligonucleotides generated from RNA) may be performed using any suitable method known in the art. Sequencing libraries for high throughput sequence may be generated using methods that are known in the art. High throughput sequencing methods are well known in the art, and in principle any method may be contemplated to be used in the invention. High throughput sequencing technologies may be performed according to the manufacturer’s instructions (as e.g. provided by Roche, Illumina or Thermo Fisher). By way of example, sequencing may be performed on a MiSeq (Illumina) or a NextSeq 550 (Illumina). For example, pooled libraries from cDNA and protein ID barcode oligonucleotides may be sequence with a NextSeq 550 using a 150bp kit across all platforms with the cycle configuration 74 bp Read 1, 6 bp i7, 0 bp i5, 86 bp Read 2. In one embodiment, the sequencing is performed on the RNA library and protein-detection library separately or on the pooled RNA and protein-detection libraries. In one embodiment, sequencing the mature oligonucleotide sequences provides barcode sequencing information. In one embodiment, the method further comprises the step of assigning single-cell identities to the RNA and protein-detection sequencing reads based upon the barcode sequencing information. Sequence analysis, de-multiplexing and / or de-barcoding may be performed using methods that are known in the art. For example, sequencing data may be de-multiplexed by adding index oligos during the library preparation and the identifying the relevant indexes and aligning mRNA FASTQ data was aligned to a reference genome using, for example, the zUMIs package https: / / github.com / sdparekh / zUMIs (Parekh et al., GigaScience, 2018, Volume 7, Issue 6, giy059). De-barcoding may be performed using any suitable method known in the art. For example, one or more of the following packages may be used: the Kallisto KITE module from the BUStools package https: / / github.com / pachterlab / kite (Melsted et al., Nature Biotechnology, 2021, 39: 813-818) or the splitRtools package https: / / github.com / JamesOpz / splitRtools (James Opzoomer. (2023). JamesOpz / splitRtools: v0.1.0 (v0.1.0), Zenodo, https: / / doi.org / 10.5281 / zenodo.8038862). The Kallisto KITE module from the BUStools package https: / / github.com / pachterlab / kite (Melsted et al., Nature Biotechnology, 2021, 39: 813-818) may also be used for de-multiplexing in place of the zUMIs package. Sample The sample may be any suitable sample for which combined protein and RNA (e.g. mRNA) readouts are desired, preferably at the single cell level. In one embodiment, the plurality of single-cells is selected from the group consisting of mammalian cells, yeast cells, bacterial cells, and combinations thereof. In one embodiment, the plurality of single-cells are a sample of mammalian cells selected from the group consisting of isolated cells, tissue, or whole organs. In one embodiment, the plurality of single-cells are from a solid tumour sample. Suitably, the sample may be a solid tumour biopsy. Suitably, the sample may be a colorectal cancer (CRC) biopsy. In one embodiment, the plurality of single-cells are from a patient-derived organoid (PDO). Suitably, the PDO may be a CRC PDO. In one embodiment, the plurality of single-cells are from a TME. The cells may be any suitable cell from the TME such as CAFs, endothelial cells, immune cells or pericytes. Suitably, the cells may be cancer-associated fibroblasts (CAFs). Suitably, the tissue sample – in particular the solid tumour sample - is a formalin cross-linking sample. Suitably, the sample may be a paraffin embedded sample. Suitably, the sample may be a Formalin-Fixed Paraffin-Embedded (FFPE) sample. The present invention also provides a method for predicting whether a patient having, suspected of having, or at risk of developing a disease (such as cancer) will respond to a treatment, said method comprising a method of RNA sequencing and protein-detection by sequencing as described herein. Suitably, a method for predicting whether a patient having, suspected of having, or at risk of developing a disease (such as cancer) will respond to a treatment may comprise the following steps: a. providing a plurality of fixed, permeabilized single-cells obtained from the patient which were treated with the treatment before being fixed; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences; e. sequencing the mature oligonucleotide sequences; and f. measuring the response of the cells to the treatment and classifying the patient as a predicted treatment responder or a predicted treatment non- responder. The treatment may be any treatment suitable for the disease, such as a drug or targeted therapy. Method of making RNA and protein-detection sequence libraries The present invention also provides a method of making parallel RNA and protein-detection sequence libraries, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; and d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences. Each of steps a. to d. may be performed as described herein. Suitably, step d. generates RNA (i.e. cDNA) and protein detection sequencing libraries. Kit The invention further provides a kit for making parallel RNA and protein-detection sequence libraries, the kit comprising: a. a plurality of first oligonucleotide sequences, wherein each first oligonucleotide sequence comprises a primer binding sequence, a first barcode sequence and a first capture sequence; b. a plurality of second oligonucleotide sequences, wherein each second oligonucleotide sequence comprises a second capture sequence and a second barcode sequence; c. a plurality of third oligonucleotide sequences, wherein each third oligonucleotide sequence comprises a third barcode sequence; and d. a blocking solution; wherein each of the first barcode sequence, second barcode sequence and third barcode sequence is different from one another, and wherein the first and second capture sequences are complementary to each other. The kit may further comprise a plurality of reverse transcription primers. The components of the kit may be as defined for the corresponding features of the methods as described herein. Suitably, the second oligonucleotide sequences of part c. may further comprise a reverse transcription (RT) primer. Without wishing to be bound by theory, the use of a second oligonucleotide sequences comprising the RT primer may provide a particularly efficient implementation of the invention. Each oligonucleotide sequence may be annealed to a splint oligonucleotide having complementarity to the ligation linker sequences of said oligonucleotide sequence. The kit may further comprise a cDNA amplification primer, a library generation oligonucleotide and / or a universal cell barcode primer. The cDNA amplification primer may be suitable to amplify the protein ID barcode oligonucleotide library based on the primer binding site in the plurality of first oligonucleotide sequences. The library generation oligonucleotide may be suitable for the addition of the full sequencing read (e.g. Illumina Read 1) and sequencing adapter sequences to the protein ID barcode oligonucleotide library. Suitably, this may be used with a universal Cell barcode library primer (which could also be used in the mRNA sequencing library generation) that adds e.g. the read 2 and sequencing adapter sequence to the further split-pool oligonucleotide sequence primer binding site (e.g. present in the terminal oligonucleotide of the split-pool labelling method). This generates a complete amplicon that can be sequenced as is on an Illumina platform. The kit may further comprise at least one of a reverse transcriptase, a template switching oligonucleotide, a fixation agent, a permeabilization agent, a ligation agent, complementary capture agent (i.e. capable of binding to the capture agent present in the terminal oligonucleotide), and a lysis agent. The kit may further comprise a reverse transcriptase, a template switching oligonucleotide, a fixation agent, a permeabilization agent, a ligation agent, complementary capture agent (i.e. capable of binding to the capture agent present in the terminal oligonucleotide), and a lysis agent. In embodiments where the capture agent in the terminal oligonucleotide is biotin, the complementary capture agent in the kit may be a streptavidin entity (e.g. streptavidin beads). The kit may further comprise one or more further pluralities of oligonucleotide sequences, wherein each further oligonucleotide sequence comprises a barcode sequence and a ligation linker, and wherein the barcode sequence is different in each given further plurality of oligonucleotide sequences. The kit may further comprise one or more binding moieties specific for a protein. The binding moieties may be binding moieties as described herein. The protein may be an intra-cellular protein or extracellular protein as defined herein. The kit may comprise a plurality of binding moieties, each specific for a protein. The binding moiety or moieties may each be conjugated to a first oligonucleotide sequence. One or more of the binding moieties may be an antibody. The blocking solution may be a blocking solution as described herein. This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, any nucleic acid sequences are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in this disclosure. It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. The terms "comprising", "comprises" and "comprised of' as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms "comprising", "comprises" and "comprised of' also include the term "consisting of'. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto. The invention will now be further described by way of Examples, which are meant to serve to assist one of ordinary skill in the art in carrying out the invention and are not intended in any way to limit the scope of the invention. EXAMPLES EXAMPLE 1: Method - Spheroid SIGNAL-seq Sample Processing The SIGNAL-seq workflow is illustrated in Figure 1. Step 1: Fix solid-phase 3D model in situ Spheroids in an Elplasia plate were placed on ice and fixed in situ for 20 minutes on ice in 1% effective Formaldehyde added to the serum-free media (Formaldehyde, 16%, methanol-free, Ultra Pure; Polysciences #18814-20). The cell-fixation media was then removed and the cells were incubated with 50 (u)M Tris-HCL (Thermo Scientific J22638.AE) for 5 minutes on ice and re-suspended in DPBS with Protectorase (Roche 3335402001) and Superase (Invitrogen AM2694) RNAse inhibitors added at 0.1 U / uL each (RNAse inhibitor cocktail). Step 2: Single-cell dissociation Spheroids were then re-suspended in 600uL of PBS and 0.1% BSA (Invitrogen AM2618) and loaded into TissueGrinder tubes (FastForward Technologies) for mechanical dissociation. The TissueGrinder protocol "Harsh" was run to dissociate the spheroids. The cells were then pelleted and re-suspended in PBS / BSA plus RNAse inhibitor cocktail. Cells were then permeabilized in 0.2% Triton X-1000 (Sigma #X100) for 3 minutes and re-suspended in 0.5x PBS with 0.05% DMSO and frozen at -80 until the SIGNAL-seq barcoding process was carried out. Step 3: Intracellular stain with anti-PTM oligo mAbs Antibody Conjugation All antibodies were tested for antigen binding in their respective model systems using TOBis mass cytometry. Antibodies were provided carrier-free for conjugation. We used the conjugation protocol outlined in (https: / / citeseq.files.wordpress.com / 2019 / 03 / cite- seq_hyper_conjugation_190321.pdf), that is based on an original conjugation protocol developed for immuno-PCR (see van Bruggenum et al; as above). All oligo sequences were ordered from Integrated DNA Technologies (IDT) and had the structure: / 5AmMC12 / CTACACGACGCTCTTCCGATCT-(contd) XXXXXXXXXXXXXXXBAAAAAAAAAAAAAAAAAA*A*A where the X is representative of the antibody specific 15nt barcode. Complete antibody conjugation was validated by running both conjugated and un-conjugated paired antibodies on a 4-15% SDS-PAGE gel (Bio-rad) under non-reducing conditions. Confirmation of the antibody clean-up steps to remove free (unconjugated) ssDNA oligo was performed using a 4% agarose gel. All antibody concentrations were determined using a BCA assay (Thermo) and pooled individually using pilot CyTOF staining titrations to determine the optimal staining concentration. SIGNAL-Seq Oligo-Antibody Staining Cells were thawed at 37◦C until a small ice crystal remained and then placed on ice. The cells were then added to a 96-well Nunc M Well Plate (Thermo # 267334) and washed with blocking buffer; PBS + 1%BSA, 0.1% Tween (Thermo #85113), 0.05% Dextran sulfate (Thermo catno), 1mg / mL Salmon Sperm DNA (Thermo catno), 1:100 FcX TruStain (BioLegend) with RNAse inhibitor cocktail. Cells were then incubated in blocking buffer on ice for 15 minutes after which the cells were stained in a total volume of 75uL with Oligo-antibody cocktail in blocking buffer. Cells were then washed with blocking buffer twice and once with 0.5x PBS before re-suspension in 0.5x PBS + RNAse cocktail. Cells were then filtered two or more times through a 40micrometre FlowMi filter (Flowmi #BAH136800040) until no cell multiplets could be seen under a microscope and counted. Cells were then re-suspended to the appropriate concentration in 0.5x PBS + RNAse cocktail for loading into the SIGNAL-seq reverse transcription barcoding plate. Steps 4 & 5: SIGNAL-Seq Split-pool Barcoding Split-pool barcoding was performed, involving combinatorial indexing of both transcriptome and antibody-oligo tags as per the SPLiT-seq protocol, which is described in Rosenberg et al. 2018, Science, 360.6385 with minor modifications. An updated barcode plate setup was used as described in the Micro-SPLiT method (as indicated in Kuchina et al.2021, Science, 371.6531). Reverse-transcription was performed in- cell, followed by a series of two consecutive in-cell split-pool ligations to generate and append a unique combination of oligonucleotide barcodes to each cell’s mRNA derived cDNA and antibody derived oligo tags as described in Rosenberg et al. 2018, Science, 360.6385. All temperature incubation steps were performed in a thermocycler to increase temperature stability. At the end of the barcoding process the cells were counted on a haemocytometer using DiYo with a GFP filter on an EVOS FL microscope to resolve in-tact cells from debris. Cells were split into 25uL sub-libraries, combined with 30uL of 2x SPLiT-seq lysis buffer and incubated at 65◦C for 60 minutes and stored them at -80◦C until library preparation and sequencing. Complete lysis of cells was verified by looking at lysates under the an EVOS FL microscope after staining a lysate aliquot with with DiYo dye on a GFP filter to confirm no intact cells were present. Steps 6 & 7: SIGNAL-Seq library preparation and sequencing cDNA isolation and amplification was performed based on the SPLiT-seq protocol (Rosenberg et al.2018, Science, 360.6385) with some modifications. Steps in the SPLiT-seq library preparation protocol were scaled down to half volume to enable thermocycler compatibility and reduce reagents quantity used, with the exception that each sub-library was incubated with a total effective volumetric quantity of 44uL of my-One C1 Dynabeads (Thermo), re-suspended in 50uL of 2xB+W and processed at as described in Rosenberg et al.2018, Science, 360.6385. cDNA amplification cycle numbers were selected based on initial cycle number optimisation of a range of cycles using EvaGreen dye qPCR Ct saturation and pilot sequencing of smaller 250-350 cell sub-libraries on an Illumina MiSeq platform to inform cycle selection of a particular sub-library cell quantity and sample type combination. In order to selectively amplify the antibody-oligo derived tag library a primer specific to the PCR handle region of the antibody oligo tag at 0.15 uM final concentration, with the sequence: CTACACGACGCTCTTCCGATCT, was spiked in. After cDNA amplification, a 0.6x SPRI bead (KAPA pure beads, Roche) cleanup was performed keeping the supernatant, which contains the antibody-oligo library, whilst the RNA library was bound to the beads fraction, which was eluted and processed as described in the SPLiT-seq protocol using the Nextera XT kit (Illumina) to generate the final mRNA derived cDNA SPLiT-seq libraries. The antibody-oligo library containing SPRI cleanup supernatant was taken forward and a further 2x rounds of a 2x SPRI cleanup to remove residual PCR primers was performed. Half of the antibody-oligo quantity was taken forwards to build Illumina compatible libraries. PCR amplification was performed using a standard KAPA HIFI mastermix protocol (Roche sequencing) using a custom library oligo, with the sequence: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC, and one of the SPLiT-seq sub-library i7 index oligos BC0076-BC0083. cDNA amplification cycles were selected (with a range of 6-8x total) based on optimisation of cycle number using a spare sub-library in a similar manner to cDNA amplification step. The resulting library was purified with a 1.2x SPRI cleanup. Final sequencing libraries were quantified using a Qbit DNA HS kit (Thermo) for concentration and a Bioanalayzer HS DNA chip (Agilent) for amplicon size. The mRNA and antibody-oligo libraries were both sequenced separately on a MiSeq (Illumina) and also as a pool on a NextSeq 550 (Illumina) using a 150bp kit across all platforms with the cycle configuration 74 bp Read 1, 6 bp i7, 0 bp i5, 86 bp Read 2. EXAMPLE 2: 3D Culture System – Production and Treatment of HeLa Spheroids HeLa cells were obtained from ATCC cultured in DMEM high-glucose with L-Glutamine and Sodium pyruvate (Thermo Fisher Scientific #41966-029), supplemented with 2 mM L- Glutamine (Sigma #G7513) and 10% FBS (Pan-Biotech #P30-8500). HeLa spheroids were generated by seeding 70k cells per well in a Elplasia® 96-well plate (Corning #4446). HeLa cells were cultured as spheroids for 48 hours and then starved in serum-free media for 4 hours before treatment. After starvation HeLa spheroids were pre-treated with a combination of inhibitors for 10 minutes before growth factor treatment: 100 nM Trametenib and 500 nM GDC0941 Pictilisib (SelleckChem #S186513) or vehicle (DMSO Sigma #D2650). After inhibitor treatment spheroids were treated with a combination of growth factors for 30 minutes before fixation in-situ: 100 nM Human IGF1 (Peprotech #100-11) and 100 nM Human EGF (Peprotech #AF-100-15-1mg). Spheroids have a GF responsive core (pS6+), and an apoptotic periphery (cC3+) (Figure 2). EXAMPLE 3: Parallel analysis of spheroids using SIGNAL-seq and mass cytometry Following treatments, spheroids were fixed with PFA in situ, dissociated into single-cells, and analysed in parallel by both SIGNAL-seq and thiol organoid barcoding in situ (TOBis) mass cytometry, as described above. Earth movers distance (EMD) analysis (as described in Orlova et al. 2016, PLosS ONE, 11.3) revealed SIGNAL-seq and mass cytometry detect identical PTM regulation following growth factor and inhibitor treatments (r 2 = 0.83) (Figure 3). EXAMPLE 4: SIGNAL-seq detects regulation of growth factor signalling via PTMs and mRNA SIGNAL-seq identified a subpopulation pS6 response to EGF and IGF (GF) and an increase in cCaspase 3 following MEK and PI3K inhibition (GF + i) (Figure 4, Figure 5A). Figure 4 indicates the centred log ratio transformation (CLR) detection pS6 and cCaspase3 across each condition by SIGNAL-seq. Figure 5A indicates the single-cell PHATE (Potential of Heat- diffusion for Affinity-based Trajectory Embedding) driven by PTMs for each treatment Furthermore, SIGNAL-seq could detect regulation of growth factor signalling via both PTMs (e.g. pS6, pNDRG1 [T346], p4E-BP1 [T37 / T47], and pPDK1 [S241]) and mRNA (e.g. EGR1, FOS, and JUNB). Figure 5B displays the integrated single-cell PHATEs of all conditions annotated by either PTMs or RNA features. IGF and EGF responsive cells were generally in the cell-cycle as identified by both PTMs (pRB [S807 / S811]+) and mRNA (MKI67+). By contrast, inhibitor treated cells were largely apoptotic (cCaspase 3 [D175]+) and have high levels of long non-coding RNA (lncRNA) (Figure 5B). EXAMPLE 5: SIGNAL-seq is capable of mRNA detection SIGNAL-seq detected transcriptional up-regulation of several canonical growth factor early- response target genes (Figure 6). Parallel analysis of PTMs and mRNA in a dynamic model system enabled a direct comparison of cellular features captured by each modality. For example, it was observed that in all conditions mRNA detection was substantially higher in viable cells (cCaspase 3 [D175]–) compared to apoptotic cells (cCaspase3 [D175]+) (Figure 7A). Apoptotic cells were shown to contain a lower relative proportion of poly-A mRNA in their transcriptome compared to viable cells (Figure 7B), suggesting that apoptotic cells may undergo global mRNA degradation in a poly-A dependant manner in early apoptosis, resulting in an abundance of lncRNA. A direct comparison of pRB [S807 / S811] against cell-cycle gene expression signatures confirmed mRNA can be used to approximate cell-cycle phase (Figure 8).
[0009] EXAMPLE 6: SIGNAL-seq Analysis of Tumour Microenvironment Drug Response Plasticity Materials and methods PDO and CAF Culture CRC PDOs HCM-SANG-0270-C20 were obtained from the Human Cancer Models Initiative (Sanger Institute, Cambridge, UK) and expanded in 12-well plates in x325 µL droplets of Growth Factor Reduced Matrigel per well with 1 mL of Advanced DMEM F / 12 containing 2 mM L-glutamine, 1 mM N-acetyl-L-cysteine, 10 mM HEPES, 500 nM A83-01, 10 µM SB202190, and 1X B-27 Supplement, 1X N-2 Supplement, 50 ng mL−1 EGF, 10 nM Gastrin I, 10 mM Nicotinamide, and 1X HyClone Penicillin-Streptomycin Solution, and conditioned media produced as described in Takahashi et al., (Stem Cell Reports 10.1 Jan.2018314- 328) at 5% CO2, 37°C. PDOs were dissociated into single cells with 1X TrypLE Express Enzyme (incubated at 37°C for 20 minutes) and passaged every 10 days. CRC CAFs (ATCC #CRL-1459) were cultured in Dulbecco's Modified Eagle Medium (DMEM) enriched with 10% fetal bovine serum (FBS), and 1X HyClone Penicillin-Streptomycin Solution at 5% CO2, 37°C. PDOs and CAFs were routinely tested negative for mycoplasma. PDO and CAF Co-Culture and Treatment On Day 0 CRC PDOs were dissociated into single cells as described above, and expanded in 12-well plates in Growth Factor Reduced Matrigel with 1 mL per well of Advanced DMEM F / 12, supplemented with 2 mM L-glutamine, 1 mM N-acetyl-l-cysteine, 10 mM HEPES, 1X HyClone Penicillin-Streptomycin Solution, 1X B-27 Supplement, 1X N-2 Supplement, 50 ng mL−1 EGF, 10 nM Gastrin I, 10 mM Nicotinamide, 500 nM A83-01 and 10 µM SB202190 at 5% CO2, 37°C for 96 hours. On Day 1, CAFs were split into a new flask containing a low- serum media (DMEM supplemented with 2% FBS and 1X HyClone-Penicillin Streptomycin Solution). On Day 4, PDO culture media was changed to a reduced media; Advanced DMEM F / 12 supplemented with 2 mM glutamine, 1 mM N-acetyl-L-cysteine, 10 mM HEPES, 1X B-27 Supplement, 1X N-2 Supplement, 10 mM Nicotinamide, 1X HyClone-Penicillin Streptomycin Solution and 25 ng mL−1 EGF). PDOs and CAFs were seeded on Day 5 in 96- well plates in 50 µL Growth Factor Reduced Matrigel with 300 µL of reduced media. PDOs were seeded at a density of approximately 1.5 × 103 organoids / well and CAFs at 3 × 105 cells / well. PDOs and CAFs were either seeded in mono-culture alone, or in co-culture by mixing together in Matrigel on ice. Cultures were maintained for 72 hours at 5% CO2, 37°C, with media changes every 24 hours. On Day 6 and 7, media was replaced with reduced media containing 15 nM SN-38 or dimethylsulfoxide (DMSO), as a vehicle control. On Day 8, after 72-hours in culture and 48-hours of treatment, cultures were processed for SIGNAL-seq (see below). Organoid SIGNAL-seq Sample Processing PDOs were extracted from Matrigel with ice cold PBS. PDOs were then digested to a single- cell suspension with TrypLE Express Enzyme for 10 minutes at 37°C on a heated orbital shaker at 300rpm. Cells were then re-suspended in 1 mL PBS + RNAse inhibitor cocktail (RI). Fixation and permeabilisation was then carried out with a modified SPLiT-seq protocol. Single-cell suspensions were fixed with on ice in 1% effective Formaldehyde for 10 minutes before the cells were permeabilized for a further 3 minutes with 0.2% effective Triton X-100. Fixation was then quenched with 50 mM of Tris-HCL before the cells were re-suspended in 300 µL of 0.5x PBS +RI +5% DMSO before freezing and storage at -80°C. After SIGNAL- seq barcoding sublibraries of 9000 cell target input were generated at the lysis stage and 4 were taken forwards for library preparation. The sublibraries were amplified with 8 PCR cycles during the second cycling phase of the cDNA amplification step before separating the RNA and ADT libraries by SPRI size selection. The ADT library was then amplified for 11 PCR cycles to build the final Illumina compatible i7 indexed ADT libraries. We sequenced the RNA and ADT libraries as a pool at a 15:85 ADT:RNA library ratio. i7 sublibray indexes 76-79 were assigned to the RNA modality sublibraries and indexes 80-83 were assigned to the ADT modality sublibraries, matched in numerical order i.e (76-RNA:80-ADT = sublibrary 1). The library pool was sequenced on a NovaSeq (Illumina) using an S2 v1.5200bp kit with the cycle configuration 85 bp Read 1, 6 bp i7, 0 bp i5, 87 bp Read 2. Discussion In solid-tumours, both inter-cellular signalling from the TME and anti-cancer drug treatments can regulate intra-cellular PTM signalling networks in cancer cells. Deregulated PTM signalling can then alter cancer cell gene expression to drive phenotypic plasticity. For example, in CRC inter-cellular signalling from CAFs can regulate cancer cell PTM signalling to polarise cancer cells from a chemosensitive proliferative colonic stem cell fate to a chemorefractory revival stem cell fate. By measuring RNA and PTMs in fixed single cells, we hypothesised that SIGNAL-seq could perform inter and intra-cellular signalling analysis of TME-driven drug response plasticity in a single assay. To test this, we cultured CRC PDOs + / -CAFs in 3D, and treated + / -SN-38 chemotherapy. This patient-derived 3D model system provides a dynamic range of signalling and cell-fates driven by both inter-cellular communication and chemotherapy. Fixed PDO- CAF single cells were analysed by SIGNAL-seq using an expanded ADT antibody panel that included additional oligo-tagged antibodies against cell type-specific intra-cellular proteins and the DNA-damage marker pHH2AX [S139]. Following data quality control, SIGNAL-seq identified 30,892 single cells and could clearly resolve Cytokeratin 18+ PDOs and Vimentin+ CAFs at both mRNA and protein levels (Figure 11). Cytokeratin 18 and Vimentin protein measurements are noticeably less sparse than their respective mRNA transcripts — highlighting the value of SIGNAL-seq to measure cell-type-specific intra-cellular proteins. SIGNAL-seq detected major shifts across both PTM signalling and RNA response in PDOs + / -CAFs, + / -SN-38. SN-38 inhibits topoisomerase I, resulting in stalled DNA-replication and DNA-damage. In agreement, SIGNAL-seq detected pHH2AX [S139]+ DNA-damage in SN- 38 treated PDOs (Figure 12). Various preferred features and embodiments of the invention will now be described with reference to the following numbered paragraphs: 2. A method of making parallel RNA and protein-detection sequence libraries, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; and d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences. 3. A method of parallel single-cell RNA sequencing and protein-detection by sequencing, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences; and e. sequencing the mature oligonucleotide sequences. 4. The method according to paragraph 1 or paragraph 2, wherein the oligonucleotide- conjugated binding moieties are oligonucleotide-conjugated antibodies. 5. The method according to any one of the preceding paragraphs, wherein each binding moiety is specific for intra-cellular proteins and / or extracellular proteins. 6. The method according to paragraph 4, wherein the proteins are post-translationally modified proteins. 7. The method according to any one of the preceding paragraphs, wherein the oligonucleotides in step b. comprise a primer binding sequence, a barcode sequence and a capture sequence. 8. The method according to paragraph 6, wherein the barcode sequence is unique for each oligonucleotide-conjugated binding moiety. 9. The method according to any one of the preceding paragraphs, wherein the blocking is performed using a blocking solution comprising dextran sulphate and double- stranded DNA. 10. The method according to paragraph 8, wherein the double-stranded DNA is salmon sperm DNA. 11. The method according to any one of the preceding paragraphs, wherein the one or more rounds of split-pool barcoding of step d. comprise: i. splitting the sample into a plurality of partitions; ii. without lysing the cells, performing reverse-transcription (RT) and PCR in-cell in the presence of a plurality of second oligonucleotide sequences each comprising a second capture sequence and a second barcode sequence, wherein the second barcode sequence in each partition is unique to that partition; iii. pooling the sample and then splitting the sample into a plurality of partitions; iv. coupling a third oligonucleotide sequence to the second oligonucleotide sequence, wherein the third oligonucleotide sequence comprises a third barcode sequence , and wherein the third barcode sequence in each partition is unique to that partition; v. optionally, repeating steps iii. and iv. one or more times to couple a further oligonucleotide sequence(s) to the oligonucleotide sequence used in the previous round, wherein the further oligonucleotide sequence comprises a further barcode sequence unique to each partition, ; and vi. pooling the sample wherein steps iii. and iv. are performed up to the addition of a terminal oligonucleotide sequence in order to generate a mature oligonucleotide sequence. 12. The method according to paragraph 10, wherein each of the oligonucleotide sequences further comprises a 3’ ligation linker, a 5’ ligation linker, or both. 13. The method according to paragraph 11, wherein the second oligonucleotide sequence comprises a 3’ ligation linker. 14. The method according to paragraph 11 or paragraph 12, wherein the third oligonucleotide sequence comprises a 5’ ligation linker. 15. The method according to paragraph 10 or paragraph 11, wherein coupling the oligonucleotide sequences in steps iv and v comprises ligating the oligonucleotide sequences. 16. The method according to paragraph 10, wherein the third oligonucleotide sequence and each further oligonucleotide sequence is pre-annealed to a splint oligonucleotide having complementarity to the 5’ ligation linker of said oligonucleotide sequence and to the 3’ ligation linker of the oligonucleotide sequence used in the previous round. 17. The method according to any one of the preceding paragraphs, wherein the terminal oligonucleotide sequence of the mature oligonucleotide sequence comprises a capture agent, suitably wherein the capture agent is streptavidin. 18. The method according to any one of the preceding paragraphs, wherein sufficient rounds of split-pool barcoding are carried out in step d. to generate a unique series of mature oligonucleotide sequences in a single cell of the plurality of single-cells. 19. The method according to paragraph 10, wherein part v is performed 1, 2 or 3 times. 20. The method according to any one of paragraphs 10 to 18, wherein the second capture sequence comprises a polyT sequence, a random hexamer sequence, or both. 21. The method according to any one of paragraphs 2 to 19, wherein the sequencing is performed on the RNA library and protein-detection library separately or on the pooled RNA and protein libraries. 22. The method according to any one of paragraphs 2 to 20, wherein sequencing the mature oligonucleotide sequences provides barcode sequencing information. 23. The method according to paragraph 21, wherein the method further comprises the step of assigning single-cell identities to the RNA and protein-detection sequencing reads based upon the barcode sequencing information. 24. The method according to any one of the preceding paragraphs, wherein the plurality of single-cells is selected from the group consisting of mammalian cells, yeast cells, bacterial cells, and combinations thereof. 25. The method according to paragraph 23, wherein the plurality of single-cells are from a sample of mammalian cells selected from the group consisting of isolated cells, tissue, or whole organs. 26. The method according to paragraph 24, wherein the plurality of single-cells are from a solid tumour sample. 27. A kit for making parallel RNA and protein-detection sequence libraries, the kit comprising: a. a plurality of first oligonucleotide sequences, wherein each first oligonucleotide sequence comprises a primer binding sequence, a first barcode sequence and a first capture sequence; b. a plurality of second oligonucleotide sequences, wherein each second oligonucleotide sequence comprises a second capture sequence and a second barcode sequence; c. a plurality of third oligonucleotide sequences, wherein each third oligonucleotide sequence comprises a third barcode sequence; and d. a blocking solution; wherein each of the first barcode sequence, second barcode sequence and third barcode sequence is different from one another, and wherein the first and second capture sequences are complementary to each other. 28. The kit according to paragraph 26, wherein each oligonucleotide sequence is pre- annealed to a splint oligonucleotide having complementarity to the ligation linker sequences of said oligonucleotide sequence and to the ligation linker of the oligonucleotide sequence used in the previous round. 29. The kit according to paragraph 26 or paragraph 27, wherein the kit further comprises a cDNA amplification primer, a library generation oligonucleotide and / or a universal cell barcode primer. 30. The kit according to any one of paragraphs 26 to 28, wherein the kit further comprises at least one of a reverse transcriptase, a template switching oligonucleotide, a fixation agent, a permeabilization agent, a ligation agent, a complementary capture agent, and a lysis agent. 31. The kit according to any one of paragraphs 26 to 29, wherein the kit further comprises one or more further pluralities of oligonucleotide sequences, wherein each further oligonucleotide sequence comprises a barcode sequence, and wherein the barcode sequence is different in each given further plurality of oligonucleotide sequences. 32. The kit according to any one of paragraphs 26 to 30, wherein the kit further comprises a plurality of binding moieties specific for intra-cellular proteins and / or extracellular proteins. 33. The kit according to paragraph 31, wherein the plurality of binding moieties are conjugated to the first oligonucleotide sequence. 34. The kit according to paragraph 31 or paragraph 32, wherein the binding moieties are antibodies. 35. The kit according to any one of paragraphs 26 to 33, wherein the blocking solution comprises dextran sulphate and double-stranded DNA. 36. The kit according to paragraph 34, wherein the double-stranded DNA is salmon sperm DNA. All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.
Claims
CLAIMS 1. A method of making parallel RNA and protein-detection sequence libraries, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; and d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences.
2. A method of parallel single-cell RNA sequencing and protein-detection by sequencing, the method comprising the steps: a. providing a plurality of fixed, permeabilized single-cells; b. blocking the fixed, permeabilized cells; c. staining the plurality of blocked cells with oligonucleotide-conjugated binding moieties; d. performing one or more rounds of split-pool barcoding on the blocked, stained cells to provide mature oligonucleotide sequences; and e. sequencing the mature oligonucleotide sequences.
3. The method according to claim 1 or claim 2, wherein the oligonucleotide-conjugated binding moieties are oligonucleotide-conjugated antibodies.
4. The method according to any one of the preceding claims, wherein each binding moiety is specific for intra-cellular proteins and / or extracellular proteins, optionally wherein the proteins are post-translationally modified proteins.
5. The method according to any one of the preceding claims, wherein the oligonucleotides in step b. comprise a primer binding sequence, a barcode sequence and a capture sequence, optionally wherein the barcode sequence is unique for each oligonucleotide-conjugated binding moiety.
6. The method according to any one of the preceding claims, wherein the blocking is performed using a blocking solution comprising dextran sulphate and double-stranded DNA, optionally wherein the double-stranded DNA is salmon sperm DNA.
7. The method according to any one of the preceding claims, wherein the one or more rounds of split-pool barcoding of step d. comprise: i. splitting the sample into a plurality of partitions; ii. without lysing the cells, performing reverse-transcription (RT) and PCR in-cell in the presence of a plurality of second oligonucleotide sequences each comprising a second capture sequence and a second barcode sequence, wherein the second barcode sequence in each partition is unique to that partition; iii. pooling the sample and then splitting the sample into a plurality of partitions; iv. coupling a third oligonucleotide sequence to the second oligonucleotide sequence, wherein the third oligonucleotide sequence comprises a third barcode sequence , and wherein the third barcode sequence in each partition is unique to that partition; v. optionally, repeating steps iii. and iv. one or more times to couple a further oligonucleotide sequence(s) to the oligonucleotide sequence used in the previous round, wherein the further oligonucleotide sequence comprises a further barcode sequence unique to each partition, ; and vi. pooling the sample wherein steps iii. and iv. are performed up to the addition of a terminal oligonucleotide sequence in order to generate a mature oligonucleotide sequence.
8. The method according to claim 7, wherein each of the oligonucleotide sequences further comprises a 3’ ligation linker, a 5’ ligation linker, or both.
9. The method according to claim 8, wherein the second oligonucleotide sequence comprises a 3’ ligation linker and / or wherein the third oligonucleotide sequence comprises a 5’ ligation linker.
10. The method according to any one of claims 7 to 9, wherein coupling the oligonucleotide sequences in steps iv and v comprises ligating the oligonucleotide sequences.
11. The method according to claim 7, wherein the third oligonucleotide sequence and each further oligonucleotide sequence is pre-annealed to a splint oligonucleotide having complementarity to the 5’ ligation linker of said oligonucleotide sequence and to the 3’ ligation linker of the oligonucleotide sequence used in the previous round.
12. The method according to any one of the preceding claims, wherein the terminal oligonucleotide sequence of the mature oligonucleotide sequence comprises a capture agent, optionally wherein the capture agent is streptavidin.
13. The method according to any one of the preceding claims, wherein sufficient rounds of split-pool barcoding are carried out in step d. to generate a unique series of mature oligonucleotide sequences in a single cell of the plurality of single-cells.
14. The method according to claim 7, wherein part v is performed 1, 2 or 3 times.
15. The method according to any one of claims 7 to 14, wherein the second capture sequence comprises a polyT sequence, a random hexamer sequence, or both.
16. The method according to any one of claims 2 to 15, wherein the sequencing is performed on the RNA library and protein-detection library separately or on the pooled RNA and protein libraries.
17. The method according to any one of claims 2 to 16, wherein sequencing the mature oligonucleotide sequences provides barcode sequencing information, optionally wherein the method further comprises the step of assigning single-cell identities to the RNA and protein-detection sequencing reads based upon the barcode sequencing information.
18. The method according to any one of the preceding claims, wherein the plurality of single-cells is selected from the group consisting of mammalian cells, yeast cells, bacterial cells, and combinations thereof, optionally wherein the plurality of single-cells are from a sample of mammalian cells selected from the group consisting of isolated cells, tissue, or whole organs, preferably wherein the plurality of single-cells are from a solid tumour sample.
19. A kit for making parallel RNA and protein-detection sequence libraries, the kit comprising: a. a plurality of first oligonucleotide sequences, wherein each first oligonucleotide sequence comprises a primer binding sequence, a first barcode sequence and a first capture sequence; b. a plurality of second oligonucleotide sequences, wherein each second oligonucleotide sequence comprises a second capture sequence and a second barcode sequence; c. a plurality of third oligonucleotide sequences, wherein each third oligonucleotide sequence comprises a third barcode sequence; and d. a blocking solution; wherein each of the first barcode sequence, second barcode sequence and third barcode sequence is different from one another, and wherein the first and second capture sequences are complementary to each other.
20. The kit according to claim 19, wherein each oligonucleotide sequence is pre-annealed to a splint oligonucleotide having complementarity to the ligation linker sequences of said oligonucleotide sequence and to the ligation linker of the oligonucleotide sequence used in the previous round.
21. The kit according to claim 19 or claim 20, wherein the kit further comprises a cDNA amplification primer, a library generation oligonucleotide and / or a universal cell barcode primer.
22. The kit according to any one of claims 19 to 21, wherein the kit further comprises at least one of a reverse transcriptase, a template switching oligonucleotide, a fixation agent, a permeabilization agent, a ligation agent, a complementary capture agent, and a lysis agent.
23. The kit according to any one of claims 19 to 22, wherein the kit further comprises one or more further pluralities of oligonucleotide sequences, wherein each further oligonucleotide sequence comprises a barcode sequence, and wherein the barcode sequence is different in each given further plurality of oligonucleotide sequences.
24. The kit according to any one of claims 19 to 23, wherein the kit further comprises a plurality of binding moieties specific for intra-cellular proteins and / or extracellular proteins, optionally wherein the plurality of binding moieties are conjugated to the first oligonucleotide sequence, optionally wherein the binding moieties are antibodies.
25. The kit according to any one of claims 19 to 24, wherein the blocking solution comprises dextran sulphate and double-stranded DNA, optionally wherein the double- stranded DNA is salmon sperm DNA.