Methods of generating and expanding hematopoietic stem cells

Abstract

To provide a method of producing a liver organoid that produces a hematopoietic stem cell.SOLUTION: A method of producing a liver organoid that produces a hematopoietic stem cell (HSC) includes culturing a foregut spheroid under conditions sufficient to differentiate the foregut spheroid into the liver organoid, wherein the liver organoid contains a CD34+ hematopoietic endothelial population that differentiates into a hematopoietic stem cell, and the foregut spheroid contains mesenchyme.SELECTED DRAWING: Figure 1A

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 855,524, filed May 31, 2019, and U.S. Provisional Patent Application No. 62 / 855,536, filed May 31, 2019, each of which is expressly incorporated herein by reference in its entirety.

[0002] Sequence Listing Reference This application has been submitted with an electronic Sequence Listing. The Sequence Listing is provided as a file named CHMC63_019WOSeqListing.TXT, was created and last updated on May 18, 2020, and is 2,077 bytes in size. The information in the electronic Sequence Listing is incorporated herein by reference in its entirety.

[0003] Aspects of the present disclosure relate generally to hematopoietic stem cell compositions and methods for their production. [Background technology]

[0004] Clinically, bone marrow-derived hematopoietic stem cell (HSC) transplants are a common procedure, performed more than 40,000 times per year worldwide. These transplants can be performed to treat various types of blood cancers, immune disorders, and genetic defects in blood cells. HSC transplants can be performed either autologous (using the patient's own cells) or allogeneic (using a human leukocyte antigen (HLA)-matched donor). However, autologous transplants are often not an option due to the limited availability of the patient's own healthy cells, and allogeneic transplants can result in graft-versus-host disease (GVHD), which can be chronic, and require immunosuppressants that expose patients to infection. For this reason, allogeneic transplants have a low survival rate.

[0005] While HSCs can be collected from umbilical cord blood (UCB) and used in patients, the number of cells that can be obtained this way is limited, and there are currently no culture methods to significantly expand their numbers in vitro. Furthermore, previous attempts to produce HSCs from iPSCs require the introduction of foreign transgenes, which pose unknown risks, hindering potential clinical applications. For example, there is a current and persistent need for robust production and expansion of HSCs for use in autologous or allogeneic transplantation. Summary of the Invention

[0006] Some aspects of the present disclosure relate to the method for producing the liver organoid that produces hematopoietic stem cells.In some embodiments, the method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, the liver organoid is expressed by CD34 that differentiates into hematopoietic stem cells. +Contain hematopoietic endothelial population. In some embodiments, culturing foregut spheroids under conditions sufficient for differentiating foregut spheroids into liver organoids comprises contacting foregut spheroids with one or more (for example, at least 1, 2, 3) of FGF signaling pathway activators, Wnt signaling pathway activators, or JPG inhibitors, or any combination thereof. In some embodiments, culturing foregut spheroids under conditions sufficient for differentiating foregut spheroids into liver organoids comprises contacting foregut spheroids with FGF signaling pathway activators or Wnt signaling pathway activators, or both. In some embodiments, the FGF signaling pathway activators are FGF4. In some embodiments, the Wnt signaling pathway activators are CHIR99021. In some embodiments, the JPG inhibitor is Noggin. In some embodiments, culturing foregut spheroids comprises contacting foregut spheroids with Notch activators or ligands. In some embodiments, the Notch activator or ligand is, comprises, consists essentially of, or consists of one or more of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the Notch activator or ligand is, comprises, consists essentially of, or consists of cells expressing one or more of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the foregut spheroids comprise cells expressing one or more Notch activators or ligands selected from the group consisting of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more of IL-3, IL-34, or GM-CSF, or any combination thereof.In some embodiments, culturing foregut spheroids comprises contacting foregut spheroids with stem cell factor (SCF) or thrombopoietin (TPO), or both.In some embodiments, culturing foregut spheroids does not comprise contacting foregut spheroids with retinoic acid (RA).In some embodiments, culturing foregut spheroids does not comprise contacting foregut spheroids with one or more of dexamethasone, oncostatin M, or hepatocyte growth factor, or any combination thereof.In some embodiments, hematopoietic stem cells do not exogenously express one or more of ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1, FOSB, or GFI1, or any combination thereof.In some embodiments, the method comprises isolating hematopoietic endothelial population or hematopoietic stem cells, or both, from liver organoid. In some embodiments, isolating hematopoietic endothelial population or hematopoietic stem cell or both is carried out by selecting cell population from liver organoid that is CD34+, CD45+ or both.In some embodiments, method comprises: culturing induced pluripotent stem cell under sufficient conditions to differentiate induced pluripotent stem cell into definitive endoderm; culturing definitive endoderm under sufficient conditions to differentiate definitive endoderm into foregut spheroid, and then culturing foregut spheroid under sufficient conditions to differentiate definitive endoderm into liver organoid.In some embodiments, method comprises: culturing definitive endoderm under sufficient conditions to differentiate definitive endoderm into foregut spheroid, and then culturing foregut spheroid under sufficient conditions to differentiate definitive endoderm into foregut spheroid, and then culturing foregut spheroid under sufficient conditions to differentiate definitive endoderm into liver organoid.

[0007] Some aspects of the present disclosure relate to liver organoid.In some embodiments, liver organoid is the liver organoid produced by any one of the methods disclosed herein.

[0008] Some aspects of the present disclosure relate to hemogenic endothelial populations. In some embodiments, the hemogenic endothelial populations are produced by any one of the methods disclosed herein.

[0009] Some aspects of the present disclosure relate to hematopoietic stem cells. In some embodiments, the hematopoietic stem cells are produced by any one of the methods disclosed herein.

[0010] Some aspects of the present disclosure relate to a method for isolating lymphocytes from liver organoid. In some embodiments, liver organoid is any one of the liver organoids produced by any one of the methods disclosed herein. In some embodiments, lymphocytes are isolated from any one of the liver organoids produced by any one of the methods described herein. In some embodiments, lymphocytes comprise one or more of B cells, T cells, NK cells, or general lymphoid progenitor cells. In some embodiments, B cells are B1 cells. In some embodiments, B cells are B2 cells. In some embodiments, B cells are both B1 cells and B2 cells. In some embodiments, before isolating lymphocytes, the method comprises making a single cell suspension from liver organoid and culturing the single cell suspension on stromal cells. In some embodiments, culturing the single cell suspension on stromal cells expands lymphocytes in the single cell suspension. In some embodiments, the stromal cells are MS-5 cells. In some embodiments, the single cell suspension is contacted with one or more of FLT3 ligand, SCF, or IL-7, or any combination thereof. In some embodiments, B1 cells are CD20 + CD43 + CD27 + In some embodiments, isolating B1 cells comprises isolating B1 cells by CD20 + , CD43 + , CD27 +The method is carried out by sorting a population of cells from a single cell suspension that is one or more of:

[0011] Some aspects of the present disclosure relate to lymphocyte cells. In some embodiments, the lymphocyte cells are lymphocyte cells produced by any one of the methods described herein. In some embodiments, the lymphocyte cells are B1 cells, and the B1 cells are B1 cells produced by any one of the methods described herein.

[0012] Some aspects of the present disclosure relate to a method for expanding a population of hematopoietic stem cells. In some embodiments, the method comprises culturing a population of hematopoietic stem cells in contact with liver organoid. In some embodiments, the liver organoid comprises a hematopoietic niche environment. In some embodiments, the liver organoid is the liver organoid produced by any one of the methods described herein. In some embodiments, culturing a population of hematopoietic stem cells comprises contacting the population of hematopoietic stem cells with SCF or TPO, or both. In some embodiments, the expanded population of hematopoietic stem cells maintains pluripotency. In some embodiments, the population of hematopoietic stem cells is obtained from umbilical cord blood, mobilized peripheral blood, bone marrow, pluripotent stem cells, embryonic stem cells, fetal liver, or fetal spleen, or any combination thereof. In some embodiments, the population of hematopoietic stem cells is autologous or allogeneic to the liver organoid. In some embodiments, the population of hematopoietic stem cells is obtained from an individual. In some embodiments, the individual is an individual who needs hematopoietic stem cells. In some embodiments, the liver organoid is produced from induced pluripotent stem cells derived from an individual.

[0013] Some aspects of the present disclosure relate to methods of administering to an individual in need thereof a population of hematopoietic stem cells. In some embodiments, the population of hematopoietic stem cells is a population of hematopoietic stem cells produced by any one of the methods described herein. In some embodiments, the population of hematopoietic stem cells is autologous or allogeneic to the individual in need thereof.

[0014] Some aspects of the present disclosure relate to cell composition.In some embodiments, the cell composition comprises a population of hematopoietic stem cells and liver organoid.In some embodiments, the population of hematopoietic stem cells is the population of hematopoietic stem cells produced by any one of the methods described herein.In some embodiments, the liver organoid is the liver organoid produced by any one of the methods described herein.In some embodiments, the population of hematopoietic stem cells and liver organoid are derived from the same individual.In some embodiments, the population of hematopoietic stem cells and liver organoid are derived from different individuals.

[0015] Some aspects of the present disclosure relate to methods of treating an individual in need. In some embodiments, the method comprises administering to an individual in need an isolated hemogenic endothelial population. In some embodiments, the isolated hemogenic endothelial population is an isolated hemogenic endothelial population produced by any one of the methods described herein. In some embodiments, the method comprises administering to an individual in need isolated hematopoietic stem cells. In some embodiments, the isolated hematopoietic stem cells are isolated hematopoietic stem cells produced by any one of the methods described herein. In some embodiments, the method comprises administering to an individual in need isolated lymphoid cells. In some embodiments, the isolated lymphoid cells are isolated lymphoid cells produced by any one of the methods described herein. In some embodiments, the method comprises administering to an individual in need isolated B1 cells. In some embodiments, the isolated B1 cells are isolated B1 cells produced by any one of the methods described herein.

[0016] The embodiments of the present disclosure provided herein are described by the following numbered alternatives: 1. A method for generating hematopoietic cells in liver organoids, comprising contacting a foregut spheroid with an FGF signaling pathway activator, a Wnt signaling pathway activator, and a JPG inhibitor to form a liver organoid having a mesodermal cell population; The method, wherein the liver organoid produces hematopoietic stem cells (HSCs). 2. The method of alternative 1, wherein said foregut spheroids comprise mesenchyme. 3. The method of alternative 1 or 2, comprising contacting said foregut spheroids with a Notch activator. 4. The method of alternative 3, wherein said Notch activator is selected from one or more proteins selected from DLL1, DLL3, DLL4, JAG1, JAG2, and combinations thereof. 5. The method of alternative 3, wherein the Notch activator is selected from one or more cells expressing DLL1, DLL3, DLL4, JAG1, JAG2, and combinations thereof. 6. The method of any of the preceding alternatives, wherein said Notch activator is a myeloid cell line expressing one or more of DLL1, DLL3, DLL4, JAG1, JAG2, and combinations thereof. 7. The method of any of the preceding alternatives, comprising contacting said liver organoid with a cytokine. 8. The method of alternative 7, wherein the cytokine is added at a concentration of about 1 to about 10 ng / mL, about 2 to about 15 ng / mL, about 3 to about 20 ng / mL, about 4 to about 25 ng / mL, or about 5 to about 30 ng / mL. 9. The method of alternative 1, wherein said HLO expresses one or more of albumin (gene accession number HGNC:399), alpha-fetoprotein (HGNC:317), and erythropoietin (HGNC:3415). 10. The method of any of the preceding alternatives, wherein said hematopoietic stem cells (HSCs) are identified by flow cytometry as one or more of lin-, CD34+, CD38-, CD90+, CD45RA-, CD49f+. 11. The method of any of the preceding alternatives, wherein said hematopoietic stem cells are at a concentration of about 1 / 10,000 cells in HLO culture. 12. The method of alternative 3, wherein said Notch activator activates Notch4 (HGNC:7884). 13. A method for expanding a population of stem cells, comprising culturing the stem cells in the presence of liver organoids. 14. The method of alternative 13, wherein said stem cells are obtained from umbilical cord blood, peripheral blood, fetal liver, fetal spleen, bone marrow, intestine, yolk sac, or a combination thereof. 15. The method of alternative 13 or 14, wherein said expanded stem cells maintain pluripotency. 16. The method of any of the preceding alternatives, wherein said stem cells are obtained from an individual in need of stem cell treatment. 17. The method of any of the preceding alternatives, comprising administering said expanded stem cells to an individual in need thereof. 18. The method of any of the preceding alternatives, comprising genetically modifying said stem cells at one or more time periods selected from before, during, and after expansion. [Brief explanation of the drawings]

[0017] In addition to the features described above, additional features and modifications will be readily apparent from the following drawings and description of exemplary embodiments, it being understood that the drawings illustrate embodiments and are not intended to limit the scope.

[0018] [Figure 1A] FIG. 1 shows an embodiment of a schematic diagram of a liver organoid differentiation method. [Figure 1B] Shown are histology of day 18 liver organoid cultures in Matrigel droplets containing hematoxylin / eosin, as well as immunohistochemistry (IHC) for albumin, alpha-fetoprotein, CD34, and CD45. Boxed areas are shown as enlarged images in the inset at the bottom right. [Figure 1C]1 shows an embodiment of the expression of CD34, AFP, HBG1, and ALB in liver organoid cultures on different days, as measured by rt-PCR. [Figure 1D] An embodiment of albumin expression by liver organoid cultures cultured in liver differentiation medium (RA / HCM) or undifferentiated liver organoid (+FGF+JPG / HCM and +FGF+JPG) cultures from different iPSC lines (72_3, 1383D6, 449) is shown, as measured by ELISA. [Figure 2] An embodiment of a t-SNE plot of scRNA-seq data from a day 14 organoid culture containing different labeled populations of interest is shown. [Figure 3] An embodiment of a t-SNE plot of scRNA-seq data from a day 14 organoid culture containing labeled liver, endothelial / HSC, and erythroid populations is shown. [Figure 4A-C] Illustrated are embodiments of t-SNE plots of associated genes representing (A) hepatic populations, (B) hemogenic endothelial populations, and (C) erythroid populations. [Figure 5A] 1 shows an embodiment of a representative image from Giemsa staining after CFC assay performed from cells of day 14 organoid cultures. [Figure 5B] 1 shows an embodiment of an assay for colony-forming units from CD34+ UCB cells, day 18 liver organoid cells, and undifferentiated iPSCs. [Figure 6A] 1 shows an embodiment of an immunofluorescence image demonstrating the presence of adjacent clusters of EpCAM-stained liver organoid cells, CD34-stained endothelial cells, and GYPA-stained red blood cells. [Figure 6B] 1 shows an embodiment of IHC staining for CD34 and CD45 in organoid cultures at day 18. [Figure 6C] 1 shows an embodiment of a flow cytometry plot detecting CD34 in organoid cultures at day 11, 13, and 15. [Figure 6D]1 shows an embodiment of a graph depicting the number of colonies formed from cells of organoid cultures at different days of differentiation compared to UCB CD34+ controls. [Figure 6E] 1 shows an embodiment of a graph depicting qPCR results showing expression levels of HES1 in organoid cultures at different days. [Figure 7A] FIG. 1 shows an embodiment of a t-SNE plot of scRNA-seq data showing a population of cells co-expressing CD34 and several genes related to Notch signaling. [Figure 7B] An embodiment of a schematic diagram showing how to prepare liver organoids and add DLL4 on day 6 of culture is shown. [Figure 8] An embodiment of CD45 expression in liver organoid cultures after addition of DLL4 and cytokines (IL-3, IL-34, GM-CSF) is shown. [Figure 9A] 1 shows an embodiment of a graph showing the results of qPCR of IL-6 expression in organoids at day 18 (N=negative control, D=DLL4 added, C=cytokine added, DC=DLL4 and cytokine added). [Figure 9B] 1 shows an embodiment of a graph showing the results of qPCR of albumin expression in organoids at day 18 (N=negative control, D=DLL4 added, C=cytokine added, DC=DLL4 and cytokine added). [Figure 10A] 1 shows an embodiment of light microscope images of organoid cultures containing either DMSO control or 100 μM DAPT after 12 days of treatment. [Figure 10B] An embodiment of a schematic diagram is shown in which DAPT is added for 4 days on day 6 of culture (DAPT is removed on day 10 of culture). [Figure 10C] 1 shows an embodiment of HES1 expression at different concentrations of DAPT after 4 days of treatment. [Figure 10D] 1 shows an embodiment of ALB expression at different concentrations of DAPT after 4 days of treatment. [Figure 11A]1 shows an embodiment of a schematic diagram illustrating the layout of a co-culture system: MS-5 cells are cultured with FLT3L, SCF, and IL-7. [Figure 11B] 1 shows an embodiment of a brightfield image showing MS-5 co-cultures at day 20 with either UCB cells or organoid culture cells. [Figure 11C] Shown is an embodiment of a flow cytometry plot of an organoid / MS-5 co-culture at day 26. The leftmost panel shows the CD45 and CD20 subsets, which are further gated to CD43 and CD27 in the next panel. [Figure 12A] 1 shows an embodiment of histology of a day 18 organoid culture showing IHC for CD34 and nestin. [Figure 12B] 1 shows an embodiment of immunofluorescence images showing DAPI, CD34, and nestin in organoid cultures at day 18. [Figure 12C] 1 shows an embodiment of a t-SNE plot of scRNA-seq data showing expression of TPO and SCF. [Figure 12D] 1 shows an embodiment of a flow cytometry plot of CD34 and CD45 in organoid cultures at day 18 with and without the addition of SCF and TPO. [Figure 12E] 1 shows an embodiment of a graph showing the number of CFC colonies produced per Matrigel droplet on day 18 of organoid culture after adding UCB cells, SCF, and TPO on day 6 of organoid culture. "H+U" indicates HLO and UCB cells combined in the Matrigel droplet. [Figure 12F]Figure 1 shows an embodiment of a graph showing the number of CFC colonies formed per 1,000 UCB cells. The X-axis indicates days in organoid culture. UCB cells were combined with HLO on day 6 of organoid culture. "UCB" indicates a fresh UCB cell control not co-cultured with HLO. "DMEM-RA" indicates UCB cells and HLO co-cultured in advanced DMEM only (without retinoic acid). "HCM" indicates UCB cells and HLO co-cultured in DMEM+RA for 4 days (days 6-10 of organoid culture), followed by HCM hepatic differentiation medium. [Figure 12G] 12C shows an embodiment of a graph depicting the relative abundance of different colony types in a CFC assay under different conditions shown in FIG. 12F. [Figure 13A] FIG. 1 shows an embodiment of a schematic diagram illustrating the layout of a mouse engraftment experiment. [Figure 13B] 1 shows an embodiment of a flow cytometry blot detecting CD45 in isolated PMBCs from mice 7 weeks after injection of cells. DETAILED DESCRIPTION OF THE INVENTION

[0019] The generation of hematopoietic stem cells (HSCs) from induced pluripotent stem cells (iPSCs) holds great potential for clinical use but has thus far remained elusive. Recent success has been seen by adding exogenous genes (e.g., ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1, FOSB, or GFI1) to either iPSCs or endothelial cells for direct conversion. However, the genomic manipulation required for this feat limits any potential clinical translation. At the same time, the emergence of organoid culture systems has recently provided researchers with powerful tools to mimic complex systems consisting of multiple cell types and study them over time in a controlled environment. The organoid system disclosed herein recreates the complex niche of the fetal liver microenvironment, providing a more efficient method for studying hematopoiesis in vitro with the goal of generating cells for use in the clinic. The production of hematopoietic cells in organoid systems is discussed in PCT Publication No. 2020 / 056158.

[0020] Hematopoiesis in the fetal liver is a unique timeframe for extensive HSC expansion. This makes it particularly attractive for modeling as an HSC niche. Because HSCs cannot be maintained in culture, in vitro expansion has been limited to date, although some success has been seen recently with mouse HSCs using a cocktail of growth factors. The current state-of-the-art for in vitro HSC expansion involves the use of a medium containing hematopoietic cytokines to maintain and expand the cells. However, this does not fully recapitulate the complex microenvironment containing multiple cell types that interact through direct and transient signaling. The organoid system described herein offers a unique opportunity to model this niche in a manner that allows for the expansion of HSCs for therapeutic applications.

[0021] Modeling the fetal liver microenvironment allows for the generation of B1 cells, a unique type of hematopoietic cell that differentiates during fetal development. These cells are specifically produced in the fetal liver and are present at very low levels in the spleen and peritoneum after birth. Because of their very low abundance in adults, most B1 cell studies use mouse cells, but human B1 cells have not yet been fully described, and potential progenitor populations remain unknown. Another aspect of B1 cells is their ability to secrete IgM without stimulation. Because of this, they are involved in the early response during vaccination. Additional analysis of their differentiation and development may allow for their generation in vitro, providing a useful source of antibodies and aiding in potential vaccine development.

[0022] The organoid system described herein is positioned to have a major clinical impact: cells from patients requiring HSC transplantation can have iPSCs generated and used to create customized HSCs that can be re-transplanted without the risk of rejection and GVHD, thereby fulfilling the need for a large supply of HSCs for use in autologous or allogeneic transplants.

[0023] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, like symbols typically identify like elements unless context dictates otherwise. The illustrative embodiments set forth in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein and illustrated in the figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated.

[0024] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs when read in light of this disclosure. For purposes of this disclosure, the following terms are described below.

[0025] The embodiments herein are generally disclosed using affirmative language to describe multiple embodiments, and also include those in which subject matter such as substances or materials, method steps and conditions, protocols, or procedures are excluded in whole or in part.

[0026] The articles "a" and "an" are used herein to refer to one or to more than one (e.g., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0027] "About" means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by about 10% from a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0028] Throughout this specification, unless the context requires otherwise, the words "comprise," "comprises," and "comprising" are understood to mean the inclusion of a stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements. "Consisting of" means including and limited to what follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the listed elements are required or essential, and that other elements may not be present. "Consisting essentially of" means including any elements listed after the phrase, and is limited to other elements that do not interfere with or contribute to the activity or behavior specified in the disclosure of the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or essential, but that other elements are optional and may or may not be present depending on whether they materially affect the activity or behavior of the listed elements.

[0029] As used herein, the terms "individual," "subject," or "patient" have their plain and ordinary meaning as understood in light of the present specification, and refer to a human or non-human mammal, such as a dog, cat, mouse, rat, cow, sheep, pig, goat, non-human primate, or bird, such as a chicken, as well as any other vertebrate or invertebrate. The term "mammal" is used in its ordinary biological sense. Thus, it specifically includes, but is not limited to, simians (chimpanzees, apes, monkeys) and primates, including humans, cows, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc.

[0030] As used herein, the terms "effective amount" or "effective dose" have their plain and ordinary meaning as understood in light of the present specification and refer to that amount of the recited composition or compound that produces an observable effect. The actual dosage level of the active ingredient in the active composition of the presently disclosed subject matter can be varied to administer an amount of the active composition or compound effective to achieve the desired response for a particular subject and / or application. The selected dosage level depends on various factors, including, but not limited to, the activity of the composition, formulation, route of administration, combination with other drugs or treatments, the severity of the condition being treated, and the physical condition and previous medical history of the subject being treated. In some embodiments, a minimum dose is administered, and in the absence of dose-limiting toxicity, the dose is increased to the minimum effective amount. Determination and adjustment of the effective dose, as well as evaluation of when and how to make such adjustments, are contemplated herein.

[0031] As used herein, the terms "function" and "functional" have their plain and ordinary meaning as understood in light of this specification and refer to biological, enzymatic, or therapeutic function.

[0032] As used herein, the term "inhibit" has its plain and ordinary meaning as understood in light of the present specification and can refer to a reduction or prevention of biological activity. The reduction can be by a percentage of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, about those percentages, at least those percentages, at least about those percentages, or less than those percentages, or less than about those percentages, or an amount within a range defined by any two of the foregoing values. As used herein, the term "delay" has its plain and ordinary meaning as understood in light of the present specification and refers to a delay, prolongation, or postponement of a biological event to a time later than would otherwise be expected. The delay can be 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% of a percentage, about a percentage of ...

[0033] As used herein, the term "isolated" has its plain and ordinary meaning as understood in light of the present specification and refers to (1) a substance and / or entity that has been separated from at least some of the components with which it is associated when originally produced (whether in nature and / or in an experimental setting) and / or (2) a substance and / or entity that has been produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or equal to 100%, about %, at least %, at least about %, no more than %, or no more than about % (or ranges including and / or ranging from the foregoing values) of other components with which they are originally associated. In some embodiments, an isolated chemical is 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, substantially 100%, or 100% pure, about those % pure, at least those % pure, at least about those % pure, or less than those % pure, or less than those % pure (or ranges including and / or ranging from the aforementioned values). As used herein, an "isolated" material can be "pure" (e.g., substantially free from other components). As used herein, the term "isolated cell" can refer to a cell that is not contained in a multicellular organism or tissue.

[0034] As used herein, "in vivo" has its plain and ordinary meaning as understood in light of the present specification and refers to the performance of methods within living organisms, usually animals, mammals, including humans, and plants, as opposed to tissue extracts or dead organisms.

[0035] As used herein, "ex vivo" has its plain and ordinary meaning as understood in light of the present specification and refers to the performance of the method outside of a living body with little change in natural conditions.

[0036] As used herein, "in vitro" has its plain and ordinary meaning as understood in light of the specification, and refers to the performance of a method outside biological conditions, for example, in a petri dish or test tube.

[0037] As used herein, the terms "nucleic acid" or "nucleic acid molecule" have their plain and ordinary meaning as understood in light of the present specification and refer to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, those occurring naturally in cells, fragments produced by polymerase chain reaction (PCR), and fragments produced by ligation, cleavage, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally occurring nucleotides (such as DNA and RNA), or analogs of naturally occurring nucleotides (e.g., enantiomeric forms of naturally occurring nucleotides), or combinations of both. Modified nucleotides can have alterations in the sugar moiety and / or the pyrimidine or purine base moiety. Sugar modifications include, for example, replacing one or more hydroxyl groups with halogens, alkyl groups, amines, and azide groups, or the sugar can be functionalized as an ether or ester. Additionally, the entire sugar moiety can be replaced with sterically and electronically similar structures, such as azasugars and carbocyclic sugar analogs. Examples of modifications of the base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substituents. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Phosphodiester linkage analogs include phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates, phosphoranilidates, or phosphoramidates. The term "nucleic acid molecule" also includes so-called "peptide nucleic acids," which contain naturally occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single-stranded or double-stranded. "Oligonucleotide" can be used interchangeably with nucleic acid and can refer to either double-stranded or single-stranded DNA or RNA.The nucleic acid(s) may be contained in a nucleic acid vector or construct (e.g., a plasmid, virus, retrovirus, lentivirus, bacteriophage, cosmid, fosmid, phagemid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), or human artificial chromosome (HAC), which can be used to amplify and / or express the nucleic acid(s) in various biological systems. Typically, the vector or construct also includes elements including, but not limited to, a promoter, enhancer, terminator, inducer, ribosome binding site, translation initiation site, start codon, stop codon, polyadenylation signal, origin of replication, cloning site, multiple cloning site, restriction enzyme site, epitope, reporter gene, selection marker, antibiotic selection marker, target sequence, peptide purification tag, or accessory gene, or any combination thereof.

[0038] A nucleic acid or nucleic acid molecule can contain one or more sequences encoding different peptides, polypeptides, or proteins, which can be adjacent in the same nucleic acid or nucleic acid molecule, or can be separated by additional nucleic acids, such as linkers, repeats, or restriction enzyme sites, or can be joined by any other sequence that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases in length, about, at least, at least about, up to, or equal to about, or equal to, or any other length in the range defined by any two of the aforementioned lengths. As used herein, the term "downstream" of a nucleic acid has its plain and ordinary meaning as understood in light of the specification, and refers to the sequence after the 3' end of the preceding sequence on the strand containing the coding sequence (sense strand) if the nucleic acid is double-stranded. As used herein, the term "upstream" of a nucleic acid has its plain and ordinary meaning as understood in light of the specification, and refers to the sequence before the 5' end of the succeeding sequence on the strand containing the coding sequence (sense strand) if the nucleic acid is double-stranded. As used herein, the term "grouped," in reference to nucleic acids, has its plain and ordinary meaning as understood in light of the present specification, and refers to two or more sequences that occur in close proximity, either directly or with extra nucleic acid between them, e.g., linkers, repeats, or restriction enzyme sites, or with any other sequence that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases in length, about those bases in length, at least those bases in length, at least about those bases in length, up to those bases in length, or up to about those bases in length, or any length in the range defined by any two of the foregoing lengths, but generally without any intervening sequence encoding a functional or catalytic polypeptide, protein, or protein domain.

[0039] The nucleic acid described herein comprises nucleobases.The primary, normal, natural or unmodified bases are adenine, cytosine, guanine, thymine and uracil.Other nucleobases include, but are not limited to, purine, pyrimidine, modified nucleobases, 5-methylcytosine, pseudouridine, dihydrouridine, inosine, 7-methylguanosine, hypoxanthine, xanthine, 5,6-dihydrouracil, 5-hydroxymethylcytosine, 5-bromouracil, isoguanine, isocytosine, aminoallyl base, dye-labeled base, fluorescent base or biotin-labeled base.

[0040] As used herein, the terms "peptide," "polypeptide," and "protein" have their plain and ordinary meaning as understood in light of this specification and refer to polymers composed of amino acids linked by peptide bonds. The many functions of peptides, polypeptides, and proteins are known in the art and include, but are not limited to, enzymatic, structural, transport, defensive, hormonal, or signal transduction functions. Peptides, polypeptides, and proteins are often, but not always, produced biologically by ribosomal complexes using nucleic acid templates, although chemical synthesis is also available. Mutations of peptides, polypeptides, and proteins, such as substitutions, deletions, truncations, additions, duplications, or fusions of two or more peptides, polypeptides, or proteins, can be achieved by manipulating the nucleic acid template. These fusions of two or more peptides, polypeptides, or proteins can be adjacent in the same molecule, or can be separated by extra amino acids, such as linkers, repeats, epitopes, or tags, or can be linked by any other sequence that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases in length, about, at least, at least about, up to, or about, or up to, or any other length in the range defined by any two of the aforementioned lengths. As used herein, the term "downstream" of a polypeptide has its plain and ordinary meaning as understood in light of the specification and refers to the sequence after the C-terminus of the preceding sequence. As used herein, the term "upstream" of a polypeptide has its plain and ordinary meaning as understood in light of the specification, and refers to a sequence that precedes the N-terminus of a subsequent sequence.

[0041] As used herein, the term "purity" of any given substance, compound, or material has its plain and ordinary meaning as understood in light of this specification and refers to the actual abundance of the substance, compound, or material relative to the expected abundance. For example, a substance, compound, or material may be at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% pure (including all decimal points therebetween). Purity may be affected by undesirable impurities, including, but not limited to, nucleic acids, DNA, RNA, nucleotides, proteins, polypeptides, peptides, amino acids, lipids, cell membranes, cell debris, small molecules, degradation products, solvents, carriers, vehicles, or contaminants, or any combination thereof. In some embodiments, the substance, compound, or material is substantially free of host cell proteins, host cell nucleic acids, plasmid DNA, contaminating viruses, proteasomes, host cell culture components, process-related components, mycoplasma, pyrogens, bacterial endotoxins, and adventitious substances. Purity may be measured using techniques including, but not limited to, electrophoresis, SDS-PAGE, capillary electrophoresis, PCR, rtPCR, qPCR, chromatography, liquid chromatography, gas chromatography, thin layer chromatography, enzyme-linked immunosorbent assay (ELISA), spectroscopy, UV-visible spectroscopy, infrared spectroscopy, mass spectrometry, nuclear magnetic resonance, gravimetry, or titration, or any combination thereof.

[0042] As used herein, the term "yield" of any given substance, compound, or material has its plain and ordinary meaning as understood in light of this specification, and refers to the actual total amount of the substance, compound, or material relative to the expected total amount. For example, the yield of a substance, compound, or material may be 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, about, at least, at least about, no more than, or no more than about (including all decimal points in between) 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the expected total amount. Yield may be affected by reaction or process efficiency, undesired side reactions, decomposition, quality of input substances, compounds, or materials, or loss of desired substances, compounds, or materials during any step of production.

[0043] As used herein, the term "w / w%" or "weight / weight %" has its plain and ordinary meaning as understood in light of the present specification and refers to a percentage expressed in terms of the weight of a component or agent relative to the total weight of the composition, multiplied by 100. As used herein, the term "v / v%" or "volume / volume %" has its plain and ordinary meaning as understood in light of the present specification and refers to a percentage expressed in terms of the liquid volume of a compound, substance, component, or agent relative to the total liquid volume of the composition, multiplied by 100.

[0044] Some embodiments described herein relate to pharmaceutical compositions comprising, consisting essentially of, or consisting of an effective amount of a cell composition described herein and a pharmaceutically acceptable carrier, excipient, or combination thereof. The pharmaceutical compositions described herein are suitable for human and / or veterinary use.

[0045] As used herein, "pharmaceutically acceptable" has its plain and ordinary meaning as understood in light of the present specification and refers to a carrier, excipient, and / or stabilizer that is nontoxic or has an acceptable level of toxicity to cells or mammals exposed thereto at the dosages and concentrations employed. As used herein, "pharmaceutically acceptable," "diluent," "excipient," and / or "carrier" have their plain and ordinary meaning as understood in light of the present specification and are intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with administration to a human, feline, canine, or other vertebrate host. Typically, pharmaceutically acceptable diluents, excipients, and / or carriers are those approved by federal, state, or other regulatory agencies, or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia, for use in animals, including humans and non-human mammals such as cats and dogs. The terms diluent, excipient, and / or "carrier" can refer to a diluent, adjuvant, excipient, or vehicle with which a pharmaceutical composition is administered. Such pharmaceutical diluents, excipients, and / or carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin. Water, saline, and aqueous dextrose and glycerol solutions can be used as liquid diluents, excipients, and / or carriers, particularly for injectable solutions. Suitable pharmaceutical diluents and / or excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. A non-limiting example of a physiologically acceptable carrier is a pH-buffered aqueous solution.Physiologically acceptable carriers may also contain one or more of the following: antioxidants such as ascorbic acid, proteins such as low molecular weight (less than about 10 residues) polypeptides, serum albumin, gelatin, immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, carbohydrates such as amino acids, glucose, mannose, or dextrin, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and non-ionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®. The compositions, if desired, can also contain minor amounts of wetting agents, bulking agents, emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, sustained-release formulations, etc. The formulation should be compatible with the method of administration.

[0046] Cryoprotectants are cell composition additives that improve the efficiency and yield of cryopreservation by preventing the formation of large ice crystals. Cryoprotectants include, but are not limited to, DMSO, ethylene glycol, glycerol, propylene glycol, trehalose, formamide, methylformamide, dimethylformamide, glycerol 3-phosphate, proline, sorbitol, diethyl glycol, sucrose, triethylene glycol, polyvinyl alcohol, polyethylene glycol, or hydroxyethyl starch. Cryoprotectants can be used as part of a cryopreservation medium that contains other components, such as nutrients (e.g., albumin, serum, bovine serum, fetal calf serum [FCS]) to improve the survival rate of cells after thawing. In these cryopreservation media, at least one cryoprotectant may be found at a concentration of 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, about those concentrations, at least those concentrations, at least about those concentrations, up to those concentrations, or up to about those concentrations, or any percentage concentration within the range defined by any two of the foregoing numbers.

[0047] Additional excipients with desirable properties include, but are not limited to, preservatives, adjuvants, stabilizers, solvents, buffers, diluents, solubilizers, detergents, surfactants, chelating agents, antioxidants, alcohols, ketones, aldehydes, ethylenediaminetetraacetic acid (EDTA), citric acid, salts, sodium chloride, sodium bicarbonate, sodium phosphate, sodium borate, sodium citrate, potassium chloride, potassium phosphate, magnesium sulfate, sugars, dextrose, fructose, mannose, lactose, galactose, sucrose, sorbitol, cellulose, serum, amino acids, polysorbate 20, polysorbate 80, sodium deoxycholate, sodium taurodeoxycholate, magnesium stearate, octylphenol ethoxylate, benzethonium chloride, thimerosal, gelatin, esters, ethers, 2-phenoxyethanol, urea, or vitamins, or any combination thereof. Some excipients may be residual amounts or contaminants from the manufacturing process, including, but not limited to, serum, albumin, ovalbumin, antibiotics, inactivating agents, formaldehyde, glutaraldehyde, β-propiolactone, gelatin, cell debris, nucleic acids, peptides, amino acids, or growth medium components, or any combination thereof. The amount of excipient was 0 w / w%, 0.1 w / w%, 0.2 w / w%, 0.3 w / w%, 0.4 w / w%, 0.5 w / w%, 0.6 w / w%, 0.7 w / w%, 0.8 w / w%, 0.9 w / w%, 1 w / w%, 2 w / w%, 3 w / w%, 4 w / w%, 5 w / w%, 6 w / w%, 7 w / w%, 8 w / w%, 9 w / w%, 10 w / w%, 20 w / w%, 30 w / w%, 40 w / w%, 50 w / w%, 60 w / w %, 70 w / w%, 80 w / w%, 90 w / w%, 95 w / w%, 100 w / w%, about those percentages, at least those percentages, at least about those percentages, up to those percentages, or up to about those percentages, or any weight percentage within the range defined by any two of the foregoing values.

[0048] The term "pharmaceutically acceptable salts" has its plain and ordinary meaning as understood in light of this specification and includes relatively non-toxic inorganic and organic acid or base addition salts of compositions or excipients, including, but not limited to, analgesics, therapeutic agents, other materials, and the like. Examples of pharmaceutically acceptable salts include those derived from mineral acids such as hydrochloric acid and sulfuric acid, and those derived from organic acids such as ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, and the like. Examples of inorganic bases suitable for forming salts include hydroxides, carbonates, and bicarbonates of ammonia, sodium, lithium, potassium, calcium, magnesium, aluminum, zinc, and the like. Salts can also be formed with suitable organic bases, including those that are non-toxic and strong enough to form such salts. For example, classes of such organic bases may include, but are not limited to, mono-, di-, and trialkylamines, including methylamine, dimethylamine, and triethylamine; mono-, di-, or trihydroxyalkylamines, including mono-, di-, and triethanolamine; amino acids, including glycine, arginine, and lysine; guanidine; N-methylglucosamine; N-methylglucamine; L-glutamine; N-methylpiperazine; morpholine; ethylenediamine; N-benzylphenethylamine; and trihydroxymethylaminoethane.

[0049] Appropriate formulation depends on the selected route of administration.The techniques for formulating and administering the compounds described herein are known to those skilled in the art.Multiple techniques for administering compounds exist in the art, including but not limited to enteral, oral, rectal, topical, sublingual, buccal, intraaural, epidural, epicutaneous, aerosol, parenteral delivery (including intramuscular, subcutaneous, intraarterial, intravenous, intraportal, intraarticular, intradermal, peritoneal, intramedullary injection, intrathecal, direct intraventricular, intraperitoneal, intranasal or intraocular injection).Pharmaceutical compositions are generally tailored to a specific intended route of administration.

[0050] As used herein, "carrier" has its plain and ordinary meaning as understood in light of the present specification and refers to a compound, particle, solid, semi-solid, liquid, or diluent that facilitates the passage, delivery, and / or incorporation of a compound into cells, tissues, and / or bodily organs.

[0051] As used herein, the term "diluent" has its plain and ordinary meaning as understood in light of this specification and refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent can be used to increase the bulk of a potent drug whose mass is too small to manufacture and / or administer. It can also be a liquid for dissolving a drug to be administered by injection, ingestion, or inhalation. A common form of diluent in the art is a buffered aqueous solution, such as, but not limited to, phosphate-buffered saline, which mimics the composition of human blood.

[0052] stem cells As used herein, the term "totipotent stem cells" (also known as omnipotent stem cells) has its plain and ordinary meaning as understood in light of this specification: stem cells that can differentiate into embryonic and extraembryonic cell types. Such cells are capable of building complete, viable organisms. These cells are produced from the fusion of egg and sperm cells. Cells produced by the first few divisions of a fertilized egg are also totipotent.

[0053] As used herein, the term "embryonic stem cells (ESCs), commonly abbreviated as ES cells, has its plain and ordinary meaning as understood in light of this specification and refers to cells that are pluripotent and derived from the inner cell mass of an early embryo, the blastocyst. For purposes of this disclosure, the term "ESCs" may be used broadly to encompass embryonic germ cells.

[0054] As used herein, the term "pluripotent stem cells (PSCs)" has its plain and ordinary meaning as understood in light of the present specification and encompasses any cell that can differentiate into almost any cell type of the body, i.e., cells derived from any of the three germ layers (germinal epithelium), including endoderm (stomach lining, digestive tract, lungs), mesoderm (muscle, bone, blood, urogenital tract), and ectoderm (epidermal tissue and nervous system). PSCs may be the progeny of inner cell mass cells of a preimplantation blastocyst, or may be obtained by the induction of non-pluripotent cells, e.g., adult somatic cells, by forcing the expression of certain genes. Pluripotent stem cells may be derived from any suitable source. Examples of sources of pluripotent stem cells include mammalian sources, including human, rodent, porcine, and bovine.

[0055] As used herein, the term "induced pluripotent stem cells (iPSCs)," commonly abbreviated as iPS cells and having its plain and ordinary meaning as understood herein, refers to a type of pluripotent stem cell artificially derived from a non-pluripotent cell, such as an adult somatic cell, by inducing the "forced" expression of certain genes. hiPSCs refer to human iPSCs. In several methods known in the art, iPSCs can be obtained by transfecting certain stem cell-associated genes into non-pluripotent cells, such as adult fibroblasts. Transfection can be achieved by viral transduction using viruses such as retroviruses or lentiviruses. Transfected genes can include the master transcriptional regulators Oct-3 / 4 (POU5F1) and Sox2, although other genes can also improve the efficiency of induction. After 3-4 weeks, a small number of transfected cells begin to resemble pluripotent stem cells morphologically and biochemically and are typically isolated by morphological selection, doubling time, or reporter gene and antibiotic selection. As used herein, iPSCs include first-generation iPSCs, second-generation iPSCs in mice, and human induced pluripotent stem cells.In some methods, retrovirus system is used to transform human fibroblasts into pluripotent stem cells using four essential genes: Oct3 / 4, Sox2, Klf4, and c-Myc.In other methods, lentivirus system is used to transform somatic cells with OCT4, SOX2, NANOG, and LIN28.Genes whose expression is induced in iPSCs include, but are not limited to, Oct-3 / 4 (POU5F1), certain members of the Sox gene family (e.g., Sox1, Sox2, Sox3, and Sox15), certain members of the Klf family (e.g., Klf1, Klf2, Klf4, and Klf5), certain members of the Myc family (e.g., C-myc, L-myc, and N-myc), Nanog, LIN28, Tert, Fbx15, ERas, ECAT15-1, ECAT15-2, Tcl1, β-catenin, ECAT1, Esg1, Dnmt3L, ECAT8, Gdf3, Fth117, Sal14, Rex1, UTF1, Stella, Stat3, Grb2, Prdm14, Nr5a1, Nr5a2, or E-cadherin, or any combination thereof.

[0056] As used herein, the term "progenitor cell" has its plain and ordinary meaning as understood in light of the present specification and encompasses any cell that can be used in the methods described herein, through which one or more progenitor cells acquire the ability to regenerate themselves or differentiate into one or more specialized cell types. In some embodiments, progenitor cells are pluripotent or have the ability to become pluripotent. In some embodiments, progenitor cells are subjected to treatment with external factors (e.g., growth factors) to acquire pluripotency. In some embodiments, progenitor cells can be totipotent (or omnipotent) stem cells, pluripotent stem cells (induced or non-induced), multipotent stem cells, oligopotent stem cells, and unipotent stem cells. In some embodiments, progenitor cells can be derived from an embryo, an infant, a child, or an adult. In some embodiments, progenitor cells can be somatic cells that are subjected to treatment to confer pluripotency via genetic manipulation or protein / peptide treatment. Progenitor cells include embryonic stem cells (ESCs), embryonic carcinoma cells (ECs), and epiblast stem cells (EpiSCs).

[0057] In some embodiments, one step is to obtain stem cells that are pluripotent or can be induced to become pluripotent. In some embodiments, the pluripotent stem cells are derived from embryonic stem cells, which are derived from totipotent cells of early mammalian embryos and are capable of indefinite undifferentiated proliferation in vitro. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of an early-stage embryo, the blastocyst. Methods for deriving embryonic stem cells from blastocysts are well known in the art. Human embryonic stem cells H9 (H9-hESC) are used in the exemplary embodiments described herein, but it will be understood by those skilled in the art that the methods and systems described herein are applicable to any stem cells.

[0058] Additional stem cells that can be used in embodiments according to the present disclosure include, but are not limited to, those provided by or described in databases hosted by the National Stem Cell Bank (NSCB), the Human Embryonic Stem Cell Research Center at the University of California, San Francisco (UCSF), the WISC cell Bank at the Wi Cell Research Institute, the University of Wisconsin Stem Cell and Regenerative Medicine Center (UW-SCRMC), Novocell, Inc. (San Diego, Calif.), Cellartis AB (Göteborg, Sweden), ES Cell International Pte Ltd (Singapore), the Technion at the Israel Institute of Technology (Haifa, Israel), and the Stem Cell Database hosted by Princeton University and the University of Pennsylvania. Exemplary embryonic stem cells that can be used in embodiments according to the present disclosure include, but are not limited to, SA01 (SA001), SA02 (SA002), ES01 (HES-1), ES02 (HES-2), ES03 (HES-3), ES04 (HES-4), ES05 (HES-5), ES06 (HES-6), BG01 (BGN-01), BG02 (BGN-02), BG03 (BGN-03), TE03 (13), TE04 (14), TE06 (16), UCO1 (HSF1), UC06 (HSF6), WA01 (HI), WA07 (H7), WA09 (H9), WA13 (H13), WA14 (H14). Exemplary human pluripotent cell lines include, but are not limited to, TkDA3-4, 1231A3, 317-D6, 317-A4, CDH1, 5-T-3, 3-34-1, NAFLD27, NAFLD77, NAFLD150, WD90, WD91, WD92, L20012, C213, 1383D6, FF, or 317-12 cells.

[0059] In developmental biology, cell differentiation is the process by which less specialized cells become more specialized cell types. As used herein, the term "directed differentiation" describes the process by which less specialized cells become specific specialized target cell types. The specificity of the specialized target cell type can be determined by any applicable method that can be used to define or change the fate of the original cell. Exemplary methods include, but are not limited to, genetic manipulation, chemical treatment, protein treatment, and nucleic acid treatment.

[0060] In some embodiments, adenovirus can be used to deliver the four necessary genes, resulting in iPSCs that are virtually identical to embryonic stem cells. Because adenovirus does not combine its own genes with the target host, the risk of tumor formation is eliminated. In some embodiments, non-viral techniques are used to generate iPSCs. In some embodiments, reprogramming can be achieved via plasmids without the use of any viral transfection system at all, albeit with very low efficiency. In other embodiments, direct protein delivery is used to generate iPSCs, thus eliminating the need for viral or genetic modification. In some embodiments, mouse iPSCs can be generated using similar methodologies. Repeated treatment of cells with certain proteins delivered to the cells via polyarginine anchors was sufficient to induce pluripotency. In some embodiments, the expression of pluripotency-inducing genes can also be increased by treating somatic cells with FGF2 under hypoxic conditions.

[0061] As used herein, the term "feeder cells" has its plain and ordinary meaning as understood in light of the present specification and refers to cells that support the growth of pluripotent stem cells, such as by secreting growth factors into the medium or displaying them on the cell surface. Feeder cells are generally adherent cells and may be growth-arrested. For example, feeder cells are growth-arrested by irradiation (e.g., gamma rays), mitomycin-C treatment, electric pulses, or mild chemical fixation (e.g., formaldehyde or glutaraldehyde). However, feeder cells do not necessarily have to be growth-arrested. Feeder cells may serve purposes such as secreting growth factors, displaying growth factors on the cell surface, detoxifying the culture medium, or synthesizing extracellular matrix proteins. In some embodiments, feeder cells are allogeneic or xenogeneic to the supported target stem cells, which may affect downstream applications. In some embodiments, feeder cells are mouse cells. In some embodiments, feeder cells are human cells. In some embodiments, the feeder cells are mouse fibroblasts, mouse embryonic fibroblasts, mouse STO cells, mouse 3T3 cells, mouse SNL 76 / 7 cells, human fibroblasts, human foreskin fibroblasts, human skin fibroblasts, human adipose mesenchymal cells, human bone marrow mesenchymal cells, human amniotic mesenchymal cells, human amniotic epithelial cells, human umbilical cord mesenchymal cells, human fetal muscle cells, human fetal fibroblasts, or human adult fallopian tube epithelial cells. In some embodiments, the conditioned medium prepared from feeder cells is used instead of or in combination with feeder cell co-culture. In some embodiments, feeder cells are not used during the expansion of target stem cells.

[0062] Blood cell production originates from a single cell type, the hematopoietic stem cell, and through proliferation and differentiation develops into the entire hematopoietic system. Hematopoietic stem cells are thought to be capable of self-renewal, expanding their own population of stem cells, and they are pluripotent (capable of differentiating into any cell in the hematopoietic system). From this rare cell population, the entire mature hematopoietic system is formed, including lymphocytes (B and T cells of the immune system) and myeloid cells (erythrocytes, megakaryocytes, granulocytes, and macrophages). The lymphoid lineage, including B and T cells, produces antibodies, regulates the cellular immune system, detects foreign substances in the blood, and detects cells that are foreign to the host. The myeloid lineage, including monocytes, granulocytes, megakaryocytes, and other cells, monitors the presence of foreign substances, provides defense against neoplastic cells, removes foreign substances, and produces platelets. The erythroid lineage produces red blood cells, which function as oxygen carriers.

[0063] The liver is a vital organ that provides many metabolic functions essential for life, including detoxification and coagulation of exogenous compounds, as well as the production of lipids, proteins, ammonium, and bile. Primary hepatocytes are a highly polarized metabolic cell type that form bile canaliculi with microvilli-covered channels, separating the peripheral circulation from the bile acid secretion pathway. In vitro reconstruction of a patient's liver may offer applications including regenerative therapy, drug discovery, and drug toxicity studies. Existing methodologies using primary hepatocytes exhibit very poor functionality, primarily due to the lack of essential anatomical structures, limiting their practical use in the pharmaceutical industry. The formation of liver organoids, which comprise luminal structures with internalized microvilli and mesenchymal cells and exhibit liver cell types such as hepatocytes, stellate cells, Kupffer cells, and liver endothelial cells, and methods for their production and use, have previously been described in PCT Publication Nos. 2018 / 085615, 2018 / 085622, 2018 / 085623, and 2018 / 226267, each of which is expressly incorporated herein by reference in its entirety.

[0064] In some embodiments, the ESCs, germ cells, or iPSCs are cultured in a growth medium that supports stem cell growth. In some embodiments, the ESCs, germ cells, or iPSCs are cultured in a stem cell growth medium. In some embodiments, the stem cell growth medium is RPMI 1640, DMEM, DMEM / F12, Advanced DMEM, Hepatocyte Culture Medium (HCM), StemFit, mTeSR 1, or mTeSR Plus medium. In some embodiments, the stem cell growth medium comprises fetal bovine serum (FBS). In some embodiments, the stem cell growth medium comprises FBS at a concentration of, about, at least about, at or below 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, or any percentage within a range defined by any two of the foregoing concentrations, e.g., 0%-20%, 0.2%-10%, 2%-5%, 0%-5%, or 2%-20%. In some embodiments, the stem cell growth medium is xenogeneic. In some embodiments, the growth medium comprises one or more small molecule compounds, activators, inhibitors, or growth factors. In some embodiments, the stem cells are grown on a feeder cell substrate. In some embodiments, the stem cells are not grown on a feeder cell substrate. In some embodiments, the stem cells are grown on laminin-coated plates. In some embodiments, the stem cells are grown supplemented with FGF2 or a ROCK inhibitor (e.g., Y-27632), or both.In some embodiments, FGF2 is at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 ng / mL, about those concentrations, at least those concentrations, at least about those concentrations, or less than or equal to those concentrations, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 1-500 ng / mL, 10-200 ng / mL, 100-150 ng / mL, 1-100 ng / mL, or 100-500 ng / mL. In some embodiments, the ROCK inhibitor is at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nM, about those concentrations, at least those concentrations, at least about those concentrations, or up to or equal to about those concentrations, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 1-30 nM, 5-25 nM, 10-20 nM, 1-15 nM, or 10-30 nM. In some embodiments, stem cells are grown on laminin-coated plates.

[0065] Definitive endoderm differentiation method Any method for producing definitive endoderm (DE) from pluripotent cells (e.g., iPSCs or ESCs) is applicable to the methods described herein. Exemplary methods are disclosed, for example, in U.S. Patent No. 9,719,068. In some embodiments, iPSCs are used to produce definitive endoderm.

[0066] In some embodiments, one or more growth factors are used in the differentiation process of pluripotent stem cells to DE cells. In some embodiments, the one or more growth factors used in the differentiation process include growth factors from the TGF-beta superfamily. In some embodiments, the one or more growth factors include the Nodal / Activin and / or JPG subgroups of the TGF-beta superfamily of growth factors. In some embodiments, the one or more growth factors are selected from the group consisting of Nodal, Activin A, Activin B, JPG4, or any combination thereof. In some embodiments, the PSC is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2100, 2200, 2300, 2400, The cells are contacted with one or more growth factors for 0, 180, 190, 200, 210, 220, 230, or 240 hours, about those days, at least those days, at least about those days, up to those days, or up to about those days, or any number of hours within a range defined by any two of the aforementioned numbers of days, e.g., 1 to 240 hours, 20 to 120 hours, 30 to 50 hours, 1 to 100 hours, or 50 to 240 hours. In some embodiments, PSCs are contacted with one or more growth factors at a concentration of, about, at least about, up to, or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 10-1000 ng / mL, 50-800 ng / mL, 100-500 ng / mL, 10-200 ng / mL, or 100-1000 ng / mL. In some embodiments, the concentration of the one or more growth factors is maintained at a constant level throughout the period of contact.In some embodiments, the concentration of the one or more growth factors is varied during the contacting period. In some embodiments, the one or more growth factors are dissolved in growth medium. In some embodiments, a population of cells enriched for definitive endoderm cells is used. In some embodiments, the definitive endoderm cells are isolated or substantially purified. In some embodiments, isolated or substantially purified definitive endoderm cells express one or more (e.g., at least one, three) of SOX17, FOXA2, or CXRC4 markers to a greater extent than one or more (e.g., at least one, three, five) of OCT4, AFP, TM, SPARC, or SOX7 markers.

[0067] In some embodiments, definitive endoderm cells are contacted with one or more modulators of a signaling pathway described herein. In some embodiments, definitive endoderm cells are contacted with one or more modulators of a signaling pathway described herein for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 hours or ... hours. The cells are treated with one or more modulators of a signaling pathway for a period of time of, about, at least, at least about, up to, or about, 19, or 20 days, or any number of hours or days within a range defined by any two of the foregoing days or hours, e.g., 1 hour to 20 days, 20 hours to 10 days, 1 hour to 48 hours, 1 day to 20 days, 1 hour to 5 days, or 24 hours to 20 days. In some embodiments, the concentration of the one or more modulators of a signaling pathway is maintained at a constant level throughout the period of contact. In some embodiments, the concentration of the one or more modulators of a signaling pathway is varied during the period of contact.

[0068] In some embodiments, to differentiate definitive endoderm into foregut spheroids, definitive endoderm cells are contacted with one or more modulators of the FGF pathway and the Wnt pathway. In some embodiments, cellular components related to the Wnt and / or FGF signaling pathway, such as natural inhibitors, antagonists, activators, or agonists of the pathway, can be used to inhibit or activate the Wnt and / or FGF signaling pathway. In some embodiments, siRNA and / or shRNA targeting cellular components related to the Wnt and / or FGF signaling pathway are used to inhibit or activate these pathways.

[0069] Fibroblast growth factors (FGFs) are a family of growth factors involved in angiogenesis, wound healing, and embryonic development. FGFs are heparin-binding proteins, and their interaction with cell surface-associated heparan sulfate proteoglycans has been shown to be essential for FGF signaling. FGFs play important roles in the growth and differentiation processes of a wide variety of cells and tissues. In humans, 22 members of the FGF family have been identified, all of which are structurally related signaling molecules. Members FGF1–FGF10 all bind to fibroblast growth factor receptors (FGFRs). FGF1 is also known as acidic fibroblast growth factor, and FGF2 is also known as basic fibroblast growth factor (bFGF). Members FGF11, FGF12, FGF13, and FGF14, also known as FGF homologous factors 1–4 (FHF1–FHF4), have been shown to have distinct functional differences compared to FGFs. Although these factors share very similar sequence homology, they do not bind to FGFRs and are involved in intracellular processes unrelated to FGFs. This group is also known as "iFGFs." Members FGF15 through FGF23 are newer and less well characterized. FGF15 is the mouse ortholog of human FGF19 (thus, there is no human FGF15). Human FGF20 was identified based on its homology to Xenopus FGF-20 (XFGF-20). In contrast to the local activity of other FGFs, FGF15 / FGF19, FGF21, and FGF23 have more systemic effects. In some embodiments, the FGF used is one or more (e.g., at least 1, 3, 5) of FGF1, FGF2, FGF3, FGF4, FGF4, FGF5, FGF6, FGF7, FGF8, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15 (FGF19, FGF15 / FGF19), FGF16, FGF17, FGF18, FGF20, FGF21, FGF22, and FGF23. In some embodiments, the FGF used is FGF4.In some embodiments, the definitive endoderm is contacted with FGF at a concentration of, about, at least about, up to, or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 10-2000 ng / mL, 50-1500 ng / mL, 500-100 ng / mL, 10-1000 ng / mL, or 500-2000 ng / mL.

[0070] In some embodiments, the definitive endoderm is contacted with a Wnt protein or activator to differentiate the definitive endoderm into foregut spheroids. In some embodiments, the definitive endoderm is contacted with a glycogen synthase kinase 3 (GSK3) inhibitor. The GSK3 inhibitor acts to activate the Wnt pathway. In some embodiments, the definitive endoderm is contacted with the GSK3 inhibitor Chiron (CHIR99021). In some embodiments, definitive endoderm is contacted with CHIR99021 at a concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μM, at about those concentrations, at least those concentrations, at least about those concentrations, or less than or equal to about those concentrations of CHIR99021, or any concentration within the range defined by any two of the foregoing concentrations, e.g., 0.1-10 μM, 0.4-6 μM, 1-5 μM, 0.1-1 μM, or 0.5-10 μM CHIR99021.

[0071] In some embodiments, the foregut spheroids comprise mesoderm. In some embodiments, the foregut spheroids comprise mesodermal cells. In some embodiments, the foregut spheroids comprise mesodermal progenitor cells. In some embodiments, the foregut spheroids comprise mesenchyme. In some embodiments, the foregut spheroids comprise mesenchymal cells. In some embodiments, the foregut spheroids comprise mesenchymal stem cells. In some embodiments, the foregut spheroids comprise mesenchymal progenitor cells. In some embodiments, one or more (e.g., at least 1, 2, 3, 4, 5) of mesoderm, mesodermal cells, mesodermal progenitor cells, mesenchyme, mesenchymal cells, mesenchymal stem cells, or mesenchymal progenitor cells, or any combination thereof, are differentiated into a hemogenic endothelial population. In some embodiments, the mesenchyme is differentiated into a hemogenic endothelial population. In some embodiments, the hemogenic endothelial population is CD34 + Be hematopoietic endothelial group.In some embodiments, be hematopoietic endothelial group is the hematopoietic endothelial group of any one of the liver organoids described herein.

[0072] Foregut spheroid differentiation method In some embodiments, foregut spheroid is differentiated into liver organoid.In some embodiments, foregut spheroid is differentiated into liver organoid by contacting foregut spheroid with retinoic acid (RA).In some embodiments, the liver organoid produced from contacting foregut spheroid resembles mature liver tissue.In some embodiments, foregut spheroid is differentiated into liver organoid that more closely resembles fetal liver tissue.In some embodiments, foregut spheroid is differentiated into liver organoid that more closely resembles fetal liver tissue by not contacting foregut spheroid with RA.

[0073] In some embodiments, fetal liver organoid is produced by Matrigel droplet method.In some embodiments, foregut spheroid is embedded in 100% Matrigel, and incubated at 37 ℃ to solidify Matrigel. In some embodiments, Matrigel-embedded foregut spheroids are grown in medium without retinoic acid (e.g., DMEM / F12) for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days, about those days, at least those days, at least about those days, up to those days, or up to those days about those days, or any number of days within a range defined by any two of the foregoing days, e.g., 1-30 days, 10-20 days, 12-18 days, 1-20 days, or 10-30 days. In some embodiments, foregut spheroids are grown in medium that does not contain one or more of dexamethasone, oncostatin M, or hepatocyte growth factor, or any combination thereof.

[0074] In some embodiments, foregut spheroid or liver organoid, or both, are contacted with cytokine.In some embodiments, cytokine is delivered stem cell factor (SCF), interleukin 3 (IL-3), interleukin 6 (IL-6), interleukin 34 (IL-34), erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), or any combination thereof.In some embodiments, foregut spheroid or liver organoid, or both, are dissociated into single cell before being contacted with cytokine. In some embodiments, the cytokine is at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 ng / mL or at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 70 Concentrations of 0, 800, 900, 1000 μg / mL, about those concentrations, at least those concentrations, at least about those concentrations, or less than those concentrations, or less than about those concentrations, or any concentration within a range defined by any two of the aforementioned concentrations, for example, 1 ng / mL to 1000 μg / mL, 50 ng / mL to 100 μg / mL, 500 ng / mL to 10 μg / mL, 1 ng / mL to 1000 ng / mL, 1 μg / mL to 1000 μg / mL, 1 ng / mL to 50 μg / mL, or 100 ng / mL to 1000 μg / mL.In some embodiments, foregut spheroids or liver organoids, or both, are cultured using a method comprising the steps of: The cells are contacted with the cytokine for 47, 48, 49, or 50 days, about those days, at least those days, at least about those days, up to those days, or up to about those days, or any number of days within a range defined by any two of the foregoing numbers of days, e.g., 1 to 50 days, 5 to 40 days, 10 to 30 days, 1 to 30 days, or 20 to 50 days.

[0075] In some embodiments, foregut spheroid or liver organoid, or both, are contacted with Notch activator or ligand.Notch signal transduction is important for establishing definitive hematopoiesis in hematopoietic endothelium, and Notch activator or ligand activates Notch signal transduction pathway.In some embodiments, Notch ligand is Notch activator.In some embodiments, contacting with Notch activator or ligand can activate CD45 in foregut spheroid or liver organoid, or both. +Increase hematopoietic cell production. In some embodiments, contact with Notch activator or ligand increases the number of red blood cells produced by foregut spheroid or liver organoid, or both. In some embodiments, contact with Notch activator or ligand increases the expression of IL-6 in foregut spheroid or liver organoid, or both. In some embodiments, contact with Notch activator or ligand increases the expression of HES1 in foregut spheroid or liver organoid, or both. In some embodiments, contact with Notch activator or ligand comprises one or more (for example, at least 1, 2, 3, 4, 5) of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, Notch activator or ligand comprises cells that express one or more (for example, at least 1, 2, 3, 4, 5) of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, foregut spheroids comprise cells that express one or more (for example, at least 1, 2, 3, 4, 5) Notch activators or ligands selected from the group consisting of DLL1, DLL3, DLL4, JAG1 or JAG2, or any combination thereof.In some embodiments, foregut spheroids express one or more (for example, at least 1, 2, 3, 4, 5) Notch activators selected from the group consisting of DLL1, DLL3, DLL4, JAG1 or JAG2, or any combination thereof.In some embodiments, Notch activators or ligands are DLL4.In some embodiments, foregut spheroids or liver organoids, or both, are dissociated into single cells before being contacted with Notch activators or ligands.In some embodiments, the Notch activator or ligand is at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 ng / mL or Concentrations of 0, 700, 800, 900, 1000 μg / mL, about those concentrations, at least those concentrations, at least about those concentrations, or less than those concentrations, or about those concentrations or less, or any concentration within a range defined by any two of the aforementioned concentrations, for example, 1 ng / mL to 1000 μg / mL, 50 ng / mL to 100 μg / mL, 500 ng / mL to 10 μg / mL, 1 ng / mL to 1000 ng / mL, 1 μg / mL to 1000 μg / mL, 1 ng / mL to 50 μg / mL, or 100 ng / mL to 1000 μg / mL. In some embodiments, foregut spheroids or liver organoids, or both, are cultured using a method comprising the steps of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 1 The Notch activator or ligand is contacted for 8, 49, or 50 days, about those days, at least those days, at least about those days, up to those days, or up to about those days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1 to 50 days, 5 to 40 days, 10 to 30 days, 1 to 30 days, or 20 to 50 days.

[0076] In some embodiments, the albumin secretion of foregut spheroid or liver organoid, or both, is quantified.In some embodiments, albumin secretion is quantified by ELISA.In some embodiments, foregut spheroid or liver organoid, or both, is examined by immunohistochemistry.In some embodiments, foregut spheroid or liver organoid, or both, is examined for albumin, CD34 or CD45 expression, or any combination thereof.In some embodiments, foregut spheroid or liver organoid, or both, is examined by flow cytometry.In some embodiments, foregut spheroid or liver organoid, or both, is examined for CD45, CD34, CD11b, CD19, CD27, CD43 or CD45 expression, or any combination thereof.In some embodiments, foregut spheroid or liver organoid, or both, is examined by hematopoietic colony-forming cell assay. In some embodiments, foregut spheroids or liver organoids, or both, produce erythroid colonies, myeloid colonies, or lymphoid colonies, or any combination thereof.In some embodiments, foregut spheroids or liver organoids, or both, are examined by RT-qPCR.In some embodiments, RT-qPCR is carried out using the sequences of SEQ ID NOs: 1-12.In some embodiments, foregut spheroids or liver organoids, or both, are examined by RT-qPCR to quantify the expression of AFP, ALB, CD34, HBG1, HES1, or HES5, or any combination thereof.In some embodiments, foregut spheroids or liver organoids, or both, are examined by single-cell RNA sequencing.

[0077] In some embodiments, provided is a method for producing hepatic organoids that produce hematopoietic stem cells (HSCs).In some embodiments, the method comprises: culturing induced pluripotent stem cells under sufficient conditions to differentiate induced pluripotent stem cells into definitive endoderm; culturing definitive endoderm under sufficient conditions to differentiate definitive endoderm into foregut spheroids; and culturing foregut spheroids under sufficient conditions to differentiate foregut spheroids into liver organoids.In some embodiments, the method comprises culturing induced pluripotent stem cells under sufficient conditions to differentiate induced pluripotent stem cells into definitive endoderm.In some embodiments, the method comprises culturing definitive endoderm under sufficient conditions to differentiate foregut spheroids into liver organoids.In some embodiments, the method comprises culturing foregut spheroids under sufficient conditions to differentiate foregut spheroids into liver organoids. In some embodiments, culturing foregut spheroids under conditions sufficient to differentiate the foregut spheroids into liver organoids comprises contacting the foregut spheroids with one or more (for example, at least 1, 2, 3) of an FGF signaling pathway activator, a Wnt signaling pathway activator, or a JPG inhibitor, or any combination thereof. In some embodiments, culturing foregut spheroids under conditions sufficient to differentiate the foregut spheroids into liver organoids comprises contacting the foregut spheroids with an FGF signaling pathway activator, a Wnt signaling pathway activator, or both. In some embodiments, the FGF signaling pathway activator is FGF4. In some embodiments, the Wnt signaling pathway activator is CHIR99021. In some embodiments, the JPG inhibitor is noggin. In some embodiments, the foregut spheroids comprise mesoderm. In some embodiments, the foregut spheroids comprise mesoderm cells. In some embodiments, the foregut spheroids comprise mesoderm progenitor cells. In some embodiments, the foregut spheroids comprise mesenchyme. In some embodiments, the foregut spheroids comprise mesenchymal cells. In some embodiments, the foregut spheroids comprise mesenchymal stem cells.In some embodiments, the foregut spheroid comprises mesenchymal progenitor cells. In some embodiments, one or more (e.g., at least 1, 2, 3, 4, 5) of mesoderm, mesodermal cells, mesodermal progenitor cells, mesenchyme, mesenchymal cells, mesenchymal stem cells, mesenchymal stem cells, or mesenchymal progenitor cells, or any combination thereof, are differentiated into a hemogenic endothelial population. In some embodiments, the hemogenic endothelial population expresses CD34. + In some embodiments, the liver organoids are CD34 + Comprises hemogenic endothelial population. In some embodiments, hemogenic endothelial population differentiates into hematopoietic stem cells. In some embodiments, hemogenic endothelial population of liver organoid is differentiated from one or more (for example, at least 1, 2, 3, 4, 5) of mesoderm, mesodermal cell, mesodermal progenitor cell, mesenchyme, mesenchymal cell, mesenchymal stem cell or mesenchymal progenitor cell of foregut spheroid, or any combination thereof. In some embodiments, hemogenic endothelial population of liver organoid is differentiated from the mesenchyme of foregut spheroid. In some embodiments, hemogenic endothelial population differentiates into erythrocytes. In some embodiments, hemogenic endothelial population differentiates into erythrocytes without adding exogenous hematopoietic cytokines. In some embodiments, liver organoid comprises one or more (for example, at least 1, 2, 3) of hepatic population, erythrocyte population or hemogenic endothelial population, or any combination thereof. In some embodiments, the liver organoids comprise cells that express EpCAM. In some embodiments, the liver organoids comprise cells that express CD34 + In some embodiments, CD34 + Endothelium expresses one or more (for example, at least 1, 3, 5) of Notch1, Notch4, HEY1, HEY2, DLL4 or GATA2, or any combination thereof.In some embodiments, liver organoid comprises the erythroid cells that express GYPA.In some embodiments, liver organoid comprises the hematopoietic cells that express CD45.

[0078] In some embodiments, the induced pluripotent stem cells are cultured for, about, at least, at least about, up to, or equal to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-50 days, 5-40 days, 10-30 days, 1-30 days, or 20-50 days. In some embodiments, the definitive endoderm is cultured for, about, at least, at least about, up to, or equal to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-50 days, 5-40 days, 10-30 days, 1-30 days, or 20-50 days. In some embodiments, foregut spheroids are cultured for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 days, about those days, at least those days, up to or including those days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-50 days, 5-40 days, 10-30 days, 1-30 days, or 20-50 days.

[0079] In some embodiments, culturing the induced pluripotent stem cells comprises contacting the induced pluripotent stem cells with one or more (e.g., at least one or two) of activin A or JPG4. In some embodiments, culturing the definitive endoderm comprises contacting the definitive endoderm with one or more (e.g., at least one or two) of CHIR99021 or FGF. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more of JPG4 and FGF2. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more of JPG4 and FGF2 in an extracellular matrix. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with a Notch activator or ligand. In some embodiments, the Notch activator or ligand comprises one or more (e.g., at least one, three, five) of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the Notch activators or ligands comprise cells that express one or more (e.g., 1, 3, 5) of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the foregut spheroids comprise cells that express one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands selected from the group consisting of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the foregut spheroids express one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands selected from the group consisting of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the Notch activator or ligand is DLL4. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more (e.g., at least one, two, three) of IL-3, IL-34, or GM-CSF, or any combination thereof.In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with stem cell factor (SCF) or thrombopoietin (TPO), or both. In some embodiments, culturing the foregut spheroids further comprises contacting the foregut spheroids with one or more (e.g., at least 1, 2, 3, 4, or 5) of IL-3, IL-34, EPO, G-CSF, GM-CSF, SCF, or TPO, or any combination thereof. In some embodiments, culturing the foregut spheroids does not comprise contacting the foregut spheroids with retinoic acid (RA). In some embodiments, culturing the foregut spheroids does not comprise contacting the foregut spheroids with one or more (e.g., at least 1, 2, 3, or 4) of RA, dexamethasone, oncostatin M, or hepatocyte growth factor, or any combination thereof.

[0080] The method described herein is to produce the liver organoid that produces hematopoietic stem cells.This method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, foregut spheroid comprises mesenchyme.In some embodiments, liver organoid is differentiated into hematopoietic stem cells by CD34. + In some embodiments, the CD34 +The hematopoietic endothelial population is derived from the mesenchyme of the foregut spheroid. In some embodiments, the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm by any one of the methods described herein. In some embodiments, the PSCs or iPSCs are cultured for 1, 2, 3, 4, or 5 days, about those days, at least those days, at least about those days, or less than ... In some embodiments, definitive endoderm is cultured for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days by any one of the methods described herein to obtain foregut spheroids. In some embodiments, definitive endoderm is cultured with FGF4 or CHIR99021, or both, for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days to obtain foregut spheroids. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with a Notch activator or ligand. In some embodiments, the Notch activator or ligand is provided at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 μg / mL, at about those concentrations, at least those concentrations, at least about those concentrations, or less than or equal to about those concentrations, or any concentration within a range defined by any two of the foregoing concentrations, for example, 1 ng / mL to 50 μg / mL, 5 ng / mL to 40 μg / mL, 10 ng / mL to 30 μg / mL, 1 ng / mL to 20 ng / mL, or 5 μg / mL to 20 μg / mL.In some embodiments, foregut spheroids are contacted with a Notch activator or ligand for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, about those days, at least those days, at least about those days, up to those days, or up to about those days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days.

[0081] The method described herein is to produce the liver organoid that produces hematopoietic stem cells.This method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, foregut spheroid comprises mesenchyme.In some embodiments, liver organoid is differentiated into hematopoietic stem cells by CD34. + In some embodiments, the CD34 +The hematopoietic endothelial population is derived from the mesenchyme of the foregut spheroid. In some embodiments, the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm by any one of the methods described herein. In some embodiments, the PSCs or iPSCs are cultured for 1, 2, 3, 4, or 5 days, about those days, at least those days, at least about those days, or less than ... In some embodiments, definitive endoderm is cultured for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days by any one of the methods described herein to obtain foregut spheroids. In some embodiments, definitive endoderm is cultured with FGF4 or CHIR99021, or both, for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days to obtain foregut spheroids. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof.In some embodiments, one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof, are provided at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 μg / mL, at about those concentrations, at least those concentrations, at least about those concentrations, up to or equal to those concentrations, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 1 ng / mL to 50 μg / mL, 5 ng / mL to 40 μg / mL, 10 ng / mL to 30 μg / mL, 1 ng / mL to 20 ng / mL, or 5 μg / mL to 20 μg / mL. In some embodiments, foregut spheroids are contacted with one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof, for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, about those days, at least those days, at least about those days, up to those days, or up to those days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days. In some embodiments, the foregut spheroids comprise cells that express one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands selected from the group consisting of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the foregut spheroids express one or more (e.g., at least 1, 2, 3, 4, 5) Notch activators or ligands selected from the group consisting of DLL1, DLL3, DLL4, JAG1, or JAG2, or any combination thereof. In some embodiments, the Notch activator or ligand is DLL4.

[0082] The method described herein is to produce the liver organoid that produces hematopoietic stem cells.This method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, foregut spheroid comprises mesenchyme.In some embodiments, liver organoid is differentiated into hematopoietic stem cells by CD34. + In some embodiments, the CD34 +The hematopoietic endothelial population is derived from the mesenchyme of the foregut spheroid. In some embodiments, the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm by any one of the methods described herein. In some embodiments, the PSCs or iPSCs are cultured for 1, 2, 3, 4, or 5 days, about those days, at least those days, at least about those days, or less than ... In some embodiments, definitive endoderm is cultured for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days by any one of the methods described herein to obtain foregut spheroids. In some embodiments, definitive endoderm is cultured with FGF4 or CHIR99021, or both, for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days to obtain foregut spheroids. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with DLL4. In some embodiments, DLL4 is provided at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 μg / mL, about those concentrations, at least those concentrations, at least about those concentrations, or less than those concentrations, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 1 ng / mL to 50 μg / mL, 5 ng / mL to 40 μg / mL, 10 ng / mL to 30 μg / mL, 1 ng / mL to 20 ng / mL, or 5 μg / mL to 20 μg / mL.In some embodiments, foregut spheroids are contacted with DLL4 for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, about those days, at least those days, at least about those days, up to those days, or up to about those days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days.

[0083] The method described herein is to produce the liver organoid that produces hematopoietic stem cells.This method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, foregut spheroid comprises mesenchyme.In some embodiments, liver organoid is differentiated into hematopoietic stem cells by CD34. + In some embodiments, the CD34 +The hematopoietic endothelial population is derived from the mesenchyme of the foregut spheroid. In some embodiments, the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm by any one of the methods described herein. In some embodiments, the PSCs or iPSCs are cultured for 1, 2, 3, 4, or 5 days, about those days, at least those days, at least about those days, or less than ... In some embodiments, definitive endoderm is cultured for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days by any one of the methods described herein to obtain foregut spheroids. In some embodiments, definitive endoderm is cultured with FGF4 or CHIR99021, or both, for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days to obtain foregut spheroids. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with a cytokine. In some embodiments, the cytokine is provided at a concentration of, about, at least about, up to, or about 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 50-150 ng / mL, 80-120 ng / mL, 0-100 ng / mL, or 100-200 ng / mL.In some embodiments, the cytokine is one or more (e.g., at least 1, 2, or 3) of IL-3, IL-34, or GM-CSF, or any combination thereof. In some embodiments, the foregut spheroids are contacted with a Notch activator or ligand for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, about those days, at least those days, at least about those days, up to those days, or up to about those days, or any number of days within a range defined by any two of the foregoing days, e.g., 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days.

[0084] The method described herein is to produce the liver organoid that produces hematopoietic stem cells.This method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, foregut spheroid comprises mesenchyme.In some embodiments, liver organoid is differentiated into hematopoietic stem cells by CD34. + In some embodiments, the CD34 +The hematopoietic endothelial population is derived from the mesenchyme of the foregut spheroid. In some embodiments, the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm by any one of the methods described herein. In some embodiments, the PSCs or iPSCs are cultured for 1, 2, 3, 4, or 5 days, about those days, at least those days, at least about those days, or less than ... In some embodiments, definitive endoderm is cultured for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days by any one of the methods described herein to obtain foregut spheroids. In some embodiments, definitive endoderm is cultured with FGF4 or CHIR99021, or both, for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days to obtain foregut spheroids. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more (e.g., at least 1, 2, 3, 4, 5) of the cytokines SCF, IL-3, IL-6, IL-34, EPO, TPO, G-CSF, or GM-CSF, or any combination thereof.In some embodiments, one or more (e.g., at least 1, 2, 3, 4, 5) of the cytokines SCF, IL-3, IL-6, IL-34, EPO, TPO, G-CSF, or GM-CSF, or any combination thereof, is / are 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 410, 420, 430, 440, 450, 460, 470, 480, 490, 510, 520, 530, 540, 550, 560, 570, 580, 590, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, , 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, at about those concentrations, at least those concentrations, at least about those concentrations, up to those concentrations, or up to about those concentrations, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 5-10 ng / mL, 20-100 ng / mL, or 100-200 ng / mL. In some embodiments, one or more (e.g., at least 1, 2, 3, 4, 5) of the cytokines SCF, IL-3, IL-6, IL-34, EPO, TPO, G-CSF, or GM-CSF, or any combination thereof, is provided at a concentration of, about, at least about, up to, or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 μg / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-100 μg / mL, 1-10 μg / mL, 10-50 μg / mL, 20-100 μg / mL, or 5-15 μg / mL.In some embodiments, foregut spheroids are contacted with one or more (e.g., at least 1, 2, 3, 4, 5) of the cytokines SCF, IL-3, IL-6, IL-34, EPO, TPO, G-CSF, or GM-CSF, or any combination thereof, for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, about those days, at least those days, at least about those days, up to those days, or up to those days, or any number of days within a range defined by any two of the foregoing numbers of days, e.g., 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days.

[0085] The method described herein is to produce the liver organoid that produces hematopoietic stem cells.This method comprises culturing foregut spheroid under sufficient conditions to make foregut spheroid differentiate into liver organoid.In some embodiments, foregut spheroid comprises mesenchyme.In some embodiments, liver organoid is differentiated into hematopoietic stem cells by CD34. + In some embodiments, the CD34 +The hematopoietic endothelial population is derived from the mesenchyme of the foregut spheroid. In some embodiments, the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm by any one of the methods described herein. In some embodiments, the PSCs or iPSCs are cultured for 1, 2, 3, 4, or 5 days, about those days, at least those days, at least about those days, or less than ... In some embodiments, definitive endoderm is cultured for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days by any one of the methods described herein to obtain foregut spheroids. In some embodiments, definitive endoderm is cultured with FGF4 or CHIR99021, or both, for, about, at least, at least about, up to, or about 1, 2, 3, 4, or 5 days to obtain foregut spheroids. In some embodiments, culturing the foregut spheroids comprises contacting the foregut spheroids with one or more (e.g., at least one, two, three) of IL-3, IL-34, or GM-CSF, or any combination thereof.In some embodiments, one or more (e.g., at least one, two, three) of IL-3, IL-34, or GM-CSF, or any combination thereof, is provided at a concentration of, about, at least about, up to, or about 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 50-150 ng / mL, 80-120 ng / mL, 0-100 ng / mL, or 100-200 ng / mL. In some embodiments, the cytokine is one or more (e.g., at least 1, 2, or 3) of IL-3, IL-34, or GM-CSF, or any combination thereof. In some embodiments, the foregut spheroids are contacted with one or more (e.g., at least 1, 2, or 3) of IL-3, IL-34, or GM-CSF, or any combination thereof, for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, about those days, at least those days, at least about those days, up to those days, or up to those days, or any number of days within a range defined by any two of the foregoing days, e.g., 1 to 20 days, 5 to 15 days, 10 to 14 days, 1 to 15 days, or 5 to 20 days.

[0086] In some embodiments, any one of the methods described herein further comprises: culturing induced pluripotent stem cells under sufficient conditions for them to differentiate into definitive endoderm; culturing definitive endoderm under sufficient conditions for them to differentiate into foregut spheroids, and then culturing foregut spheroids under sufficient conditions for them to differentiate into liver organoids.In some embodiments, any one of the methods described herein further comprises: culturing definitive endoderm under sufficient conditions for them to differentiate into foregut spheroids, and then culturing foregut spheroids under sufficient conditions for them to differentiate into liver organoids.In some embodiments, the sufficient conditions for them to differentiate into definitive endoderm comprise contacting induced pluripotent stem cells with activin A or JPG4 or both to obtain definitive endoderm. In some embodiments, the sufficient conditions for differentiating definitive endoderm into foregut spheroids comprise contacting definitive endoderm with FGF4 or CHIR99021, or both, to obtain foregut spheroids.In some embodiments, the foregut spheroid comprises mesoderm, mesodermal cells, mesodermal progenitor cells, mesenchyme, mesenchymal cells, mesenchymal stem cells, or mesenchymal progenitor cells, or any combination thereof.In some embodiments, the foregut spheroid comprises mesenchyme.In some embodiments, one or more of induced pluripotent stem cells, definitive endoderm, foregut spheroids, or liver organoids, or any combination thereof, are prepared by the methods described herein.In some embodiments, one or more of induced pluripotent stem cells, definitive endoderm, foregut spheroids, or liver organoids, or any combination thereof, are prepared by the methods described in PCT Publication Nos. 2018 / 085615, 2018 / 191673, 2018 / 226267, 2019 / 126626, 2020 / 023245, 2020 / 056158, and 2020 / 069285, each of which is expressly incorporated herein by reference for purposes of producing induced pluripotent stem cells, definitive endoderm, foregut spheroids, or liver organoids, or any combination thereof.

[0087] As described herein, some embodiments of liver organoid produce one or more (for example, at least 1, 2, 3) of hemogenic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells, or any combination thereof.In some embodiments, one or more of hemogenic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells, or any combination thereof, are derived from the mesenchyme of liver organoid.In some embodiments, one or more of hemogenic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells, or any combination thereof, are derived from the mesenchyme of foregut spheroid that differentiates into liver organoid.In some embodiments, hemogenic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells, or any combination thereof, are isolated from liver organoid.In some embodiments, the isolated hemogenic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells, or any combination thereof, are administered to individuals in need. In some embodiments, the hematopoietic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells or any combination thereof that are separated from liver organoid are allogeneic to individual.In some embodiments, liver organoid is autologous to individual, and consequently, hematopoietic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells or any combination thereof are also autologous to individual.In some embodiments, hematopoietic endothelial cells, hematopoietic cells, hematopoietic stem cells or hematopoietic progenitor cells or any combination thereof do not exogenously express one or more (for example, at least 1, 3, 5) of ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1, FOSB or GFI1, or any combination thereof.

[0088] In some embodiments, the method described herein comprises isolating hematopoietic endothelial group or hematopoietic stem cell or both from liver organoid.In some embodiments, isolating hematopoietic endothelial group or hematopoietic stem cell or both is carried out by selecting cell population from liver organoid that is CD34+, CD45+ or both.

[0089] In some embodiments, the method described herein comprises isolating lymphocytes from liver organoids. In some embodiments, the liver organoid is any one of the liver organoids produced by any one of the methods described herein. In some embodiments, lymphocytes are isolated from any one of the liver organoids produced by any one of the methods described herein. In some embodiments, the lymphocytes comprise one or more of B cells, T cells, NK cells, or general lymphoid progenitor cells. In some embodiments, the B cells are B1 cells. In some embodiments, the B cells are B2 cells. In some embodiments, the B cells are both B1 cells and B2 cells. In some embodiments, the lymphocytes isolated are B1 cells. In some embodiments, the method described herein comprises producing a single cell suspension from liver organoids. In some embodiments, the method described herein comprises culturing the single cell suspension on stromal cells. In some embodiments, the method described herein comprises culturing the single cell suspension on stromal cells before isolating lymphocytes. In some embodiments, culturing the single cell suspension on stromal cells expands lymphocyte cells in the single cell suspension. In some embodiments, the stromal cells are MS-5 cells. In some embodiments, the single cell suspension is cultured on the stromal cells for 2, 3, 4, or 5 weeks, about those weeks, at least those weeks, at least about those weeks, up to those weeks, or up to those weeks. In some embodiments, the single cell suspension is contacted with one or more cytokines.In some embodiments, one or more cytokines or any combination thereof are provided at a concentration of, about, at least about, up to, or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 5-10 ng / mL, 20-100 ng / mL, or 100-200 ng / mL. In some embodiments, liver organoid is contacted with one or more cytokines for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, about these days, at least these days, at least about these days, less than these days, or less than about these days, or any number of days within the range defined by any two of the above-mentioned days, for example, 1-20 days, 5-15 days, 10-14 days, 1-15 days or 5-20 days.In some embodiments, single cell suspension is contacted with one or more (for example, at least 1, 2, 3) of SCF, IL-3, IL-6, IL-7, IL-34, EPO, TPO, G-CSF, GM-CSF or Fms-like tyrosine kinase 3 ligand (FLT3 ligand, FLT3L), or any combination thereof.In some embodiments, one or more (e.g., at least 1, 2, 3) of SCF, IL-3, IL-6, IL-7, IL-34, EPO, TPO, G-CSF, GM-CSF, or FLT3 ligand, or any combination thereof, is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 112, 114, 116, 118, 119, 220, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, It may be provided at a concentration of, about, at least about, at least about, up to, or about 20, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 5-10 ng / mL, 20-100 ng / mL, or 100-200 ng / mL. In some embodiments, one or more (e.g., at least one, two, three) of SCF, IL-3, IL-6, IL-7, IL-34, EPO, TPO, G-CSF, GM-CSF, or FLT3 ligand, or any combination thereof, is provided at a concentration of, about, at least about, up to, or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 μg / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-100 μg / mL, 1-10 μg / mL, 10-50 μg / mL, 20-100 μg / mL, or 5-15 μg / mL.In some embodiments, liver organoid is contacted with one or more (for example, at least 1, 2, 3) of SCF, IL-3, IL-6, IL-7, IL-34, EPO, TPO, G-CSF, GM-CSF or FLT3 ligand, or any combination thereof, for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, about those days, at least those days, at least about those days, less than those days, or less than those days, or any number of days within the range defined by any two of the aforementioned days, for example, 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days. In some embodiments, the single cell suspension is contacted with one or more (eg, at least 1, 2, 3) of FLT3 ligand, SCF, or IL-7, or any combination thereof. In some embodiments, one or more (e.g., at least one, two, three) of FLT3 ligand, SCF, or IL-7, or any combination thereof, is provided at a concentration of, about, at least about, up to, or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 5-10 ng / mL, 20-100 ng / mL, or 100-200 ng / mL.In some embodiments, liver organoid is contacted with one or more (for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, about these days, at least these days, at least about these days, less than these days, or less than about these days, or any number of days within the range defined by any two of the above-mentioned days, for example, 1-20 days, 5-15 days, 10-14 days, 1-15 days, or 5-20 days, FLT3 ligand, SCF or IL-7, or any combination thereof.In some embodiments, isolating lymphocyte cell is carried out by sorting cell population from single cell suspension. In some embodiments, lymphoid cells are isolated from a single cell suspension after culturing for, about, at least, at least about, up to, or about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 days, or any number of days within a range defined by any two of the foregoing days, e.g., 10-50 days, 15-40 days, 20-30 days, 10-30 days, or 20-50 days. In some embodiments, B1 cells are CD20. + CD43 + CD27 + CD70 - In some embodiments, isolating B1 cells comprises isolating B1 cells by CD20 + , CD43 + , or CD27 +In some embodiments, B1 cells have autoimmune properties, innately express surface IgM, or both. In some embodiments, B1 cells are not found in UCB cells. In some embodiments, the B1 cells are isolated from a single cell suspension after being cultured for, about, at least, at least about, up to, or equal to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 10-50 days, 15-40 days, 20-30 days, 10-30 days, or 20-50 days.

[0090] In some embodiments, a method for expanding a population of hematopoietic stem cells is provided. In some embodiments, the hematopoietic stem cells in the fetal liver or liver organoids, or both, are expressed by nestin. +In some embodiments, liver organoid expresses stem cell factor (SCF) or thrombopoietin (TPO), or both, which induces HSC expansion and maintenance.In some embodiments, method comprises culturing a population of hematopoietic stem cells in contact with liver organoid.In some embodiments, liver organoid comprises hematopoietic niche environment.In some embodiments, liver organoid is the liver organoid produced or isolated by any one of the methods described herein.In some embodiments, culturing a population of hematopoietic stem cells comprises contacting a population of hematopoietic stem cells with one or more cytokines.In some embodiments, culturing a population of hematopoietic stem cells comprises contacting a population of hematopoietic stem cells with SCF or TPO, or both. In some embodiments, SCF or TPO, or both, are provided at a concentration of, about, at least about, up to, or about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, e.g., 0-200 ng / mL, 5-10 ng / mL, 20-100 ng / mL, or 100-200 ng / mL. In some embodiments, the population of hematopoietic stem cells is contacted with SCF or TPO, or both, for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about, at least, at least about, up to, or up to about, or any number of days within a range defined by any two of the foregoing, e.g., 1-25 days, 5-20 days, 10-20 days, 1-20 days, or 10-25 days. In some embodiments, the expanded population of hematopoietic stem cells maintains pluripotency.In some embodiments, the expanded population of hematopoietic stem cells maintain pluripotency for, about, at least, at least about, up to, or equal to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 days, or any number of days within a range defined by any two of the foregoing numbers, e.g., 1-50 days, 5-40 days, 10-30 days, 1-30 days, or 20-50 days. In some embodiments, the hematopoietic stem cell population is obtained from umbilical cord blood, mobilized peripheral blood, bone marrow, pluripotent stem cell, embryonic stem cell, fetal liver or fetal spleen, or any combination thereof.In some embodiments, the liver organoid that is differentiated by one or more (for example, at least 1, 2, 3, 4) of RA, dexamethasone, oncostatin M, or hepatocyte growth factor, or any combination thereof, does not support hematopoietic cell and undifferentiated fetal-like liver organoid.

[0091] In some embodiments, the expanded population of hematopoietic stem cells is transplanted into an individual. In some embodiments, the individual is a mouse. In some embodiments, the individual is an immunocompromised mouse. In some embodiments, the individual is a human. In some embodiments, the individual is an immunocompromised human. In some embodiments, the individual is an individual in need of hematopoietic stem cells. In some embodiments, the population of hematopoietic stem cells is injected into the individual. In some embodiments, the population of hematopoietic stem cells is injected into the thigh. In some embodiments, the population of hematopoietic stem cells is injected with liver organoid cells. In some embodiments, the population of hematopoietic stem cells is injected after isolating the population of hematopoietic stem cells so that no liver organoid cells remain. In some embodiments, the individual is also administered SCF or TPO, or both. In some embodiments, the population of hematopoietic stem cells is engrafted into the individual. In some embodiments, the individual in need of hematopoietic stem cells is a patient suffering from aplastic anemia, Fanconi anemia, Diamond-Blackfan syndrome, sickle cell disease, thalassemia, paroxysmal nocturnal hemoglobinuria, Chediak-Higashi syndrome, chronic granulomatous disease, Glanzmann thrombasthenia, osteopetrosis, Gaucher disease, Niemann-Pick disease, mucopolysaccharidosis, glycoproteinosis, immunodeficiency, AIDS, ataxia-telangiectasia, DiGeorge syndrome, severe combined immunodeficiency, Wiskott-Aldrich syndrome, or the like. syndrome, Kostmann syndrome, Shwachman-Diamond syndrome, leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, hairy cell leukemia, chronic lymphocytic leukemia, myelodysplasia, Hodgkin's disease, non-Hodgkin's disease, multiple myeloma, myeloproliferative neoplasms, myelofibrosis, polycythemia vera, chronic myeloid leukemia, neuroblastoma, desmoplastic small round cell tumor, Ewing's sarcoma, or choriocarcinoma, or any combination thereof.

[0092] In some embodiments, the hematopoietic stem cell group is autologous or allogeneic to liver organoid.In some embodiments, the hematopoietic stem cell group is obtained from individual.In some embodiments, liver organoid is differentiated from the cell obtained from individual.In some embodiments, liver organoid is produced from the induced pluripotent stem cell that is derived from individual.In some embodiments, the hematopoietic stem cell group and liver organoid are obtained or derived from the same individual.In some embodiments, the individual is the individual that needs hematopoietic stem cell.

[0093] Described herein are methods for administering a population of hematopoietic stem cells to an individual in need thereof. In some embodiments, the population of hematopoietic stem cells is an isolated population of hematopoietic stem cells. In some embodiments, the population of hematopoietic stem cells is expanded, produced, or isolated by any one of the methods described herein, or any combination thereof. In some embodiments, the population of hematopoietic stem cells is autologous or allogeneic to the individual in need. In some embodiments, the population of hematopoietic stem cells is autologous to the individual in need. In some embodiments, the population of hematopoietic stem cells is allogeneic to the individual in need.

[0094] Described herein are methods for administering a hemogenic endothelial population to an individual in need thereof. In some embodiments, the hemogenic endothelial population is an isolated hemogenic endothelial population. In some embodiments, the hemogenic endothelial population is produced or isolated, or both, by any one of the methods described herein. In some embodiments, the hemogenic endothelial population is autologous to the individual in need thereof. In some embodiments, the hemogenic endothelial population is allogeneic to the individual in need thereof.

[0095] Described herein are methods of administering lymphoid cells to an individual in need thereof. In some embodiments, the lymphoid cells are isolated lymphoid cells. In some embodiments, the lymphoid cells are produced or isolated, or both, by any one of the methods described herein. In some embodiments, the lymphoid cells are autologous to the individual in need thereof. In some embodiments, the lymphoid cells are allogeneic to the individual in need thereof. In some embodiments, the lymphoid cells comprise one or more of B cells, T cells, NK cells, or common lymphoid progenitor cells, or any combination thereof. In some embodiments, the B cells are B1 cells or B2 cells, or both.

[0096] Described herein are methods for administering B1 cells to an individual in need thereof. In some embodiments, the B1 cells are isolated B1 cells. In some embodiments, the B1 cells are produced or isolated, or both, by any one of the methods described herein. In some embodiments, the B1 cells are autologous to the individual in need thereof. In some embodiments, the B1 cells are allogeneic to the individual in need thereof.

[0097] Embodiments of cell compositions are described herein. In some embodiments, the cell composition comprises liver organoids produced by any one of the methods described herein. In some embodiments, the cell composition comprises a hemogenic endothelial population produced or isolated by any one of the methods described herein. In some embodiments, the cell composition comprises hematopoietic stem cells produced or isolated by any one of the methods described herein. In some embodiments, the cell composition comprises B1 cells produced or isolated by any one of the methods described herein. In some embodiments, the cell composition comprises any combination of other cell compositions described herein. In some embodiments, the cell composition comprises one or more (e.g., at least 1, 2, 3, 4) of liver organoids, hemogenic endothelial populations, hematopoietic stem cells, or B1 cells disclosed herein, or any combination thereof. In some embodiments, the cell composition comprises a population of hematopoietic stem cells and liver organoids. In some embodiments, the population of hematopoietic stem cells is prepared or isolated by any one of the methods described herein, or both. In some embodiments, the liver organoid is prepared or isolated by any one of the methods described herein, or both. In some embodiments, hematopoietic stem cell group and liver organoid are from, or are obtained from, or are derived from the same individual.In some embodiments, hematopoietic stem cell group and liver organoid are from, or are obtained from, or are derived from different individuals. [Example]

[0098] Some aspects of the above embodiments are disclosed in further detail in the following examples, which are not intended to limit the scope of the disclosure in any way. Those skilled in the art will appreciate that many other embodiments are also within the scope of the present disclosure, as described above and in the claims herein.

[0099] Example 1. Materials and Methods hPSC maintenance Human iPSC lines were maintained as previously described (Takebe et al., 2015; Takebe et al., 2014). Undifferentiated hiPSCs were maintained in StemFit medium (StemCell Technologies) on plates coated with laminin (1% iMatrix-511 silk in PBS) in feeder-free conditions at 37°C for 2 hours. iPSCs were cultured at 37°C in 5% CO2 at a density of 8 × 10 in StemFit medium supplemented with 100 ng / mL FGF2 and 10 nM ROCK inhibitor Y-27632. 4 Cells / well were seeded into 6-well cell culture treated plates (BD Falcon).

[0100] Definitive endoderm induction Human iPSCs were induced to differentiate into definitive endoderm using a method described previously with slight modifications (Spence et al., 2011). Briefly, human iPSC colonies were isolated in Accutase (Thermo Fisher Scientific) in Dulbecco's phosphate-buffered saline (DPBS, Life Technologies), and 150,000 cells / mL were plated onto tissue culture plates at a 1 / 30 dilution of Matrigel in RPMI 1640 medium (Life Technologies) supplemented with 100 ng / mL activin A (R&D Systems) and 50 ng / mL bone morphogenetic protein 4 (JPG4, R&D Systems) on day 1, and with 100 ng / mL activin A and 2% fetal calf serum (FCS) on day 3. On days 4–6, cells were cultured in Advanced DMEM (Thermo Fisher Scientific) supplemented with B27 (Life Technologies) and N2 (Gibco), and further supplemented with 500 ng / mL fibroblast growth factor 4 (FGF4, R&D Systems) and 3 μM CHIR99021 (Stemgent). Cells were maintained at 37°C in 5% CO2, and the medium was changed daily. Spheroids appeared on the plates on day 7 of differentiation.

[0101] Human liver organoid (HLO) formation On day 7, spheroids were collected by manual pipetting and pelleted by centrifugation. The cells were embedded in 100% Matrigel by aspirating the medium and gently pipetting to homogenize the cell pellet. If desired, add a Notch activator or ligand (e.g., 10 μg / mL DLL4) to the Matrigel. Alternatively, optionally, add UCB cells (e.g., 1,000 UCB cells per 75 μL of Matrigel) to the Matrigel for coculture with organoids. For definitive endoderm culture, 250 μL of Matrigel (Corning) was used per well of a 24-well plate. 75 μL of Matrigel droplets were placed in each well of a new 24-well plate (VWR). The plate was then incubated at 37°C in a 5% CO2 / 95% air atmosphere for 5–15 minutes. After the Matrigel solidified, Advanced DMEM / F12 containing 1x B27, 1x N2, 2mM L-glutamine, 15mM HEPES, and 1x penicillin / streptomycin was added to the wells. This medium was supplemented with 20ng / mL JPG4 and 10ng / mL FGF2 for 4 days, after which JPG4 and FGF2 were removed.

[0102] Albumin ELISA To measure albumin secretion levels in HLOs, 200 μL of culture supernatant was collected from Matrigel-embedded HLOs. Culture supernatants were collected 24 hours after medium change and stored at -80°C until use. The supernatants were assayed using the Human Albumin ELISA Quantitation Set kit (Bethyl Laboratories, E80-129) according to the manufacturer's instructions.

[0103] histology Samples were collected in Matrigel droplets, fixed in 4% paraformaldehyde, and embedded in paraffin. Sections were subjected to hematoxylin and eosin (H&E) and immunohistochemical staining. The following primary antibodies were used: anti-human albumin (Sigma-Aldrich, A668), anti-human CD34 (Roche, 760-2620), and anti-human CD45 (Roche, 760-2505).

[0104] Flow cytometry Organoids were isolated from the Matrigel droplets and washed with 1x PBS. HLOs were dissociated into single cells by treating with trypsin-EDTA (0.05%, containing phenol red, Gibco) for 10 minutes. Cells were washed in DMEM / F12 containing 10% FBS and suspended in PBS containing 2% FBS. After filtration (e.g., through a 40-50 µm nylon filter), single cells were subjected to flow cytometry using the following antibodies: anti-CD45-APC (Miltenyl, 130-098-143), anti-CD34-APC / Cy7 (BioLegend, 343513), anti-CD11b-PE / Cy7 (BioLegend, 301322), anti-CD19-BV421 (BioLegend, 302233), anti-CD27-AF700 (BioLegend, 356415), and anti-CD43-FITC (BioLegend, 315204). For mouse engraftment experiments, anti-mouse CD45-BV421 (BioLegend, 103133) was used.

[0105] Colony-forming cell (CFC) assay 150,000 cells / mL were plated in 3 mL of MethoCult SF H4436 serum-free methylcellulose-based medium (StemCell Technologies). The mixture was evenly distributed into 60 mm dishes and maintained in a humidified chamber at 37°C for 14 days before being examined under a light microscope. The medium used contained insulin, transferrin, and cytokines such as SCF, IL-3, IL-6, EPO, G-CSF, and GM-CSF. SCF, IL-3, IL-6, G-CSF, and GM-CSF were supplemented at 100 ng / mL, and EPO was supplemented at 1–8 IU / mL (approximately 10–100 ng / mL).

[0106] Cytospin and Giemsa staining Cells from the CFC assay were harvested from the methylcellulose medium by washing with PBS, and 7,000 cells were applied as a thin layer to glass slides using a Cytospin centrifuge (500 rpm for 10 min). Slides were air-dried and stained with a Wright-Giemsa staining kit (Thermo Fisher Scientific) according to the manufacturer's instructions, followed by examination under a light microscope.

[0107] Mouse transplantation NSG-SGM3 (NSGS, NOD-scid IL2Rgnull-3 / GM / SF) mice were bred and housed in an animal care facility. Animal experiments were performed in accordance with the institutional guidelines approved by the Animal Care Committee. Mice were sublethally immunosecreted with busulfan (30 μg / g body weight in a 10 μL volume) administered by IP injection 24 h prior to cell injection. Cells were injected intra-thigh. Organoid cultures were cultured using umbilical cord blood (UCB) CD34 + The cells were co-cultured with 2 × 10 cells, and the medium was supplemented with stem cell factor (SCF) and thrombopoietin (TPO) for 12 days. 6 HLO+UCB cells or 2 × 10 3 UCB CD34 + Cells alone were injected into mice, and after 7 weeks, femoral bone marrow and blood were collected and analyzed by flow cytometry.

[0108] RNA isolation and RT-qPCR RNA was isolated using an RNeasy Mini Kit (Qiagen). Reverse transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) according to the manufacturer's protocol. qPCR was performed in duplicate on a QuantStudio 3 Real-Time PCR System (Thermo Fisher) using TaqMan Gene Expression Master Mix (Applied Biosystems) and probes from the Universal Probe Library (Roche). All primer and probe information for each target gene was obtained from the Universal Probe Library Assay Design Center (accessible on the World Wide Web at qpcr.probefinder.com / organism.jsp). The primers were as follows: Alpha-fetoprotein (AFP) forward: tgtactgcagagataagtttagctgac (SEQ ID NO: 1) AFP reverse: tccttgtaagtggcttcttgaac (SEQ ID NO: 2) Albumin (ALB) forward: gtgaggttgctcatcggttt (SEQ ID NO: 3) ALB reverse: gagcaaaggcaatcaacacc (SEQ ID NO: 4) CD34 forward: ggcacagctggaggtcttat (SEQ ID NO: 5) CD34 reverse: tgttcaggcatcagagaagtg (SEQ ID NO: 6) Hemoglobin subunit gamma-1 (HBG1) forward: tggatcctgagaacttcaagc (SEQ ID NO: 7) HBG1 reverse: gccactgcagtcaccatct (SEQ ID NO: 8) HES1 forward: gaagcacctccggaacct (SEQ ID NO: 9) HES1 reverse: gtcacctcgttcatgcactc (SEQ ID NO: 10) HES5 forward: cccggggttctatgatatttg (SEQ ID NO: 11) HES5 reverse: gccctgaagaaagtcctctaca (SEQ ID NO: 12)

[0109] Accession numbers are available as HUGO Gene Nomenclature Committee IDs: AFP (HGNC:317), ALB (HGNC:399), CD34 (HGNC:1662), HBG1 (HGNC:4831), HES1 (HGNC:5192), HES5 (HGNC:19764), EPO (HGNC:3415), TPO (THPO, HGNC:11795), SCF (KIT ligand, KITLG, HGNC:6343).

[0110] Single-cell RNA sequencing HLOs were isolated from the Matrigel droplets and washed with 1x PBS. They were dissociated into single cells by treating with trypsin-EDTA (0.05%, containing phenol red, Gibco) for 10 minutes. Cells were washed in DMEM / F12 containing 10% FBS and suspended in PBS containing 2% FBS. Next, cells underwent single-cell RNA-seq library preparation and sequencing on the 10X Genomics Chromium platform. 2,868 cells were recovered for analysis. Sequencing reads were processed using the Cell Ranger gene expression pipelines mkfastq and count, starting with demultiplexing barcode and read data and converting them to fastq files. Raw reads were aligned to the Hg19 genome and filtered to generate a gene barcode matrix. Analysis was performed using AltAnalyze, where gene and cell clusters were identified through unsupervised analysis and dominant sample populations were identified through expression clustering. After removing outliers, clusters were restricted to those with >5 cells, a minimum Pearson correlation of 0.5, and a fold change between clusters >4. Cell cycle effects were removed. Cluster-based heatmaps and corresponding tSNE plots were generated using R v3.3.3. Cell cluster identity was determined by phylogenetic correlation and ontology analysis in ToppGene (available on the World Wide Web at toppgene.cchmc.org). tSNE plots were established using Loupe Cell Browser v1.0.5.

[0111] Example 2. Parallel differentiation of hepatic endoderm and hemogenic endothelium To mimic the fetal liver environment, iPSC-derived midgut spheroids were generated by endodermal induction in the presence of activin A and embedded in Matrigel droplets as described herein. Next, the midgut spheroids were cultured in the presence of JPG4 and FGF2, which are important for early liver specification. The resulting organoid cultures expressed hepatic genes, including albumin (ALB) and alpha-fetoprotein (AFP), as well as the endothelial marker CD34 (Figure 1A-D). The organoids also contained a hematopoietic population expressing fetal hemoglobin (as evidenced by the presence of the hemoglobin gamma subunit). Additional analysis revealed that the organoid system contained a hemogenic endothelial population capable of producing red blood cells without the addition of exogenous hematopoietic cytokines (Figure 1A). This was further verified by single-cell RNA sequencing (scRNA-seq) of organoid cultures at day 14. Expression profile analysis showed that at this time point, three populations of interest were present, in addition to a large mesenchymal population expressing mesodermal and ectodermal markers (Figures 2, 3). The clusters of interest included a hepatic population, an erythroid population, and a hemogenic endothelial population (Figure 4A-C). These hemogenic endothelial cells were further analyzed by colony-forming cell (CFC) assay, in which cells from organoid cultures were dispersed into a single-cell suspension and plated in a methylcellulose-based medium containing cytokines. The plated cells produced both erythroid and myeloid colonies, with peak colony formation occurring around day 14 of organoid culture (Figure 5A-B).

[0112] Example 3. Notch-dependent emergence of hemogenic endothelium Histological examination of liver organoid cultures revealed CD34 expression, with adjacent erythroid cells expressing glycophorin A (CD235a, GYPA) and CD45-expressing hematopoietic cells. + Epithelial cell adhesion molecule (EpCAM)-expressing cells were evident along with the endothelium (Figure 6A-B). Time-lapse analysis of CD34-expressing cells revealed that CD34 + It became clear that the number of cells decreased before the peak of CFC assay activity (Figure 6C-D).

[0113] Notch signaling has previously been shown to be important in establishing definitive hematopoiesis in hemogenic endothelium. Specifically, the Notch receptors Notch1 and Notch4, along with the Notch ligands JAG1, JAG2, and DLL4, are expressed by aortic endothelial cells and are essential for early hematopoiesis via hemogenic endothelium. During this process, endothelial cells expressing the receptor Notch1 or Notch4 interact with neighboring endothelial cells expressing the ligand DLL4, leading to increased expression of downstream target genes such as HES1 / 5, HEY1 / 2, and GATA2. A rapid increase in Notch signaling is evidenced by increased HES1 expression levels, which peak around day 10 of organoid culture. This peak is just prior to the peak of hematopoietic activity demonstrated by the CFC assay, which peaks around days 12–14 (Figure 6D–E). Flow cytometry of organoid cells to detect CD34 revealed that CD34 expression increased as organoids differentiated. + The CD34 cell numbers showed a steady decrease (Figure 6C). To better understand the population dynamics of the organoid system described herein, organoid cultures at day 14 were analyzed by scRNA-seq. + Closer analysis of the endothelial population revealed highly specific expression of the Notch signaling genes Notch1, Notch4, HEY1, HEY2, DLL4, and GATA2 (Fig. 7A, 4C).

[0114] To test Notch dependency in the organoid culture system, we added the Notch ligand DLL4 (1–10 µg / mL) to Matrigel droplets during organoid seeding, and supplemented the organoid growth medium with the hematopoietic cytokines IL-3, IL-34, and GM-CSF (100 ng / mL each) (Figure 7B). Addition of DLL4 increased the expression of CD45 +The efficiency of cytokines in the production of hematopoietic cells increased (Figure 8). This resulted in a significant increase in IL-6 expression and only a slight decrease in albumin expression (Figure 9A-B). Conversely, organoid cultures treated with the γ-secretase inhibitor DAPT to inhibit Notch activity resulted in a visible decrease in erythrocytes and HES1 expression while maintaining albumin expression (Figure 10A-D).

[0115] Example 4. Generation of B1 cells from organoid culture Definitive hematopoiesis is characterized by the production of both myeloid and lymphoid lineages. To examine the lymphoid potential of the organoid cultures described herein, cells were harvested around day 14 of organoid culture and plated onto confluent MS-5 mouse stromal cells to differentiate into B cells (Figure 11A-B). MS-5 cells were cultured in medium supplemented with 5 ng / mL FLT3 ligand (FLT3L), 100 ng / mL SCF, and 5 ng / mL IL-7. During development, the fetal liver is the source of a unique B1 cell population. These cells differ from adult (B2) cells in that they develop independently of HSCs. B1 cells have autoimmune properties and inherently express surface IgM and CD20. + CD43 + CD27 + CD70 - It has been reported that cells from organoids were compared with UCB cells in their production of B cells from MS-5 co-culture. Interestingly, while both organoids and UCB cells were able to demonstrate B cell differentiation, the organoid-derived B cell population contained a unique B1 cell phenotype that could not be regenerated from UCB cells. FACS analysis revealed that CD20 + CD43 + CD27 + Clusters of cells became apparent (Fig. 11C).

[0116] Example 5. Creation of a hematopoietic niche environment Hematopoietic stem and progenitor cells exist within a specific, complex niche environment that is not yet fully understood, particularly during fetal development, where HSCs in the fetal liver undergo extensive expansion.To better understand the origin of hematopoietic cells in the organoid cultures described herein, organoid cells were analyzed for hematopoietic niche markers.HSCs in the fetal liver express nestin. + Associated with the portal vasculature. In organoid cultures, CD34 + Pockets of cells were also seen in close association with nestin staining, and scRNA-seq also revealed a population of CD34 / nestin co-expressing cells (Figures ​(Figures12A-B,4A-D). Interestingly, scRNA-seq also revealed that cells clustered with the hepatic population expressed stem cell factor (SCF) and thrombopoietin (TPO), which are essential for HSC expansion and maintenance and are often used in attempts to expand HSC ex vivo (Figure 12C).

[0117] To further test the niche environment in organoid cultures, we used CD34 + Human UCB cells were added to the Matrigel droplets during organoid seeding. Exogenous recombinant SCF and TPO were added to the growth medium to improve the efficiency of hematopoietic cell production and maintenance. Addition of 100 ng / mL SCF and 10 ng / mL TPO significantly increased CD34 expression in organoid cultures. + and CD45 + Cell production was significantly increased, as was the number of colonies formed (Fig. 12D-E).

[0118] To determine whether these results were due to the presence of a hematopoietic niche or simply due to contamination with mesodermal populations leading to hematopoietic differentiation, we examined the ability of UCB cells to form colonies after mixing with organoid cultures. Promoting hepatic differentiation of organoids with retinoic acid (RA), followed by hepatocyte culture medium (HCM, Lonza), optionally supplemented with 0.1 µM dexamethasone, 10 ng / mL oncostatin M, and 10 ng / mL hepatocyte growth factor (HGF), resulted in a steady decline in hematopoietic colony-forming capacity. Conversely, the protocol described herein, modified to limit hepatic differentiation, maintained the presence of colony-forming cells and their diverse differentiation potential, modeling the transient stage of fetal liver hematopoiesis and demonstrating the existence of a unique niche dependent on the presence of immature hepatic populations (Figure 12F-G).

[0119] UCB cells can engraft in immunocompromised recipients and reconstitute a complete hematopoietic system. However, a limiting factor for the potential therapeutic use of these cells is their inability to be cultured or expanded in vitro. To further analyze the niche environment of the organoid system described herein, we tested the engraftment of UCB cells after co-culture with organoids. UCB cells were combined with organoids in Matrigel droplets, and the growth medium was supplemented with SCF and TPO on day 6 of organoid culture. After 12 days, UCB and organoid cells were collected into a single-cell suspension and injected intrafemorally into the bone marrow of NSGS mice. After 7 weeks, the mice expressed human-specific CD45 + Cell engraftment was demonstrated (Figure 13A-B). The engraftment obtained was approximately 3% after co-culturing UCB cells with organoids, compared to approximately 16% without co-culture. While this engraftment is reduced compared to fresh umbilical cord blood cells, UCB cultured under the same conditions without organoids quickly lost their engraftment potential. Therefore, this provides a new system for culturing HSCs while maintaining their engraftment potential.

[0120] As shown herein, a novel fetal liver organoid system derived from human iPSCs can give rise to both hepatocytes and hematopoietic cells in a symbiotic co-differentiation system. Hematopoietic cells in this system arise from a hemogenic endothelial population and differentiate into both myeloid and lymphoid lineages in the presence of cytokines. Co-culturing organoid cells with MS-5 mouse stromal cells resulted in a fetal B1-like cell population, as identified by flow cytometry. Although engraftment of UCB cells after co-culturing with organoids was limited, this system provides evidence for a novel method for maintaining HSCs in culture by mimicking their natural environment.

[0121] In at least some of the foregoing embodiments, one or more elements used in an embodiment may be used interchangeably in another embodiment unless such substitution is technically feasible. Those skilled in the art will appreciate that various other omissions, additions, and modifications may be made to the methods and structures described herein without departing from the scope of the claimed subject matter. All such modifications and variations are intended to fall within the scope of the subject matter, as defined by the appended claims.

[0122] With respect to the use of virtually any plural and / or singular term herein, one of ordinary skill in the art can translate from plural to singular and / or from singular to plural as appropriate to the context and / or application. For clarity, various singular / plural permutations may be expressly set forth herein.

[0123] In general, terms used herein, particularly in the appended claims (e.g., the body of the appended claims), are generally intended to be "open" terms (e.g., the term "including" should be interpreted as "including but not limited to," the term "having" should be interpreted as "having at least," the term "includes" should be interpreted as "including but not limited to," etc.). Where a specific number of introduced claim recitations are intended, such intention will be explicitly set forth in the claim; in the absence of such recitation, it will be further understood by those skilled in the art that no such intention exists. For example, to aid in understanding, the following appended claims may include the use of the introductory phrases "at least one" and "one or more" to introduce claim recitations. However, the use of such phrases should not be construed to mean that introducing a claim recitation with the indefinite article "a" or "an" limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even if that same claim also contains the introductory phrase "one or more" or "at least one" and an indefinite article such as "a" or "an" (e.g., "a" and / or "an" should be interpreted as "at least one" or "one or more"). The same applies to the use of definite articles used to introduce claim recitations. Additionally, even when a specific number of introduced claim recitations is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., a mere recitation of "two recitations," without other modifiers, means at least two recitations, or more than two recitations). Furthermore, when language similar to "at least one of A, B, and C, etc." is used, generally such configuration is intended in the sense that one of ordinary skill in the art would understand the practice (e.g., "a system having at least one of A, B, and C" includes, but is not limited to, systems having A only, B only, C only, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.).When language similar to "at least one of A, B, or C, etc." is used, generally, such configuration is intended in the sense that one of ordinary skill in the art would understand the practice (e.g., "a system having at least one of A, B, or C" includes, but is not limited to, systems having A only, B only, C only, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). Furthermore, one of ordinary skill in the art will understand that any disjunctive word and / or disjunctive phrase presenting two or more alternative terms, whether in the specification, claims, or drawings, should be understood to contemplate the possibility of including one of those terms, either of those terms, or both of those terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."

[0124] Additionally, when features or aspects of the present disclosure are described in terms of a Markush group, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0125] As will be understood by those skilled in the art, for all purposes, including with respect to providing a written description, all ranges disclosed herein encompass any and all possible subranges and combinations of subranges. Any recited range can be readily recognized as fully descriptive and allowing for that same range to be divided into at least two equal parts, a third, a quarter, a fifth, a tenth, etc. As a non-limiting example, each range described herein can be readily divided into a lower third, a middle third, and an upper third, etc. As will also be understood by those skilled in the art, terms such as "up to," "at least," "greater than," "less than," etc., all refer to ranges that are inclusive of the recited numbers and that can be subsequently divided into subranges, as described herein. Finally, as will be understood by those skilled in the art, a range includes each individual member. Thus, for example, a group having 1 to 3 items refers to groups having 1, 2, or 3 items. Similarly, a group having 1 to 5 items refers to groups having 1, 2, 3, 4, or 5 items, etc.

[0126] While various aspects and embodiments are disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

[0127] All references cited herein, including, but not limited to, published and unpublished applications, patents, and literature references, are incorporated by reference in their entirety and are hereby made a part of this specification. To the extent that the publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, this specification is intended to supersede and / or take precedence over any such conflicting material.

[0128] References Sugimura R,Jha DK,Han A,et al.Haematopoietic stem and progenitor cells from human pluripotent stem cells.Nature.2017;545(7655):432-438.doi:10.1038 / nature22370 Lis R,Karrasch CC,Poulos MG,et al.Conversion of adult endothelium to immunocompetent haematopoietic stem cells.Nature.2017;545(7655):439-445.doi:10.1038 / nature22326 Wilkinson AC,Ishida R,Kikuchi M,et al.Long-term ex vivo haematopoietic-stem-cell expansion allows nonconditioned transplantation.Nature.2019;571(7763):117-121.doi:10.1038 / s41586-019-1244-x Rothstein TL,Griffin DO,Holodick NE,Quach TD,Kaku H.Human B-1 cells take the stage.Ann N Y Acad Sci.2013;1285:97-114.doi:10.1111 / nyas.12137 Montecino-Rodriguez E,Leathers H,Dorshkind K.Identification of a B-1 B cell-specified progenitor.Nat Immunol.2006;7(3):293-301.doi:10.1038 / ni1301 McCracken KW,Aihara E,Martin B,et al.Wnt / β-catenin promotes gastric fundus specification in mice and humans.Nature.2017;541(7636):182-187.doi:10.1038 / nature21021 Spence JR,Mayhew CN,Rankin SA,et al.Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro.Nature.2011;470(7332):105-109.doi:10.1038 / nature09691 Si-Tayeb K,Noto FK,Nagaoka M,et al.Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells.Hepatology.2010;51(1):297-305.doi:10.1002 / hep.23354 Uenishi GI,Jung HS,Kumar A,et al.NOTCH signaling specifies arterial-type definitive hemogenic endothelium from human pluripotent stem cells.Nat Commun.2018;9.doi:10.1038 / s41467-018-04134-7 Robert-Moreno A,Espinosa L,Pompa JL de la,Bigas A.RBPjκ-dependent Notch function regulates Gata2 and is essential for the formation of intra-embryonic hematopoietic cells.Development.2005;132(5):1117-1126.doi:10.1242 / dev.01660 Robert-Moreno A,Guiu J,Ruiz-Herguido C,et al.Impaired embryonic haematopoiesis yet normal arterial development in the absence of the Notch ligand Jagged1.EMBO J.2008;27(13):1886-1895.doi:10.1038 / emboj.2008.113 Griffin DO,Holodick NE,Rothstein TL.Human B1 cells in umbilical cord and adult peripheral blood express the novel phenotype CD20+CD27+CD43+CD70-.J Exp Med.2011;208(1):67-80.doi:10.1084 / jem.20101499 Khan JA,Mendelson A,Kunisaki Y,et al.Fetal liver hematopoietic stem cell niches associate with portal vessels.Science.2016;351(6269):176-180.doi:10.1126 / science.aad0084 Ueda T,Tsuji K,Yoshino H,et al.Expansion of human NOD / SCID-repopulating cells by stem cell factor,Flk2 / Flt3 ligand,thrombopoietin,IL-6,and soluble IL-6 receptor.J Clin Invest.2000;105(7):1013-1021. Zhang CC,Kaba M,Iizuka S,Huynh H,Lodish HF.Angiopoietin-like 5 and IGFBP2 stimulate ex vivo expansion of human cord blood hematopoietic stem cells as assayed by NOD / SCID transplantation.Blood.2008;111(7):3415-3423.doi:10.1182 / blood-2007-11-122119

Claims

1. An in vitro fetal liver organoid that produces hematopoietic cells, said organoid comprising a hematopoietic niche environment.

2. An in vitro fetal liver organoid as described in claim 1, wherein the liver organoid comprises a CD34+ hemogenic endothelial population that differentiates into hematopoietic cells.

3. An in vitro fetal liver organoid as described in claim 2, wherein the CD34+ hemogenic endothelial population co-expresses nestin.

4. An in vitro fetal liver organoid as described in any one of claims 1 to 3, wherein the organoid comprises an immature liver population.

5. An in vitro fetal liver organoid described in any one of claims 2 to 4, wherein the CD34+ hemogenic endothelial population is derived from the mesenchyme of the foregut spheroid.

6. An in vitro fetal liver organoid as described in claim 5, wherein the foregut spheroid is obtained by culturing PSCs, iPSCs, or definitive endoderm.

7. An in vitro fetal liver organoid described in any one of claims 1 to 6, wherein the hematopoietic cells are hemogenic endothelial cells, hematopoietic cells, hematopoietic stem cells, or hematopoietic progenitor cells, or any combination thereof.

8. An in vitro fetal liver organoid described in any one of claims 1 to 7, wherein the hematopoietic cells are lymphocytic cells.

9. An in vitro fetal liver organoid as described in claim 8, wherein the lymphocyte cells include one or more of B cells, T cells, NK cells, or general lymphocyte progenitor cells.

10. An in vitro fetal liver organoid as described in claim 9, wherein the B cells are B1 cells, B2 cells, or both.

11. An in vitro fetal liver organoid as described in any one of claims 1 to 10, wherein the hematopoietic cells do not exogenously express one or more of ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1, FOSB, and GFI1.

12. An in vitro fetal liver organoid as described in any one of claims 1 to 11, wherein the organoid expresses stem cell factor (SCF), or thrombopoietin (TPO), or both.

13. A hemogenic endothelial population isolated from a liver organoid described in any one of claims 1 to 12.

14. The hemogenic endothelial population of claim 13, wherein the hemogenic endothelial population is CD34+, or CD45+, or both.

15. A hemogenic endothelial population as described in claim 14, wherein the CD34+ hemogenic endothelial population is derived from the mesenchyme of the foregut spheroid.

16. A hemogenic endothelial population as described in claim 15, wherein the foregut spheroids are obtained by culturing PSCs, iPSCs, or definitive endoderm.

17. Hematopoietic stem cells produced from a liver organoid described in any one of claims 1 to 12.

18. A hematopoietic stem cell as described in claim 17, wherein the hematopoietic stem cell does not exogenously express one or more of ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, SPI1, FOSB, and GFI1.

19. A hematopoietic stem cell as described in claim 17 or 18, wherein the hematopoietic stem cell maintains pluripotency for at least 20 days.

20. A cell composition comprising a population of hematopoietic stem cells (HSCs) and a liver organoid described in any one of claims 1 to 12.

21. The cell composition of claim 20, wherein the HSCs are derived from umbilical cord blood, mobilized peripheral blood, bone marrow, pluripotent stem cells, embryonic stem cells, fetal liver, or fetal spleen, or any combination thereof.

22. A cell composition as described in claim 20 or 21, wherein the population of hematopoietic stem cells and the liver organoids are derived from cells of the same individual.

23. A cell composition as described in claim 20 or 21, wherein the population of hematopoietic stem cells and the liver organoids are derived from cells of different individuals.

24. A cell composition comprising umbilical cord blood and a liver organoid described in any one of claims 1 to 12.

25. Use of an organoid according to any one of claims 1 to 12, a hemogenic endothelial population according to any one of claims 13 to 16, or a cell composition according to any one of claims 20 to 23 in the manufacture of a pharmaceutical composition for the treatment of blood cancers, immune disorders, and genetic defects in blood cells, wherein the pharmaceutical composition is administered to an individual.

26. The use of claim 25, wherein HSCs are produced after administration of the pharmaceutical composition.

27. ​​The use according to any one of claims 25 to 26, wherein the administration comprises injection into the bone marrow.

28. A method for maintaining hematopoietic stem cells, comprising culturing hematopoietic stem cells together with a liver organoid described in any one of claims 1 to 12.

29. The method of claim 28, comprising contacting the hematopoietic stem cells with SCF or TPO, or both.

30. A method according to any one of claims 28 to 29, wherein the hematopoietic stem cells maintain pluripotency for a certain period of time.

31. An organoid as described in any one of claims 1 to 12, which is allogeneically transplanted into an individual.

32. A hemogenic endothelial population according to any one of claims 13 to 16, which is allogeneically transplanted into an individual.

33. A cell composition described in any one of claims 20 to 23, which is allogeneically transplanted into an individual.

34. An organoid as described in any one of claims 1 to 12, which is autologously transplanted into an individual.

35. A hemogenic endothelial population according to any one of claims 13 to 16, which is autologous transplanted into an individual.

36. A cell composition described in any one of claims 20 to 23, which is autologous transplanted into an individual.

Images