Hydrodynamic Gene Delivery

Abstract

Hydrodynamic injection of nucleic acids or proteins for in vivo gene therapy into the bile duct, liver, pancreas, and kidneys of a subject.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 165,944, filed March 25, 2021, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] The liver, pancreas, and kidneys are affected by many acquired and inherited genetic disorders. Devastating single-gene disorders, such as alpha-1 antitrypsin deficiency, cystic fibrosis, and many others, could theoretically be treated by inserting a corrected copy of the defective gene into affected cells. This presents an opportunity for the application of organ-targeted gene therapy, where single-gene replacement has been shown to have significant clinical impact. However, no technically simple, organ-specific method for delivering gene therapy to the liver, pancreas, or kidneys currently exists. The lack of such a method represents a major drawback to the effective treatment of millions of patients, many of whom are children. Previous attempts at treating some of these disorders have highlighted potentially devastating side effects associated with delivery vehicles and methods. There is a need for the development of clinical-grade, simple, safe, and efficient in vivo nucleic acid delivery systems. Summary of the Invention [Problem to be solved by the invention]

[0003] The present disclosure provides methods and systems for intrabiliary delivery of nucleic acids and proteins via hydrodynamic administration. [Means for solving the problem]

[0004] In one aspect, methods and systems are provided for treating or preventing kidney, liver, or pancreatic diseases by gene therapy. In certain embodiments, methods are provided for treating or preventing hemophilia A, hemophilia B, alpha-1 antitrypsin deficiency, familial hypercholesterolemia, progressive familial intrahepatic cholestasis, hereditary hemochromatosis, Wilson's disease, Crigler-Najjar syndrome, methylmalonic acidemia, phenylketonuria, and / or ornithine transcarbamylase deficiency, as well as other diseases and disorders disclosed herein by gene therapy.

[0005] More specifically, in one preferred embodiment, a method and system for treating a subject is provided, the method and system comprising administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the subject's biliary tree to the subject's liver using a catheter, wherein a delivery portion of the catheter is advanced through the bile duct upstream of the cystic duct and into the common hepatic duct.

[0006] In one embodiment, the catheter tip is positioned at an extrahepatic location during delivery of the nucleic acid. In another embodiment, the catheter tip is positioned within an intrahepatic location within the liver parenchyma during delivery of the nucleic acid. In a further embodiment, the catheter tip is positioned within or near the liver parenchyma. In yet another embodiment, the catheter is positioned so that the catheter balloon is inflated proximal or downstream of the porta hepatis within the common hepatic duct.

[0007] The administered nucleic acid and / or protein solution appropriately increases intrahepatic pressure, and preferably the catheter balloon is inflated within the liver parenchyma to prevent backflow of fluid into the common hepatic duct.

[0008] In a further aspect, methods and systems are provided that may include administering to a subject's biliary tree, liver, kidney, or pancreas 1) a first fluid composition that does not contain nucleic acids and / or proteins, and then 2) an effective amount of a nucleic acid and / or protein solution. In one embodiment, the first fluid injection preferably serves to remove bile, urine, or pancreatic exocrine secretions from the biliary tree, ureter and renal pelvis, or pancreatic duct system prior to injection of the nucleic acid and / or protein solution.

[0009] In a further aspect, methods and systems are provided that may include administering a radiocontrast agent through the subject's biliary tree, liver, kidney, or pancreas to confirm catheter placement after balloon inflation, and then administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the subject's biliary tree, liver, kidney, or pancreas. Preferably, the catheter location is selected and / or verified by visualization of the administered radiocontrast agent. Preferably, the radiocontrast agent is administered to the subject's liver via the subject's biliary tree, to the subject's pancreas via the subject's pancreatic duct, and / or to the subject's kidney via the subject's ureter.

[0010] In additional aspects, methods and systems are provided for placing a catheter in the common hepatic duct for biliary hydrodynamic infusion, where the catheter placement comprises the use of endoscopic retrograde cholangiopancreatography (ERCP) to insert the catheter into the common hepatic duct at a location specified herein, or alternatively, into the pancreatic duct of a subject.

[0011] In each of these aspects, at least in certain embodiments, preferably the catheter is selectively advanced into the right hepatic bile duct, whereby the nucleic acid is administered into the right hepatic lobe.

[0012] In each of these aspects, at least in certain embodiments, preferably the catheter is selectively advanced into the left hepatic bile duct, whereby the nucleic acid is administered into the left hepatic lobe.

[0013] In each of these aspects, at least in certain embodiments, one or more pharmacological agents are preferably injected into the pancreatic duct before or after the endoscopic retrograde cholangiopancreatography procedure to appropriately reduce the frequency and severity of post-procedural pancreatitis. Exemplary pharmacological agents include one or more agents that inhibit pancreatic digestive enzymes. Suitable pharmacological agents for administration may include enzyme inhibitors, including gabexate mesilate, nafamostat mesilate, urinastatin, camostat mesilate, aprotinin, pefabloc, trasylol, and urinary trypsin inhibitors, or somatostatin. Additional suitable pharmacological agents may include one or more agents that suppress the immune system, such as corticosteroids, tacrolimus, or sirolimus.

[0014] In a further aspect, a method and system for placing a catheter in the common hepatic duct for biliary hydrodynamic infusion is provided, comprising the steps of: (a) advancing an endoscope / echo-endoscope into the small intestine or stomach; (b) inserting a needle through the small intestine or stomach wall into the bile duct or gallbladder; (c) optionally injecting fluid into the bile duct or gallbladder to appropriately increase its diameter to allow easier entry of a guidewire and / or catheter; (d) passing a guidewire through the needle and into the bile duct or gallbladder; and (e) advancing a catheter over the wire into the common hepatic duct and administering nucleic acid and / or protein via the catheter.

[0015] Preferably, such methods and systems use ultrasound guidance to locate the common bile duct, common hepatic duct, right hepatic duct, left hepatic duct, small intrahepatic ducts, or gallbladder. Contrast agents may also be suitably injected to opacify the biliary tree. Exemplary contrast agents include carbon dioxide or an isotonic non-ionic contrast agent.

[0016] Preferably, in such methods and systems, the catheter is localized in the right or left common hepatic duct for nucleic acid and / or protein injection. Preferably, in such methods, the first bile duct accessed is upstream of the common hepatic duct in the liver.

[0017] In certain embodiments of such methods and systems, an upstream branch of the common hepatic duct is first accessed, and the catheter is advanced antegrade relative to bile flow to mediate positioning in the common hepatic duct or to maintain it within a particular bile duct branch. In further embodiments, the catheter is configured so that the injection port opening exit, through which nucleic acid and / or protein solutions exit, is downstream (facing the intrahepatic biliary tree) of the occlusion balloon to mediate transfection into the target area. In yet additional embodiments, a second balloon is utilized to occlude the catheter insertion site in the biliary tree. Preferably, the second balloon is adjustable along the length of the catheter so that it can be positioned or inflated at the target location for needle entry into the biliary tree.

[0018] In certain embodiments, the upstream branch of the common hepatic duct is accessed first, and the infusion opening of the catheter is closer to the second proximal catheter balloon, so that fluid flows in the antegrade direction but is stopped by the first catheter balloon distal to the common hepatic duct, thereby restricting fluid to the intrahepatic ductal system.

[0019] In certain embodiments, a stent is positioned within the opening created by the needle to allow repeated endoscopic entry of the biliary system over time for further hydrodynamic injections.

[0020] In a further aspect, methods and systems are provided for placing a catheter in the common hepatic duct for biliary hydrodynamic injection, suitably comprising: (a) using ultrasound, computed tomography, or another imaging modality to place a percutaneous needle through the skin directly into the gallbladder or bile duct of the liver; (b) injecting a contrast agent into the gallbladder and / or bile duct to opacify the biliary tree; (c) advancing a wire through the needle from the initial entry point into the common hepatic duct; and (d) advancing a catheter over the wire into the common hepatic duct and administering nucleic acid and / or protein.

[0021] In one embodiment, the upstream branch of the common hepatic duct is first accessed via a percutaneous route, and the catheter is advanced antegrade relative to bile flow to mediate positioning in the common hepatic duct or maintain it within a specific bile duct branch. Preferably, a catheter is used that is configured so that the injection port opening outlet through which the nucleic acid and / or protein solution exits is downstream from the occlusion balloon (on the side facing the intrahepatic biliary tree) that mediates transfection to that specific region. In a preferred embodiment, a catheter is used that includes a second balloon to occlude the catheter insertion site in the biliary tree or gallbladder. In a further preferred embodiment, a catheter is used that includes a second balloon that is adjustable along the length of the catheter so that it can be inflated at the target location.

[0022] In certain embodiments of the methods and systems, including, for example, reducing the risk of pancreatitis in high-risk patients, the methods may have advantages over endoscopic retrograde cholangiopancreatography due to catheter placement in the common hepatic duct prior to gene infusion.

[0023] In a further embodiment, a method and system for biliary hydrodynamic injection into the liver is provided, wherein a guidewire used for catheter placement into the common hepatic duct is retained during the hydrodynamic injection for quality assurance of catheter placement and stability during injection.

[0024] In yet another embodiment, a method and system for biliary hydrodynamic injection into the liver is provided, in which a guidewire is selectively advanced into the right or left common hepatic duct and held during the hydrodynamic injection for quality assurance of catheter placement and stability during the injection.

[0025] In certain preferred embodiments of the present methods and systems, the nucleic acid and / or protein solution is administered to the subject's liver through the subject's biliary tree.

[0026] In a further preferred embodiment of the method and system, the cells of the subject are transfected with the administered nucleic acid or protein.

[0027] In yet another preferred embodiment of the method and system, the method may further comprise selecting the amount of nucleic acid or protein to be administered to the subject based on the subject's liver weight.

[0028] In a further preferred embodiment of the method and system, the nucleic acid comprises DNA administered in an amount of at least 1 mg of DNA per kilogram of total liver tissue weight of the subject.

[0029] In a further preferred embodiment of the method and system, the nucleic acid comprises RNA administered in an amount of at least 1 mg of RNA per kilogram of total liver tissue weight of the subject.

[0030] In a further preferred embodiment of the method and system, the nucleic acid is administered as a fluid composition in a total volume of 30 mL or more per kilogram of total liver tissue weight of the subject.

[0031] In a further preferred embodiment of the method and system, the nucleic acid is administered as a fluid composition in a total volume of 100 mL or more per kilogram of total liver tissue weight of the subject.

[0032] In a further preferred embodiment of the method and system, the hydrodynamic injection results in loss of the injected volume through leakage into the vascular system, so that the biliary system is not blocked and is not limited by the injected volume.

[0033] In a further preferred embodiment of the method and system, the volume of nucleic acid or protein solution injected is correlated with the subject's liver weight.

[0034] In certain embodiments, methods and systems are provided for determining the liver weight of an individual patient for purposes of nucleic acid, protein, and / or volumetric administration, comprising calculating the liver weight of a subject, or calculating the liver weight of a subject from a computed tomography scan or magnetic resonance image, followed by performing a biliary hydrodynamic procedure.

[0035] In a further preferred embodiment of the method and system, the flow rate is independent of the weight of the liver of the subject.

[0036] In yet another preferred embodiment of the method and system, the nucleic acid is administered as a fluid composition at an injection rate of 2 mL / sec or greater and does not result in bile duct rupture.

[0037] In a further preferred embodiment of the method and system, the nucleic acid is administered as a fluid composition at an injection rate of 5 mL / sec or greater and does not result in bile duct rupture.

[0038] In a further preferred embodiment of the method and system, the nucleic acid is administered as a fluid composition at an injection rate of 10 mL / sec or greater and does not result in bile duct rupture.

[0039] In a further preferred embodiment of the method and system, the non-nucleic acid solution is administered at a flow rate of 1 mL / sec or less and in a volume of greater than 20 mL prior to nucleic acid injection to remove biliary substances from the system.

[0040] In another preferred embodiment of the method and system, the first non-nucleic acid composition is administered before the nucleic acid or protein.Preferably, the first non-nucleic acid composition is administered in an amount approximately equal to the subject's natural bile volume.Also preferred is when the non-nucleic acid solution includes normal saline, 5% dextrose in water, lactated Ringer's solution, and phosphate buffer.

[0041] In further preferred embodiments of the methods and systems, the subject's liver enzymes, for example, the subject's aspartate aminotransferase, alanine aminotransferase, lactate dehydrogenase, gamma-glutamyltransferase, and alkaline phosphatase, are monitored during and / or after administration.

[0042] In a further preferred embodiment of the method and system, the flow rate is adjusted according to the degree of liver damage designated for the infusion.

[0043] In yet another preferred embodiment of the method and system, the flow rate of the nucleic acid solution is greater than 5 mL / sec to achieve an ALT or AST level in the subject's serum or plasma of at least 100 U / L within 5 minutes to 5 days after administration of the nucleic acid solution.

[0044] In a further preferred embodiment of the method and system, the flow rate of the nucleic acid solution or protein solution is greater than 5 mL / sec to achieve an ALT or AST level in the subject's serum or plasma of at least 200 U / L within 5 minutes to 5 days after administration of the nucleic acid solution.

[0045] In a further preferred embodiment of the method and system, the flow rate of the nucleic acid or protein solution is 5 mL / sec or less to avoid inducing liver enzyme elevations upon infusion.

[0046] In further preferred embodiments of the methods and systems, one or more immunosuppressants or anti-inflammatory agents (e.g., cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone and / or prednisone) are administered to the subject before, during or after biliary hydrodynamic infusion to appropriately reduce inflammation from an immune response to the infusion or transgene.

[0047] In a further aspect, a method is provided for targeting transfection of specific hepatocytes within liver tissue by varying the flow rate of bile duct hydrodynamic injection.

[0048] In certain preferred embodiments of such methods and systems, higher flow rates of 4 mL / sec or greater are used to preferentially target hepatocytes near the lobular border (zone 1), the portal triad, and the major vessels. In further embodiments, lower flow rates of 4 mL / sec or less preferably target hepatocytes around the central vein of the lobule (zone 3) and throughout the lobule. In further embodiments, at least two different flow rates, above and below 4 mL / sec, are preferably used during biliary hydrodynamic injection to maximize gene delivery to an increased proportion of hepatocytes within the hepatic lobule and liver.

[0049] In further preferred embodiments of the present methods and systems, including gene delivery to cholangiocytes, the nucleic acid and / or protein solution may be injected at high pressure through the biliary system, preferably thereby allowing the nucleic acid and / or protein to enter directly into cholangiocytes adjacent to the bile duct.

[0050] In further preferred embodiments of the present methods and systems, including gene delivery to endothelial cells of the liver, the nucleic acid and / or protein solution is injected at high pressure through the biliary system, preferably thereby creating high pressure in the portal triad and causing the fluid solution to escape from the bile ducts into the endothelial cells.

[0051] In a further preferred embodiment of the present methods and systems, involving gene delivery to liver fibroblasts, the nucleic acid and / or protein solution is injected at high pressure through the biliary system, preferably thereby creating high pressure in the portal triad and causing the fluid solution to escape from the bile duct to the fibroblasts.

[0052] In further preferred embodiments of the present methods and systems, including gene delivery to neurons in the liver, the nucleic acid and / or protein solution is injected at high pressure through the biliary system, preferably thereby creating high pressure in the portal triad and causing the fluid solution to escape from the bile duct to the neurons.

[0053] In a further preferred embodiment of the present methods and systems, involving gene delivery to smooth muscle cells of the liver, the nucleic acid and / or protein solution is injected at high pressure through the biliary system, preferably thereby creating high pressure in the portal triad and causing the fluid solution to escape from the bile ducts into the smooth muscle cells.

[0054] In further preferred embodiments of the present methods and systems, including gene delivery to hepatocytes, the nucleic acid and / or protein solution is injected at high pressure through the biliary system, preferably thereby allowing the nucleic acid and / or protein to enter directly into hepatocytes adjacent to the canaliculi and bile ducts.

[0055] In a further preferred embodiment of the present method and system, which involves targeting expression to specific cell types within the liver during bile duct hydrodynamic injection, DNA molecules containing cell-type-specific promoters can be injected to target expression to specific cell types. Preferably, cholangiocytes are targeted for expression using the cytokeratin-19 and cytokeratin-18 promoters. In another embodiment, hepatocytes are targeted for expression using the alpha-1 antitrypsin promoter, thyroxine-binding globulin promoter, albumin promoter, HBV core promoter, or hemopexin promoter. In a further embodiment, endothelial cells are targeted for expression using the intercellular adhesion molecule-2 (ICAM-2) promoter, fms-like tyrosine kinase-1 (Flt-1) promoter, vascular endothelial cadherin promoter, or von Willebrand factor (vWF) promoter. In yet another embodiment, fibroblasts are targeted for expression using the COL1A1 promoter, COL1A2 promoter, FGF10 promoter, Fsp1 promoter, GFAP promoter, NG2 promoter, or PDGFR promoter. In yet another embodiment, hepatic smooth muscle cells are targeted for expression using the muscle creatine kinase promoter. In yet another embodiment, hepatic neurons are targeted for expression using the synapsin I promoter, calcium / calmodulin-dependent protein kinase II promoter, tubulin αI promoter, neuron-specific enolase promoter, and platelet-derived growth factor β chain promoter.

[0056] In another embodiment, a method for targeting expression to multiple cell types in the liver during bile duct hydrodynamic injection is provided, comprising injecting a DNA molecule that promotes activity in two or more of hepatocytes, cholangiocytes, endothelial cells, or fibroblasts. In such a method, the promoters used to target two or more cell types in the liver preferably include the cytomegalovirus promoter, the EF1α promoter, the SV40 promoter, the ubiquitin B, the GAPDH promoter, the β-actin promoter, or the PGK-1 promoter.

[0057] In a further aspect, a method for nucleic acid and / or protein delivery to cells of the pancreas is provided, comprising: (a) placing a catheter through the major duodenal papilla into the main pancreatic duct distal to where the pancreatic duct joins with the common bile duct; (b) removing fluid present in the pancreatic duct and removing digestive enzymes from the lumen of the pancreatic duct; (c) injecting a contrast agent into the pancreatic duct to confirm correct placement; (d) inflating a balloon within the catheter near the entrance to the pancreatic duct beyond the common bile duct to prevent backflow of fluid; and (e) injecting a composition comprising DNA, RNA, oligonucleotide, or protein.

[0058] In a further aspect, a method for nucleic acid and / or protein delivery to cells of the pancreas is provided, comprising the steps of: (a) placing a catheter into the accessory or dorsal pancreatic duct through the minor duodenal papilla and optionally advancing it further into the main pancreatic duct; (b) removing fluid present in the pancreatic duct and removing digestive enzymes from the lumen of the pancreatic duct; (c) injecting a contrast agent into the pancreatic duct to confirm correct placement; (d) inflating a balloon within the catheter at the junction of the dorsal and ventral pancreatic ducts to prevent backflow of fluid; and (e) injecting a composition comprising DNA, RNA, oligonucleotide, or protein.

[0059] Such methods may utilize endoscopic retrograde cholangiopancreatography (ERCP) mediated placement of a catheter into the pancreatic duct. Preferably, fluid present within the pancreatic duct is removed by aspiration.

[0060] In such a method, the catheter used for injection preferably has at least three ports: one for balloon air, one for pressure catheter insertion, and one for DNA injection. Preferred catheters may further include a guidewire and an injection port, so that the pressure catheter can be inserted through either port depending on its size, and the DNA solution can be inserted through either port depending on its size. Preferably, a guidewire is selectively advanced into the pancreatic duct and held during hydrodynamic injection to ensure the catheter's target depth and maintain its stability during injection.

[0061] In such methods, the injection parameters for pancreatic injection preferably correspond to the weight of the pancreas. Preferably, the volume of the nucleic acid or protein composition injected into the pancreas is a minimum of 10 mL, more preferably 20 mL, or can exceed 30 or 40 mL in volume so that the volume escapes from the pancreatic duct into the parenchyma. Preferably, the flow rate of the fluid administered for treatment is greater than 1 mL / sec, more preferably greater than 2 mL / sec, and in other embodiments, greater than 3 mL / sec or 4 mL / sec. Preferably, the injection procedure is monitored by intraductal pressure to ensure pancreatic function. Preferably, the optimal ductal pressure for pancreatic gene delivery is greater than 50 mmHg, greater than 75 mmHg, greater than 100 mmHg, greater than 150 mmHg, or greater than 200 mmHg.

[0062] In such methods, the DNA composition is preferably primed into the circuit tubing between the power injector and the distal end of the catheter tip. Preferably, the DNA composition is injected using a double-barrel power injector so that no DNA composition remains as a result of non-DNA components displacing the DNA solution through the circuit.

[0063] In such methods, preferably amylase and lipase levels are trended to the extent of pancreatic injury.

[0064] In such methods, preferably the catheter is advanced further into the pancreatic duct to deliver the gene specifically to the distal portion of the pancreas.

[0065] In such methods, preferably the solution corresponds to normal saline, phosphate buffer, or dextrose 5% in water.

[0066] In this method, preferably, additional pharmacological agents are added to the nucleic acid and / or protein solution for delivery to pancreatic cells.For example, the pharmacological agent can function to prevent or ameliorate the onset of pancreatitis after injection.Suitable pharmacological agents suppress the immune system and can include, for example, cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone, and / or prednisone.

[0067] Pharmacological agents may also inhibit pancreatic digestive enzymes. Suitable pharmacological agents may include enzyme inhibitors including gagabexate mesylate, nafamostat mesylate, urinastatin, camostat mesylate, aprotinin, pefabloc, trasylol, and urinary trypsin inhibitor, or somatostatin.

[0068] In such methods, preferably, a solution containing a pharmacological agent that inhibits pancreatitis is administered at a flow rate (<1 mL / sec) after hydrodynamic injection is completed and before repeat fluoroscopy.

[0069] In such methods, preferably, the targeted pancreatic tissue is a tumor, and the catheter is suitably positioned in close proximity to the site of the tumor, e.g., such that the administered nucleic acid or protein can contact the tumor, or such that the catheter tip contacts the tumor or is within 0.1, 0.2, 0.3, 0.4, or 0.5 of the tumor at the time of administering the nucleic acid or protein.

[0070] In such methods, the nucleic acid may suitably be circular DNA, such as plasmid DNA or minicircle DNA, or linear DNA, such as closed-end DNA.

[0071] In such methods, the macromolecule may suitably be one or more of an mRNA, a small interfering RNA, an antisense RNA, a ribozyme, or a protein.

[0072] In certain embodiments of such methods, the pancreas has a condition to be treated, including cancer, cystic fibrosis, type 1 diabetes, type 2 diabetes, autoimmune pancreatitis, and rare monogenic pancreatic disorders.

[0073] In certain embodiments of such methods involving gene delivery to pancreatic ductal epithelial cells, the nucleic acid and / or solution may be at high pressure through the pancreatic ductal system, preferably thereby allowing the nucleic acid and / or protein to enter directly into the pancreatic ductal epithelial cells adjacent to the pancreatic duct.

[0074] In such methods, in certain embodiments involving gene delivery to acinar cells of the pancreas, the nucleic acid and / or protein solution may be injected at high pressure through the pancreatic duct system, preferably thereby allowing the fluid solution to escape the duct system into the acinar cells.

[0075] In such methods, in certain embodiments involving gene delivery to pancreatic islet cells, the nucleic acid and / or protein solution may be injected at high pressure through the pancreatic duct system, preferably thereby allowing the fluid solution to escape from the duct system into the islet cells.

[0076] In such methods, in certain embodiments involving gene delivery to pancreatic endothelial cells, the nucleic acid and / or protein solution may be injected at high pressure through the pancreatic ductal system, preferably thereby allowing the fluid solution to escape from the ductal system into the endothelial cells.

[0077] In such methods, in certain embodiments involving gene delivery to neurons of the pancreas, the nucleic acid and / or protein solution may be injected at high pressure through the pancreatic duct system, preferably thereby allowing the fluid solution to escape from the pancreatic duct system to the neurons.

[0078] In certain embodiments, DNA molecules containing cell-type-specific promoters can be injected during pancreatic duct hydrodynamic injection, preferably to target expression to specific cell types within the pancreas. In one embodiment, pancreatic acinar cells are preferably targeted for expression using the chymotrypsin-like elastase-1 promoter, Ptf1a promoter, or Amy2a promoter. In another embodiment, pancreatic duct epithelial cells are preferably targeted for expression using the Sox9 promoter, Hnf1b promoter, Krt19 promoter, and Muc1 promoter. In another embodiment, pancreatic islet cells are preferably targeted for expression using the insulin promoter, glucagon promoter, somatostatin promoter, ghrelin promoter, or neurogenin-3 promoter. In another embodiment, pancreatic endothelial cells are targeted for expression using the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter. In another embodiment, pancreatic neurons are targeted for expression using the synapsin I promoter, the calcium / calmodulin-dependent protein kinase II promoter, the tubulin αI promoter, the neuron-specific enolase promoter, and the platelet-derived growth factor β chain promoter.

[0079] In another aspect, there is provided a method for targeting the expression of multiple cell types in pancreas during pancreatic duct hydrodynamic injection, comprising injecting the DNA molecule that promotes the activity in two or more of pancreatic acinar cells, pancreatic duct epithelial cells or pancreatic islet cells.In one embodiment of this method, the promoter that is used to target two or more cell types in pancreas comprises cytomegalovirus promoter, EF1α promoter, SV40 promoter, ubiquitin B promoter, GAPDH promoter, β-actin promoter or PGK-1 promoter.

[0080] In a further aspect, a method for nucleic acid and / or protein delivery to different cell types in the kidney is provided, comprising the steps of: (a) obtaining a cystoscope and advancing it through the urethra into the bladder; (b) advancing a catheter through the cystoscope into the right or left ureter; (c) advancing the catheter to the distal end of the ureter and its entrance into the renal pelvis, preferably using contrast injection and fluoroscopy to confirm the position of the catheter; (d) aspirating fluid through the catheter to drain urine from the renal pelvis to reduce potential toxicity; (e) opening the balloon to seal the ureter, preferably preventing antegrade flow of solution during hydrodynamic injection; (f) injecting contrast and imaging with fluoroscopy to confirm balloon seal, optionally followed by removal of the contrast; (g) priming the catheter circuit from the power injector to the distal tip with a DNA solution; and (h) injecting a fluid containing nucleic acid and / or protein.

[0081] In preferred embodiments, such methods may further include one or more of the following: (i) in certain embodiments, using a guidewire to facilitate cannulation of the ureteral orifice, followed by insertion of a catheter; (ii) injecting a fluid containing nucleic acid and / or protein at high velocity and pressure using a power injector and monitoring the injection using a pressure catheter for quality assurance of reached injection targets; (iii) in certain embodiments, expelling the macromolecule-containing fluid, if necessary, with a non-macromolecule-containing solution, such as normal saline, to ensure complete delivery of the solution to the kidney; (iv) deflating the balloon after cessation of the injection; (v) optionally repeating the contrast injection and fluoroscopy; (vi) removing the catheter and guidewire from the ureter and repeating the procedure again on the uninjected kidney; (vii) removing the catheter from the ureter, bladder, and urethra outside the patient together with a bladder cystoscope; and / or (viii) optionally monitoring creatinine, blood urea nitrogen, and glomerular filtration rate after injection to monitor for damage from the hydrodynamic injection.

[0082] In certain preferred embodiments of such methods, the injection parameters include a flow rate that is at least 1 mL / sec, or at least 2 mL / sec, or at least 3 mL / sec. Suitably, the injection parameters include a total volume injected of up to 10 mL, 20 mL, 30, or 50 mL, such that volume escapes from the renal pelvis into the parenchyma.

[0083] In certain preferred embodiments of such methods, the pressure reached during renal infusion is at least 50 mmHg, or reaches at least 75 mmHg, or reaches at least 100 mmHg.

[0084] In a preferred embodiment of such a method, one or more additional therapeutic agents are preferably included in the infusion solution, for example, to reduce inflammation and / or potential infection from the infusion procedure. The one or more additional therapeutic agents may preferably include one or more small molecules. The one or more additional therapeutic agents may preferably include one or more of antibiotics and anti-inflammatory drugs, including cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone, and / or prednisone.

[0085] In certain preferred embodiments of such methods, the cell types include collecting duct cells, proximal tubule cells, distal tubule cells, interstitial cells, podocytes, glomerular cells, renal epithelial cells, and endothelial cells.

[0086] In certain preferred embodiments of such methods, a DNA molecule containing a cell-type specific promoter to target expression to a particular cell type is injected.

[0087] In certain preferred embodiments of such methods, proximal tubule epithelial cells are targeted for expression using the gamma-glutaryl transpeptidase promoter, the Sglt2 promoter, or the NPT2a promoter. Preferably, endothelial cells are targeted for expression using the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter. Preferably, podocytes are targeted for expression using the podocin promoter. Preferably, the NKCC2 promoter targets cells of the thick ascending limb of Henle, the AQP2 promoter targets cells of the collecting duct, and the kidney-specific cadherin promoter targets renal epithelial cells.

[0088] In a further aspect, a method is provided for targeting expression to multiple cell types within the kidney during renal pelvic hydrodynamic infusion, comprising injecting a DNA molecule that promotes activity in two or more of collecting duct cells, proximal tubule cells, distal tubule cells, interstitial cells, podocytes, and glomerular cells.

[0089] In such methods, preferred promoters used to target two or more cell types in the kidney include the cytomegalovirus promoter, the EF1α promoter, the SV40 promoter, the ubiquitin B promoter, the GAPDH promoter, the β-actin promoter, or the PGK-1 promoter.

[0090] In such methods, the nucleic acid preferably comprises circular DNA, linear DNA, plasmid DNA, minicircle DNA, mRNA, siRNA, antisense RNA, ribozyme, or protein.

[0091] In a further aspect, a method for treating a subject is provided, comprising administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the biliary tree, liver, kidney, or pancreas of the subject using a catheter, wherein the catheter is configured to administer the nucleic acid and / or protein in a forward direction only, and not obliquely or perpendicularly.

[0092] In such methods, the catheter is preferably configured to administer the nucleic acid or protein only in a forward direction, rather than obliquely or perpendicularly to the bile duct wall, pancreatic duct wall, or ureter wall of the subject.

[0093] In a further aspect, a method for treating a subject is provided, comprising administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the biliary tree, liver, kidney or pancreas of the subject using a catheter, wherein the catheter tip is at least 1 cm forward along the length of the catheter from the catheter balloon midpoint.

[0094] In such a method, the catheter tip is preferably at least 4 cm along the length of the catheter from the midpoint of the catheter balloon. Preferably, the catheter comprises at least two ports and associated lumens. Preferably, a first catheter port is used for delivery of a radiocontrast agent, and a second catheter port is used for delivery of nucleic acids and / or proteins.

[0095] Preferably, the same catheter port is used to deliver both the radiocontrast agent and the subsequent nucleic acid and / or protein. Preferably, the catheter includes a port for guidewire placement. Preferably, the port for guidewire placement is used to administer the nucleic acid after the guidewire is removed. Preferably, the multiple catheter ports have different diameters. Preferably, the port used to administer the nucleic acid and / or protein solution has the largest cross-section of the multiple catheter ports.

[0096] In certain preferred embodiments of the present methods and systems, the contrast agent composition is administered at a slower flow rate than the nucleic acid agent and / or solution is administered.

[0097] In further preferred embodiments of the methods and systems, the administered nucleic acid suitably comprises one or more of DNA, mRNA, siRNA, miRNA, lncRNA, tRNA, circular RNA, or antisense oligonucleotides.

[0098] In certain preferred embodiments of the present methods and systems, the administered nucleic acid is an expression cassette that encodes a protein and comprises circular DNA, linear DNA, single-stranded DNA, double-stranded DNA, linear mRNA, or circular mRNA.

[0099] In a preferred embodiment of the present method and system, one or more DNA or RNA molecules may be combined in the same nucleic acid solution and injected simultaneously.

[0100] In further particularly preferred embodiments of the present methods and systems, increasing the amount of DNA or RNA injected results in a higher transfection percentage into liver, pancreas, or kidney cells.

[0101] In certain preferred embodiments of the present methods and systems, proteins are administered, including site-specific nuclease enzymes, including but not limited to transcription factors, antibody fragments, RNA-guided nucleases, meganucleases, homing nucleases, TALE nucleases, or zinc finger nucleases, or other endogenous intracellular human proteins.

[0102] In certain preferred embodiments of the present methods and systems, the protein is administered in an amount of at least 100 micrograms of protein per kilogram of total liver weight of the subject.

[0103] In certain preferred embodiments of the present methods and systems, the nucleic acids and / or proteins are configured in certain fluid solutions.

[0104] In certain preferred embodiments of the present methods and systems, the administered fluid solution has a viscosity within ±10% of saline so as to avoid stress on the walls of the common hepatic duct, pancreatic duct, or ureter.

[0105] In certain preferred embodiments of the present methods and systems, the administered fluid solution is hypertonic relative to serum or bile to facilitate gene delivery.

[0106] In certain preferred embodiments of the present methods and systems, the administered nucleic acid and / or protein solution is endotoxin-free to avoid immune activation and transgene removal.

[0107] In certain preferred embodiments of the present methods and systems, the administered fluid solutions comprising nucleic acids and / or proteins are normal saline, 5% dextrose in water, lactated Ringer's solution, and phosphate buffered saline.

[0108] In certain preferred embodiments of the present methods and systems, the administered nucleic acid and / or protein solution also or alternatively contains a radiological contrast agent for monitoring the distribution of the nucleic acid solution. Preferably, the administered solution is monitored in real time using fluoroscopic imaging. Preferably, the administered solution is monitored in real time by fluoroscopy for the presence of the contrast agent in the targeted liver lobes, pancreatic tissue, and kidney tissue. Preferably, the nucleic acid solution contains 1-33% radiological contrast agent solution, based on the total weight of the nucleic acid solution, to reduce viscosity.

[0109] In certain preferred embodiments of the present methods and systems, the injected composition is monitored using a pressure catheter inserted through one of the catheter ports. Preferably, the pressure catheter is inserted into one of two ports or channels, one of which is used for both radiocontrast agent injection and hydrodynamic nucleic acid and / or protein solution injection.

[0110] In certain preferred embodiments of the present methods and systems, the intrabiliary, intraductal, or intrapelvic pressure achieved during hydrodynamic injection depends on the flow rate used.

[0111] In certain other preferred embodiments of the present methods and systems, the intrabiliary, intraductal, or intrapelvic pressure achieved during hydrodynamic injection is substantially independent of the volume injected.

[0112] In certain preferred embodiments of the present methods and systems, the hydrodynamic injection results in a rapid increase in pressure and a plateau level that drops (preferably substantially immediately) upon cessation of the injection.

[0113] In further particularly preferred embodiments of the present methods and systems, a plateau level of pressure is achieved during successful administration of the nucleic acid.

[0114] In some embodiments, the pressure plateau is greater than or equal to about 80 mmHg. In other embodiments, the pressure plateau is greater than or equal to about 150 mmHg. In yet other embodiments, the pressure plateau is greater than or equal to about 200 mmHg.

[0115] In certain preferred embodiments of the present methods and systems, a failed injection is manifested by the disappearance of the plateau waveform during the injection. In certain embodiments, if the expected pressure curve is not achieved due to a balloon seal failure or other cause, the injection can be repeated again during the same procedure.

[0116] In certain preferred embodiments of the present methods and systems, the pressure curves generated by varying the flow rate of the administered nucleic acid and / or protein solution produce different peak pressure plateaus.

[0117] In a further preferred embodiment of the method and system, sealing of the catheter balloon during administration to effectively prevent or substantially inhibit unwanted backflow is confirmed using pressure tracing.

[0118] In certain preferred embodiments of the present methods and systems, the catheter balloon is deflated substantially immediately after completing hydrodynamic infusion of nucleic acid and / or protein from the catheter. Preferably, deflation of the balloon after infusion reduces fluid pressure within the biliary system, liver, kidney, or pancreas of the subject. Preferably, deflation of the balloon after infusion demonstrates a rapid pressure drop within the system, confirming an effective seal.

[0119] In further preferred embodiments of the present methods and systems, the administering step comprises multiple hydrodynamic injections of the nucleic acid and / or protein solution during a single endoscopic, ureteroscopy, or percutaneous procedure to increase gene transfection into liver, pancreatic, or kidney tissue. In such embodiments, the catheter is preferably repositioned between one or more of the multiple injections. In such embodiments, the multiple injections are preferably completed within the same endoscopic, ureteroscopy, or percutaneous procedure.

[0120] In certain preferred embodiments of the present methods and systems, a second endoscopic, ureteroscopy, or percutaneous procedure and injection of nucleic acid and / or protein is performed on the same patient on a different day through the bile duct, pancreatic duct, or ureter to increase or boost gene expression. In such embodiments, preferably, successive hydrodynamic injections may be performed on a subject at intervals of days to weeks, months, or years, without significant tissue damage being observed.

[0121] In certain further preferred embodiments of the present methods and systems, the subject's liver enzymes, pancreatic enzymes, or renal biochemical markers and / or vital signs are monitored prior to each infusion.

[0122] In certain further preferred embodiments of the present methods and systems, repeat cholangiograms, pancreatograms, or ureterograms are performed during the infusion.

[0123] In certain preferred embodiments of the present methods and systems, fluid power is delivered into the biliary system through a power injector that is filled with infusion solution and programmed for a specified flow rate and duration for each flow rate prior to injection. In such embodiments, the power injection preferably can inject fluid at a rate of 1-50 mL / sec at a pressure of 500-2000 psi in volumes up to 200 mL.

[0124] In certain further preferred embodiments of the present methods and systems, at least two flow rates are used during procedures that initially involve filling the biliary system, pancreatic system, or ureter-renal system with a DNA solution, thereby priming these biliary systems with DNA, followed by pressurization throughout the system at a high flow rate.

[0125] In certain preferred embodiments of the present methods and systems, the flow rate can be varied during infusion at different short periods of high flow rates and at intermediate lower flow rates for longer periods to minimize stress on the bile duct, pancreatic duct, or ureteral walls and catheter walls.

[0126] In a further preferred embodiment of the method and system, after balloon catheter placement is confirmed with radiocontrast, the tubing lines and biliary system are flushed to ensure removal of the contrast before the power injector is activated to avoid hepatotoxicity, pancreatic toxicity, or nephrotoxicity.

[0127] In certain further preferred embodiments of the present methods and systems, the power injector circuit is connected under sterile conditions to an endoscopic or ureteroscope catheter circuit.

[0128] In certain preferred embodiments of the present methods and systems, an initial solution free of nucleic acids and / or proteins is first infused at a slow flow rate into the biliary tree, pancreatic duct, or ureter to remove bile, pancreatic enzymes, or urine from the system prior to infusion of nucleic acids or proteins. In such embodiments, the non-nucleic acid and / or protein solution is preferably infused at a flow rate of 1 mL / sec or less into the liver in a volume greater than 20 mL, into the pancreas in a volume greater than 10 mL, or into the kidney in a volume greater than 10 mL.

[0129] In certain further preferred embodiments of the present methods and systems, the biliary system is primed with a nucleic acid and / or protein solution prior to hydrodynamic infusion at a volume equivalent to the natural bile volume, or pancreatic duct volume, or ureter-renal pelvic volume.

[0130] In a further preferred embodiment of the method and system, the tubing circuit from the power injector to the catheter port connection is primed with a nucleic acid and / or protein solution prior to hydrodynamic injection.

[0131] In further preferred embodiments of the present methods and systems, the power injector and / or circuit is filled with an additional non-nucleic acid solution that is less dense than the nucleic acid and / or protein solution in a volume equal to or greater than the dead space remaining in the circuit in order to force all of the nucleic acid or protein solution into the liver, pancreas, or kidney.

[0132] In a further preferred embodiment of the present method and system, a double-barrel power injector is optimally used to inject nucleic acid and / or protein solutions into the catheter. In such an embodiment, preferably, one barrel is filled with saline, lactated Ringer's solution, or 5% dextrose solution, and the second barrel is filled with nucleic acid and / or protein solutions. In such an embodiment, preferably, the nucleic acid and / or protein solutions are injected first, and then the second barrel is fired to expel the nucleic acid and / or protein solutions through the tubing and ensure that they enter the liver, pancreas, or kidneys completely. In such an embodiment, preferably, the non-nucleic acid solution chase occurs at a pressure equivalent to that of the nucleic acid and / or protein solutions to maintain equivalent flow rates. In such an embodiment, preferably, the non-nucleic acid solution is first fired through the circuit at a low flow rate to remove bile from the biliary system, followed by the nucleic acid and / or protein solutions, followed by the non-nucleic acid solution. In such embodiments, the non-nucleic acid solution chase is preferably at most equal in volume to the infused nucleic acid and / or protein solution and at least equal in volume to the volume of the tubing and catheter circuit outside the biliary, pancreatic, or ureteropelvic systems.

[0133] In further preferred embodiments of the methods and systems, the fluid pressure from the administration is sufficient to create fluid-filled vesicles and / or dilute the inner cytoplasm of the liver cells, pancreatic cells, or kidney cells.

[0134] In further preferred embodiments of the methods and systems, administration results in hydrodynamic forces and tissue changes, including fluid-filled vesicles and / or diluted cytoplasm in both the proximal and distal portions of individual liver lobes.

[0135] In yet another preferred embodiment of the present methods and systems, other tissues outside the target organs of the liver, pancreas, or kidney are not subjected to hydrodynamic forces and are not transfected with the nucleic acid and / or protein solution.

[0136] In a preferred embodiment, the composition comprising the nucleic acid expression cassette is administered into the biliary tree of a subject in a retrograde manner, which can easily increase the pressure of the administered composition. In one embodiment, the nucleic acid expression cassette is administered into or into the common bile duct of a subject. In one embodiment, the nucleic acid expression cassette is administered into or into the hepatic duct of a subject. In another embodiment, the nucleic acid expression cassette is administered into or into the pancreatic duct of a subject.

[0137] In further embodiments, the nucleic acid expression cassette may be administered under conditions based on one or more of: 1) the measured volume of the subject's biliary tree or other administration site volume / characteristics; and 2) the measured target organ characteristics.

[0138] In a further aspect, a method of treating or preventing liver or pancreatic disease by gene therapy is provided, comprising the steps of: delivering a vector comprising a nucleic acid sequence that ameliorates liver or pancreatic disease to a subject having or susceptible to liver or pancreatic disease; creating a unidirectional fluid flow; injecting the vector into a sealed duct or vascular space under the required pressure and volume so that the vector moves into the cytoplasm of liver or pancreatic cells; and expressing the nucleic acid sequence to treat or prevent liver or pancreatic disease (or a disease resulting from a defect / deficiency in liver, pancreatic or kidney cells) in the subject.

[0139] As referred to herein, the term "substantially closed space" refers to an in vivo space in which normal directional fluid flow is blocked, such that retrograde injection of this fluid flow can induce an increase in pressure upon delivery of a composition (e.g., a fluid composition) containing a nucleic acid expression cassette. In the methods of the present invention, the pressure is increased above the initial introduction or injection pressure of the fluid composition, for example, by at least about a 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 percent increase, or even higher, such as a 5, 8, 10, 15, 20, 25, 30, 40, 50, or 60-fold increase, relative to the pressure at which the fluid composition is initially introduced into the space, such as by injection. It is experimentally verified that the administered fluid (e.g., a fluid composition containing a nucleic acid expression cassette) leaks from the closed space during the administration protocol, for example, during or after injection of the fluid composition into the target site.

[0140] In certain preferred embodiments of the methods of the present invention, an apparatus capable of preventing bidirectional fluid flow can be utilized in conjunction with administration of the nucleic acid expression cassette. A balloon-containing device can be utilized that can facilitate establishing or maintaining unidirectional fluid flow during administration of the nucleic acid expression cassette.

[0141] In certain embodiments, endoscopic retrograde cholangiopancreatography (ERCP) including a balloon can be utilized in conjunction with administration of the nucleic acid expression cassette. The ERCP can also contain the nucleic acid expression cassette for administration. In use, an ERCP endoscope can be placed through a subject's mouth, stomach, duodenum, and pancreatic or hepatic duct, and the ERCP balloon can be opened, thereby creating a retrograde unidirectional fluid flow in vivo that can facilitate establishing and maintaining elevated pressure in the nucleic acid expression cassette during the course of the administration protocol.

[0142] Suitable nucleic acid sequences used in the present disclosure may encode a protein or peptide, or a second nucleic acid selected from the group consisting of shRNA, mRNA, and combinations thereof. The protein or peptide may be an antibody. In some embodiments, the nucleic acid sequence encodes a protein or functional portion thereof that treats liver cirrhosis, hemophilia, cystic fibrosis, or urea cycle enzyme alterations. In some embodiments, the nucleic acid sequence encodes a protein that treats a pancreatic disease or a functional portion thereof. Suitable vectors include, by way of example, viruses, plasmids, or both. An example of a virus used in the present disclosure is AAV. In some embodiments, the plasmid may contain an SB transposon containing the nucleic acid sequence. In some embodiments, the method of the present disclosure may include an additional step of removing the remaining vector through an endoscope.

[0143] In some embodiments, a vector is provided that includes any of the expression cassettes disclosed herein.

[0144] The methods and systems are particularly useful for treating or preventing liver-related diseases and disorders, including, for example, hemophilia A, hemophilia B, alpha-1 antitrypsin deficiency, familial hypercholesterolemia, progressive familial intrahepatic cholestasis, hereditary hemochromatosis, Wilson's disease, Crigler-Najjar syndrome, methylmalonic acidemia, phenylketonuria, and / or ornithine transcarbamylase deficiency.

[0145] In certain embodiments, the methods and systems are used to treat hemophilia, including hemophilia B, for example, by administering a nucleic acid that expresses factor IX.

[0146] The methods and systems are particularly useful for treating or preventing pancreas-related diseases and disorders, including, for example, type I DM, the monogenic disorders that cause pancreatitis: CFTR, CLDN2, CPA1, PRSS1, and SPINK1.

[0147] In one aspect, the present disclosure provides a method for introducing DNA into hepatocytes via hydrodynamic delivery, comprising the steps of: inserting a catheter into the common hepatic duct of the liver by endoscopic retrograde cholangiopancreatography (ERCP); inflating a balloon to seal the common hepatic duct; and injecting DNA in solution at a flow rate of at least about 2 mL / sec; wherein approximately 30% of the hepatocytes in the liver exhibit transgene expression from the transfected DNA.

[0148] In an embodiment, the DNA is plasmid DNA.

[0149] In embodiments, the DNA is a vector comprising a promoter, a 5'UTR, a protein-coding gene, a 3'UTR, and a polyadenylation sequence; optionally, the DNA comprises a transposon.

[0150] In an embodiment, the solution comprises at least 3 mg of plasmid DNA.

[0151] In an embodiment, the promoter is a liver-specific promoter.

[0152] In embodiments, the liver-specific promoter is selected from the group consisting of an LP1 promoter, an ApoE / A1AT promoter, an alpha-1 antitrypsin promoter, a thyroxine-binding globulin promoter, an albumin promoter, an HBV core promoter, a transthyretin promoter, and a hemopexin promoter.

[0153] In embodiments, the transposon comprises a piggyBac transposon or a hyperactive piggyBac transposon for enhanced integration.

[0154] In embodiments, the 5'UTR contains an intron to enhance gene expression.

[0155] In embodiments, the protein coding genes are codon optimized for the host organism to enhance protein expression.

[0156] In embodiments, the 3'UTR is selected to enhance mRNA transcript stability and protein expression.

[0157] In an embodiment, the 3'UTR is a human albumin 3'UTR.

[0158] In embodiments, transfected hepatocytes are observed in all hepatic lobules of the liver.

[0159] In an embodiment, each liver lobe has an equal percentage of transfected hepatocytes.

[0160] In embodiments, tissue sites proximal and distal to the common hepatic duct within a liver lobe have equivalent percentages of transfected hepatocytes.

[0161] In embodiments, the DNA is dissolved in a solution comprising saline, 5% dextrose in water, lactated Ringer's solution, and phosphate buffer.

[0162] In embodiments, the transfected hepatocytes result in detectable protein expression from the gene upon immunostaining of liver tissue.

[0163] In embodiments, about 30%, about 35%, about 40%, or about 45% of the hepatocytes in the liver are transfected with the plasmid DNA.

[0164] In one aspect, the present disclosure provides a method for positioning a catheter in the common hepatic duct or gallbladder for biliary hydrodynamic injection, comprising the steps of: advancing an endoscope / ultrasound endoscope into the small intestine or stomach; inserting a needle through the small intestine or stomach wall into the bile duct or gallbladder; optionally injecting fluid into the bile duct or gallbladder to increase its diameter; passing a guidewire through the needle into the bile duct or gallbladder; advancing a catheter over the guidewire into the common hepatic duct and administering nucleic acid and / or protein via the catheter.

[0165] In an embodiment, ultrasound guidance is used to visualize a location selected from the group consisting of the common bile duct, the common hepatic duct, the right hepatic duct, the left hepatic duct, small intrahepatic ducts, and the gallbladder.

[0166] In an embodiment, the method further comprises injecting a contrast agent to opacify the biliary tree.

[0167] In embodiments, the contrast agent is carbon dioxide or an isotonic non-ionic contrast agent.

[0168] In an embodiment, the catheter is localized in the right or left common hepatic duct.

[0169] In an embodiment, the first accessed bile duct is upstream of the common hepatic duct in the liver.

[0170] In an embodiment, an upstream branch of the common hepatic duct is first accessed and the catheter is advanced antegrade relative to bile flow to mediate positioning in the common hepatic duct or to maintain it within a particular bile duct branch.

[0171] In embodiments, the catheter is configured so that the open outlet of the injection port through which the nucleic acid and / or protein solution exits is downstream of the occlusion balloon.

[0172] In an embodiment, a second balloon is utilized to occlude the catheter insertion site in the biliary tree.

[0173] In embodiments, the second balloon is adjustable along the length of the catheter so that it can be positioned or inflated at the target location of needle entry into the biliary tree.

[0174] In embodiments, the second balloon is adjustable along the length of the catheter so that the second balloon can be inflated and positioned at the target location for needle entry into the biliary tree.

[0175] In embodiments, the second balloon is adjustable along the length of the catheter so that it can be inflated and positioned at the target location.

[0176] In an embodiment, an upstream branch of the common hepatic duct is first accessed by a catheter having an infusion opening closer to the second proximal catheter balloon, so that fluid flows in the antegrade direction toward the common hepatic duct and is prevented from flowing in the retrograde direction by the distal first catheter balloon, thereby restricting fluid flow into the intrahepatic ductal system.

[0177] In embodiments, a stent is positioned within the opening created by the needle, allowing repeated endoscopic access to the biliary system over time for additional hydrodynamic injections.

[0178] In embodiments, the method further includes: using ultrasound, computed tomography, or another imaging modality for percutaneous needle placement directly through the skin into the bile duct of the liver or gallbladder; injecting a contrast agent into the bile duct of the liver or gallbladder to opacify the biliary tree; advancing a guidewire through the needle from the initial point of entry into the common hepatic duct; advancing a catheter over the ear into the common hepatic duct and administering nucleic acid and / or protein;

[0179] In embodiments, an upstream branch of the common hepatic duct is first accessed via a percutaneous route, and then the catheter is advanced antegrade relative to bile flow to mediate positioning of the catheter in the common hepatic duct or to maintain the catheter within a particular bile duct branch.

[0180] In embodiments, the catheter is configured such that the open outlet of the injection port through which the nucleic acid and / or protein solution exits is positioned downstream from an occlusion balloon positioned facing the intrahepatic biliary tree to mediate transfection to a specific biliary region.

[0181] In embodiments, the catheter includes a second balloon to occlude the catheter insertion site in the biliary tree or gallbladder.

[0182] In embodiments, the catheter includes a second balloon that is adjustable along the length of the catheter so that it can be inflated at a target location.

[0183] In embodiments, a guidewire is held in place during hydrodynamic injection, and optionally, the guidewire is advanced into either the right or left common hepatic duct.

[0184] In embodiments, one or more pharmacological agents are injected into the pancreatic duct before or after an endoscopic retrograde cholangiopancreatography (ERCP) procedure to reduce the frequency and severity of post-procedural pancreatitis.

[0185] In embodiments, the one or more pharmacological agents include one or more agents that inhibit pancreatic digestive enzymes.

[0186] In embodiments, the one or more pharmacological agents are selected from the group consisting of gabexate mesylate, nafamostat mesylate, urinastatin, camostat mesylate, aprotinin, pefabloc, trasylol, and an enzyme inhibitor that is a urinary trypsin inhibitor, or optionally somatostatin.

[0187] In embodiments, the one or more pharmacological agents include one or more agents that suppress the immune system, including a corticosteroid, tacrolimus, or sirolimus.

[0188] In embodiments, the subject's cells are transfected with the administered nucleic acid or protein.

[0189] In embodiments, the method further comprises selecting the amount of nucleic acid or protein to be administered to the subject based on the subject's liver weight.

[0190] In embodiments, the nucleic acid comprises DNA administered in an amount of at least 1 mg of DNA per kilogram of total liver tissue weight in the subject.

[0191] In embodiments, the nucleic acid comprises RNA administered in an amount of at least 1 mg of RNA per kilogram of total liver tissue weight in the subject.

[0192] In embodiments, the nucleic acid is administered as a fluid composition in a total volume of 30 mL or more per kilogram of total liver tissue weight of the subject.

[0193] In embodiments, the nucleic acid is administered as a fluid composition in a total volume of 100 mL or more per kilogram of total liver tissue weight of the subject.

[0194] In embodiments, hydrodynamic injection results in loss of the injected volume through leakage into the vascular system, so that the biliary system is not obstructed and is not limited by the injected volume.

[0195] In embodiments, the volume injected correlates with the subject's liver weight.

[0196] In one aspect, the present disclosure provides a method for determining liver weight in an individual patient, comprising calculating the subject's body weight from a CT scan or magnetic resonance imaging, or calculating the subject's liver weight, determining an infusion flow rate, and performing biliary hydrodynamic treatment based on the flow rate.

[0197] In an embodiment, the flow rate is independent of the subject's liver mass.

[0198] In embodiments, it is administered as a fluid composition, with a flow rate of 2 mL / sec or greater, that does not result in bile duct rupture.

[0199] In embodiments, it is administered as a fluid composition, with a flow rate of 5 mL / sec or greater, that does not result in bile duct rupture.

[0200] In embodiments, it is administered as a fluid composition, with a flow rate of 10 mL / sec or greater, that does not result in bile duct rupture.

[0201] In embodiments, the non-nucleic acid solution is administered in a volume greater than 20 mL at a flow rate of 1 mL / sec or less prior to nucleic acid injection to remove biliary materials from the system.

[0202] In embodiments, the first non-nucleic acid composition is administered before the nucleic acid or protein.

[0203] In embodiments, the first non-nucleic acid composition is administered in an amount approximately equal to the subject's natural bile volume.

[0204] In embodiments, the non-nucleic acid solutions include saline, 5% dextrose in water, lactated Ringer's solution, and phosphate buffer.

[0205] In embodiments, the subject's liver enzymes, including aspartate aminotransferase, alanine aminotransferase, lactate dehydrogenase, gamma-glutamyltransferase, and alkaline phosphatase, are monitored during and / or after administration.

[0206] In an embodiment, the flow rate is adjusted according to the degree of liver damage designated for the infusion.

[0207] In embodiments, the flow rate is greater than 5 mL / sec such that the subject's serum or plasma ALT or AST levels are at least 100 U / L within 5 minutes to 5 days after administration of the nucleic acid solution.

[0208] In embodiments, the flow rate is greater than 5 mL / sec such that the subject's serum or plasma ALT or AST levels are at least 200 U / L within 5 minutes to 5 days after administration of the nucleic acid solution.

[0209] In embodiments, the flow rate of the administered nucleic acid solution is 5 mL / sec or less to avoid inducing liver enzyme elevations upon infusion.

[0210] In embodiments, one or more immunosuppressants or anti-inflammatory agents, including cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone, and / or prednisone, are administered to the subject before, during, or after biliary hydrodynamic infusion to reduce inflammation due to the infusion or immune response to the transgene.

[0211] In one aspect, the present disclosure provides a method for targeting transfection of specific hepatocytes within liver tissue by varying the flow rate of bile duct hydrodynamic injection.

[0212] In embodiments, higher flow rates of 4 mL / sec or greater preferentially target hepatocytes near the lobular borders (zone 1), the portal triad, and the great vessels.

[0213] In embodiments, lower flow rates of 4 mL / sec or less preferentially target hepatocytes around the central blood vessels of the lobule (zone 3) and throughout the lobule.

[0214] In embodiments, at least two different flow rates above and below 4 mL / sec are used during bile duct hydrodynamic injection to maximize gene delivery to an increased proportion of hepatocytes within the hepatic lobule and liver.

[0215] In embodiments, nucleic acids are transfected into cholangiocytes by injecting a nucleic acid and / or protein solution at high pressure through the biliary system, thereby allowing the nucleic acid and / or protein to enter directly into cholangiocytes adjacent to the bile duct.

[0216] In embodiments, nucleic acids are transfected into endothelial cells of the liver by injecting a nucleic acid and / or protein solution at high pressure through the biliary system to increase the pressure in the portal triad, thereby allowing the nucleic acid and / or protein to enter the endothelial cells.

[0217] In embodiments, nucleic acids are transfected into liver fibroblasts by injecting a nucleic acid and / or protein solution at high pressure through the biliary system to increase the pressure in the portal triad, thereby allowing the nucleic acid and / or protein to enter the fibroblasts.

[0218] In embodiments, nucleic acids are transfected into neurons in the liver by injecting a nucleic acid and / or protein solution at high pressure through the biliary system to increase pressure in the portal triad, thereby allowing the nucleic acid and / or protein to enter the neurons.

[0219] In embodiments, nucleic acids are transfected into smooth muscle cells of the liver by injecting a nucleic acid and / or protein solution at high pressure through the biliary system to increase pressure in the portal triad, thereby allowing the nucleic acid and / or protein to enter the smooth muscle cells.

[0220] In embodiments, nucleic acids are transfected into hepatocytes by injecting a nucleic acid and / or protein solution at high pressure through the biliary system, thereby allowing the nucleic acid and / or protein to enter directly into hepatocytes adjacent to the canaliculi and bile ducts.

[0221] In embodiments, the nucleic acid comprises a cell-type specific promoter to target expression of the transgene to a particular cell type.

[0222] In embodiments, the cytokeratin-19 promoter or the cytokeratin-18 promoter is used to target expression to bile duct cells.

[0223] In embodiments, hepatocytes are targeted for expression using the alpha-1 antitrypsin promoter, the thyroxine-binding globulin promoter, the albumin promoter, the HBV core promoter, or the hemopexin promoter.

[0224] In embodiments, endothelial cells are targeted for expression by the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter.

[0225] In embodiments, fibroblasts are targeted for expression using the COL1A1 promoter, COL1A2 promoter, FGF10 promoter, Fsp1 promoter, GFAP promoter, NG2 promoter, or PDGFR promoter.

[0226] In embodiments, smooth muscle cells of the liver are targeted for expression using the muscle creatine kinase promoter.

[0227] In embodiments, hepatic neurons are targeted for expression using the synapsin I promoter, calcium / calmodulin-dependent protein kinase II promoter, tubulin αI promoter, neuron-specific enolase promoter, and platelet-derived growth factor β chain promoter.

[0228] In embodiments, the nucleic acid comprises two or more promoters active in two or more of hepatocytes, cholangiocytes, endothelial cells, or fibroblasts.

[0229] In embodiments, the two or more promoters used to target two or more cell types in the liver include a cytomegalovirus promoter, an EF1α promoter, an SV40 promoter, a ubiquitin B promoter, a GAPDH promoter, a β-actin promoter, or a PGK-1 promoter.

[0230] In one aspect, the disclosure provides a method of hydrodynamic gene delivery to pancreatic cells, comprising: placing a catheter through the major duodenal papilla into the main pancreatic duct distal to where the pancreatic duct joins with the common bile duct, or from within the minor duodenal papilla into an accessory or dorsal pancreatic duct; optionally advancing the catheter further into the main pancreatic duct; optionally removing fluid present in the pancreatic duct and removing digestive enzymes from the lumen of the pancreatic duct; injecting a contrast agent into the pancreatic duct to confirm correct placement of the catheter; inflating a balloon within the catheter near the entrance to the pancreatic duct beyond the common bile duct to prevent backflow of fluid; and injecting a solution at a flow rate of at least 2 mL / sec and a volume of at least 20 mL containing at least 1 mg of DNA, wherein the flow rate, volume, and DNA dose are sufficient to mediate gene expression in all pancreatic lobes and multiple pancreatic cell types.

[0231] In embodiments, the solution corresponds to normal saline, phosphate buffered saline, or a 5% solution of dextrose in water.

[0232] In an embodiment, the flow rate and volume are determined based on the mass of the pancreas.

[0233] In embodiments, the DNA composition is primed into the circuit tubing between the power injector and the distal end of the catheter tip, or the DNA composition is injected with a double-barrel power injector such that the non-DNA composition drives the DNA composition through the circuit tubing without leaving any DNA composition behind.

[0234] In embodiments, amylase levels and / or lipase levels are monitored to assess the extent of pancreatic injury during infusion.

[0235] In embodiments, one or more pharmacological agents are added to the nucleic acid solution to prevent or ameliorate the development of pancreatitis after infusion.

[0236] In embodiments, the one or more pharmacological agents are selected from the group consisting of cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate, mofetil, dexamethasone, and prednisone, or the one or more pharmacological agents are selected from the group consisting of enzyme inhibitors including gabexate mesilate, nafamostat mesilate, urinastatin, camostat mesilate, aprotinin, pefabloc, trasylol, and urinary trypsin inhibitors, and optionally somatostatin, or the pharmacological agents inhibit pancreatic digestive enzymes, or the one or more pharmacological agents are administered at a flow rate (<1 mL / sec) after hydrodynamic injection is completed and before repeat fluoroscopy.

[0237] In embodiments, the volume injected into the pancreas can be a minimum of 20 mL or can exceed 30 or 40 mL in volume as the volume escapes from the pancreatic duct into the parenchyma.

[0238] In embodiments, the flow rate for treatment is greater than 2 mL / sec, and in other embodiments, greater than 3 mL / sec or 4 mL / sec.

[0239] In embodiments, the injection procedure is monitored by intraductal pressure to ensure pancreatic function.

[0240] In embodiments, the optimal ductal pressure for pancreatic gene delivery is greater than 50 mmHg, greater than 75 mmHg, greater than 100 mmHg, greater than 150 mmHg, or greater than 200 mmHg.

[0241] In embodiments, the targeted pancreatic tissue is a tumor and the catheter is positioned proximate to the site of the tumor.

[0242] In embodiments, the nucleic acid may be circular DNA, such as plasmid DNA or minicircle DNA, or linear DNA, or the solution contains macromolecules selected from mRNA, small interfering RNA, antisense RNA, ribozymes, and / or proteins.

[0243] In embodiments, amylase and lipase levels are trended with respect to the extent of pancreatic injury.

[0244] In embodiments, the catheter is further advanced into the pancreatic duct to deliver the gene specifically to the distal portion of the pancreas.

[0245] In embodiments, the solution corresponds to normal saline, phosphate buffered saline, or a 5% solution of dextrose in water.

[0246] In embodiments, one or more additional pharmacological agents are added to the nucleic acid and / or protein solution for delivery to cells of the pancreas.

[0247] In embodiments, the one or more pharmacological agents may function to prevent or ameliorate the development of post-infusion pancreatitis.

[0248] In embodiments, these pharmacological agents suppress the immune system and include cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone, and / or prednisone.

[0249] In embodiments, the pharmacological agent inhibits a pancreatic digestive enzyme.

[0250] In embodiments, the pharmacological agent is selected from enzyme inhibitors including gabexate mesylate, nafamostat mesylate, urinastatin, camostat mesylate, aprotinin, pefabloc, trasylol, and urinary trypsin inhibitor, or somatostatin.

[0251] In embodiments, a solution with a pharmacological agent that inhibits pancreatitis is administered at a flow rate (<1 mL / sec) after hydrodynamic injection is completed and before repeat fluoroscopy.

[0252] In embodiments, the targeted pancreatic tissue is a tumor and the catheter is positioned proximate to the site of the tumor.

[0253] In embodiments, the nucleic acid may be circular DNA, such as plasmid DNA or minicircle DNA, or linear DNA, such as closed-end DNA.

[0254] In embodiments, the macromolecule may be one or more of an mRNA, a small interfering RNA, an antisense RNA, a ribozyme, or a protein.

[0255] In embodiments, the pancreas has a condition to be treated, including cancer, cystic fibrosis, type 1 diabetes, type 2 diabetes, autoimmune pancreatitis, and rare monogenic pancreatic disorders.

[0256] In embodiments, the nucleic acid comprises a cell-type specific promoter to target expression of the transgene to a particular cell type.

[0257] In embodiments, pancreatic acinar cells are targeted for expression using the chymotrypsin-like elastase-1 promoter, the Ptf1a promoter, or the Amy2a promoter.

[0258] In embodiments, pancreatic ductal epithelial cells are targeted for expression by the Sox9 promoter, the Hnf1b promoter, the Krt19 promoter, and / or the Muc1 promoter.

[0259] In embodiments, pancreatic islet cells are targeted for expression using the insulin promoter, glucagon promoter, somatostatin promoter, ghrelin promoter, or neurogenin-3 promoter.

[0260] In embodiments, pancreatic endothelial cells are targeted for expression using the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter.

[0261] In embodiments, the nucleic acid comprises a cell-type specific promoter for targeting gene expression to a particular cell type.

[0262] In embodiments, pancreatic neurons are targeted for expression using the synapsin I promoter, calcium / calmodulin-dependent protein kinase II promoter, tubulin αI promoter, neuron-specific enolase promoter, and platelet-derived growth factor β chain promoter.

[0263] In embodiments, the nucleic acid comprises two or more promoters active in two or more of pancreatic acinar cells, ductal epithelial cells, or pancreatic islet cells.

[0264] In embodiments, pancreatic islet cells are targeted for expression using the insulin promoter, glucagon promoter, somatostatin promoter, ghrelin promoter, or neurogenin-3 promoter.

[0265] In embodiments, pancreatic endothelial cells are targeted for expression using the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter.

[0266] In embodiments, pancreatic neurons are targeted for expression using the synapsin I promoter, calcium / calmodulin-dependent protein kinase II promoter, tubulin αI promoter, neuron-specific enolase promoter, and platelet-derived growth factor β chain promoter.

[0267] In one aspect, the present disclosure provides a method of retrograde ureteral hydrodynamic infusion into the kidney, wherein one or more additional therapeutic agents are included in the infusion solution to reduce inflammation and / or potential infection from the infusion procedure.

[0268] In embodiments, the one or more additional therapeutic agents comprise one or more small molecules.

[0269] In embodiments, the one or more additional therapeutic agents comprise one or more antibiotics or anti-inflammatory agents, optionally wherein the anti-inflammatory agents are selected from the group consisting of cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone, and prednisone.

[0270] In embodiments, the cell types include collecting duct cells, proximal tubule cells, distal tubule cells, interstitial cells, podocytes, glomerular cells, renal epithelial cells, and endothelial cells.

[0271] In embodiments, the method comprises injecting a nucleic acid molecule comprising one or more cell type-specific promoters to target expression to specific cell types.

[0272] In embodiments, proximal tubule epithelial cells are targeted for expression by the gamma-glutaryl transpeptidase promoter, the Sglt2 promoter, or the NPT2a promoter.

[0273] In embodiments, endothelial cells are targeted for expression by the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter.

[0274] In embodiments, podocytes are targeted for expression using the podocin promoter.

[0275] In embodiments, the NKCC2 promoter targets cells of the thick ascending limb of Henle, the AQP2 promoter targets cells of the collecting duct, and the kidney-specific cadherin promoter targets renal epithelial cells.

[0276] In embodiments, the nucleic acid molecule comprises two or more promoters active in two or more tissues selected from the group consisting of collecting duct cells, proximal tubule cells, distal tubule cells, interstitial cells, podocytes, and glomerular cells.

[0277] In embodiments, the two or more promoters used to target two or more cell types in the kidney include a cytomegalovirus promoter, an EF1α promoter, an SV40 promoter, a ubiquitin B promoter, a GAPDH promoter, a β-actin promoter, or a PGK-1 promoter.

[0278] In embodiments, the nucleic acid comprises circular DNA, linear DNA, plasmid DNA, minicircle DNA, mRNA, siRNA, antisense RNA, ribozyme, or protein.

[0279] In embodiments, the catheter is configured to administer nucleic acids and / or proteins in a forward direction only, rather than obliquely or perpendicularly.

[0280] In embodiments, the catheter is configured to administer the nucleic acid or protein only in a forward direction, rather than obliquely or perpendicularly to the bile duct wall, pancreatic duct wall, or ureter wall of a subject, thereby avoiding damage to any wall.

[0281] In embodiments, the imaging composition is administered at a slower flow rate than the nucleic acid and / or solution is administered.

[0282] In embodiments, the nucleic acid comprises one or more of DNA, mRNA, siRNA, miRNA, lncRNA, tRNA, circular RNA, or antisense oligonucleotides.

[0283] In embodiments, the nucleic acid is an expression cassette encoding a protein and comprises circular DNA, linear DNA, single-stranded DNA, double-stranded DNA, linear mRNA, or circular mRNA.

[0284] In embodiments, one or more DNA or RNA molecules may be combined in the same nucleic acid solution and injected simultaneously.

[0285] In embodiments, the infusion is monitored using a pressure catheter inserted through one of the catheter ports.

[0286] In embodiments, the pressure catheter is inserted into one of two ports or channels, one of the ports being used for both radiocontrast injection and hydrodynamic nucleic acid and / or protein solution injection.

[0287] In an embodiment, a failed infusion is detected by the disappearance of the plateau waveform during the infusion.

[0288] In an embodiment, if the expected pressure curve is not achieved due to a balloon seal failure or other cause, the injection is repeated again during the same procedure.

[0289] In embodiments, pressure curves generated by varying the flow rate of the administered nucleic acid and / or protein solution produce different peak pressure plateaus.

[0290] In embodiments, at least two flow rates are used during a procedure that initially involves filling the biliary system, pancreatic system, or ureter-renal system with a DNA solution, thereby priming these biliary systems with DNA, after which high pressure is applied to apply a flow rate throughout the system.

[0291] In embodiments, the flow rate may be varied during the infusion, with different short periods of high flow rates and longer periods of intermediate, lower flow rates to minimize stress on the bile duct, pancreatic duct, or ureteral walls and catheter walls.

[0292] In embodiments, a double-barrel power injector is used to inject the nucleic acid and / or protein solution into the catheter.

[0293] In embodiments, one barrel is filled with saline, lactated Ringer's solution, or 5% dextrose in water, and the second barrel is filled with a nucleic acid and / or protein solution.

[0294] In embodiments, the nucleic acid and / or protein solution is injected first, and then the second barrel is fired to expel the nucleic acid and / or protein solution through the tubing, ensuring it enters the liver, pancreas, or kidney completely.

[0295] In embodiments, the non-nucleic acid solution chase is carried out at the same pressure as the nucleic acid and / or protein solution to maintain the same flow rate.

[0296] In embodiments, the non-nucleic acid solution is first pumped through the circuit at a low flow rate to remove bile from the biliary system, followed by the nucleic acid and / or protein solution, followed by the non-nucleic acid solution.

[0297] In embodiments, the non-nucleic acid solution chase is at most equal in volume to the infused nucleic acid and / or protein solution and at least equal in volume to the volume of the tubing and catheter circuit outside the biliary, pancreatic, or ureteropelvic systems.

[0298] In embodiments, the fluid pressure from administration is sufficient to create fluid-filled vesicles and / or dilute the inner cytoplasm of the liver, pancreatic, or kidney cells.

[0299] In embodiments, administering results in hydrodynamic forces and tissue changes including fluid-filled vesicles and / or diluted cytoplasm in both the proximal and distal portions of the respective liver lobes.

[0300] In embodiments, other tissues outside of the target organs of the liver, pancreas, or kidney are not subjected to hydrodynamic forces and are not transfected with the nucleic acid and / or protein solution.

[0301] In one aspect, the present disclosure provides a method of treating a subject comprising administering to the biliary tree, liver, kidney, or pancreas of the subject a first fluid composition that does not contain nucleic acids and / or proteins, followed by administering an effective amount of a nucleic acid and / or protein solution.

[0302] In embodiments, the first fluid injection serves to remove bile, urine, or pancreatic exocrine secretions from the biliary tree, ureter and renal pelvis, or pancreatic duct system prior to injection of the nucleic acid and / or protein solution.

[0303] definition The term "activity" refers to the ability of a gene to perform its function, such as indoleamine 2,3-dioxygenase (oxidoreductase), which catalyzes the breakdown of the essential amino acid tryptophan (trp) to N-formyl-kynurenine.

[0304] As used in this disclosure, the term "antibody" refers to an immunoglobulin or a fragment or derivative thereof and encompasses any polypeptide containing an antigen-binding site, whether produced in vitro or in vivo. This term includes, but is not limited to, polyclonal antibodies, monoclonal antibodies, monospecific antibodies, multispecific antibodies, nonspecific antibodies, humanized antibodies, single-chain antibodies, chimeric antibodies, synthetic antibodies, recombinant antibodies, hybrid antibodies, mutated antibodies, and grafted antibodies. Unless otherwise modified by the term "intact," as in "intact antibody," for purposes of this disclosure, the term "antibody" also includes antibody fragments, e.g., Fab, F(ab')2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen-binding function, i.e., the ability to specifically bind, for example, to PD-L1. Typically, such fragments contain the antigen-binding domain.

[0305] The terms "antigen-binding domain," "antigen-binding fragment," and "binding fragment" refer to a portion of an antibody molecule comprising amino acids responsible for specific binding between the antibody and the antigen. If the antigen is large, the antigen-binding domain may bind to only a portion of the antigen. The portion of the antigen molecule responsible for specific interaction with the antigen-binding domain is called an "epitope" or "antigenic determinant." An antigen-binding domain typically contains an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), but does not necessarily contain both. For example, a so-called Fd antibody fragment consists only of the VH domain but still retains some antigen-binding function of an intact antibody.

[0306] Binding fragments are produced by recombinant DNA technology or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab', F(ab')2, Fv, and single-chain antibodies. Antibodies other than "bispecific" or "bifunctional" antibodies are understood to have identical binding sites. Digestion of antibodies with the enzyme papain produces two identical antigen-binding fragments, also known as "Fab" fragments, and an "Fc" fragment, which lacks antigen-binding activity but has the ability to crystallize. Digestion of antibodies with the enzyme pepsin produces an F(ab')2 fragment, in which the two arms of the antibody molecule remain linked and contain two antigen-binding sites. The F(ab')2 fragment has the ability to cross-link antigens. As used herein, "Fv" refers to the minimum fragment of an antibody that retains both the antigen-recognition and antigen-binding sites. "Fab" refers to an antibody fragment containing the constant domain of the light chain and the CH1 domain of the heavy chain.

[0307] By "agent" is meant any small molecule compound, antibody, nucleic acid molecule, or polypeptide, or fragment thereof.

[0308] By "ameliorate" is meant to decrease, suppress, attenuate, diminish, halt, or stabilize the onset or progression of a disease.

[0309] "Alteration" refers to a change (increase or decrease) in the expression level or activity of a gene or polypeptide, as detected by standard art-known methods, such as those described herein. As used herein, alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.

[0310] "Analog" refers to a molecule that is not identical but has similar functional or structural characteristics. For example, a polypeptide analog retains the biological activity of the corresponding naturally occurring polypeptide, but has certain biochemical modifications that enhance the function of the analog compared to the naturally occurring polypeptide. Such biochemical modifications can, for example, increase the analog's protease resistance, membrane permeability, or half-life without altering ligand binding. Analogs can also contain unnatural amino acids.

[0311] "Disease" means any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include cancer.

[0312] "Effective amount" means the amount required to improve the symptoms of a disease compared to an untreated patient. The effective amount of active compound(s) used to practice the present disclosure for the therapeutic treatment of a disease will vary depending on the mode of administration, the age, weight, and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and administration regimen. Such an amount is referred to as an "effective" amount.

[0313] "ERCP" refers to endoscopic retrograde cholangiopancreatography (ERCP), a technique that combines the use of endoscopy and fluoroscopy to diagnose and treat certain problems in the biliary or pancreatic systems. Through an endoscope, physicians can see inside the stomach and duodenum and inject contrast media into the biliary tree and pancreatic ducts, making them visible on x-rays. ERCP is primarily used to diagnose and treat conditions of the bile duct and main pancreatic duct, including gallstones, inflammatory strictures (scarring), leakage (due to trauma and surgery), and cancer. While ERCP can be performed for diagnostic and therapeutic reasons, the development of safer, relatively noninvasive investigations, such as magnetic resonance cholangiopancreatography (MRCP) and endoscopic ultrasound, means that ERCP is now rarely performed without therapeutic intent.

[0314] The term "express" refers to the ability of a gene to express a gene product, including, for example, its corresponding mRNA or protein sequence(s).

[0315] As used herein, the term "expression cassette" or "nucleic acid expression cassette" refers to a DNA sequence that encodes and is capable of producing one or more desired expression products (RNA or protein). The production of such desired expression products may require the presence of various expression control sequences operably linked to the DNA sequence encoding the product. Such control sequences include promoters, as well as other non-coding nucleotide sequences. An expression cassette may contain none, some, or all of these expression control sequences. If some or all of these expression control sequences are not present in the expression cassette, they are supplied by the vector into which the expression cassette is inserted.

[0316] As used herein, "subject" refers to a human. The terms "patient," "individual," and "subject" are used interchangeably herein. A subject may be a subject previously diagnosed or identified as suffering from or having a condition requiring treatment (e.g., a brain tumor) or one or more complications associated with the condition, and optionally, a subject who has already received treatment for the condition or one or more complications associated with the condition. Alternatively, a subject may be a subject who has not previously been diagnosed with the condition or one or more complications associated with the condition. For example, a subject may exhibit one or more risk factors for the condition or one or more complications associated with the condition, or a subject who does not exhibit risk factors. A "subject in need" of treatment for a particular condition, such as a neurodegenerative condition, may be a subject suspected of having the condition, diagnosed with the condition, already treated or being treated for the condition, not being treated for the condition, or at risk of developing the condition.

[0317] The term "biliary tree" includes the common bile duct and the hepatic duct. The pancreatic duct may also be included in certain embodiments along with the common bile duct and / or the hepatic duct. The ureters and kidneys may also be included in certain aspects along with the common bile duct and / or the common hepatic duct.

[0318] The term "polynucleotide" as used herein refers to a sequence of 20 or more nucleotides. A polynucleotide may be an RNA, DNA, or hybrid RNA or DNA molecule, and may be single-stranded or double-stranded. In certain embodiments, a polynucleotide is a single-stranded or double-stranded DNA molecule.

[0319] The term "promoter," as used herein, is defined as a DNA sequence recognized by a cell's synthetic machinery or introduced synthetic machinery necessary to initiate the specific transcription of a polynucleotide sequence. A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes a gene product to be produced in a cell under most or all physiological conditions of the cell. An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes a gene product to be produced in a cell substantially only if an inducer corresponding to the promoter is present in the cell. A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes a gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0320] By "fragment" is meant a portion of a polypeptide or nucleic acid molecule. The portion preferably comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.

[0321] "Hybridization" means hydrogen bonding between complementary nucleobases, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.

[0322] An "immunoassay" is an assay that uses an antibody to specifically bind to an antigen (e.g., a marker). Immunoassays are characterized by the use of the specific binding properties of a particular antibody to isolate, target, and / or quantify the antigen.

[0323] The term "obtaining," as in "obtaining a drug," includes synthesizing, purchasing, or otherwise acquiring a drug.

[0324] The term "mAb" refers to a monoclonal antibody. Antibodies of the present disclosure include, but are not limited to, whole native antibodies, bispecific antibodies, chimeric antibodies, Fab, Fab', single-chain V-region fragments (scFv), fusion polypeptides, and non-conventional antibodies.

[0325] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues are analogs or mimetics of corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. Polypeptides can be modified, for example, by the addition of carbohydrate residues to form glycoproteins. The terms "polypeptide," "peptide," and "protein" include glycoproteins and non-glycoproteins.

[0326] By "reduce" is meant a negative change of at least 10%, 25%, 50%, 75%, or 100%. "Reference" refers to a standard or control condition, such as a sample (human cells) or subject that is free or substantially free of an agent, such as a plasmid or transposon of the present disclosure.

[0327] A "reference sequence" is a defined sequence used as the basis for sequence comparison. A reference sequence can be a subset or the entirety of a specific sequence; for example, it can be a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of a reference polypeptide sequence is generally at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of a reference nucleic acid sequence is generally at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides, or any integer between or about that length.

[0328] By "specifically binds" is meant a compound or antibody that recognizes and binds to a polypeptide of the present disclosure, but does not substantially recognize or bind to other molecules in a sample, e.g., a biological sample that naturally contains a polypeptide of the present disclosure.

[0329] As used herein, the term "subject" is intended to refer to any individual or patient that the method described herein is carried out.Generally, subject is human, but as understood by those skilled in the art, subject can also be animal.Therefore, other animals, including livestock, including rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, cows, horses, goats, sheep, pigs, etc., and mammals such as primates (including monkeys, chimpanzees, orangutans and gorillas), are included in the definition of subject.

[0330] By "substantially identical" is meant a polypeptide or nucleic acid molecule that exhibits at least 50% identity to a reference amino acid sequence (e.g., any one of the amino acid sequences described herein) or nucleic acid sequence (e.g., any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95%, or even 99% identical at the amino acid or nucleic acid level to the sequence used for comparison.

[0331] Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, the BLAST program can be used, e.g., -3 and e -100 A probability score between indicates closely related sequences.

[0332] Ranges provided herein are understood to be shorthand for all values ​​within that range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0333] As used herein, the terms "treat," "treating," "treatment," and the like refer to reducing or ameliorating a disorder and / or its associated symptoms. It is understood that treating a disorder or condition does not require that the disorder, condition, or its associated symptoms be completely eliminated, although it is not excluded.

[0334] "Transgene" is used herein to simply refer to the polynucleotide or nucleic acid that is intended or introduced into a cell or organism.Transgene includes any nucleic acid, such as a gene that encodes a polypeptide or protein.For example, suitable transgenes for use in gene therapy are well known to those skilled in the art.For example, the vector described herein can deliver transgenes and uses, including but not limited to those described in U.S. Patent Nos. 6,547,099; 6,506,559; and 4,766,072; U.S. Patent Application Publication Nos. 20020006664; 20030153519; and 20030139363; and PCT application publications WO 01 / 68836 and WO 03 / 010180, and for example, miRNA and other transgenes in WO2017 / 152149, each of which is incorporated herein by reference in its entirety.

[0335] Unless otherwise stated or clear from context, as used herein, the term "or" is understood to be inclusive. Unless otherwise stated or clear from context, as used herein, the terms "a," "an," and "the" are understood to be singular or plural.

[0336] Unless otherwise specified or clear from the context, the term "about" as used herein is understood to mean within a normal range of tolerance in the art, for example, within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term about.

[0337] The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiment or portion thereof.

[0338] Any composition or method provided herein can be combined with one or more of any of the other compositions and methods provided herein.

[0339] As used herein, the terms "prevent," "preventing," "prevention," "prophylactic treatment," and the like refer to reducing the chance of developing a disorder or condition in a subject who does not have the disorder or condition but is at risk of or susceptible to developing the disorder or condition.

[0340] Such treatment (surgery and / or chemotherapy) is preferably administered to subjects, particularly humans, suffering from, having, susceptible to, or at risk for pancreatic cancer or its diseases, disorders, or symptoms. The determination of a subject "at risk" can be made by any objective or subjective determination, such as by diagnostic testing or the opinion of the subject or healthcare provider (e.g., genetic testing, enzyme or protein markers, Markers (as defined herein), family history, etc.).

[0341] Other aspects of the present disclosure are disclosed below. [Brief explanation of the drawings]

[0342] The patent or application file contains at least one drawing executed in color. Copies of this application with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Figure 1] 1 illustrates an exemplary catheter placement in which the catheter balloon and distal catheter tip are positioned in the extrahepatic common hepatic duct adjacent to the liver wall of a subject. [Figure 2] 1 illustrates an exemplary catheter placement in which the catheter balloon and distal catheter tip are positioned in the intrahepatic common hepatic duct within the liver of a subject. [Figure 3] 1 illustrates an exemplary catheter placement in which the catheter distal end is positioned in an intrahepatic duct within a subject's liver and the catheter balloon is positioned in an extrahepatic duct adjacent to the subject's liver wall. [Figure 4] 1 illustrates an exemplary catheter placement in which the catheter balloon and distal catheter tip are positioned within the right hepatic duct within the liver of a subject. [Figure 5] 1 illustrates an exemplary catheter placement in which the catheter balloon and distal catheter tip are positioned within the left hepatic duct within the liver of a subject. [Figure 6] 1 illustrates an exemplary catheter placement in which the catheter balloon and distal catheter end are positioned within the pancreatic duct. [Figure 7]An exemplary catheter useful in the present methods and systems is illustrated having a handle that allows different lumens to be accessed, including air / balloon, infusion, and guidewire lumens. [Figure 8A-8B] 8A and 8B illustrate exemplary catheter cross sections with injection ports / lumens, respectively. Figure 8A shows a catheter configuration of a common commercially available catheter, where injection ports inject laterally into the vessel wall. Figure 8B shows the disclosed catheter design, where all ports / lumens inject forward to avoid wall stresses that could rupture the vessel. [Figure 9] Fluoroscopic images of the rupture of the proximal common hepatic duct during hydrodynamic injection are shown. [Figures 10A-10B] 10A and 10B show images of an exemplary injection protocol: Figure 10A shows the initial position of the catheter and balloon, and Figure 10B shows an exemplary progression of contrast agent into the liver during hydrodynamic injection. [Figure 11] 1 shows a graph illustrating the pressure curve of intrabiliary pressure during an exemplary hydrodynamic injection protocol and the subsequent pressure drop at the end of the injection, as described in Example 6. [Figure 12] 10 shows a graph of pressure curves of intrabiliary pressure during an exemplary injection protocol, demonstrating that pressure monitoring can detect balloon slippage and loss of ductal seal, as described in Example 7. [Figures 13A-13E] 10 is a photograph showing that pigs tolerated repeated hydrodynamic infusions in the biliary tree, as described in Example 8, since macroscopic examination of the liver immediately after infusion revealed no obvious abnormalities. [Figure 14] 1 shows an image of the hepatocyte cytoplasm of a sample from Example 9, which demonstrates that the histology of pig liver after repeated hydrodynamic bile injections demonstrates the hydrodynamic effect. [Figure 15] 1 shows images of hepatocyte cytoplasm from samples of Example 9, demonstrating that hydrodynamic bile infusion induces acute tissue architectural changes in pigs similar to hydrodynamic tail vein infusion in mice. [Figure 16]1 shows images of proximal common hepatic duct rupture following injection of a volume of over 30 mL of 100% contrast solution at 2 mL / sec, as disclosed in Example 10. [Figure 17] 10 shows images demonstrating that injection of 25% contrast solution did not mediate hepatic duct rupture, as disclosed in Example 10. [Figure 18] Fluorescence imaging demonstrating a very low transfection rate when 3 mg of DNA of a plasmid carrying the EF1α promoter was administered in a volume of 30 mL and injected at 2 mL / sec. [Figure 19] 1 shows hFIX immunostaining images showing high transfection efficiency between 35-50% after use of a liver-specific promoter as disclosed in Example 11. [Figures 20A-20B] Figure 20A shows two images and a bar graph, respectively. Figure 20A shows images of mice (upper panel) and pigs (lower panel) that received hFIX vascular hydrodynamic injection. Figure 20B shows a bar graph showing that increasing DNA concentration resulted in increased transfection efficiency in pigs, with both doses in pigs achieving higher transfection efficiencies than those achieved in mice. [Figures 21A-21C] Figure 21 shows a series of gels testing for the presence of plasmid DNA (pDNA) by polymerase chain reaction (PCR). Figure 21A shows the results of pDNA testing in pig plasma and bile. Figure 21B shows the results of pDNA testing in pig feces. Figure 21C shows the results of pDNA testing in a series of tissues sampled from pig #3 one week after injection. [Figure 22] Hematological data after hydrodynamic infusion are shown for four pigs infused via the biliary route at 30 mL, 2 mL / sec. [Figure 23] Biochemical data after hydrodynamic infusion are shown for four pigs infused via the biliary route at 30 mL, 2 mL / sec. [Figure 24] 1 shows a series of dot plots depicting the vital signs of a subject before and after hydrodynamic infusion via the biliary route. [Figure 25]1 shows a series of dot plots depicting the subject's vital signs before and after the next round of hydrodynamic infusion three weeks later. [Figures 26A-26C] Figure 26 shows a series of bar graphs quantifying the area of ​​hFIX immunostaining positive within liver lobules after injection. Figure 26A shows the area % of hFIX-positive immunostaining within individual lobules (n = 5) in pig #3 (1 week after injection) and pigs #1, #2, and #4 (3 weeks after injection). Figure 26B shows that the distal and proximal portions of individual liver lobes between pigs #3 and #4 show no consistent differences in the area % of hFIX-positive hepatocytes (n = 5-6 lobules per lobe). Figure 26C shows that higher doses of plasmid DNA resulted in higher hFIX% transfected areas. [Figure 27] A series of H&E stained liver tissue samples are shown showing large vesicle formation within hepatocytes, dilated hepatic sinusoids, and diluted cytoplasm within hepatocytes after bile infusion at 10 mL / sec with diluted cytoplasm. [Figures 28A-28E] The design and validation of hFIX plasmid vectors in a mouse model are shown with two vector maps, dot plots, stained tissues, and bar graphs. Figure 28A shows a diagram of pT-LP1-hFIX. Figure 28B shows a diagram of pCMV-hyperPB. Figure 28C shows that delivery of 8 μg of hFIX transposon and 1 μg of hyperPB transposase by hydrodynamic tail vein injection in mice resulted in 11,268±1,077 ng / mL of hFIX one week after injection. Figure 28D shows the frequency of hFIX-positive hepatocytes in mouse livers by cytoplasmic immunostaining. Figure 28E shows that individual lobules were quantified in three injected mice, and the stained area was quantified (n=6 lobules / mouse). [Figures 29A-29G]Four images and three graphs are shown demonstrating that ERCP-mediated hydrodynamic infusion was well tolerated by pigs. Figure 29A depicts cannulation of the ampulla of Vater during endoscopy in pig #2. Figure 29B shows the biliary tree branching before infusion in pig #1. Figures 29C and 29D show that contrast injection using a balloon inflated within the common bile duct after hydrodynamic infusion reveals an intact biliary system, as evidenced by the absence of contrast extravasation (pig #1, Figure 29C; pig #3, Figure 29D). Figure 29E shows that heart rate, mean arterial pressure, respiratory rate, and pulse oximetry values ​​were compared pre- and post-treatment for all four pigs and demonstrated no significant differences. An independent parametric two-tailed t-test was used for analysis; significance (P<0.05). Figure 29F shows that liver function biomarkers monitored after hydrodynamic infusion demonstrate minimal toxicity in pigs. ALT and AST remained within the normal range during the week following infusion. Similarly, total bilirubin, direct bilirubin, albumin, and GGT did not show any changes. Figure 29G shows that hematological parameters monitored after hydrodynamic infusion showed minimal impact. White blood cell (WBC) counts showed no acute changes after infusion. Platelet (PLT) counts showed a mild increase after infusion. Red blood cell (RBC) counts and hemoglobin showed no significant changes after infusion. Day 0 = day of infusion, representing pre-treatment specimens. [Figures 30A-30G]Figure 30A shows that pig livers are anatomically and histologically normal after hydrodynamic injection without gene delivery to non-liver tissues. Figure 30A shows the visceral liver surface of pig #3 one week after injection. All five lobes, along with the gallbladder and portal triad, are observed, with no gross abnormalities. Figure 30B shows that the diaphragmatic liver surface of pig #3 also shows no abnormalities. Figure 30C shows that the intrahepatic bile duct branches of pig #3 were dissected without any rupture or lesions. Figure 30D shows that hydrodynamically injected pigs exhibited normal liver histology one week after injection. H&E staining is shown for pig #3 and a non-injected pig. PCR of hFIX DNA showed the expected band size (550 bp). The positive control (CTL) was the hFIX plasmid, and the negative control was a non-injected pig liver. Figure 30E shows that pDNA biodistribution into pig body fluids after hydrodynamic injection was studied. Plasma samples were collected from all four pigs before treatment, 15 minutes after treatment, and one day after treatment. Bile tested by PCR one week after injection during necropsy was negative. Figure 30F shows that fecal samples were collected from pigs #2 and #4 before treatment and tested for hFIX DNA by PCR on days 4 and 14 after injection. Figure 30G shows that no transfection of pDNA was demonstrated after hydrodynamic injection into non-liver tissues. A panel of 23 different tissues was sampled during necropsy of pig #3 one week after injection and tested by PCR. [Figures 31A-31D]This shows that biliary hydrodynamic infusion mediates human FIX DNA delivery and protein expression in all liver lobes. Figure 31A shows the tissue sampling scheme of pig livers across different lobes: right lateral lobe (RLL), right medial lobe (RML), left medial lobe (LML), left lateral lobe (LLL), and quadrate lobe. Samples proximal and distal to the catheter infusion site in CHD were collected across all lobes. The liver of pig #3 is shown in Figure 31A and will be collected one week after infusion for subsequent histological analysis. Figure 31B shows that PCR on genomic DNA revealed the expected band (550 bp) for hFIX DNA in all liver lobes tested. Figure 31C shows that RT-PCR performed on RNA extracted one week after infusion confirmed the expected band size. RNA extracted from HepG2 cells transfected with the pT-LP1-hFIX plasmid was used as a positive control. For both PCRs, the positive control (CTL) was the hFIX plasmid, and the negative control was uninjected pig liver tissue. Figure 31D shows that Western blots on liver tissue demonstrated the correct size of hFIX (70 kDa) with low levels of cross-reactivity to pig FIX at the same molecular weight. Quantification of hFIX expression by Western blot band intensity and normalization to β-actin is provided. (CTL = control, uninjected pig liver). [Figures 32A-32C]Immunohistochemistry demonstrating efficient human factor IX expression in pigs after hydrodynamic delivery is shown. Figure 32A shows that IHC of hFIX in human liver tissue showed uniform cytoplasmic expression in hepatocytes, with no apparent intensity difference between hepatocytes in the lobule (central vein area vs. cord). Control tissue from a non-injected pig liver showed no hFIX staining, as expected, with only bright background staining for porcine FIX. Immunostaining in hFIX-injected pig #3 showed abundant hFIX-positive hepatocytes with cytoplasmic staining similar to human hepatocytes, but with more variable expression intensity among positive cells. (Bar = 50 μm) Figure 32B shows a low-magnification tissue section from an hFIX-injected pig, clearly demonstrating hFIX expression in all lobules (Bar = 500 μm). Figure 32C shows that individual lobules show strongest expression around the central vein, radiating toward the fibrous lobule border (Bar = 100 μm). Positive hFIX-hepatocytes are seen in all functional zones but are most abundant in zone 3 (bar = 50 μm). hFIX expression is strongest and uniform around the central vein (bar = 20 μm), but numerous positive cells are also seen near the portal triad (bar = 50 μm). IHC images of hFIX-injected pigs are obtained from a distal biopsy site in the right middle lobe of pig #3. [Figures 33A-33C]Figure 33A shows that hFIX was uniformly distributed within the pig liver after hydrodynamic injection, demonstrating good expression in all pigs. Figure 33A shows the area percentage of hFIX-positive immunostaining within individual lobules (n=5-6) in pig #3 (1 week after injection) and pigs #1, #2, and #4 (3 weeks after injection). Figure 33B shows that the distal and proximal portions of individual liver lobes between pigs #3 and #4 showed no consistent differences in the area percentage of hFIX-positive hepatocytes (n=5-6). Figure 33C shows that higher doses of pDNA resulted in higher hFIX-transfected area percentages. Each pig represents the average of the four lobes determined in Figure 33A, excluding the quadrate lobe, which is smaller in size (approximately 5% of the liver), and is pooled. Data measurements are presented as the mean ± standard error of the mean (SEM). Statistics represent unpaired parametric two-tailed t-tests; significance (p<0.05) was used. ****p<0.0001; **p<0.01; *p<0.05; ns=not significant. [Figures 34A-34C] We demonstrate that porcine bile duct hydrodynamic injection results in superior transfection efficiency compared with mouse hydrodynamic tail vein injection. Figure 34A shows that mouse HTVI was primarily located around the central vein in zone 2 (bar = 50 μm). Pig hydrodynamic bile duct injection resulted in hFIX-positive expression that almost uniformly surrounded the central vein in zone 3 (bar = 200 μm) and then radiated outward along the cord-like tissue reaching zones 1 and 2 (shown is a proximal section of the LML of pig #3). Figure 34B shows a model of the mechanism of bile-to-vascular hydrodynamic delivery. Figure 34C shows that for individual lobules, the percentage of hFIX-positive porcine hepatocytes was significantly higher than that of hFIX-positive mouse hepatocytes in matched DNA per liver weight dose (mice represent 3 mice, 18 lobules; pigs represent the average of 8 lobules from 2 pigs, excluding the quadrate lobe). Data measurements are presented as mean ± standard error of the mean (SEM). Statistics represent unpaired parametric two-tailed t-test; significance (p<0.05). ****p<0.0001; **p<0.01. [Figure 35]We show that the pCMV-hyperPB plasmid promotes efficient transposition of a reporter transposon into the genome of HEK293 cells in vitro, with stable expression after repeated passage of HEK293 cells reflecting integration of the GFP gene into the genome. [Figure 36A-36B] Vital signs were monitored and ultrasound was performed during the hydrodynamic procedure, indicating minimal pre- and post-procedure disturbances. Figure 36A shows that the gallbladder measured pre- and post-procedure showed no change in size, confirming that the balloon seal during hydrodynamic injection prevented fluid from entering this space. Figure 36B shows that vital signs taken during the procedure did not show any acute changes in blood pressure, heart rate, pulse oximetry, or respiratory tidal volume from pre- to post-procedure. [Figure 37] 1 shows that hFIX DNA delivered by biliary hydrodynamic injection is detectable in pig livers for a long period of time by PCR testing for a period of 3 weeks after injection. [Figure 38A-38B] This shows that human FIX antibodies mediate low levels of cross-reactivity to porcine FIX. Figure 38A shows that Western blots of human and porcine plasma were performed, showing that the hFIX antibody strongly stains human plasma at the correct molecular weight (70 kDa), while showing minimal binding to porcine FIX. Figure 38B shows that band intensity on the Western blot was quantified using normalization of input protein levels in each well (1:0.66 human plasma to porcine plasma protein). [Figures 39A-39C]Representative hFIX immunostaining of pig and mouse liver sections at low magnification is shown. Figure 39A shows an example of a liver section stained for hFIX at low magnification from a proximal LML section of pig #3, demonstrating that immunostaining can be observed in every single lobule, with the highest intensity in the center of the lobule (bar = 1 mm). Figure 39B shows a magnified image from the same liver biopsy section, showing strong staining adjacent to the central vein and radiating toward the lobule border (bar = 200 μm). Figure 39C shows a representative image of a mouse liver after HTVI of hFIX, demonstrating positive hFIX hepatocytes in every lobule (bar = 200 μm). [Figure 40A-40B] Figure 40A shows fluoroscopy monitoring the success of biliary hydrodynamic injection. Figure 40A shows that the bile duct anatomy and good balloon sealing to prevent backflow of contrast were confirmed. The catheter placement inside the CHD is followed by inflation of the balloon to observe bifurcation into left and right branches of the CHD. Figure 40B shows that hydrodynamic delivery to all lobes was confirmed by real-time fluoroscopic measurements of the injection. An exemplary fluoroscopic image of one hydrodynamic injection is provided, showing the image time course during injection (30 mL at 2 mL / sec). At the completion of the injection (15 seconds), all liver lobes contain detectable contrast. [Figures 41A-41E] Figure 41 shows that vital signs monitored during biliary hydrodynamic infusion showed no significant changes. All pigs had their vital signs monitored under anesthesia during the ERCP procedure. Pre- and post-procedure values ​​are provided, representing possible physiological perturbations from hydrodynamic infusion. Heart rate (Figure 41A), respiratory rate (Figure 41B), pulse oximetry (Figure 41C), end-tidal CO2 (Figure 41D), and mean arterial pressure (Figure 41E) all showed no significant changes from pre- to post-procedure (ns) (using an unpaired, two-tailed parametric t-test, P<0.05). [Figures 42A-42D]Monitoring of intrabiliary pressure during hydrodynamic infusion is shown. Baseline pressure within the biliary tree is minimal before infusion in all conditions (Figures 42A-42D). Immediately prior to infusion, the balloon is inflated to form a seal that appears to have minimal impact on the measured pressure. At the start of the infusion (solid black arrow, parameters provided above the graph), pressure increases to a brief peak before equilibrating during flow at a slightly lower pressure. Cessing the infusion (dashed black arrow) results in a rapid decrease in pressure. Deflation of the balloon (solid gray arrow) further reduces the pressure, suggesting that a baseline hydrostatic pressure measurement remains in the system after the infusion is completed. Figure 42A shows that the pressure reading for a 30 mL infusion at 2 mL / s showed a plateau pressure of 80 mmHg during the infusion, which rapidly dropped the moment the infusion ended. Figure 42B shows that when the balloon was deflated, a small level of pressure was released, representing the pressure generated by the balloon restriction of bile flow, although the exact value was variable between different experiments (4.23 mmHg to 18.92 mmHg). Peak pressure points in the initial power injector were also noted in two of the conditions (114.76 mmHg in Figure 42C and 181.36 mmHg in Figure 42D) before dropping slightly into a plateau phase. [Figure 43A-43B] Imaging and biochemical analysis support the safety profile of biliary hydrodynamic infusion. Figure 43A shows an abdominal CT scan with contrast performed on day 1 after the procedure. Axial, sagittal, and coronal images showed no evidence of intrahepatic or extrahepatic bile dilatation, hepatic infarction / necrosis, abnormal gallbladder distension, or cholecystitis. The systemic and portal venous systems were patent. Figure 43B shows that transient acute elevations of AST and total bilirubin were observed in three infused pigs, but not in the other five pigs, and biochemical abnormalities resolved by day 1 after infusion. Pig #1 is color-coded as a green dot, pig #2 is color-coded as a blue dot, and pig #3, which received multiple infusions at the maximum volume and infusion rate, is color-coded as a red dot. [Figure 44A-44B]Histology of pig livers after repeated hydrodynamic bile infusions demonstrates evidence of hydrodynamic effects. Figure 44A shows H&E staining from pigs infused at low flow rates (flow rate: <5 mL / sec; pig #1 shown) or high flow rates (flow rate: 10 mL / sec; pig #3 shown), along with H&E from a normal, uninfused pig liver for comparison. Histology taken from the liver 15 minutes after infusion showed significant dilation of the hepatic sinusoids (black arrows) and the formation of intracellular vesicles, but otherwise showed no areas of focal necrosis. Figure 44B shows histology of pig livers on days 1 and 14 post-treatment, demonstrating normal liver histology. H&E staining from pigs euthanized on days 1 and 14 post-treatment demonstrates no obvious sinusoidal dilation. Scattered fluid-filled vesicles were observed more rarely on day 1 post-treatment. On day 14, no fluid-filled vesicles were observed. Scale bars: 200 μm in 4× images; 50 μm in 20× images. [Figure 45A-45B] We demonstrate that hydrodynamic bile infusion induces acute tissue structural changes in pigs similar to those observed with hydrodynamic tail vein infusion in mice. Figure 45A shows a mouse that was infused with 10% body fluid volume over 4-7 seconds through the tail vein and sacrificed 15 minutes later for comparison with bile duct hydrodynamic infusion in pigs. Small fluid-filled cytoplasmic vesicles (black arrows), scattered hepatocytes with sparse cytoplasm, and occasional hepatocytes with engulfed red blood cells are observed in the mouse liver. Scale bars: left, 50 µm; right, 20 µm. Figure 1 [Figure 44B] Results from Pig #3, a high-flow infusion pig, show similar changes, with larger fluid-filled cytoplasmic vesicles and more frequent hepatocytes, as well as diluted cytoplasm. Scale bar: left, 50 μm; right, 2.0 μm. [Figure 46] Representative real-time vital signs during hydrodynamic infusion are shown, including body temperature, electrocardiogram, and heart rate. Continuous measurements were taken throughout one biliary hydrodynamic infusion procedure in a pig. There were no changes in body temperature, heart rate, or electrocardiogram parameters over a 10-second period at 4 mL / sec infusion. [Figures 47A-47E]Macroscopic examination of the pig livers immediately after each series of injections revealed no obvious abnormalities. The visceral surface (FIG. 47A) and diaphragmatic surface (FIG. 47B) of pig #1 are shown, showing lobules with no obvious lesions. Further examination of the common hepatic duct (CHD) of pig #1, where the catheter was placed for injection (FIG. 47C), revealed no wall lesions or lacerations. The visceral surfaces of pig #2 (FIG. 47D) and pig #3 (FIG. 47E) were also shown after tissue collection following injection, again showing no obvious macroscopic abnormalities. [Figure 48] PCR of plasmid DNA in serum samples demonstrates biliary system permeability. To assess fluid leakage from the biliary system during infusion, plasmid DNA (pCLucf) was diluted into the infusion solution. PCR primers were designed to target the GFP sequence in the pCLucf plasmid. PCR was performed on serum samples obtained before infusion, 15 minutes after infusion, and one day after infusion. DNA molecules were detected in the sample 15 minutes after infusion but were no longer detectable on day one after infusion. PCR band size spanning the GFP gene: approximately 300 bp. Molecular water was used as the template DNA for the negative control. The bright bands in the ladder represent 500 bp, and each lower ladder band is spaced 100 bp apart. [Figure 49] At high flow rates, vesicle formation was observed in the proximal and distal portions of the liver lobes. H&E staining from high-flow infused pig #3 (10 mL / sec) shows vesicle formation across all five liver lobes, as well as sampling proximal and distal to the common hepatic duct injection site. LLL, left lateral lobe; LML, left medial lobe; RML, right medial lobe; RLL, right lateral lobe. Scale bar: 100 μm. [Figure 50A-50B]Figure 50A shows that the bile ducts showed no signs of damage or rupture due to bile duct hydrodynamic infusion. Liver histology of pigs infused at the highest flow rate tested (10 mL / sec) was evaluated in livers harvested 15 minutes after infusion. Figure 50A shows that the morphology of large, medium, and small bile ducts showed no macroscopic differences in pigs infused at the high flow rate compared to uninfused normal pig liver controls. Figure 50B shows that the epithelial lining of intrahepatic and extrahepatic bile ducts was also intact in the same mice, while peribiliary glands maintained their integrity. Scale bar: 50 μm. [Figures 51A-51E] This study demonstrates that bile duct hydrodynamic injection can be used to target gene expression to different cell types in the liver. Figure 51A shows that reporter firefly luciferase staining was prominently observed in the bile duct after injection. The intensity of the staining was significantly higher than in surrounding hepatocytes, suggesting greater DNA delivery to these tissues. Figure 51B shows that GFP staining was strongly observed in endothelial cells lining arterioles in the portal triad of the liver. Figure 51C shows that luciferase staining was also observed to lightly stain interstitial fibrous tissue in the portal triad. Figure 51D shows that firefly luciferase staining was observed in hepatocytes scattered throughout the lobule. Figure 51E shows that smooth muscle associated with arteries in the portal triad also demonstrated efficient expression of GFP after injection. Figure 51F shows that neurons in the portal triad also showed efficient expression of GFP after injection. [Fig. 52A-52F] Figure 52A shows different cell types in the pancreas that can be targeted by ductal hydrodynamic injection. Figure 52A shows that pancreatic ductal epithelial cells stained prominently with firefly luciferase after injection. Figure 52B shows that pancreatic acinar cells were found abundantly and could express GFP. Figure 52C shows that pancreatic islet cells stained prominently with firefly luciferase after injection. Figure 52D shows that cells of the hematopoietic system also showed strong staining with GFP. Figure 52E shows that pancreatic endothelial cells were positive for firefly luciferase staining. Figure 52F shows that neurons stained strongly with GFP. [Figures 53A-53E]This study demonstrates that different regions of the liver can be targeted by varying the flow rate of hydrodynamic infusion through the biliary system. In this example, 7 mg of plasmid (approximately 7 kb) encoding CMV promoter-firefly luciferase and SV40 promoter-GFP was infused into a 50 kg pig at 4 mL / s over a total volume of 40 mL via hydrodynamic infusion. Figure 53A shows that GFP staining revealed prominent staining around the portal triad. Figure 53B shows that firefly luciferase staining was present along the lobule borders. In comparison, Figure 53C shows that central vessels at this flow rate had relatively few cells. Figure 53D shows the staining pattern of localized transfection at 2 mL / s, primarily around the central veins. Notably, Figure 53E shows that expression was particularly strong near large vessels, resulting in outward transfection radiation regardless of the lobule. [Fig. 54A-54D] This shows that promoters can result in the elimination of expression in different cell types in the liver and pancreas. Figure 54A shows that strong GFP staining of endothelial cells (solid arrows) was observed with the SV40 promoter, but bile ducts (dashed arrows) were not stained for GFP. Figure 54B, by comparison, shows that firefly luciferase can be observed in both cell types. Figure 54C shows that acinar cells were only most strongly stained for GFP under the SV40 promoter, while Figure 54D shows that the CMV promoter did not drive strong firefly luciferase expression / staining in the same cell types. [Figure 55] 1 shows the common bile duct being accessed by endoscopic ultrasound for the subsequent procedure, bile duct hydrodynamic injection. [Figure 56] FIG. 1 shows the common hepatic duct accessed by percutaneous needle access to the gallbladder for a subsequent procedure of biliary hydrodynamic infusion. [Figure 57] 1 shows a schematic representation of endoscopic needle access to the common hepatic duct through the stomach wall into the intrahepatic duct, followed by retrograde hydrodynamic injection with fluid injection proximal to the balloon. [Figure 58]1 shows a schematic representation of a multiple balloon administration system and endoscopic needle access to the common hepatic duct through the stomach wall into the intrahepatic duct followed by retrograde hydrodynamic injection. [Figure 59] 1 depicts a schematic diagram showing how hydrodynamic injection in the biliary tree can proceed through percutaneous ultrasound access of the intrahepatic bile ducts. A needle is advanced through the skin into these intrahepatic bile ducts, and then a catheter is advanced through the needle. A balloon is inflated within the catheter, and injection proceeds through the proximal opening of the balloon, resulting in fluid movement proceeding in a retrograde manner, as shown. [Figures 60A-60C] Diagrams of catheter placement with balloon inflation for optimal injection and sealing are shown for the liver, pancreas, and kidney, respectively. Examples of guidewires that remain in place during injection are provided for the liver (FIG. 60A), pancreas (FIG. 60B), and kidney (FIG. 60C). [Figure 61A-61B] 61A-61B show schematic diagrams of catheter placement within the ureter and renal pelvis for optimal injection and sealing. Figure 61A depicts localization of the balloon within the ureter before fanning out from the renal pelvis. Figure 61B shows that in an alternative exemplary embodiment, the balloon can be inflated within the renal pelvis itself. [Figure 62] 1 shows a schematic representation of cannulation of the ureteral orifice in the bladder with a catheter. [Figure 63] 1 shows a model of hydrodynamic fluid forces on the kidney to mediate efficient delivery of DNA to the tissue. [Figure 64A-64D]The results of ERCP experiments performed on two pigs for pancreatic gene delivery are shown. Figure 64A shows a porcine pancreas carefully dissected from other internal organs. The porcine pancreas has three distinct lobes, including the duodenal lobe, connecting lobe, and splenic lobe. All lobes contain a pancreatic duct that joins the duodenal lobe and also joins the bile duct. Figure 64B shows cannulation of the pancreatic duct orifice using a catheter. Figure 64C shows that contrast injection before hydrodynamic injection was able to visualize the pancreatic duct (left panel; arrows point to the branching toward the splenic lobe), and repeated contrast injection after hydrodynamic injection demonstrates that the ductal structure remains preserved (right panel; arrows point to the ductal branching toward the splenic lobe). Figure 64D shows that different cell types throughout the pancreas demonstrated gene delivery. Among the most prominent cell types, all pancreatic ductal epithelial cells showed consistent and strong luciferase staining, from large ducts to small ducts and branching ducts. GFP staining was prominent in pancreatic acinar cells. Luciferase staining was intense in islet cells and appeared uniform among all types of islet cells (α, β, and δ). [Figure 65]

[0033] Figure 1 shows data regarding the safety of pancreatic hydrodynamic infusion in two pigs, as assessed by chemistry values. Effect of pancreatic hydrodynamic infusion on chemistry values. Blood chemistries were collected pre-infusion, 10 minutes after pancreatic infusion, and on day 1 after infusion. Only amylase was consistently elevated in both pigs after pancreatic infusion. [Figure 66] Data on the safety of pancreatic hydrodynamic infusion in two pigs, as assessed by hematological values, are shown. The effect of pancreatic hydrodynamic infusion on hematological values. Blood was collected before infusion, 10 minutes after pancreatic infusion, and one day after infusion, and various hematological parameters were examined. No significant changes were observed. [Figures 67A-67F]This demonstrates the ability to specifically target protein expression to endothelial cells after bile duct hydrodynamic injection. Pigs were injected with the plasmid pICAM2-GFP, which has an endothelial cell-specific promoter driving the expression of green fluorescent protein (GFP). The data show immunohistochemical staining of GFP protein in pig liver tissue. Figure 67A shows endothelial cells adjacent to blood vessels that specifically stain positive for GFP expression. Figure 67B shows isolated endothelial cells that are positive for GFP among negatively stained hepatocytes. Figures 67C, 67D, and 67E show the portal triad within the pig liver, demonstrating that only endothelial cells (solid arrows) are positive for protein expression. For comparison, the bile duct (dashed arrow) is negative for any GFP expression, highlighting the specificity of cell-specific targeting. Figure 67F shows hepatocytes surrounding the central vein of the lobule, all of which are negative, reflecting the lack of observed off-target cell expression. DETAILED DESCRIPTION OF THE INVENTION

[0343] The present disclosure is based, at least in part, on the discovery of improved protocols for using hydrodynamic injection for gene therapy in large animals using naked DNA. The technology herein provides methods and systems for transfecting cells in a subject in vivo, including administering an effective amount of a nucleic acid expression cassette to the biliary tree, liver, or pancreas of the subject at high pressure. The technology herein also provides methods and systems for delivering polypeptides or vectors containing nucleic acid sequences that ameliorate or prevent kidney, liver, or pancreatic diseases or disorders. Exemplary diseases or disorders may include, but are not limited to, hemophilia A, hemophilia B, alpha-1 antitrypsin deficiency, familial hypercholesterolemia, progressive familial intrahepatic cholestasis, hereditary hemochromatosis, Wilson's disease, Crigler-Najjar syndrome, methylmalonic acidemia, phenylketonuria, and / or ornithine transcarbamylase deficiency.

[0344] We now provide methods and systems that involve delivering a polypeptide or vector comprising a nucleic acid sequence that ameliorate kidney, liver, or pancreatic disease, or other disease or disorder, such as hemophilia, to a subject having or susceptible to liver, kidney, or pancreatic disease, or other disease or disorder, such as hemophilia.

[0345] Thus, in one aspect, a method is provided for transfecting cells of a subject in vivo, the method comprising administering an effective amount of a nucleic acid expression cassette to the biliary tree, liver, or pancreas of the subject at high pressure.

[0346] In one embodiment, a method for treating or preventing kidney, liver, or pancreatic disease by gene therapy is provided. In certain embodiments, a method for treating or preventing hemophilia A, hemophilia B, alpha-1 antitrypsin deficiency, familial hypercholesterolemia, progressive familial intrahepatic cholestasis, hereditary hemochromatosis, Wilson's disease, Crigler-Najjar syndrome, methylmalonic acidemia, phenylketonuria, and / or ornithine transcarbamylase deficiency, and other diseases and disorders disclosed herein by gene therapy is provided.

[0347] More specifically, in one aspect, the present disclosure provides a method and system for treating a subject, comprising administering an effective amount of nucleic acid and / or protein solution to the subject's liver through the subject's biliary tree at high fluid pressure using a catheter, wherein the delivery portion of the catheter is advanced through the bile duct upstream of the cystic duct into the common hepatic duct. In one aspect, the catheter tip is preferably positioned in an extrahepatic position during nucleic acid delivery. In a further aspect, the catheter tip is positioned within an intrahepatic position within the liver parenchyma during nucleic acid delivery. In yet another aspect, the catheter tip is positioned within or adjacent to the liver parenchyma. In yet another aspect, the catheter is positioned so that the catheter balloon is inflated proximal or downstream of the porta hepatis within the common hepatic duct. These aspects help eliminate stress on the bile duct wall and the possibility of bile duct rupture during hydrodynamic injection.

[0348] In another preferred aspect, the present disclosure provides methods and systems for treating a subject, comprising administering to the subject an effective amount of a nucleic acid and / or protein solution at high fluid pressure to the subject's biliary tree, liver, kidney, or pancreas using a catheter, wherein the catheter balloon is deflated substantially immediately after completing administration of the dose of nucleic acid from the catheter. Preferably, balloon deflation reduces fluid pressure within the subject's biliary system, liver, kidney, or pancreas.

[0349] In yet additional preferred embodiments, the present disclosure provides methods and systems for treating a subject comprising administering to the biliary tree, liver, kidney, or pancreas of the subject a nucleic acid and / or protein solution: 1) a first fluid composition that does not contain nucleic acids or proteins, and then 2) an effective amount of the nucleic acid or protein solution. Preferably, the first fluid injection serves to remove bile from the biliary system prior to injection of the nucleic acid or protein solution.

[0350] In yet another preferred aspect, the present disclosure provides methods and systems for treating a subject, comprising administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the biliary tree, liver, kidney, or pancreas of the subject using a catheter, wherein the catheter is configured to administer the nucleic acid or protein only in a antegrade direction, rather than obliquely or perpendicularly. Preferably, the catheter is configured to administer the nucleic acid or protein only in a antegrade direction, rather than obliquely or perpendicularly, relative to the bile duct wall of the subject.

[0351] In a further aspect, the present disclosure provides methods and systems for treating a subject, comprising administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the biliary tree, liver, kidney, or pancreas of the subject using a catheter, wherein the catheter tip is at least 1 cm, or at least 4 cm, forward along the length of the catheter from the catheter balloon midpoint.

[0352] In still further aspects, the present disclosure provides methods and systems for treating a subject, the methods and systems comprising administering a radiological contrast agent through the subject's biliary tree, liver, kidney, or pancreas to verify catheter placement after balloon inflation, and then administering an effective amount of a nucleic acid and / or protein solution at high fluid pressure through the subject's biliary tree, liver, kidney, or pancreas. Preferably, the catheter location is selected and / or verified by visualization of the administered radiological contrast agent, and the radiological contrast agent is preferably administered through the subject's biliary tree to the subject's liver.

[0353] In a preferred embodiment of the above-described methods and systems, the nucleic acid and / or protein solution may be administered to the subject's liver through the subject's biliary tree.

[0354] In certain embodiments, the nucleic acid or protein can be administered using endoscopic retrograde cholangiopancreatography (ERCP).

[0355] In some embodiments, the catheter may be selectively advanced into the subject's right hepatic bile duct, whereby the nucleic acid is administered into the right hepatic lobe.

[0356] In some embodiments, the catheter may be selectively advanced into the left hepatic bile duct, whereby the nucleic acid is administered into the left hepatic lobe.

[0357] In certain embodiments, the imaging composition may be administered at a slower flow rate than the nucleic acid solution is administered. A variety of nucleic acids may be administered to a subject, including one or more of DNA, mRNA, siRNA, miRNA, lncRNA, tRNA, circular RNA, or antisense oligonucleotides.

[0358] In certain embodiments, the amount of nucleic acid or protein administered to a subject can be selected based on the subject's liver weight.In particular, DNA can be administered in an amount of at least 1 mg DNA per kilogram of the subject's total liver tissue weight.RNA can also be administered in an amount of at least 1 mg RNA per kilogram of the subject's total liver tissue weight.One or more proteins can preferably be administered in an amount of at least 100 μg protein per kilogram of the subject's total liver weight.

[0359] In further systems, the nucleic acid may be administered as a large volume fluid composition, such as a total volume of 30 mL or more per kilogram of total liver tissue weight of the subject, or a total volume of 40, 50, 60, 70, 80, 90, 100 mL or more per kilogram of total liver tissue weight of the subject.

[0360] In certain systems, one or more DNA or RNA molecules can be combined in the same nucleic acid solution and injected simultaneously.

[0361] In certain embodiments, the flow rate of the composition administered can be independent of the subject's liver mass, hi further embodiments, the volume of the composition administered can be correlated to the subject's liver weight.

[0362] In some embodiments, it may be administered as a fluid composition at an infusion rate of greater than 2 mL / sec without causing bile duct rupture, or at higher flow rates, such as 5 mL / sec or 10 mL / sec or more, without causing bile duct rupture.

[0363] In some systems, hydrodynamic infusion of the administered composition produces a rapid increase in pressure that reaches a plateau, which immediately subsides upon cessation of infusion.

[0364] Exemplary plateau pressures can include, for example, about 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mmHg or greater. The pressure plateau can also serve as a type of diagnostic for successful administration, such as when administration (infusion) is unsuccessful, such as by not creating a substantially closed system for administration, particularly when the expected pressure curve is not achieved due to a balloon seal failure or other cause.

[0365] In a related aspect, pressure tracking can be used to assess the effectiveness of a catheter balloon seal during administration in preventing or substantially inhibiting unwanted backflow.

[0366] For certain applications, it may be preferable to administer a composition that does not contain a therapeutic agent (nucleic acid or protein). Preferably, the first non-nucleic acid composition is administered before administering the nucleic acid or protein. The first non-nucleic acid composition can be administered in various amounts and flow rates. In a preferred embodiment, the non-nucleic acid composition is administered in an amount approximately equal to the subject's natural bile volume. In a further embodiment, the non-nucleic acid composition can be administered in a volume greater than 20 mL prior to nucleic acid / protein injection to remove bile substances. One suitable flow rate for the non-nucleic acid composition is 1 mL / second or less. One preferred non-nucleic acid composition comprises one or more of saline, 5% dextrose in water, lactated Ringer's solution, and phosphate buffer.

[0367] Preferably, the nucleic acid or protein therapeutic is delivered to a substantially closed system, or a sealed or substantially sealed system, preferably where injection (e.g., of a therapeutic fluid composition) proceeds in a retrograde direction relative to normal fluid flow. For example, a subject's blood vessels or organs, optionally in conjunction with a medical device or tool, can be utilized to provide a sealed tube or vasculature where retrograde flow creates elevated pressure of the administered composition comprising the nucleic acid expression cassette.

[0368] In certain embodiments, nucleic acid molecules can be used in nucleic acid expression cassettes with their native promoters and with other promoters.For example, if the target of administration is the liver cells of a subject, a liver-specific promoter can be used if desired to increase liver specificity and / or avoid the leakage of expression in other tissues.The liver-specific promoter may or may not be a hepatocyte-specific promoter.Regulatory sequences can also be used in nucleic acid expression cassettes.

[0369] According to certain embodiments, an expression cassette may contain only one regulatory element. According to another specific embodiment, two or more regulatory elements are included in a nucleic acid expression cassette, i.e., they are modularly combined to enhance the regulatory (and / or enhancing) effect. According to further specific embodiments, two or more copies of the same regulatory element may be used in a nucleic acid expression cassette. For example, two, three, four, or five or more copies of a regulatory element may be provided as tandem repeats. According to another further specific embodiment, the two or more regulatory elements included in a nucleic acid expression cassette comprise at least two different regulatory elements. In certain embodiments, it is envisioned that the length of all regulatory elements in a nucleic acid expression cassette does not exceed 1,000 nucleotides.

[0370] A transgene can be homologous or heterologous to the promoter (and / or the animal, particularly a mammal, into which it is introduced, if the nucleic acid expression cassette is used in gene therapy). Furthermore, a transgene can be a full-length cDNA or genomic DNA sequence, or any fragment, subunit, or mutant thereof that has at least some biological activity. In particular, a transgene can be a minigene, i.e., a gene sequence lacking some, most, or all of its intron sequences. Thus, a transgene can optionally include intron sequences. In some cases, a transgene can be a hybrid nucleic acid sequence, i.e., constructed from homologous and / or heterologous cDNA and / or genomic DNA fragments. A transgene can also optionally be a variant of one or more naturally occurring cDNA and / or genomic sequences.

[0371] In certain aspects, the nucleic acid expression cassette does not contain a transgene, but rather uses regulatory element(s) operably linked to a promoter to drive expression of an endogenous gene (and thus is equivalent to a transgene in terms of enhanced and / or tissue-specific expression). The nucleic acid expression cassette may be integrated into the cell's genome or remain episomal. Other sequences may also be incorporated into the nucleic acid expression cassette (e.g., introns and / or polyadenylation sequences), typically to further increase or stabilize expression of the transgene product. Any intron may be utilized in the expression cassettes described herein. The term "intron" encompasses any portion of a full intron that is large enough to be recognized and spliced ​​by the nuclear splicing machinery. Typically, short functional intron sequences are preferred to keep the size of the expression cassette as small as possible to facilitate construction and manipulation of the expression cassette. In some embodiments, the intron is obtained from a gene encoding the protein encoded by the coding sequence in the expression cassette. The intron may be located 5' to the coding sequence, 3' to the coding sequence, or within the coding sequence. An advantage of placing an intron 5' to the coding sequence is that it minimizes the chance that the intron will interfere with the function of the polyadenylation signal.

[0372] Importantly, the technology herein provides systems and methods for avoiding common hepatic duct rupture, thereby enabling increased volume and flow levels to be achieved. This includes methods for optimal catheter placement to avoid common hepatic duct wall rupture and methods for modifying catheters to facilitate infusion flow for the same purpose. In a further aspect, new acceptable levels of volume and flow that can be infused during bile duct procedures are disclosed herein.

[0373] Furthermore, the present technology has unexpectedly discovered that the flow rate of the administered composition can be a key determinant of intrabiliary pressure during biliary hydrodynamic infusion, meaning that flow rate and pressure are primarily maintained for biliary hydrodynamic infusion in neonatal, adolescent, and adult patients. The present methods and systems can also avoid waste of DNA solution during administration, including pre-loading of the DNA solution in the catheter circuit and / or liver, as well as methods of expelling the DNA solution with a second, non-DNA solution, including, in certain embodiments, mediated via a double-barrel application device such as a power injector.

[0374] The present method and system can also distinguish between specific flow rates that may mediate liver injury versus conditions that do not, as determined by serum liver enzyme levels and tissue histology. Different flow rates can also be used to specifically target hepatocytes within different regions of the liver.

[0375] As disclosed herein, biliary hydrodynamic gene therapy represents a novel, non-viral method for directly delivering proteins and / or nucleic acids into hepatocytes in the liver.As further discussed below, the technology herein also provides methods and systems for delivering proteins and / or nucleic acids to pancreatic and kidney cells.It is contemplated within the scope of the present disclosure that a wide variety of nucleic acids, including DNA and other forms of nucleic acids, including mRNA, miRNA, siRNA, long non-coding RNA, or ribozymes, can be delivered according to this method and system.In addition, recombinant proteins can be delivered into hepatocytes by this method and system.

[0376] DNA solution The appropriate procedure can begin with the preparation of a nucleic acid solution for injection. Injecting a combination of nucleic acids is readily contemplated. In a preferred embodiment, the nucleic acid to be injected is a DNA solution. The DNA solution is injected into the biliary system and then enters the bloodstream. To avoid physiological disruption, the ideal solution should maintain a concentration close to normal physiological molarity. Examples of optimal solutions include 0.9% normal saline, 5% dextrose in water, lactated Ringer's solution, and phosphate buffer. In an alternative embodiment, hyperosmotic solutions can be utilized, but care should be taken to limit the total volume infused into the patient and their circulatory system to avoid disruption of physiological function. Hyperosmotic solutions function by increasing the size of pores formed in the hepatocyte membrane. An important consideration in preparing the DNA solution is its sterile preparation. This involves thorough mixing of the DNA with the injected solution volume and is optimally prepared in a biosafety cabinet to prevent contamination. In other preferred embodiments, the DNA solution is prepared off-site in a central manufacturing facility and pre-packaged into a cartridge that can be fitted into the power injector for use.

[0377] DNA content One important consideration in this procedure is determining the optimal amount of DNA to be injected. In one particular embodiment, constructs under the control of an optimized liver-specific promoter were found to exhibit transfection rates of up to 35% when the DNA solution was preloaded into the catheter and injected at a volume of 30 mL and a secondary flow rate of 2 mL / sec. Surprisingly, when the DNA mass was increased to 5.5 mg DNA, the transfection efficiency increased by more than 50%. This result was unexpected, given that there is only limited correlation between increasing DNA doses in hydrodynamic tail vein injections in mice and the final transfection efficiency in the liver. Without being bound by theory, this aspect may be useful for optimizing the DNA dose of therapeutic nucleic acids used to treat specific liver disorders, where each liver disorder requires a different complement percentage of hepatocytes to mediate treatment. In preferred embodiments, the DNA mass injected is a minimum of 3 mg per kilogram of liver weight, in other embodiments 5 mg, and in still other embodiments, more than 10 mg. Different liver sizes may require different DNA doses depending on the target liver weight. All DNA was prepared in endotoxin-free quality to avoid immune activation and / or death of transfected cells.

[0378] DNA solution volume The next aspect of the biliary hydrodynamic procedure is determining the volume of the DNA solution to be prepared. Volume is an important parameter to consider due to both the physiological stress exerted on the relevant organs of interest and, equally important, the mechanical stress exerted on the tubing within the catheter circuit (e.g., the endoscopic catheter within the power injector tubing). Using a larger volume implies a longer injection time, which increases both mechanical and physiological stress. Furthermore, a smaller volume is preferred because a larger volume will ultimately be released into the patient's circulatory system, thus reducing the impact of the excess volume on cardiac and renal function. This disclosure demonstrates that a minimum preferred volume may be 30 mL, which corresponds to the approximate volume of the biliary system in an adult human liver. Thus, an injection of 30 mL results in the expulsion of the entire bile volume, increasing pressure within the system. The results herein demonstrate that much higher volumes can be tolerated for injection without significant stress on the biliary system or liver function, or physiological perturbations to heart rate or echocardiograms. Pigs tolerated the injection well when a volume of 140 mL was injected at 1 mL / s, or when no significant liver enzyme abnormalities were observed. Notably, this volume is close to the maximum barrel volume (150 mL) of the specific power injector tested, so larger injection volumes are possible. Depending on the power injector source, higher volumes can be imagined. The optimal DNA solution volume is significantly less than this, between 30 mL and 60 mL in adults, which corresponds to up to twice the volume of bile. Of note, the DNA solution volume can be increased to account for any DNA solution that may remain within the catheter and power injector circuit. This effectively reduces the fraction of DNA left inside the catheter tubing after the injection is completed. Alternatively, dead space issues can be mitigated, as further discussed below.

[0379] Endoscopic retrograde cholangiopancreatography Patients should be prepared for the gene therapy procedure under standard endoscopic retrograde cholangiopancreatography (ERCP) procedural guidelines. This includes an overnight no-consumption (NPO) to clear the stomach and intestinal system of any food to allow for maximum visualization for endoscopy. Prior to the procedure, the patient is prepared under anesthesia according to standard surgical practice. At the beginning of the procedure, the endoscope is advanced through the oropharynx into the esophagus, then into the stomach, and into the small intestine, eventually seating it in the small intestine facing the biliary ostium. A catheter is advanced through the endoscope, and an attempt is made to cannulate the ampulla of Vater. After successful cannulation, the catheter is advanced through the common bile duct, passing through the cystic duct and entering the common hepatic duct. A balloon positioned near the distal tip of the catheter is inflated at this point. The balloon closes against or within the porta hepatis. The provider may feel resistance to balloon inflation and catheter movement, which helps verify correct catheter placement. This positioning is verified with fluoroscopy, where the balloon is radiopaque to determine its position. At this point in the gene therapy procedure, a small volume of radiopaque contrast solution, typically 5–10 mL, is administered through one of the catheter's ports, followed by fluoroscopic imaging to confirm that the contrast solution is within the bile duct. Preferably, both the left and right branches of the bile duct are confirmed to be present and contain contrast. While the endoscopist may be concerned about advancing the catheter toward one branch or the other, successful inflation of the balloon prevents the catheter from advancing too deeply into the liver parenchyma. In certain embodiments, the catheter may be advanced further into the liver to access the right or left hepatic bile duct, respectively, for targeted injection of the right and left hepatic lobes.

[0380] Endoscopic ultrasound needle treatment As an alternative to the ERCP procedure described above, alternative methods of placing a catheter into the common hepatic duct can be implemented. The purpose of these alternative methods is to access the common hepatic duct through a different route to eliminate the possibility of post-ERCP pancreatitis. During ERCP, the catheter temporarily occludes the pancreatic duct system, leading to the possibility of pancreatitis in a small percentage of patients. If the catheter can be introduced into the common hepatic duct by a different means, pancreatic duct occlusion will not occur, resulting in a safer procedure for the patient. Furthermore, these alternative routes are particularly beneficial when many repeat procedures may occur in a given patient over time.

[0381] In one alternative embodiment of the present disclosure, catheter insertion occurs via an endoscopic procedure, in which ultrasound is used to place a needle in the wall of the stomach or small intestine, thereby directly contacting the bile duct. After the needle is threaded through the wall, a guidewire is inserted, and the catheter can then be finally exchanged over the guidewire, over which the catheter itself can fit through the opening. In some instances, the common hepatic duct or common bile duct itself can be directly accessed, allowing the remainder of the procedure to be performed in a manner very similar to ERCP. In other instances, the gallbladder can be directly accessed, and then a catheter is advanced from the gallbladder into the common hepatic duct. In other instances, the bile duct within the liver parenchyma is accessed as the catheter is advanced antegrade toward the common hepatic duct.

[0382] In these methods, once the bile duct is positioned in the common hepatic duct, the procedure can be performed largely according to the same specifications described elsewhere in the patent, including precise placement of the catheter within the common hepatic duct. One modification is that if an upstream branch of the bile duct system is first accessed with ultrasound, the catheter itself must have an opening proximal to the balloon so that the infusion proceeds proximally. A second balloon is included within the catheter to block this opening to prevent solution leakage through the hole inserted into the intestinal wall.

[0383] Percutaneous procedures In a second alternative to the ERCP procedure, which effectively eliminates the possibility of pancreatitis from the gene delivery procedure, a percutaneous procedure can be performed to deliver a catheter to the common hepatic duct, with all subsequent steps of the gene delivery procedure being substantially similar to those described elsewhere in this patent application. In this alternative, ultrasound or another imaging modality is used to identify the location of the gallbladder or bile duct within the liver below the surface of the skin. Once these structures are identified, a needle is placed through the skin into the gallbladder or bile duct.

[0384] A guidewire can be placed through the needle and then eventually exchanged for a catheter that can be inserted into this space. In instances where the gallbladder is first contacted, the catheter can be advanced from the gallbladder through the cystic duct and into the common hepatic duct. After this, all steps of the infusion are performed similarly to the other locations in the pattern. In versions where an upstream bile duct is identified within the liver, the catheter is advanced through the skin into this upstream bile duct, and then into the common hepatic duct in an antegrade fashion with natural bile flow. As mentioned in the previous section, in this version of the procedure, the catheter is modified to accommodate an infusion opening proximal to the user under the balloon, so that all infusions proceed proximally to the catheter but still anatomically proceed retrogradely relative to the remainder of the liver. Similar to endoscopic procedures, percutaneous procedures preferably have a balloon inflated around the needle insertion site through the skin into the organ outside the skin, or more preferably at the contact point within the bile duct or gallbladder. This helps eliminate the possibility of fluid leakage during hydrodynamic infusion through these entry points.

[0385] Catheter placement The present methods and systems also include catheter placement. Conventional approaches have resulted in rupture of the common hepatic duct (CHD) at high flow rates and / or injected volumes. 41In certain aspects, delivery of the administered composition (e.g., by injection) occurs within the liver parenchyma to enhance fluid wall stress and thus prevent or otherwise minimize the occurrence of any rupture of the biliary tree. In some embodiments, the catheter is placed within the intrahepatic common hepatic duct, such that the balloon is inflated within the intrahepatic common hepatic duct. In other embodiments, extrahepatic balloon placement results in placement of the catheter tip within the liver parenchyma. In a preferred aspect, the catheter extends at least 1, 2, or 3 centimeters beyond the inflation balloon to ensure placement within the liver parenchyma; for example, in this placement, the catheter is placed in the extrahepatic common hepatic duct. As discussed above, the liver parenchyma should reinforce the bile duct and prevent bile duct rupture. In another aspect, the catheter tip is placed just upstream of the inflation balloon to minimize preferential entry of injected plasmid DNA into the left or right hepatic duct. If the inflation balloon is placed within the left or right hepatic duct, having an opening for fluid injection can maximize the amount of liver parenchyma exposed to the plasmid.

[0386] In a further aspect, catheter systems are provided in which one or more catheter channels face forward to maximize forward fluid flow and, more preferably, to avoid lateral drainage or delivery of fluid that would otherwise impose significant wall stress on the bile duct. In these preferred systems, the forward-facing catheter channels deliver the administered composition in a forward direction, thereby reducing stress on the duct wall.

[0387] Excretion of bile from the biliary system In a preferred embodiment of the present disclosure, fluids not containing nucleic acid solution are injected through the catheter to remove any remaining contrast agent solution in the bile duct. Similarly, fluids are also injected at this point to remove bile itself from the biliary system; otherwise, bile may contain nucleases that could bind to DNA and inhibit delivery, or result in toxicity when introduced into the hepatocyte cytoplasm, or may degrade DNA during injection, or may contain antibodies or cytokines that cause inflammation or toxicity within hepatocytes. The total volume of fluid injected to clear the biliary system is optimally equal to the total volume of the biliary system in an average adult human liver (30 mL, adjusting the level depending on the patient's size) plus an additional volume from the dead space in the catheter circuit, which can be 5–10 mL depending on the catheter brand and available tubing. These fluid injections can be performed by hand syringe at a low manual flow rate of approximately 1 mL per second or less, or alternatively, can be delivered by the power injector itself. In some embodiments, fluids not containing DNA solution will be delivered from the second barrel of a double-barrel power injector.

[0388] Verifying power injector function and balloon seal after deployment While contrast injection can confirm proper balloon placement during fluoroscopy, in a preferred embodiment, a step is performed to confirm that the balloon successfully seals the common hepatic duct during hydrodynamic injection. During this step, a short burst of non-DNA solution can be injected, such as using a power injector, to mediate hydrodynamic forces within the bile duct. Simultaneously, a pressure catheter inserted into the common hepatic duct can monitor the pressure achieved during this test injection. A substantially complete balloon seal should produce a plateau peak in pressure during the injection, while any leaks should result in a rapid drop in pressure and an irregular pressure curve. This step also importantly confirms the intended power injector settings and their ability to mediate a successful injection. Different brands of power injectors can be utilized for bile duct hydrodynamic injection procedures, and being able to confirm that a given flow rate mediates the intended peak pressure is important for the integrity of subsequent DNA delivery. If pressurization is not achieved during this step, the flow rate can be increased as necessary to achieve the intended pressurization target for the procedure. In a preferred embodiment of the present disclosure, the non-DNA solution achieved is a volume of 10 mL or less per kilogram of liver weight.

[0389] Preloading of DNA solution After draining the contrast agent solution from the biliary system, the procedure can proceed to loading the nucleic acid solution. In a preferred embodiment, a DNA (or other nucleic acid) solution is primed into the tubing of the endoscope catheter and power injector to ensure that the initial solution injected by hydrodynamic forces contains DNA. In other embodiments, the DNA solution can be pre-injected into the liver and biliary system itself, but care should be taken to ensure that the hydrodynamic injection proceeds rapidly thereafter to avoid any degradation or nonspecific binding of the DNA to the surfaces of the cholangiocytes and hepatocytes lining the bile ducts. In yet another alternative embodiment of the procedure, the tubing itself can still be primed with normal saline (or other physiological, non-DNA solution) to mediate some of the aforementioned drainage functions before the DNA in the power injector cartridge is pushed into the system for pre-loading prior to injection.

[0390] After the catheter system and infusion tubing are primed, the DNA solution can be loaded into the power injector. To load the power injector with the DNA itself, the DNA-containing solution may be loaded into an empty cartridge using a suction system within the power injector device. In other embodiments, for ease of use and to maintain sterility, a pre-filled cartridge with the DNA solution that can be fitted into the power injector will be provided prior to the procedure.

[0391] Programming the Power Injector The power injector can then be programmed for delivery of the DNA solution. Power injectors are commonly used in medical settings to inject radiocontrast agents into blood vessels to identify potential blockages or bleeding sources. Power injectors act rapidly at high flow rates and volumes to counter the normal flow and pressure of the cardiovascular system. However, the term power injector is a general term that describes a variety of different fluid delivery devices and should be considered any general system capable of applying force to a volume of liquid at high pressure to achieve a desired flow rate.

[0392] In the present method and system, the power injector can be programmed with many different potential settings. In a preferred embodiment, the power injector provides a flow rate of 2 mL / sec or greater. While prior literature has established 2 mL / sec as the maximum tolerated dose, the results herein unexpectedly found that higher flow rates can be achieved without additional toxicity or novel histological findings. The results herein found that flow rates of up to or equal to 5 mL / sec can be infused into pigs without elevation of liver enzymes after infusion. Higher flow rates, up to 10 mL / sec, have also been described, resulting in only a mild elevation of liver enzyme levels.

[0393] Catheter design and setup In at least certain methods and systems, the choice of endoscopic catheter can significantly affect the outcome of a gene delivery / therapeutic procedure. Specifically, the diameter of the channel through which the hydrodynamic solution is forced can have a significant impact on the tolerance of hydrodynamic infusion in the circuit. In a preferred embodiment, using a biliary catheter with a smaller channel size, the same programmed flow rate results in a higher flow rate inside the catheter, and a higher injector automatically reduces pressure to prevent rupture or cracking of the tubing circuit. Increasing this pressure threshold has been found to cause the catheter to break or crack at these same flow rates. In preferred embodiments, to handle these higher flow rates and pressures, a catheter with higher tensile strength in the wall is utilized, preferably one that remains flexible enough to pass through an endoscope and into the biliary system.

[0394] Alternatively, the inner diameter of the catheter channel can be as large as possible to reduce the pressure on the catheter wall at a given flow rate. This ensures that a high flow rate can be achieved that can still be delivered into the bile duct. This aspect was demonstrated during testing with porcine subjects, where larger catheter channel sizes were employed to achieve higher pressures without causing pressure alarms within the catheter system.

[0395] In a preferred embodiment, the pressure catheter is inserted through one of the ports of a catheter (e.g., an endoscopic catheter) and extends into the biliary system. Pressure catheters are already available for many endovascular procedures today. This step is performed before the injection of DNA (or other nucleic acids), ideally before the injection of the non-DNA solution. The other port(s) on the catheter in this situation serve as ports for the injection of the DNA solution and clearance or chaser solution. In some embodiments, a short burst of fluid at the intended flow rate for the procedure can be performed using a non-DNA-containing solution to check the function of the power injector before using DNA injection in a patient. The pressure catheter is optimally inserted at least 0.5-1 cm beyond the distal tip of the endoscopic catheter, ensuring its position within the hepatic bile duct to reflect the pressure within that circuit. In a preferred embodiment, the pressure catheter should have a dynamic range between 0 and 400 mmHg for detection of potential pressure waves employed during the procedure. In preferred embodiments, the pressure catheter is connected to a computer, mobile device, or tablet capable of recording pressure waves in real time to monitor the correct function of the injection. For an injection to perform as expected, a constant pressure should produce a flat plateau peak of flow rate that drops off sharply when injection is stopped. Evidence that this flat plateau peak is not maintained would suggest a ruptured balloon seal or a malfunctioning power injector. In other embodiments, the pressure catheter is connected to a computer that interprets the raw flow rate readings, and the computer may be connected to the power injector itself to provide feedback on the need to modify the injected pressure. In some embodiments of the present disclosure, the power injector will already be inside the biliary catheter, so that it is not inserted through one of the channels, since it is already located within the biliary catheter.

[0396] In certain embodiments of the catheter and treatment method, the guidewire used to facilitate catheter localization can be retained during the infusion itself. In most of the aforementioned embodiments, the guidewire is removed when the catheter is replaced. However, if the guidewire is not kept in sync, it can be difficult to assess the precise location of the catheter. Furthermore, if a specific branch of the biliary tree is targeted, this can be difficult to identify based on visualization of the catheter alone. Therefore, in some embodiments, the guidewire can be left in place during the infusion, and the DNA solution is injected through an infusion port or lumen. Retaining the guidewire is also useful in tracking whether the catheter moves during the infusion and how deep the catheter is inserted.

[0397] Guidewires can also be applied to pancreatic and renal infusions. For the pancreas, a guidewire is held in place during the infusion and used to help gauge the depth of insertion during catheter infusion and balloon inflation, helping to facilitate specific targeting of the caudal end of the pancreas. Similarly, a guidewire in renal infusion can be used to identify the ends of the ureter and pelvis, assuming the balloon is properly positioned and not floating freely within the renal pelvis, but more securely positioned within the ureter. The catheter tip can also be determined relative to the guidewire within the renal pelvis, thus ensuring that it is squarely within the renal pelvic area.

[0398] Flow rate and volume settings for injection There are two primary variables in hydrodynamic infusion. These variables include the volume of infusion and the flow rate. The importance of these variables for biliary hydrodynamic infusion has not been identified in previously published literature, and it is unclear which variables need to be maximized and how these variables relate to the pressure achieved. The present invention discovers and discloses that the key variable for delivering pressure is flow rate.

[0399] Experiments in which the flow rate was increased while the volume was kept constant resulted in a significant increase in pressure. Unexpectedly, experiments in which the volume was greatly increased while the flow rate was kept constant did not result in a significant increase in pressure. Across all experiments, the pressure within the biliary tree correlated well with the flow rate programmed into the machine. Thus, in a preferred embodiment of the present disclosure, flow rate is the primary parameter identified to govern pressure for optimizing gene delivery through the membrane pores of hepatocytes.

[0400] Considering the selection of the flow rate programmed into the power injector, this disclosure also describes metrics that can govern the procedure to select an appropriate flow rate. These are selected depending on the potential goals of gene therapy, including duration. Aside from gene delivery, a major consequence of hydrodynamic procedures is the level of tissue damage associated with gene therapy. This tissue damage revolves around the diluted cytoplasm caused by fluid rushing into cells through membrane pores and the vesicles that appear within the cell cytoplasm caused by fluid blocking portions of the cell membrane. Suboptimal hydrodynamic injection can cause the death of a small percentage of hepatocytes from the injection. In fact, hydrodynamic tail vein injection in mice results in the death of a small but significant portion of mouse hepatocytes from the procedure, but the majority of hepatocytes recover and normal histology is quickly reestablished. While hydrodynamic injection procedures in mice have been rigorously optimized in numerous studies, the porcine bile duct hydrodynamic procedure has only been described in one study, and no optimization studies of the injection and resulting tissue injury have been performed to date.

[0401] Tissue damage is an important consideration for hydrodynamic injection. In one aspect, tissue damage must be tolerable and safe for the patient, especially if the patient has liver disease or lower than normal liver function. A second consideration is that any liver cell death or damage may result in inflammation and an immune response, which may stimulate an adaptive immune response that eliminates cells expressing the transgene (i.e., perhaps through direct recognition of the transgene as a foreign protein). This is clearly not the desired outcome for human gene transfection from this procedure. On the other hand, the magnitude of liver injury in mouse models correlates with gene transfection efficiency. Therefore, liver enzymes may be useful biomarkers for confirming whether effective pressure is being achieved by hydrodynamic injection. Clearly, both of these outcomes may be desirable in different gene therapy settings and are therefore important aspects of the present disclosure. Toward the goal of infusing fluid into patients without causing any liver injury, flow rates up to 5 mL / s do not sufficiently result in elevation of ALT or AST, and achieve only dilution of cytoplasm on histology, but not large intracellular vesicle formation. To optimize pressure and flow rate, flow rates of 5-10 mL / sec or higher can be tolerated by pigs, resulting in extensive formation of large intracellular vesicles in hepatocytes histologically and a relatively mild rise in AST (AST) levels in the 200 U / L range immediately after the procedure. Considering that differences in catheter inner diameter may slightly affect tissue damage from programmed flow rates during treatment, this disclosure describes a process for screening these settings in a pig model to control ALT and AST elevations in human patients.

[0402] In certain embodiments, only one flow rate is applied for the injection, and the flow rate remains constant for the DNA solution throughout the entire injection. In other embodiments of the present disclosure, higher flow rates are utilized for smaller portions of the injection and / or are varied throughout the entire injection. In one example, 50 mL of DNA solution can be initially injected at a flow rate of 5 mL / sec for 4 seconds, after which the power injector can be switched to 10 mL / sec for 3 seconds, and then switched to 5 mL / sec for the remaining 2 seconds to complete the entire volume injected. In this manner, the DNA solution can be rapidly injected into the biliary system, and then short periods of high flow rates can be used to enhance gene delivery without prolonging the period to avoid significant tissue damage and toxicity. Furthermore, the results herein revealed that catheter rupture typically occurs later in the injection, suggesting that longer periods at higher flow rates result in greater forces against the catheter wall. This can be improved by sustaining higher flow rates for shorter intervals. Potentially, there are many different combinations of flow rates to be investigated, and the descriptions in this disclosure are not intended to be limited to any one design.

[0403] The results herein also found that flow rate can be important in determining which hepatocytes are preferentially transfected during the procedure. The results herein demonstrated that modifying the flow rate by increasing it to 4 mL / sec or higher preferentially transfects the area surrounding the portal triad, as well as large blood vessels within the liver parenchyma. This finding was entirely unexpected. Without being bound by theory, it is believed that this effect is related to increased bile pressure during infusion, causing the fluid to exit these spaces early before extending deep into the canaliculi. Interestingly, this transfection pattern was opposite to other experiments using a lower transfection rate of 2 mL / sec, in which transfection was optimally observed around the central vein in the center of the liver lobule. For these experiments, the area surrounding the portal triad had some positive staining, but it was relatively much less than that seen at higher flow rates. This finding is particularly important in light of the fact that certain diseases, including urea cycle disorders, are preferentially treated in zone 1 of the liver lobule and are therefore better targeted using higher flow rates. In contrast, treatment of acute hepatotoxin injury typically occurs around zone 3, which metabolizes acetaminophen, for example. In this case, the hydrodynamic procedure can be modified to target these hepatocytes with a lower flow rate. In other preferred embodiments, it may be desirable to optimize hepatocyte transfection across as many total hepatocytes as possible. In these embodiments, it may be desirable to vary the flow rate at which the procedure is performed, using high and low flow rates during the procedure to ultimately result in a uniform distribution of transfected hepatocytes. This strategy can be incorporated into more complex flow patterns that also take into account potential hepatotoxicity from the infusion.

[0404] Minimizing DNA loss from this procedure Following injection of a DNA solution by a power injector at a selected programmed flow rate, there is an inherent problem of some DNA solution remaining in the catheter and power circuit tubing. Depending on the system and the power injector and catheter employed, this can equate to a volume of 5–10 mL. At lower total volumes of DNA solution injected, this can amount to a significant loss of total DNA, approaching 10–20% of the DNA to be injected. This disclosure describes several solutions to this problem. In one embodiment of the present disclosure, the volume of DNA solution injected is increased to result in a less proportional loss of total DNA solution. The drawback of this approach is that the volume and flow rate experienced by the patient are altered and therefore may not be optimal for the desired transfection effect or pressure and / or level of tissue damage. In a second embodiment of the present disclosure, this problem can be solved by mixing the DNA solution with a second solution having a lower density so that the solution floats on its surface. During injection through a single-barrel power injector, the DNA solution is pushed through the circuit, completely entering the liver well; the lower-density liquid is also expelled, but remains in the tubing circuit and does not enter the patient. The volume of this second solution is equal to the dead space volume of the catheter and power injector circuit. A drawback of this approach is the use of a second exogenous fluid that is mixed with the DNA solution, which can have negative effects on the DNA solution, including binding some of the DNA molecules.

[0405] In a preferred embodiment, a double-barrel power injector is utilized to overcome the problem of dead space remaining after injection. In this scheme, one barrel of the power injector contains saline, dextrose, lactated Ringer's solution, or other physiological solution that does not contain DNA. This solution can be used initially for the aforementioned priming and / or draining / cleaning of the catheter and biliary system. In situations where the problem of residual DNA solution in the circuit is resolved, this second barrel is connected to the first barrel containing DNA at a proximal position in the circuit, so that this second barrel can be actuated to push the residual DNA solution in the circuit into the patient's liver.

[0406] In a preferred embodiment, the flow rate of the second barrel containing saline is equal to or greater than the final pressure of the DNA solution chamber to maintain a similar flow rate for gene delivery. In other embodiments, the minimum volume injected from the second barrel will be equal to the volume of the tubing circuit and catheter. In other preferred embodiments, the maximum volume injected by saline will be equal to the volume of the catheter and tubing circuit plus the calculated volume of the biliary system within the patient's liver. In this way, the present disclosure effectively displaces the injected DNA solution with a second, non-DNA-containing solution, ensuring maximum delivery of DNA to the patient's liver cells. In certain embodiments of the present disclosure, the second solution has the same composition as the DNA solution, except that it does not contain DNA.

[0407] Post-infusion monitoring This disclosure also describes several post-injection steps to ensure successful injection and safety. In one embodiment of the disclosure, intrabiliary pressure tracing is reviewed during injection. Pressure tracing is a key element to verify that the procedure worked, that the balloon seal was secure without loss of pressure due to reflux, and that the intended pressure was achieved with the power injector achieving the desired performance.

[0408] Furthermore, different patients may have subtle differences in liver physiology and anatomy, so a given flow rate for one patient may not achieve the desired blood pressure. In certain embodiments, the inability of the power injector to achieve the desired pressure may lead the physician to repeat the procedure on the same day. Therefore, the live pressure tracing in this disclosure serves as quality assurance for this process and educates the endoscopist when repeat injections are necessary.

[0409] The second step after injection is to deflate and open the balloon, allowing fluid to drain from the biliary tree. The test demonstrated that, unlike previous publications in the prior art, the balloon does not need to be open for an extended period of time, given that the pressure generated by the balloon opening alone would be too low to mediate transfection. Therefore, the balloon can be closed almost immediately after injection.

[0410] After releasing the fluid from the balloon, the balloon can be reinflated, and a small amount of radiocontrast can be injected into the biliary system to confirm that no bile duct rupture has occurred. In certain embodiments, this step can be optional, given that a successful initial setup almost eliminates the chance of any bile duct rupture. After checking the integrity of the bile duct structure, the catheter can be removed from the bile duct and withdrawn back into the endoscope and duodenum. In some embodiments of the present disclosure, the patient then undergoes a blood draw within 15 minutes of hydrodynamic injection to monitor tissue damage from the procedure. Ideally, this is done in a rapid point-of-care assay to inform the endoscopist if a repeat procedure is required for the patient that same day.

[0411] The biliary hydrodynamic injection procedure can be repeated. Beyond describing a single bile duct hydrodynamic procedure, another important embodiment of the present disclosure relates to the ability to repeat injections on a single procedure day to compensate for potential errors from the injection or as a way to increase transfection efficiency. Another important embodiment of the present disclosure is the possibility of repeating bile duct hydrodynamic injections on separate treatment days to re-administer gene therapy. It is unclear from prior literature whether the biliary system and liver can manage the trauma of multiple injections, either on the same day or on separate days. Furthermore, concerns about bile duct dilation after hydrodynamic injection have been published, which could lead to concerns about permanent liver damage or reduced efficacy during re-administration. Toward the goal of answering these questions, the present disclosure demonstrates for the first time the feasibility of repeat injections. In the first goal of determining same-day repeat injections, preferred embodiments of the present disclosure demonstrate that repeat injections are well tolerated with minimal impact on vital signs. There are no clear limitations on the volume and / or flow rate nature of the injections during these repeated injections. In some embodiments, the user may wait at least one minute or at least five minutes between injections to ensure that vital signs return to baseline and that the patient's cardiovascular system can recalibrate to handle the excess volume injected.

[0412] In another aspect, biliary hydrodynamic infusions can be safely repeated within three weeks of each other. Data are presented here demonstrating that normalization of hematological and liver chemistry profiles occurs after the first infusion, allowing patients to resemble previously uninfused humans. A second infusion can proceed without any adverse events or increased levels of liver damage, indicating that the previous infusion does not sensitize patients to larger increases in liver enzymes with repeated infusions on separate days. This was not evident prior to previous studies testing this in pigs. In preferred embodiments of the present disclosure, the infusion can be repeated a minimum of two weeks after the first infusion, with no upper limit on the time course for repeating the second infusion over an extended period. In other embodiments, further infusions over several months to several years are possible. For example, depending on the disease being treated, infusions may be repeated several years in the future to remedy a monogenic disease with reduced gene expression levels. Preferred embodiments of the present disclosure require monitoring of liver enzymes and vital signs prior to any second infusion to verify that they are within normal ranges before proceeding with this second infusion.

[0413] Alternative methods for biliary hydrodynamic infusion monitoring In certain embodiments, additional methods besides pressure monitoring can be used for live monitoring of bile duct hydrodynamic injection. This method involves mixing a radiocontrast solution with the DNA solution to be injected. The contrast solution is diluted in the DNA solution so that the total percentage is 1-33%. During bile duct hydrodynamic injection, fluoroscopy shows the contrast agent injected into all liver lobes, increasing in intensity during the injection. A successful injection results in the contrast agent being injected into all parts of the liver.

[0414] Pancreatic duct hydrodynamic injection A method for gene delivery to pancreatic tissue via the pancreatic duct system, known as hydrodynamic gene delivery, is also provided. This method involves using endoscopic retrograde cholangiopancreatography (ERCP) to insert a catheter into the pancreatic duct. The pancreatic duct effectively penetrates the entire pancreatic viscera, from the head of the pancreas to the distal tip of the tail. The duct system then expands into numerous small ductal branches, contacting acinar cells that secrete digestive enzymes into the pancreatic lumen. Unlike the venous and arterial spaces, the unidirectional flow of fluid through the pancreatic duct system lacks an effective release valve for increased fluid pressure, making it an attractive target for retrograde hydrodynamic gene therapy. A central challenge with hydrodynamic gene delivery through the duct is the potential for tissue damage, leading to pancreatitis. Therefore, precise details of the gene delivery procedure are required to treat or ameliorate this potential. In a preferred embodiment of the gene delivery method, a catheter is cannulated into the ampulla of Vater and advanced into the pancreatic duct. In many embodiments, a guidewire completes this first step, followed by exchange of the catheter over the guidewire. After this step, pancreatic juice is aspirated and removed from the pancreas, so that subsequent fluid injections do not push these digestive enzymes into the tissue parenchyma. After this step, the catheter's position can be confirmed by contrast injection and fluoroscopic imaging. Note that the contrast is then easily aspirated to avoid irritation to the pancreatic tissue. The injection procedure then begins by priming the DNA solution from the power injector all the way to the distal tip of the catheter. Given the relatively small volume of DNA solution injected into the pancreas compared to the large dead space volume (approximately 5 mL) within the catheter circuit, DNA priming is preferably performed to avoid wasted DNA from the procedure, along with wasted non-DNA solution entering the pancreas, which simply causes tissue damage and does not contribute to gene expression.

[0415] Regarding the volume injected into the pancreas, the pancreatic duct system has a relatively small volume of approximately 2-3 mL in human subjects, with a total volume of 5 mL or less. The injected volume can be quite variable, ranging from 5 mL to 10 mL, 20 mL, or even up to 50 mL in most applications. The fact that such large volumes can be injected into the pancreatic duct system was completely unexpected. This likely reflects leakage of fluid into the surrounding tissue and vasculature. In a preferred embodiment of the gene delivery method, the flow rate injected into the pancreas directly correlates with the pressure achieved in the duct, which in turn correlates with the efficiency of gene delivery. In a preferred embodiment of the method, the flow rate is 1 mL / sec. In other embodiments, the flow rate is 2 mL / sec, 3 mL / sec, 4 mL / sec, or 5 mL / sec.

[0416] Another method involves cannulating the minor papilla (thus avoiding the ampulla of Vater and the biliary tree) and inserting a guidewire through an accessory duct into the main pancreatic duct in the body or tail. A balloon catheter is inserted over the guidewire, and after a small amount of contrast injection, the balloon is positioned at the junction of the dorsal and ventral pancreatic ducts. Hydrodynamic injection is then performed. The advantages of this method are: 1) no inadvertent bile duct cannulation is avoided; 2) access to the pancreatic ducts in the body and tail is still possible in patients with pancreatic schistosis; and 3) the hydrodynamic injection selectively targets the body and tail of the pancreas, which a) targets the area of ​​the pancreas with the highest concentration of beta islet cells and b) spares the head of the pancreas from hydrodynamic injection, potentially reducing the incidence and / or severity of postprocedural pancreatitis.

[0417] The nucleic acid solution itself has several modifications compared to other hydrodynamic gene therapy procedures. To prevent the onset of pancreatitis, additional small molecules are added to the DNA solution for injection into the pancreas. These small molecules are selected from a variety of drugs, each with documented evidence of inhibiting one of the mechanisms underlying pancreatitis. The purpose of adding these drugs to the hydrodynamic solution is to facilitate their direct delivery to all surfaces of the organ receiving the DNA solution. This includes the intracellular delivery of digestive enzymes to acinar cells, which promote the breakdown of pancreatic tissue. The small molecule drug or pharmacological agent selected for this purpose is selected from pancreatic enzyme inhibitors, including gabexate mesilate, nafamostat mesilate, urinastatin, camostat mesilate, aprotinin, pefabloc, trasylol, and urinary trypsin inhibitor, or enzyme inhibitors, including somatostatin. Inflammatory inhibitors that may be co-injected include corticosteroids, tacrolimus, and sirolimus. In some embodiments of the present methods, these drugs may not be included with the DNA solution, but rather may be injected into the pancreas before or after hydrodynamic injection. In these methods, the drugs are dissolved in a physiological solution such as saline, lactated Ringer's solution, or 5% dextrose in water.

[0418] The agent is injected at a slow flow rate (1 mL / sec or less) in a small volume similar to the total volume of the pancreatic duct (2–5 mL). The DNA solution is prepared in a similar solution of normal saline, lactated Ringer's solution, or 5% dextrose in water, with or without the listed pharmacological agents. After hydrodynamic injection, the balloon is quickly deflated, and any residual solution is aspirated from the pancreatic duct system. Repeated contrast injection and fluoroscopy may be performed after hydrodynamic injection to verify duct patency. As with preprocedural imaging, the contrast agent should be aspirated quickly to avoid toxicity to the pancreatic tissue. The catheter should then be quickly removed from the pancreatic duct to avoid further irritation.

[0419] Hydrodynamic infusion of the kidney A method for gene delivery to the kidney or renal tissue via the ureteral system and hydrodynamic gene delivery is provided. To deliver hydrodynamic fluid to the kidney, a leader is selected as a conduit for this purpose. The ureter represents an ideal vascular system with unidirectional flow, while retrograde flow results in the expulsion of fluid tissue into the surrounding renal parenchyma. The mechanism of action of how to utilize this unique anatomical structure has not been fully explored or enabled in the prior art. Previous research has demonstrated that hydrodynamic injection into the renal pelvis can mediate gene delivery to different kidney cells (Scientific Reports volume 7, Article number: 44904 (2017)). However, the relative efficiency is very low, and the renal pelvis itself is directly accessed by a surgical method in which a needle is placed within the renal pelvis, which would be too invasive to apply in human patients. Furthermore, antegrade fluid flow toward the bladder was not inhibited during these hydrodynamic injection procedures (J Vis Exp. 2018 Jan 8;(131):56324), resulting in a loss of pressure during these hydrodynamic injections. Methods are presented herein for achieving efficient gene delivery procedures through cystoscopic and ureteroscopic procedures. Simply put, cystoscopy involves inserting a scope into the bladder through the urethra. A camera at the end of the scope helps visualize the two ureteral orifices. A guidewire inserted through the cytoscope can facilitate cannulation of one of the two ureteral orifices. The guidewire can then be exchanged for a catheter or retained within the renal pelvis and advanced all the way into the renal pelvis to help position the catheter in the correct position for injection, as described below.

[0420] A catheter is inserted through the scope and placed into one of two ureteral offices, either directly or with the aid of the aforementioned guidewire. The catheter can optionally be advanced up the ureter along the guidewire, and its position is monitored via contrast injection. The catheter is positioned close to the end of the ureter and advanced until it opens into the renal pelvis. The renal pelvis itself is fan-shaped or triangular, presenting unique challenges when attempting to create an effective seal with a balloon catheter. To solve this problem, the balloon is optimally inflated within the distal ureter, which, like other targeted vessels such as the common hepatic duct and pancreatic duct, still has a relatively cylindrical shape. It is essential to inject contrast prior to the procedure to confirm the balloon seal. Any space along either side of the balloon can have one of two outcomes: (1) the balloon may be pushed backward, tightening the seal and naturally positioning itself in the correct location. (2) Fluid turbulence pushes the balloon forward, causing the catheter to swing during hydrodynamic infusion. Because of this possibility, it is better to inflate the catheter balloon deeper within the ureter than within the renal pelvis. Furthermore, this point also highlights the usefulness of real-time pressure monitoring during the procedure to verify the effectiveness of the balloon seal during hydrodynamic infusion of the kidney.

[0421] The guidewire and catheter tip can also facilitate proper catheter localization, as the guidewire extends to the edge of the renal pelvis and the catheter itself has a tip that extends 1-4 cm beyond the balloon tip and well into the renal pelvis. In certain embodiments of this method, the catheter itself strikes the renal pelvic wall, setting the appropriate distance for balloon inflation, but otherwise remains localized within the ureter. Once the catheter is placed and contrast is injected, the contrast should be promptly removed before injection to avoid nephrotoxicity, a common toxicity from radiographic studies in patients. Furthermore, urine within the renal pelvis should be removed as necessary to reduce the potential for toxicity.

[0422] At this point, the pressure catheter can be optionally extended from the catheter into the renal pelvic space to monitor the infusion. The catheter is then primed with DNA solution from the power injector to the catheter tip. Infusion begins with the power injector. In preferred embodiments, the volume ranges from 10 mL, 15 mL, 20 mL, 25 mL, or 30 mL. The flow rate for this procedure is optimally 1 mL / sec, 2 mL / sec, 3 mL / sec, 4 mL / sec, or 5 mL / sec. After stopping the infusion, the balloon should be quickly deflated and any residual DNA solution in the renal pelvis should be aspirated and removed. Nephrotoxicity from hydrodynamic infusion should be monitored with serial measurements of creatinine, blood urea nitrogen, and glomerular filtration. Each individual's kidney should be examined on a separate day to ensure that baseline filtration function is maintained. Biochemical markers should be normalized, preferably on a separate day, before attempting treatment on the second kidney.

[0423] Ability to target specific cell types from hydrodynamic injection Gene delivery methods to the liver, kidney, and pancreas are further defined by the method of targeting specific cell types in the organs. Hydrodynamic gene delivery techniques via the bile duct, pancreatic duct, and ureter are unique because they ultimately target multiple different cell types in the tissue parenchyma. Surprisingly, this includes different cell types that are not directly connected to the ductal lining along which gene transfer occurs or through which gene delivery is delivered. An example of this is the efficient transfer from the bile duct to the neural tissue of the liver, where the components are not directly connected to each other. Another example in the liver is the efficient expression in the endothelium of arteries in the liver, which are also not directly connected to the biliary system. A notable example in the pancreas is the efficient gene transfer to islet cells, which are not connected to the pancreatic duct system. This tissue distribution, particularly the communication of DNA across different cellular barriers without the aid of the vasculature, was quite surprising and unexpected. While findings from rodent hydrodynamic gene delivery are largely intranslatable to larger animal models, it is interesting to note that angiohydrodynamic injection of mouse liver typically delivers genes only to hepatocytes and not to other cell types. Studies on angiohydrodynamic gene delivery to pancreatic cells also appear to deliver to limited cell types and lack widespread distribution. While the ability to target different cell types is a major advantage of this gene delivery strategy, the method disclosed here requires that the DNA vector injected into the organ possess a method for cell-specific targeting. This includes using a cell-specific promoter to restrict expression to a cell type. The example provided in this patent application revolves around the use of a hepatocyte-specific promoter that restricts expression only within hepatocytes. In other experiments using a ubiquitous, non-specific promoter, expression can be seen in all different cell types in the liver. Even when using a ubiquitous promoter, differences across cell types can still be seen; an example of this is in the pancreas, where the SV40 promoter confers stronger neuronal expression compared to the CMV promoter. In the method disclosure herein, for each particular disease, examples of cell-specific promoters are provided that allow for specific targeting of these cell types for a given disease.

[0424] List of cell type and cell-specific promoters for targeting in hydrodynamic injection Cholangiocytes: cytokeratin-19 promoter and cytokeratin-18 promoter. Hepatocytes: alpha-1 antitrypsin promoter, thyroxine-binding globulin promoter, albumin promoter, HBV core promoter, or hemopexin promoter. Endothelial cells: intercellular adhesion molecule-2 (ICAM-2) promoter, fms-like tyrosine kinase-1 (Flt-1) promoter, vascular endothelial cadherin promoter, or von Willebrand factor (vWF) promoter. Fibroblasts: COL1A1 promoter, COL1A2 promoter, FGF10 promoter, Fsp1 promoter, GFAP promoter, NG2 promoter, or PDGFR promoter. Smooth muscle cells: muscle creatine kinase promoter.

[0425] Neurons: synapsin I promoter, calcium / calmodulin-dependent protein kinase II promoter, tubulin αI promoter, neuron-specific enolase promoter, and platelet-derived growth factor β chain promoter. Pancreatic acinar cells: chymotrypsin-like elastase-1 promoter, Ptf1a promoter, or Amy2a promoter. Pancreatic ductal epithelial cells: Sox9 promoter, Hnf1b promoter, Krt19 promoter, and Muc1 promoter. Pancreatic islet cells: insulin promoter, glucagon promoter, somatostatin promoter, ghrelin promoter, or neurogenin-3 promoter. Proximal tubule epithelial cells: γ-glutaryl transpeptidase promoter, Sglt2 promoter, or NPT2a promoter. Podocyte:podocin promoter. Cells of the thick ascending limb of Henle: NKCC2 promoter Collecting duct cells: AQP2 promoter. Renal epithelial cells: kidney-specific cadherin promoter. Multiple cell types: cytomegalovirus promoter, EF1α promoter, SV40 promoter, ubiquitin B, GAPDH, β-actin, or PGK-1 promoter.

[0426] Use of drugs to regulate inflammation caused by injections In certain embodiments of hydrodynamic gene delivery methods, additional drugs may be administered before, during, or after the procedure to inhibit potential inflammation and cellular injury. Hydrodynamic delivery has the potential to introduce extracellular substances into the cell cytoplasm, which can trigger stress pathways, cause apoptosis or necrosis in a fraction of cells, and / or otherwise directly stimulate immune cells. Indeed, this has been observed in hydrodynamic tail vein injections in mice. To avoid this outcome after hydrodynamic gene injection, certain embodiments of the present disclosure include administering immunosuppressant drugs before, during, or after hydrodynamic gene delivery. These immunosuppressant drugs include cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, or a variety of different corticosteroids, including dexamethasone and prednisone. In certain embodiments, the immunosuppressant can be administered directly into the tissue itself via a catheter before or after hydrodynamic injection. In other embodiments, the immunosuppressant is dissolved in a nucleic acid and / or protein solution and injected via hydrodynamic injection. In yet other embodiments, these agents may be given via FDA-approved routes, such as orally, subcutaneously, or intravenously, in which case the regimen may be initiated prior to the procedure or after the hydrodynamic procedure is complete.

[0427] Additional explanation In one aspect, we evaluated (1) the optimal parameters for intrabilially delivered hydrodynamic gene delivery; (2) to demonstrate the feasibility of hepatocyte transduction; and (3) to assess whether successful transduction results in stable expression of the delivered plasmid protein.

[0428] The present disclosure establishes a minimally invasive method for non-viral gene delivery to the liver. The injection formulations disclosed herein typically contain an effective amount of a nucleic acid expression cassette in a pharmaceutically acceptable carrier suitable for hydrodynamic injection. The formulation can include a physiologically acceptable carrier (such as saline or phosphate buffer) selected according to the route of administration and standard pharmaceutical practice.

[0429] Pharmaceutical compositions containing the nucleic acid expression cassette are prepared according to standard techniques and include a pharmaceutically acceptable carrier. In some embodiments, saline is used as a pharmaceutically acceptable carrier. Other suitable carriers include, for example, water, buffered water, 0.9% saline, 0.3% glycine, and glycoproteins such as albumin, lipoproteins, globulins, etc. to enhance stability. The resulting pharmaceutical preparations can be sterilized by conventional, well-known sterilization techniques. The aqueous solutions can then be packaged for use or filtered under aseptic conditions and lyophilized, with the lyophilized preparation being combined with a sterile aqueous solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as needed to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, etc. (e.g., sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc.).

[0430] The composition can be administered to and taken up by the subject's cells with or without the aid of a delivery vehicle. For example, nucleic acids can also be delivered by liposomes, polymer micro- and nanoparticles, and other carriers, including polycations such as asialoglycoprotein / polylysine, which can enhance transfection efficiency. In some embodiments, the composition is incorporated into or encapsulated by nanoparticles, microparticles, micelles, synthetic lipoprotein particles, or carbon nanotubes. Preferred carriers include targeted liposomes, such as immunoliposomes, which can incorporate acylated mAbs into the lipid bilayer (Liu, et al. Curr. Med. Chem., 10:1307-1315 (2003)). Polycations such as asialoglycoprotein / polylysine can be used when the conjugate contains a molecule that recognizes the target tissue (e.g., asialoorosomucoid in the liver) and a DNA-binding compound that binds to the DNA to be transfected. Polylysine is an example of a DNA-binding molecule that binds to DNA without damaging it. This conjugate is then complexed with plasmid DNA for transfection.

[0431] Typically, the compositions disclosed herein are administered to the subject in a therapeutically effective amount.As used herein, the term "effective amount" or "therapeutically effective amount" refers to the dosage that is sufficient to treat, inhibit or alleviate one or more symptoms of the disorder being treated, or otherwise provide the desired pharmacological and / or physiological effect.The exact dosage varies depending on various factors, such as subject-dependent variables (for example, age, immune system health, etc.), disease, and treatment being performed.

[0432] Typically, the formulation contains an amount of the nucleic acid expression cassette effective to modify the genome of one or more target cells in the subject after hydrodynamic administration of the formulation to the subject. In a preferred embodiment, this amount is effective to modify the genome of the target cells sufficient to treat, alleviate, or prevent one or more symptoms of the disease being treated, or to produce a change in its physiological or biochemical manifestations.

[0433] Preferred dosages may also be determined empirically and taking into account, for example, the treatment situation and desired outcome, the age, and general health of the recipient.

[0434] The following examples also demonstrate effective dosages. Furthermore, Khorsandi, et al., Cancer Gene Therapy, 15:225-230 (2008) reported the administration of 10 mg to 20 mg of plasmid in pigs and 1 mg to 45 mg of plasmid in humans by selective hydrodynamic injection (local circulation), and all dosages were found to be safe and well tolerated by the subjects. Thus, generally, dosages can range from about 0.001 mg to about 1,000 mg, more preferably about 0.01 mg to about 100 mg, of the nucleic acid expression cassette genome editing composition, depending on the subject being treated, the route of administration, and the target cells.

[0435] Hydrodynamic injection, also known as high-pressure injection, is a method for administering nucleic acids in vivo. Hydrodynamic injection is suitable for delivering "naked" nucleic acids and therefore does not require viral carriers, which require laborious preparation and purification procedures and can raise concerns about the possibility of recombination with endogenous viruses to produce harmful forms of infection. Hydrodynamic injection also does not appear to induce immune responses and other side effects that make repeated administration of viral vectors problematic. Unlike carrier-based strategies and previous studies using hypertonic solutions and high hydrostatic pressure to facilitate intracellular DNA transfer, hydrodynamic gene delivery relies on hydrodynamic pressure generated by the rapid injection of large volumes of fluid to deliver genetic material into parenchymal cells. Suda and Liu, et al, Molecular Therapy, 15(12):2063-2069 (2007), Al-Dosari, et al, Adv. Genet. 54: 65-82 (2005), Kobayashi, et al, Adv Drug Deliv. Rev. 57: 713- 731 (2005), and Herweijer and Wolff, Gene Ther. 14: 99-107 (2007).

[0436] Injection volume and injection rate can also be important considerations in the effectiveness of hydrodynamic delivery, with faster injection rates generally preferred. The solution can be delivered by any means suitable for delivering the desired volume at the desired rate. For example, the solution can be administered using an injection device such as a catheter, an injection needle, a cannula, a stylet, a balloon catheter, a multi-balloon catheter, a single-lumen catheter, and a multi-lumen catheter. Single- and multi-port injectors can be used, as can single- or multiple-balloon catheters and injection devices with single or multiple lumens. The catheter can be inserted at a remote site and threaded through the lumen of a vein to reside in or near the target tissue. Injection can also be performed using a needle that crosses the skin and enters the lumen of a blood vessel.

[0437] Administration can be assisted by incorporating a pump or other system to facilitate the delivery of a desired volume at a desired pressure. In certain embodiments, administration involves the use of a computer-assisted system that allows real-time control of injection based on the hydrodynamic pressure at the tissue injection site. Precise control of injection can avoid tissue damage caused by excessively large injection volumes or low gene delivery efficiency due to insufficient volume or injection speed.

[0438] For example, in one preferred system, once the infusion is terminated, the intra-biliary pressure may remain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, or 20 mmHg or more higher than the intra-biliary pressure before the infusion, at least until the extraction balloon is deflated.

[0439] Gene delivery can also be optimized, and toxicity (tissue damage) minimized, by varying the volume of solution and rate of infusion; altering osmolality by adding mannitol to the infusion solution; increasing fluid and DNA extravasation by vasodilation, for example, using papaverine, hyaluronidase, or pre-infusion of VEGF protein.

[0440] In some embodiments, one or more blood vessels or ducts are occluded to reduce or prevent the flow of solution in one or more directions, e.g., backflow. Occlusion of the ducts or vessels can be achieved in a variety of ways. For example, the infusion device itself can reduce backflow. In some embodiments, one or more cuffs, tourniquets, or combinations thereof are used to reduce or prevent the flow of solution in one or more directions. The cuffs or tourniquets can be applied directly to the blood vessels or to the tissue surrounding the blood vessels. In some embodiments, one or more balloon catheters are used to reduce or prevent the flow of solution in one or more directions. For at least certain systems, it may be preferable to use balloon catheters to form a substantially closed system.

[0441] Occlusion can be performed using non-invasive, minimally invasive, or invasive procedures. For example, in some embodiments, the duct or vessel is occluded by an open surgical procedure. In other embodiments, a minimally invasive procedure, such as percutaneous surgery, is used to occlude the duct or vessel. Various approaches may be performed through the skin or through a body cavity or anatomical opening, and may incorporate the use of catheters, arthroscopic devices, laparoscopic devices, and the like, and remotely controlled operation of instruments with indirect observation of the surgical field, such as through an endoscope or large-scale display panel.

[0442] The disclosed hydrodynamic delivery methods are preferably via the biliary tree of a subject and do not involve delivery through a blood vessel such as an artery or vein. The target cells, and therefore the particular method of hydrodynamic injection, are typically selected based on the disease being treated, hi some embodiments, the target cells are liver cells, kidney cells, or pancreatic cells.

[0443] In a preferred embodiment, the target cells are parenchymal cells. Parenchymal cells are characteristic cells of glands or organs that are contained in and supported by the connective tissue framework. Parenchymal cells typically perform functions unique to a particular organ. The term "parenchyma" often excludes cells that are common to many organs and tissues (e.g., endothelial cells and fibroblasts in blood vessels).

[0444] In the liver, parenchymal cells include hepatocytes, Kupffer cells, and bile ducts and epithelial cells lining the bile ducts. The main components of the liver parenchyma are polyhedral liver cells (also known as hepatocytes), which reside in the hepatic sinusoids on at least one side and in the bile canaliculi on the other side. Non-parenchymal liver cells include cells within blood vessels, such as endothelial cells or fibroblasts.

[0445] Applications of the disclosed compositions and methods include, for example, gene therapy for treating disease, or as an antiviral, antipathogen, or anticancer therapeutic. The disclosed methods can be used to treat any disease or condition where genomic modification of target cells is effective to treat the disease or condition, and where target cells can be transfected with the disclosed compositions by hydrodynamic injection.

[0446] Preferably, cells causing disease pathology can be transfected by hydrodynamic injection. Preferred target cells include those discussed above, including liver cells, kidney cells, and pancreatic cells.

[0447] Catheter delivery systems for delivery to the biliary tree / liver, pancreatic duct / kidney, etc. In preferred systems, such as those for accessing and delivering therapeutic agents to the biliary tree / liver, pancreatic duct / pancreas, or renal collecting system / kidney, the catheter delivery system is preferably detectable, e.g., visible under fluoroscopy. During administration protocols, the catheter may be positioned for administration with or without a guidewire. When used, guidewires of various configurations may be suitable, including those with an inner diameter of approximately 0.01 to 0.04 inches, e.g., 0.018 inches, 0.025 inches, 0.035 inches, or other diameters. The guidewire may be suitably radiopaque, if desired. Preferred catheters may have one or more ports of equal or different diameters, e.g., two, three, four, or more ports. The largest diameter port is for hydrodynamic delivery. Preferred catheters may be available in sizes ranging from 6 French to 12 French, as well as other sizes.

[0448] When two or more ports are used, one port can be used to inflate an occlusion balloon or activate a mechanism to occlude the lumen and prevent / reduce the risk of catheter migration during injection, and the other port can allow a guidewire to be advanced through it first, but then the guidewire can be removed and contrast / hydrodynamic delivery of the solution can occur through that same port.

[0449] If three ports are used, a preferred configuration may include a first port for an occlusion balloon or the like, a second separate port for a guidewire / contrast / hydrodynamic delivery, and a third separate port for a pressure catheter. If four ports are used, a preferred configuration may include one for an occlusion balloon etc., one for a guidewire / contrast, one for contrast / hydrodynamic delivery, and one for a pressure catheter.

[0450] In one preferred embodiment, the catheter may have a pressure catheter embedded in its tip so that only two to three additional ports are required. If two additional ports are utilized, one may be used for an occlusion balloon, etc., and the second port may be used for a guidewire / contrast / hydrodynamic delivery. If three additional ports are utilized, one may be used for an occlusion balloon, etc., the second port may be used for a guidewire / contrast, and the third port may be used for contrast / hydrodynamic delivery. In a further preferred system, in addition to the catheter, a mechanism may be utilized to infuse solutions at various pressures, volumes, durations, and flow rates that may be fixed or titrated with feedback from a pressure sensor.

[0451] Biliary hydrodynamic injection For the particularly preferred biliary hydrodynamic infusion of therapeutic substances (e.g., nucleic acid expression cassettes), the system is suitable for both male and female patients. In a preferred protocol, an endoscope or echoendoscope is used, and a catheter is placed into the bile duct via the oral route / mouth, through the major papilla, or via direct puncture through the duodenum and advanced in a retrograde manner upstream into the biliary tree. A balloon or other mechanism can be used to occlude the lumen, inflated / activated, and the catheter is removed (or held in place) to occlude one of the common, left, or right hepatic ducts. The purpose of the balloon / other mechanism is to occlude the lumen and prevent antegrade flow of the infused solution, as well as to secure the catheter in place.

[0452] The catheter can be positioned at the aforementioned location preferably under direct visualization (cholangioscopy) and / or fluoroscopic visualization. When using fluoroscopy, the biliary tree may be opaque, which is helpful in positioning the catheter tip in the region of interest. A guidewire can be appropriately used to assist in advancing the catheter to the optimal location. The optimal location may be the common hepatic duct to allow the injected solution to enter the entire biliary system of the liver. The optimal location may also be one of the hepatic ducts (left hepatic duct, right hepatic duct) so that only a portion of the liver parenchyma / hepatocytes receives hydrodynamic injection. When using bile and / or contrast agents, bile can be aspirated to confirm the location within the biliary tree and remove as much bile as possible to minimize retrograde reflux of bile into the liver parenchyma / hepatocytes. Preferably, the biliary tree is flushed with a solution such as saline (but may be other solutions) to remove as much bile as possible to minimize retrograde outflow of bile into the liver parenchyma / hepatocytes. Preferably, the biliary tree is primed with the desired solution.

[0453] Preferably, the balloon can be inflated at this point (before hydrodynamic injection) or at any time before the catheter tip is in place. Hydrodynamic injection is then preferably performed appropriately so that the desired solution enters the various cells of the liver parenchyma / hepatocytes. The injection can be preferably performed under fluoroscopic guidance. The injection may or may not be performed using a power injector. The volume of the injected solution, the injection rate, the duration of the injection, and the injection pressure can be detected in real time by a pressure sensor integrated into the catheter or flowing through the catheter's working channel. The pressure sensor may be connected to a system that can adjust the injection parameters to generate various pressure waveforms (e.g., an initial high pressure followed by a stable medium pressure, or a stable pressure throughout, or multiple bursts of high pressure on a background of medium pressure (sawtooth pattern)) before returning to baseline when the injection is stopped and / or the balloon / occlusion mechanism is deflated. Preferably, contrast is reinjected to opacify the biliary tree and assess for leakage. This can be done by reinflating the balloon or by not using a balloon at all. The catheter is then appropriately removed.

[0454] This method recognizes that the system is not completely "closed" in the absolute sense, as significantly larger volumes can be infused into the biliary tree than it could otherwise hold. Thus, solution may / almost certainly enter the hepatic sinusoids, portal vein, and hepatic vein branches, which may result in systemic diffusion of the solution.

[0455] The method may be performed with or without intravenous infusion or irrigation of the biliary tree with prophylactic and / or post-treatment antibiotics. Preferably, the flow rate of the infusion can be up to or exceeding 2 mL / sec, 3 ml / sec, 5 ml / sec, 10 ml / sec, or other values.

[0456] Preferably, the pressure within the bile duct during hydrodynamic gene delivery can be up to or above 40 mmHg, 50 mmHg, 100 mmHg, 150 mmHg, or more, In at least some embodiments, the upper limit can be 200 mmHg, although higher pressures may be used in certain systems.

[0457] A suitable injected delivery may have various concentrations of the substance of interest (gene / DNA, etc.) and the solution may have various viscosities. Hydrodynamic injection can be performed using various volumes of solution, for example, 20 mL, 30 mL, 40 mL, 60 mL, 80 mL, 100 mL, 120 mL, 150 mL, 180 mL, 200 mL, or other amounts.

[0458] The balloon may preferably remain inflated for the duration of the injection or for an extended period after the hydrodynamic / power injection is complete. The injection can be suitably repeated at the same site or other sites in the biliary tree during the same procedure, e.g., other hepatic ducts or the same site, to optimize transfection. The entire process of hydrodynamic injection can be repeated one or more times at the same or new sites in the biliary tree.

[0459] Hydrodynamic injection of the pancreas: In preferred systems for accessing and delivering therapeutic agents to the biliary tree / liver, pancreatic duct / pancreas, and renal collecting system / kidney, the patient may be a male or female mammal, such as a human. In preferred embodiments, an endoscope or echo-endoscope or other device is used to appropriately place a catheter into the pancreatic duct via the oral route / mouth, through the major papilla, or via direct puncture through the duodenum / gastric wall, and advance it in a retrograde or antegrade manner upstream into the biliary tree. A balloon or other mechanism can be appropriately used to occlude the lumen, inflate / actuate, and withdraw (or hold in place) the catheter to occlude one of the main pancreatic ducts. The purpose of the balloon or other mechanism is to occlude the lumen and prevent antegrade flow of the injected solution, as well as to secure the catheter in place.

[0460] Preferably, the catheter may be placed at said location under direct visualization (pancreatoscopy) and / or under fluoroscopic visualization. If fluoroscopy is used, the pancreatic tree may become opaque, which aids in positioning the catheter tip in the region of interest. A guidewire may be suitably used to assist in advancing the catheter to the optimal location.

[0461] In some embodiments, the optimal location may be the main pancreatic duct, which allows the injected solution to enter the entire pancreatic parenchyma. In an additional embodiment, the optimal location may be upstream from the entrance of the accessory pancreatic duct so that there is no or minimal leakage of solution / pressure through the accessory pancreatic duct and minor papilla.

[0462] Preferably, if pancreatic ductal fluid and / or contrast agent is used, the pancreatic ductal fluid and / or contrast agent is aspirated to confirm location within the pancreatic tree and to remove as much pancreatic juice as possible to minimize retrograde reflux of pancreatic juice into the pancreatic parenchyma. Preferably, the pancreatic parenchyma comprises acinar cells and pancreatic islet cells. In one embodiment, acinar cells are processed. In a preferred application, the pancreatic tree is irrigated with a solution such as saline (but could be other solutions) to remove pancreatic fluid to minimize retrograde spillage of pancreatic fluid into the pancreatic parenchyma.

[0463] Again, in the preferred protocol, the pancreatic tree is primed with the solution of interest. The balloon can be appropriately inflated at this point (prior to hydrodynamic infusion) or at any time before the catheter tip is in place.

[0464] Hydrodynamic injection is then preferably performed so that the solution of interest enters the various cells of the pancreatic parenchyma. Injection may be performed under fluoroscopic guidance. Injection may or may not be performed using a power injector.

[0465] The volume of the solution injected, the injection rate, the duration of the injection, and the injection pressure can be detected in real time by a pressure sensor integrated into the catheter or flowing through the catheter's working channel. The pressure sensor can be appropriately connected to a system that can adjust the injection parameters to generate various pressure waveforms (e.g., an initial high pressure followed by a stable medium pressure, or a steady pressure throughout, or multiple bursts of high pressure on a background of medium pressure (e.g., a sawtooth pattern)) before returning to baseline when the injection is stopped and / or the balloon / occlusion mechanism is deflated. Contrast agent can preferably be reinjected to opacify the pancreatic tree and assess leakage. This can be done by reinflating the balloon or not using a balloon at all. The catheter is then appropriately removed.

[0466] The present method recognizes that the system may not be completely "closed" in the absolute sense, as significantly larger volumes may be infused into the pancreatic tree than it could otherwise hold. Thus, solution will likely / almost certainly enter branches of the superior mesenteric vein, splenic vein, superior pancreaticoduodenal vein, and inferior pancreaticoduodenal vein, which may result in systemic diffusion of the solution.

[0467] The method may or may not be performed with prophylactic and / or post-treatment antibiotics intravenously infused or irrigated into the pancreatic tree. The flow rate of infusion may suitably vary, for example, up to or exceeding 2 mL / sec, 3 ml / sec, 5 ml / sec, 10 ml / sec, or the like. The pressure within the pancreatic duct during hydrodynamic gene delivery may also vary and may suitably be up to or higher than 40 mmHg, 50 mmHg, or other pressures. In certain systems, the upper limit may be 200 mmHg, although higher pressures may be useful in certain systems.

[0468] A suitable injected solution can have various concentrations of the substance of interest (gene / DNA, etc.) and the solution can have various viscosities. Hydrodynamic injection may suitably use various volumes of solution, for example, 20 mL, 30 mL, 40 mL, 60 mL, 80 mL, 100 mL, 120 mL, 150 mL, 180 mL, up to or exceeding 200 mL, or other volumes.

[0469] In certain embodiments, the balloon may remain inflated only for the duration of the injection or for an extended period of time after the hydrodynamic / power injection is complete. In certain embodiments, the injection can be repeated at the same site or other sites within the pancreatic duct during the same procedure to optimize transfection. In a further aspect, the entire process of hydrodynamic injection can be repeated one or more times to the same or new sites in the pancreatic duct system.

[0470] Hydrodynamic injection of the kidney: In the preferred system of renal hydrodynamic infusion, the patient may suitably be a male or female mammal, such as a human. In a preferred protocol, a catheter can be placed via the urethra into the ureter (either left or right) and advanced to the renal pelvis, preferably under sterile technique. A balloon or other mechanism can be suitably used to occlude the lumen, inflated / activated, and the catheter removed (or held in place) to occlude one of the calyces, hilum, renal pelvis, or proximal aspect of the ureter. The purpose of the balloon / other mechanism is to occlude the lumen and prevent antegrade flow of the infused solution as well as to secure the catheter in place.

[0471] Preferably, the catheter may be placed at said location under direct visualization (ureteroscopy) and / or under fluoroscopic visualization. Preferably, if fluoroscopy is used, the renal collecting system may be opacified, which aids in positioning the catheter tip in the region of interest. A guidewire may be suitably used to assist in advancing the catheter to the optimal location.

[0472] The optimal location may be the renal pelvis, renal hilum, or proximal ureter, allowing the infused solution to enter the entire collecting system of the kidney. The optimal location may also be one of the major calyces so that only a portion of the renal parenchyma receives hydrodynamic infusion. The urine and / or contrast agent, if used, is aspirated to locate it within the renal collecting system and remove the urine, minimizing retrograde flow of urine into the renal parenchyma. Preferably, the collecting system is flushed with a solution such as saline (but could be other solutions) to remove as much urine as possible to minimize retrograde flow of urine into the renal parenchyma.

[0473] The renal collecting system is preferably primed with the solution of interest. If a balloon is used, it can be inflated at this point (prior to hydrodynamic infusion) or at any time before the catheter tip is in place. Hydrodynamic injection is then appropriately performed so that the desired solution enters the various cells of the renal parenchyma. Injection may be appropriately performed under fluoroscopic guidance. Injection may or may not be performed using a power injector.

[0474] The volume of solution injected, the injection rate, the duration of injection, and the injection pressure can be detected in real time by pressure sensors incorporated into the catheter or flowing through the working channel of the catheter. When used appropriately, the pressure sensor can be connected to a system that can adjust the injection parameters so that a variety of pressure waveforms can be produced (e.g., an initial high pressure followed by a stable medium pressure, or stable pressure throughout, or multiple bursts of high pressure on a background of medium pressure (e.g., a sawtooth pattern)) before returning to baseline when the injection is stopped and / or the balloon / occlusion mechanism is deflated.

[0475] In certain systems, contrast can be reinjected to opacify the collecting system and assess for leaks. This can be done by reinflating the balloon or by not using a balloon at all. The catheter is then appropriately removed. This method recognizes that the system is not a completely "closed" system in the absolute sense, as significantly larger volumes can be infused into the collecting system than it could otherwise hold, and therefore solution will likely / almost certainly enter branches of the renal artery and renal vein. This method may or may not be performed with prophylactic and / or post-treatment antibiotics intravenously infused or flushed into the collection system.

[0476] The flow rate of the infusion may suitably be up to or exceeding 2 mL / sec, 3 ml / sec, 5 ml / sec, 10 ml / sec, or other amounts. The pressure within the collection system during hydrodynamic gene delivery may suitably be up to or exceeding 40 mmHg, 50 mmHg, 100 mmHg, 150 mmHg, or other amounts. In certain systems, the upper pressure limit may be about 200 mmHg, although higher pressures may be appropriately used in certain systems. Suitable injected solutions may have various concentrations of the substance of interest (gene / DNA etc.) and the solutions may have various viscosities.

[0477] Hydrodynamic injection can be performed using various volumes of solution, for example, 20 mL, 30 mL, 40 mL, 60 mL, 80 mL, 100 mL, 120 mL, 150 mL, 180 mL, up to or exceeding 200 mL, or other volumes. If used properly, the balloon can remain inflated for only the duration of the injection or for an extended period of time after the hydrodynamic / power injection is complete.

[0478] The injection can be suitably repeated at the same site or at other sites in the renal collecting system during the same procedure, e.g., another calyx, another kidney, or at the same site to optimize transfection. The entire process of hydrodynamic injection may be suitably repeated one or more times to the same site or to new sites within the collection system.

[0479] Referring now to the drawings, Figure 1 shows a delivery arrangement 10 in which a catheter 12 having a balloon 14 and a distal delivery end 16 is positioned within a hepatic duct 20 beside a duct 18. In this system, the catheter balloon 14 and delivery end 16 through which the nucleic acid composition 20 is injected are beyond the duct 18 and its upper wall 18' but before the liver wall 19.

[0480] 2 shows a preferred delivery configuration 10 in which a catheter 12 having a balloon 14 and a distal delivery end 16 is positioned across a duct 18 into a hepatic duct 20, with both the balloon 14 and the catheter distal delivery end 16 positioned within the liver beyond a liver wall 19. As discussed, by positioning the delivery end 16 and balloon 14 within a subject's liver in this manner, potential rupture of the duct 20 can be minimized during delivery of nucleic acid under elevated pressure through the catheter end 16.

[0481] 3 shows a preferred delivery device 10 in which a catheter 12 having a balloon 14 and a distal delivery end 16 is positioned across a duct 18 into a hepatic duct 20, with the distal delivery end 16 positioned within the liver across a liver wall 19. As discussed, by positioning the delivery end 16 within a subject's liver in this manner, potential rupture of the duct 20 can be minimized during delivery of nucleic acid under elevated pressure through the catheter end 16. In this positioning, the balloon 14 is positioned across the duct wall 18' but in front of the liver wall 19.

[0482] 4 and 5 show additional preferred delivery configurations in which a catheter 12 having a balloon 14 and a distal delivery end 16 is positioned across duct 18 into a hepatic duct 20, with both the balloon 14 and the catheter distal delivery end 16 positioned across a liver wall 19 into the liver. In FIG. 4, the balloon 14 and the distal delivery end 16 are positioned within the right hepatic duct 22, and in FIG. 5, the balloon 14 and the distal delivery end 16 are positioned within the left hepatic duct 24. Again, such positioning of the delivery end 16 and balloon 14 within the subject's liver minimizes the possibility of rupturing the duct 22 (in the configuration of FIG. 4) or the duct 24 (in the configuration of FIG. 5) during delivery of nucleic acid under high pressure through the catheter end 16.

[0483] 6 illustrates a preferred pancreatic delivery configuration 30 in which a catheter 32 having a balloon 34 and a distal delivery end 36 is positioned within a pancreatic duct 42, with both the balloon 34 and the catheter distal delivery end 36 positioned within the subject's pancreas beyond the pancreatic wall 39. By positioning the catheter delivery end 36 and balloon 34 in the subject's liver in this manner, the possibility of rupturing the pancreatic duct 42 during delivery of nucleic acid under high pressure through the catheter end 36 can be minimized.

[0484] FIG. 7 shows a suitable delivery device 40 for administering nucleic acid compositions in the present methods and systems.

[0485] Figure 8A shows an infusion catheter system 50 that can be utilized in the present methods and systems. Catheter 52 includes multiple lumens, a guidewire port 54, an infusion port 56 for the flow of nucleic acid compositions, an infusion or delivery opening 58, and a balloon 60. Positioning of opening 58 as shown in Figure 8A provides for lateral injection of the composition to be administered.

[0486] FIG. 8B illustrates a preferred infusion catheter system 60 that can be utilized in the present methods and systems. The catheter 62 includes multiple lumens: a guidewire port 64, an infusion port 66 for the flow of nucleic acid composition, an infusion or delivery opening 68, and a balloon 70. As shown in FIG. 8B, the positioning of the opening 68 provides for forward injection of the administered composition. Thus, in this preferred system, the nucleic acid composition is not delivered laterally as shown in FIG. 8A. Instead, the delivery direction of the system in FIG. 8B is forward along the length of the vessel and substantially perpendicular to the delivery direction of the system in FIG. 8A. As discussed above, the forward delivery of the system in FIG. 8B can provide significant advantages, including reduced force against the vessel wall, thus minimizing the possibility of vessel wall rupture. The following non-limiting examples are illustrative.

[0487] Example 1 This example illustrates, among other things, the limited tensile strength of current endoscopic catheters against hydrodynamic pressure.

[0488] In vitro catheter and power injector testing As a first step toward defining injection parameters, a series of in vitro experiments were conducted using an endoscopic catheter and power injection, connecting the catheter directly to the power injector tubing. Contrast and injection ports with different widths, which could therefore tolerate different flow rates, were examined. Tests were also conducted at 999 psi and 1200 psi settings for the power injector, and no clear differences were observed between the in vitro tests. In fact, the maximum flow path in the wider injection port was 10 mL / s. At 15 mL / s, the circuit ruptured, resulting in catheter wall failure. When testing injection ports, up to 5 mL / s was achieved, but the final delivered volume was less than the programmed rate and required a longer delivery time. Medical power injectors have a built-in system for determining the pressure allowed within the circuit (maximum 1200 psi), and therefore, reaching this threshold likely caused a drop in flow rate. Therefore, the tensile strength of the endoscopic catheter may not be able to withstand the full pressure of potential power injector options, representing a limitation of the procedure.

[0489] Example 2 This example demonstrates, among other things, optimization of balloon position and catheter tip modification. Previous data indicates that parameters above 30 mL and / or 2 mL / sec result in common bile duct rupture. As an example, previous data showed that injection of 40 mL at 2 mL / sec caused rupture of the proximal common hepatic duct, manifested by contrast extravasation immediately distal to the balloon catheter tip, just below the porta hepatis. A fluoroscopic image of this rupture is shown in Figure 9.

[0490] In the current system, by optimizing the position of the balloon at the hepatic portal vein of the liver and changing the end of the catheter tip from a side-injection to a forward-injection tip (i.e., cutting the end), this enabled efficient contrast injection without CHD rupture at any flow rate or volume injected. An image of the initial position of the catheter and balloon is shown in Figure 10A, and Figure 10B shows the typical progression of contrast agent into the liver during injection.

[0491] Example 3 This example demonstrates, among other things, that test subjects can tolerate repeated injections with a single treatment.

[0492] Different biliary hydrodynamic infusion parameters were tested that pigs could tolerate within one procedure day (Table 1, see below). The central question was whether multiple hydrodynamic infusions could be repeated in the same pig during a single surgery. This strategy has not traditionally been investigated in rodent models, although other pig studies have isolated specific lobes sequentially but not performed repeated hydrodynamic infusions within the same lobe. 34 If feasible, repeated injections could, in theory, function as multiple transfections and thus boost total gene delivery. Toward this goal, more hydrodynamic injections were repeated a few minutes after injection into the pig. The next injection into pig #1 involved increasing the flow rate to 4 mL / s at the same volume, which was tolerated without issue. Next, a higher volume (50 mL) and flow rate (5 mL / s) were used, but these parameters triggered a power injector alarm and resulted in a reduction in flow rate.

[0493] As another example, a second pig, Pig #2, was injected. Hoping to eliminate the error message, the power injector pressure parameters could be increased, the injection was repeated at a flow rate of 5 mL / s and 1200 psi. However, during the injection into the pig, the circuit tubing ruptured near the end of the injection, near the exit from the power injector, indicating a limitation to the catheter material. Interestingly, the pig itself did not experience any issues during the procedure. Therefore, the circuit pressure was reduced to 999 psi, which was likely the strength the catheter material could withstand. Using this limitation, higher volumes with lower flow rates were tested (50 mL and 3 mL / s) to ensure no error messages were observed. A higher volume (37 mL) at 4 mL / s was also tested. Both were well tolerated by the pig without any issues with the power injector, suggesting that a maximum limit had not been reached. [Table 1]

[0494] Example 4 This example demonstrates, inter alia, that there is no apparent volume limitation for biliary hydrodynamic infusion beyond cardiovascular volume load considerations.

[0495] Consideration of the maximum volume infused during biliary hydrodynamic infusion and how it affects the relative intrabiliary pressure achieved was investigated. Given that increased volumes at high flow rates appear to stress the system, the question arose as to whether significantly larger supraphysiological volumes at low flow rates would similarly stress the infusion system or the pig's vital signs. To test this issue, a volume of 140 mL, near the capacity limit of the power injector, was infused into the system at 1 mL / s. The pig tolerated the large volume infusion without significant changes in vital signs, and the circuit exhibited no problems. This indicates that the biliary system has a significantly higher and undefined upper volume limit during infusion. [Table 2]

[0496] Example 5 This example demonstrates, among other things, that flow rate can be constrained by the inner diameter of the catheter injection port, and that pigs can tolerate flow rates of up to at least 10 mL / sec during biliary hydrodynamic injection.

[0497] When testing biliary hydrodynamic infusion in pigs, two different port sizes were used on the infusion catheter. Through multiple tests in pigs, it was discovered that the small-diameter infusion port appeared to have an upper flow rate limit of 4-5 mL / s for the exemplary power injector circuit described herein. Next, we tested whether pigs could tolerate higher flow rates through a wider inner diameter guide port. This in vitro study demonstrated that pigs could tolerate 10 mL / s. Using a 47 mL volume and a 10 mL / s flow rate, pigs were found to tolerate this infusion well without any acute changes in vital signs. No error messages were displayed on the power injector during the infusion. This indicates that the inner diameter of the DNA solution infusion channel has a strong influence on the flow rate that the power injector can achieve, and that pigs can tolerate flow rates into the biliary system up to 10 mL / s, at least physiologically. [Table 3]

[0498] Example 6 This example demonstrates, among other things, pressure monitoring and preferred pressure during biliary hydrodynamic injection.

[0499] As pressure has been shown to aid in the efficacy of hydrodynamic delivery, we assessed the pressure achieved during biliary hydrodynamic infusion. 25A pressure probe connected to an external laptop was obtained to record pressure in real time before, during, and after the infusion. After the endoscopic catheter was placed and the balloon opened, the pressure probe was inserted into the catheter through the guide port, 1 cm past the tip.

[0500] Pressure readings for a 30 mL injection at 2 mL / s showed a plateau pressure of 80 mmHg during the injection, which dropped rapidly the moment the injection ended (see Figure 11). This indicates that the flow rate primarily determines the pressure. As shown in Figure 42B, when the balloon deflated, a small level of pressure was released, representing the pressure generated by the balloon's restriction of bile flow; however, the exact value varied between different experiments (4.23 mmHg to 18.92 mmHg) and appeared to correlate with volume or pressure. Peak pressure points in the initial power injector were also observed in two of the conditions (114.76 mmHg and 181.36 mmHg in the table below) before entering the plateau phase. This represents the pressure within the biliary system just before volume is reached and fluid reaches a steady state for exit into the vascular system.

[0501] The relationship between flow and pressure appears to be nonlinear, as 1 mL / sec injection and 2 mL / sec injection resulted in similar flow rates of 82.12 mmHg and 89.12 mmHg, respectively, during the injection, while 3 mL / sec injection produced 148.58 mmHg. Thus, flow rate is related to the pressure reached, but not always in a sharply linear manner. A complete list of pressures achieved in the different experiments is shown in the table below. Supplementary Table 1 [Table 4]

[0502] Example 7 This example demonstrates, among other things, that pressure monitoring during biliary hydrodynamic injection can monitor the completeness of the injection.

[0503] During biliary hydrodynamic injection, the pressure curve can detect the balloon accidentally slipping backward, thereby releasing fluid into the gallbladder (Figure 12 below), which was also confirmed during fluoroscopy during the injection. Therefore, pressure monitoring is useful to periodically confirm successful injection.

[0504] Example 8 This example specifically demonstrates that flow rate during hydrodynamic injection into the bile duct can predict liver injury.

[0505] Acute pathogenic changes occurring in pigs immediately after treatment were investigated, particularly in the context of repeated hydrodynamic infusions. All pigs were bled before and after the procedure, and the pigs were sacrificed within 15 minutes of the final infusion. Organs were necropsied immediately after treatment. All three pigs exhibited grossly normal anatomy upon examination, without significant swelling, bruising, or rupture (see Figure 13). The CHD in pig #1 was probed with an instrument and confirmed to be intact with no rupture (see Figure 13C). The dorsal and ventral surfaces were intact in the pigs (see Figures 13A, 13B). [Table 5]

[0506] Regarding laboratory values, a series of liver function tests were analyzed before and after the infusion (see Table 2 below). Alanine aminotransferase (ALT) did not change significantly before or after the infusion. In contrast, aspartate aminotransferase (AST) showed a significant increase from 19 U / L to 137 U / L in pig #2 and from 59 U / L to 252 U / L in pig #3. Pig #1 showed no increase in AST or ALT. Total and direct bilirubin tended to be elevated in pigs #1 and #2 but remained within normal limits. The infusion parameters are provided for reference in Table 1 below. [Table 6]

[0507] Example 9 This example demonstrates, among other things, that increased flow rate can mediate the histological changes associated with efficient hydrodynamic delivery.

[0508] Histology of the organs was examined immediately after injection. Bile duct hydrodynamic injection showed a characteristic pathological pattern after injection, characterized by the formation of large fluid-filled vesicles in the cytoplasm of hepatocytes, along with diluted cytoplasm. Pigs #1 and #2, the low-pressure injection groups, showed acute dilation of the sinusoidal spaces within the hepatic lobule (see figure below) compared to control, non-injected pig livers, with consistent fluid volume exiting the bile canaliculi and entering the sinusoidal spaces. The central vein appeared to be the same size between injected and non-injected animals. Hepatocyte cytoplasm also appeared more diluted than in control pig livers and low-pressure injected pigs (see Figure 14), which is consistent with intracellular entry of fluid from the hydrodynamic injection. 31 Pig #3, the high-pressure infusion pig that received a 10 mL / sec infusion immediately before sacrifice, had significantly greater dilation of the intralobular sinusoidal spaces than the low-pressure infusion group (see figure below). Furthermore, pig #3 exhibited numerous large intracellular fluid-filled vesicles scattered throughout the hepatocyte cytoplasm, which was not observed in pigs #1 and #2 (see Figure 14).

[0509] Comparison with hydrodynamic tail vein injection in mice Given that hydrodynamic tail vein injection in mice results in efficient gene delivery and expression, we compared the histopathological effects in mouse livers immediately after hydrodynamic injection with those in pig livers after bile duct hydrodynamic injection. In mouse livers, scattered hepatocytes with sparse cytoplasm were observed, along with occasional hepatocytes containing erythrocytes, reflecting the vascular route of this procedure (see Figure 15). Numerous fluid-filled vesicles were observed within mouse hepatocytes, but were generally smaller than those seen in pig #3. The combination of histological changes was most similar to high-pressure injection in pig #3, suggesting that the high pressure / flow rate generated by these methods may closely mimic the conditions for efficient hydrodynamic gene delivery in mice.

[0510] Example 10 This example shows, among other things, that reducing solution viscosity during biliary hydrodynamic injection can lead to better tolerability for injection.

[0511] In a previous study, under fluoroscopy, different injection volumes (10, 20, 30, and 40 mL) of one-third-strength iohexol radiocontrast were injected at different flow rates (1, 2, and 3 mL / sec) with a maximum pressure set at 999 psi. The balloon remained inflated for 30 seconds after the completion of each injection. Injection parameters were tested sequentially in ascending order at 10-minute intervals until bile duct rupture, evidenced by contrast extravasation. These previous parameters resulted in proximal common hepatic duct rupture at injections exceeding 30 volumes and 2 mL / sec (see Figure 16).

[0512] In this study, a 25% contrast solution was used, with other modifications, but even at volumes exceeding those of previous studies, it did not mediate any rupture of the common hepatic duct. See Figure 17. This evidence points to viscosity negatively impacting bile duct integrity and to an optimal injection solution with a viscosity closer to normal physiological solution. This experiment also outlines the concentration of contrast solution that can be mixed with the DNA solution to perform hydrodynamic injection monitoring.

[0513] Example 11 This example demonstrates, inter alia, that changing the promoter in DNA to a liver-specific promoter for bile duct hydrodynamic injection can result in higher DNA transfection efficiency.

[0514] In previous studies of biliary hydrodynamic injection, very low transfection rates were achieved when 3 mg of DNA was administered in a volume of 30 mL and injected at 2 mL / sec. Results from the previous investigations are shown in Figure 18. The promoter used in these studies was the elongation factor 1 alpha (EF1α) promoter.

[0515] Based on these previous studies, which had very low transfection efficiencies, modifications were made to the present disclosure to improve the inefficient delivery and expression of DNA into pig liver. The estimated transfection efficiency of the previous studies was approximately 0.1-1%.

[0516] For this disclosure, we modified the plasmid DNA to express a gene of interest using a liver-specific promoter. We used an exemplary liver-specific promoter, LP1, which is a composite promoter consisting of the human APO-HCR enhancer and the hAAT promoter. This change in the DNA vector allowed for significant improvement in transfection efficiency using human factor IX as a reporter. In pigs after bile duct hydrodynamic injection, we achieved a transfection efficiency of 35-50% of hepatocytes staining positive for human factor IX on tissue sections. An example of an hFIX immunostaining image is shown in Figure 19.

[0517] Example 12 This example demonstrates, inter alia, the higher transfection efficiency of biliary hydrodynamic injection at higher DNA doses.

[0518] Pig bile duct hydrodynamic injection results in superior transfection efficiency compared with mouse hydrodynamic tail vein injection. As shown in Figure 20A, mouse hydrodynamic tail vein injection results in a transfection efficiency primarily surrounding the central vein in zone 2. Figure 20B shows that pig hydrodynamic bile duct injection results in positive human factor IX (hFIX) expression, which almost uniformly surrounds the central vein in zone 3, then radiates outward along the zona, reaching zones 1 and 2 (a proximal section of the left medial lobe of pig No. 3 is shown). Mouse lobules are smaller than pig lobules.

[0519] Previous studies of hydrodynamic tail vein injection in mice revealed that the maximum transfection efficiency was close to 20% in mouse hepatocytes. Increasing the DNA dose for hydrodynamic tail vein injection in mice only increased DNA delivery to the same hepatocytes, but did not result in an increase in transfection efficiency.

[0520] Unexpectedly, the current biliary hydrodynamic gene therapy described herein demonstrated a significant increase in transfection efficiency in pigs compared to mice, and also demonstrated a significant dose-dependent response in transfection efficiency in pigs. As shown in Figure 20B, a higher DNA dose in pigs (e.g., 3 mg vs. 5.5 mg) resulted in more hepatocytes remaining positive for human factor IX (e.g., approximately 35% vs. approximately 50% hFIX-stained area). This finding helps define the transfection response for this strategy, which is useful for finding doses for different diseases.

[0521] Example 13 This example demonstrates, among other things, that biliary hydrodynamic injection results in a lack of off-target tissue transfection and persistence in other body fluids.

[0522] We investigated the off-target distribution of gene therapy delivered by biliary hydrodynamic injection and tested for the presence of pDNA beyond the liver in other tissues. Plasma samples were taken before and after injection to observe the entry of pDNA into the circulation. PCR testing revealed the presence of pDNA in the plasma 15 minutes after injection, explained by leakage of fluid from the bile canaliculi into the venous circulation (see Figure 21A). By day 1 post-injection, pDNA was absent, consistent with degradation by serum DNase at this time point. 47,48Considering that pDNA in the bile duct is ultimately excreted into the small intestine, we evaluated the ability of any pDNA to undergo transformation into host gut bacteria. Fecal DNA collected from two pigs was negative for hFIX DNA at all time points, indicating that pDNA transfer did not occur to the host gut microbiome (see Figure 21B). The presence of pDNA in the systemic circulation allowed us to evaluate the ability of DNA transfection to occur in organs other than the liver. As shown in Figure 21C, we investigated different tissues (23 biopsies in total) throughout pig #3, including the kidney, lung, heart, spleen, pancreas, and several locations along the GI tract (stomach, duodenum, and colon). All tissues were negative for hFIX DNA by PCR, indicating no pDNA delivery (see Figure 21C). The excretion of pDNA in the bile duct was examined 1 week after infusion, confirming that hFIX DNA had been excreted from the bile by that time point (see Figure 21A).

[0523] Example 14 This example demonstrates, among other things, that biliary hydrodynamic infusion can be performed at low flow rates with no or minimal inflammatory response.

[0524] Hematological data for four pigs infused via the biliary route at 30 mL, 2 mL / sec, is presented and shown in Figure 22, demonstrating no significant changes over the days following infusion. This suggested that there was no acute inflammatory response at this flow rate of biliary hydrodynamic infusion and that this low range may be advantageous.

[0525] Example 15 This example demonstrates, inter alia, that biliary hydrodynamic infusion can result in the absence or minimal increase in AST and ALT at low flow rates.

[0526] Biochemical data are presented here for four pigs infused via the biliary route with 30 mL at 2 mL / sec and show no significant increase above the normal range (see Figure 23), suggesting the absence of tissue damage at this flow rate.

[0527] In another pig, higher flow rates and volumes were utilized, up to 5 mL / sec at 50 mL. Importantly, this higher flow rate did not result in an increase in AST and ALT levels, which remained normal. This suggests that this flow rate level range (2-5 mL / sec) may be ideal for efficient transfection without causing tissue damage and inflammation. [Table 7] [Table 8]

[0528] Example 16 This example demonstrates, among other things, that pigs can tolerate repeated biliary hydrodynamic infusions on separate days.

[0529] Four pigs were infused via the biliary route on the first day, all in a volume of 30 mL at a rate of 2 mL / sec. Patient vital signs before and after treatment are shown in Figure 24 and demonstrate tolerance to the treatment.

[0530] Three pigs were again infused via bile duct hydrodynamic infusion three weeks later. Their vital signs had normalized before the second infusion at this time point, and after the repeat procedure and infusion on this day, vital signs again showed no significant physiological perturbations and no lasting effects (see Figure 25). This demonstrates for the first time that repeated bile duct hydrodynamic infusion is feasible and physiologically well tolerated.

[0531] Example 17 This example demonstrates, inter alia, that biliary hydrodynamic delivery using a pre-loaded DNA solution of hFIX plasmid resulted in successful uniform distribution within the pig liver and expression in all injected pigs.

[0532] Pigs were injected with a mixture of 3–5.5 mg of hFIX transposon and piggyBac transposase at 2 mL / s using a pre-loaded catheter containing 30 mL of DNA solution. Additional DNA solution was loaded into the power injector cartridge to improve the dead space volume within the circuit, thereby allowing the full 30 mL to be injected into the pig's liver. The hFIX immunostained area within one hepatic lobule was quantified, and then five to six lobules were averaged to obtain lobular values. As shown in Figure 26A, the area % of hFIX-positive immunostaining within individual lobules (n = 5) is provided for pig #3 (1 week after injection) and pigs #1, #2, and #4 (3 weeks after injection). As shown in Figure 26B, the distal and proximal portions of individual liver lobes between pigs #3 and #4 show no consistent differences in the area % of hFIX-positive hepatocytes (n = 5–6 lobules per lobe). As shown in Figure 26C, higher doses of plasmid DNA resulted in higher hFIX-transfected area %. Each pig represents the average of the lobes determined in Figure 26A, pooled here with the quadrate lobe, which was removed due to its small size (approximately 5% of the liver). Data measurements are presented as mean ± standard error of the mean (SEM). Statistics represent unpaired parametric two-tailed t-tests; significance (p<0.05). ****p<0.0001; **p<0.01; *p<0.05; ns=not significant.

[0533] Example 18 This example demonstrates that the hydrodynamic pressure from biliary hydrodynamic injection is effectively distributed to sites both proximal and distal to the common hepatic duct injection site.

[0534] Liver tissue was sampled in pigs at sites proximal and distal to the common hepatic duct within each hepatic lobe. Bile duct hydrodynamic injection was performed at 10 mL / sec in pigs, and diluted cytoplasm and intracellular vesicles were observed as a result of injection in all lobes and at all sampling locations. H&E staining was performed, revealing large vesicle formation within hepatocytes, dilated hepatic sinusoids, and diluted cytoplasm within hepatocytes, as shown in Figure 27.

[0535] Range range 1~18. 1. Baruteau , J. , Waddington , SN , Alexander , IE & Gissen , P. Gene therapy for monogenic liver diseases: clinical successes, current challenges and future prospects . J. Inheritance. Metab. This. 40, 497–517 (2017). 2. Wang, D., Tai, PWL & Gao, G. Adeno-associated viral vector as a platform for gene therapy delivery. Nat Rev Drug Discov 18, 358–378. 3. Doshi, BS & Arruda, VR Gene therapy for hemophilia: what does the future hold? Ther Adv Hematol 9, 273–293. 4. Franchini, M., F. Frattini, S. Crestani, C. Sissa & Bonfanti, C. Treatment of hemophilia B: focus on recombinant factor IX. Biologics 7, 33–38. 5. Manno, CS et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nature Medicine 12, 342–347. 6. Nathwani, A. C. et al. Long-term safety and efficacy of factor IX gene therapy in hemophilia B. N. Engl. J. Med.371, 1994-2004 (2014). 7. Nathwani, A. C. et al. Adenovirus-associated virus vector-mediated gene transfer in hemophilia B. N. Engl. J. Med.365, 2357-2365 (2011). 8. Kok, C. Y. et al. Adeno-associated virus-mediated rescue of neonatal lethality in argininosuccinate synthetase-deficient mice. Mol Ther 21, 1823-1831 (2013). 9. Manning, W. C., Zhou, S., Bland, M. P., Escobedo, J. A. & Dwarki, V. Transient immunosuppression allows transgene expression following readministration of adeno- associated viral vectors. Human Gene Therapy 9, 477-485 (1998). 10. Calcedo, R. et al. Adeno-associated virus antibody profiles in newborns, children, and adolescents. Clin. Vaccine Immunol.18, 1586-1588 (2011). 11. George, L. A. et al. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. N. Engl. J. Med. 377, 2215-2227 (2017). 12. Fang, B. et al. Gene therapy for hemophilia B: host immunosuppression prolongs the therapeutic effect of adenovirus-mediated factor IX expression. Human Gene Therapy 6, 1039-1044 (1995). 13. Brunetti-Pierri, N. et al. Balloon catheter delivery of helper-dependent adenoviral vector results in sustained, therapeutic hFIX expression in rhesus macaques. Mol Ther 20, 1863- 1870 (2012). 14. Powell, J. S. et al. Phase 1 trial of FVIII gene transfer for severe hemophilia A using a retroviral construct administered by peripheral intravenous infusion. Blood 102, 2038- 2045 (2003). 15. Cantore, A. et al. Liver-directed lentiviral gene therapy in a dog model of hemophilia B. Science Translational Medicine 7, 277ra28-277ra28 (2015). 16. DeRosa, F. et al. Therapeutic efficacy in a hemophilia B model using a biosynthetic mRNA liver depot system. Gene Therapy (2016). doi:10.1038 / gt.2016.46 17. Ramaswamy, S. et al. Systemic delivery of factor IX messenger RNA for protein replacement therapy. Proc. Natl. Acad. Sci. U.S.A.114, E1941-E1950 (2017). 18. Sendra, L., Herrero, M. J. & Alino, S. F. Translational Advances of Hydrofection by Hydrodynamic Injection. Genes (Basel) 9, 136 (2018). 19. Dul, M. et al. Hydrodynamic gene delivery in human skin using a hollow microneedle device. J Control Release 265, 120-131 (2017). 20. Kamimura, K., Zhang, G. & Liu, D. Image-guided, intravascular hydrodynamic gene delivery to skeletal muscle in pigs. Mol Ther 18, 93-100 (2010). 21. Woodard, L. E. et al. Hydrodynamic Renal Pelvis Injection for Non-viral Expression of Proteins in the Kidney. J Vis Exp e56324 (2018). doi:10.3791 / 56324 22. Sebestyen, M. G. et al. Mechanism of plasmid delivery by hydrodynamic tail vein injection. I. Hepatocyte uptake of various molecules. J. Gene Med.8, 852-873 (2006). 23. Zhang, G., Budker, V. & Wolff, J. A. High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA. Human Gene Therapy 10, 1735-1737 (1999). 24. Liu, F., Song, Y. & Liu, D. Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Therapy 6, 1258-1266 (1999). 25. Zhang, G. et al. Hydroporation as the mechanism of hydrodynamic delivery. Gene Therapy 11, 675- 682 (2004). 26. Suda, T. & Liu, D. Hydrodynamic gene delivery: its principles and applications. Mol Ther 15, 2063-2069 (2007). 27. Kamimura, K. et al. Safety assessment of liver-targeted hydrodynamic gene delivery in dogs. PLoS ONE 9, e107203 (2014). 28. Andrianaivo, F., Lecocq, M., Wattiaux-De Coninck, S., Wattiaux, R. & Jadot, M. Hydrodynamics-based transfection of the liver: entrance into hepatocytes of DNA that causes expression takes place very early after injection. J. Gene Med. 6, 877-883 (2004). 29. Kobayashi, N., Nishikawa, M., Hirata, K. & Takakura, Y. Hydrodynamics-based procedure involves transient hyperpermeability in the hepatic cellular membrane: implication of a nonspecific process in efficient intracellular gene delivery. J. Gene Med.6, 584-592 (2004). 30. Crespo, A. et al. Hydrodynamic liver gene transfer mechanism involves transient sinusoidal blood stasis and massive hepatocyte endocytic vesicles. Gene Therapy 12, 927- 935 (2005). 31. Suda, T., Gao, X., Stolz, D. B. & Liu, D. Structural impact of hydrodynamic injection on mouse liver. Gene Therapy 14, 129-137 (2007). 32. Herweijer, H. et al. Time course of gene expression after plasmid DNA gene transfer to the liver. J. Gene Med.3, 280-291 (2001). 33. Viecelli, H. M. et al. Treatment of phenylketonuria using minicircle-based naked-DNA gene transfer to murine liver. Hepatology 60, 1035-1043 (2014). 34. Kamimura, K., Suda, T., Xu, W., Zhang, G. & Liu, D. Image-guided, lobe-specific hydrodynamic gene delivery to swine liver. Mol Ther 17, 491-499 (2009). 35. Herrero, M. J. et al. DNA delivery to 'ex vivo' human liver segments. Gene Therapy 19, 504-512 (2012). 36. Khorsandi, S. E. et al. Minimally invasive and selective hydrodynamic gene therapy of liver segments in the pig and human. Cancer Gene Ther 15, 225-230 (2008). 37. Zhang, G. et al. Expression of naked plasmid DNA injected into the afferent and efferent vessels of rodent and dog livers. Human Gene Therapy 8, 1763-1772 (1997). 38. Hu, J. et al. A remarkable permeability of canalicular tight junctions might facilitate retrograde, non-viral gene delivery to the liver via the bile duct. Gut 54, 1473-1479 (2005). 39. Chen, C.-Y., Liu, H.-S. & Lin, X.-Z. Hydrodynamics-based gene delivery to the liver by bile duct injection of plasmid DNA--the impact of lasting biliary obstruction and injection volume. Hepatogastroenterology 52, 25-28 (2005). 40. Jiang, X., Ren, Y., Williford, J.-M., Li, Z. & Mao, H.-Q. Liver-targeted gene delivery through retrograde intrabiliary infusion. Methods Mol. Biol.948, 275-284 (2013). 41. Kumbhari, V. et al. Successful liver-directed gene delivery by ERCP-guided hydrodynamic injection (with videos). Gastrointest. Endosc.88, 755-763.e5 (2018). 42. Indrajit, I. K. et al. Pressure injectors for radiologists: A review and what is new. Indian J Radiol Imaging 25, 2-10 (2015). 43. Liu, F., Song, Y. & Liu, D. Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Therapy 6, 1258-1266 (1999). 44. Zhou, T., Kamimura, K., Zhang, G. & Liu, D. Intracellular gene transfer in rats by tail vein injection of plasmid DNA. AAPS J 12, 692-698 (2010). 45. Dai, C. et al. Liver gene transfection by retrograde intrabiliary infusion facilitated by temporary biliary obstruction. J. Gene Med.22, e3144 (2020). 46. Kumbhari, V. et al. Successful liver-directed gene delivery by ERCP-guided hydrodynamic injection (with videos). Gastrointest. Endosc.88, 755-763.e5 (2018). 47. Kawabata, K., Takakura, Y. & Hashida, M. The fate of plasmid DNA after intravenous injection in mice: involvement of scavenger receptors in its hepatic uptake. Pharm. Res.12, 825-830 (1995). 48. Liu, F., Shollenberger, LM, Conwell, CC, Yuan, X. & Huang, L. Mechanism of naked DNA clearance after intravenous injection. J. Gene Med.9, 613-619 (2007).

[0536] Example 19 This example demonstrates, inter alia, that endoscope-mediated hydrodynamic gene delivery via the biliary tree can mediate efficient transfection of pig liver.

[0537] Gene therapy can provide curative treatment for many inherited monogenic diseases. Clinical trials have primarily focused on adeno-associated viruses (AAVs) for hepatic gene delivery. However, these vectors are limited by their small packaging size, capsid immune responses, and inability to be re-administered. As an alternative, non-viral hydrodynamic injection via the vascular route can successfully deliver plasmid DNA to the mouse liver, but success in large animal models has been limited. To demonstrate efficient and safe hydrodynamic injection in human-sized animals, injection via the biliary system was tested in pigs using endoscopic retrograde cholangiopancreatography (ERCP), a routine clinical procedure. Biliary hydrodynamic injection was well tolerated, with no significant changes in vital signs, liver enzymes, hematology, or histology. Using human factor IX (hFIX) as a model gene therapy, immunohistochemistry revealed that after hydrodynamic injection with a high plasmid DNA dose, 50.19% of the liver stained positive for hFIX, and all hepatic lobules in all liver lobes showed hFIX expression. hFIX-positive hepatocytes were primarily distributed around the central vein and radiated outward throughout all three metabolic zones. Biliary hydrodynamic injection in pigs produced significantly higher transfection efficiency than vascular hydrodynamic injection in mice at matched DNA doses per liver weight dose (32.7-51.9% vs. 18.9%, p<0.0001). However, hFIX was not detected in pig plasma, which may be due to species differences in protein secretion. Overall, these results demonstrate that biliary hydrodynamic injection can achieve higher transfection efficiency compared to AAV in large, human-sized animals at a reduced cost. This technology may serve as a platform for gene therapy of human liver diseases.

[0538] The results presented here utilized pigs with organ sizes similar to those of human patients and a commercially available device currently used in clinical practice worldwide. We found that the hFIX gene could be delivered to all liver lobes without toxicity and with transfection efficiencies exceeding those of AAV technology. This approach merits further development for the treatment of monogenic liver diseases in patients.

[0539] material and method Animal experiments All animal studies were conducted under the approval of the Johns Hopkins Hospital Animal Care and Use Committee and adhered to the guidelines of the NIH Guide for the Care and Use of Laboratory Animals. Mouse experiments were performed on C57BL / 6 strain mice weighing 20–30 g. Yorkshire pigs were obtained from Archer Farms, Darlington, MD. All pigs were female and reached their target weight before treatment. Pigs were acclimated and housed under conditions as previously described (39).

[0540] Gene construction and plasmid preparation Human factor IX was codon optimized using tools from IDTDNA, prepared as a gene fragment (Twist Bioscience), and cloned to form pT-LP1-hFIX (see Figure 28A). The plasmid pCMV-hyperPB (see Figure 28B) was constructed by gene synthesis (BioBasic). The sequence was codon optimized using tools from IDTDNA based on the published hyperactive piggyBac transposase sequence (55). The hFIX expression cassette used in AAV studies (44) was synthesized in a pUC backbone (BioBasic). The human albumin 3' UTR was added once to increase the stability of the mRNA transcript.

[0541] Plasmids were prepared for in vitro experiments using a maxiprep kit (Qiagen) and for in vivo injection using a gigaprep kit (Zymo Research). The transposon-to-transposase ratio for injection ranged from 7.5 to 9.2 to attempt to optimize transposition efficiency (42). Plasmid DNA was diluted in normal saline for in vivo experiments in mice and pigs.

[0542] Transfection experiments pCMV-pB and pIRII-eGFP have been previously published (56, 57). Briefly, 2.5 μg of pIRIIeGFP and pCMV-pB or pCMV-hyperPB were transfected into 6-well plates of 293T cells according to the manufacturer's protocol (Lipofectamine 3000, Thermofisher). Green fluorescent protein (GFP) was visualized by fluorescence microscopy. Transfection of pT-LP1-hFIX and pCMVhyperPB was also performed in HepG2 cells using Lipofectamine 3000 in a similar manner.

[0543] Hydrodynamic tail vein injection C57BL / 6 mice weighing 20–25 grams were selected for HTVI. Mice were treated with a heat lamp for 5–10 minutes until vasodilation was achieved. 8 μg of transposon and 1 μg of transposase were diluted in 2.2 mL (8–10% of body weight) of normal saline and injected into mice for 4–7 seconds. This dose was chosen to be consistent with liver weight-based dose comparisons for hydrodynamic studies in pigs. After HTVI, >90% of the injected DNA was localized in the liver (58). Consequently, 8 μg of transposon DNA in 1.5 g of mouse liver is equivalent to approximately 4–5.3 mg in 1 kg of pig liver.

[0544] Endoscopic procedures The pigs were fasted the night before the procedure, and all pigs were weighed before the procedure to ensure the appropriate anesthetic dose. After sedation, all pigs underwent preprocedural blood sampling from the jugular vein, and preprocedural stool samples were collected by rectal examination. Vital signs were monitored throughout the procedure by on-site veterinary care. An endoscope (Therapeutic Videoduodenoscope, ED-580XT, FUJIFILM Medical Systems USA) was advanced through the mouth into the stomach and small intestine. A sphincterotome (CleverCut 3V, Olympus Medical) preloaded with a 0.025-inch hydrophilic guidewire (GeGE, Olympus Medical) was then advanced into the common hepatic duct, as confirmed by fluoroscopy, using 4–5 mL of radiocontrast solution (Omnipaque, 350 mg / mL; VisiGlide Health) and a Philips Allura CArm. The sphincterotome was then replaced over the wire with an extraction balloon catheter (Multi-SV Plus, Olympus Medical), and the balloon catheter was inflated to 11.5 mm in the CHD, 1–2 cm below the hepatic hilum. A medical power injector (MEDRAD Mark 7 Arterion, Bayer) was filled with DNA solution and attached to the balloon injection port. The DNA solution was used to prime the tubing and catheter to fill the dead space volume before starting the injection. Injection parameters were as described in Table 1. The balloon was deflated for 30 seconds after injection, and the intact biliary system was assessed by repeated fluoroscopy with 4–5 mL of contrast injection. Transabdominal ultrasound examinations were performed on pig #2 by a certified interventional radiologist before and after hydrodynamic injection. The endoscope was withdrawn after injection. Postprocedure blood and postprocedure stool samples were then obtained as previously described. The total procedure time from endoscope insertion to endoscope injection and removal was monitored. Specific details regarding anesthetic doses before and during the procedure have been described previously ( 39 ).

[0545] Blood collection and analysis All pigs were anesthetized with ketamine / xylazine and then bled via the jugular vein by a veterinarian. Blood was collected into EDTA tubes for plasma protein and SST tubes (Becton Dickinson) for serum chemistry. Feces were collected while the pigs were anesthetized for phlebotomy by manual rectal examination. During this period, the pigs were also weighed. Blood from mice was collected by retro-orbital eye bleed under isoflurane anesthesia and similarly prepared.

[0546] ELISA testing for hFIX on cell culture supernatants, human plasma, mouse plasma, and porcine plasma was performed according to the manufacturer's protocol (AssayMax™ Human Factor IX ELISA Kit, AssayPro); the ELISA kit lacks cross-reactivity to mouse hFIX ( 15 ).

[0547] Discarded, de-identified human plasma was used as a positive control. Serum chemistry and hematology were performed by the Johns Hopkins Phenotyping Core on a Diasys Responds® 910 chemistry analyzer and a Procyte automated analyzer, respectively. Stool and tissue analysis

[0548] Pigs were euthanized at 1 and 3 weeks post-injection, and necropsies were performed within 15 minutes of death. A veterinarian and a medical pathologist were consulted regarding appropriate techniques. Biopsies were taken across multiple proximal and distal sites within each liver lobe (Figure 23A). The quadrate lobe, like the other four largest lobes, was sampled because it connects to the hilum with direct bile duct branches, whereas the caudate lobe was included in the right lateral hepatic lobe (RLL) for analysis because it shares the same bile duct branches.

[0549] Preliminary studies found that the RLL, right median lobe (RML), left lateral lobe (LLL), and left median lobe (LML) all had similar masses, within 5%, and together accounted for approximately 95% of the liver mass. Mice were euthanized 1 week after injection. For both mice and pigs, tissues were fixed in 10% formaldehyde. The Johns Hopkins Phenotyping Core performed tissue embedding and sectioning, along with hematoxylin and eosin (H&E) staining.

[0550] The DNeasy Blood & Tissue Kit (Qiagen) was used for DNA extraction from tissue, blood, and bile samples. Fecal DNA was purified using Quick-DNA Fecal / Soil Microbe (Zymo Research). RNA extraction was performed using the RNeasy Kit (Qiagen), and reverse transcription was performed using SuperScript IV (Thermofisher). PCR (DreamTaq, Thermofisher) was performed using internal primers (Sigma) directed against the synthetic hFIX sequence. Internal FIX For: GATAATAAGGTGGTCTGCTCTTGCACG, Internal FIX Rev: GTCACGTAGGAGTTGAGGACCAG.

[0551] An antibody against human factor IX (GAFIX-AP, Affinity Biologicals) was used for Western blot detection and IHC staining of pig and mouse liver sections. Western blots were performed on 10% SDS-PAGE gels using a 2.5 μg / mL antibody dilution and a mouse anti-goat IgG-HRP secondary antibody (sc-2354, Santa Cruz). IHC was performed by VitroVivo Biotech (Rockville, MD) using negative control non-injected pig and positive control human liver sections. To quantify the transfection efficiency of hydrodynamic injection, whole-slide scanning was performed (Olympus) and quantification was performed using ImageJ. Briefly, individual liver lobules were identified, and the area of ​​the entire lobule and the area of ​​hepatocytes with hFIX staining were outlined using ImageJ, and the area percentage was calculated. Since the lobule is the functional unit of the liver, the transfection efficiency in the lobule is representative of the lobule and the entire liver.

[0552] To calculate the percentage of hFIX relative to porcine FIX in liver tissue, the b-actin-normalized band intensity was taken for each lobe and the control porcine band intensity was subtracted to obtain the hFIX contribution; this result was divided by the calculated porcine FIX level determined from hFIX antibody cross-reactivity (band intensity / 6.4%). The average for all five liver lobes is shown in the text (10.11 ± 4.05%).

[0553] statistical analysis Statistical analysis was performed and graphs were generated using GraphPad Prism 7 software (GraphPad Software). Data are presented as mean ± standard error of the mean (SEM). Mean differences were tested using an unpaired parametric two-tailed t-test. The significance level used was P<0.05.

[0554] result Design and validation of a human factor IX transposon vector The results presented herein demonstrate the design and validation of an hFIX gene delivery vector. To ensure stable expression of hFIX in porcine hepatocytes, the transposon was placed on an episomal vector. This avoids potential silencing issues associated with plasmids (40) as well as the complexities of minicircle DNA production (41). To enhance integration, we used the hyperactive piggyBac (hyperPB) transposon system, which has 10-fold enhanced activity compared to SB100X in a mouse HTVI model (42). This transposon system was chosen because it mediates supraphysiological levels of hFIX at low-dose plasmid DNA (pDNA) levels in a mouse model (43).

[0555] The vector used an expression cassette currently used in AAV vector clinical trials for factor IX gene therapy (6), consisting of a chimeric liver-specific promoter with an enhancer derived from the APO-HCR gene and the hAAT promoter (44). The expression cassette contained the human albumin 3' untranslated region (UTR), which can stabilize mRNA and enhance expression (45). The hFIX sequence was codon-optimized for expression in pigs, and this strategy demonstrated a 12-fold increase in expression in mice (43). The results presented here demonstrate the co-delivery of an hFIX expression transposon (Figure 28A) and a hyperPB transposase (Figure 28B) plasmid to facilitate integration into the pig genome.

[0556] The disclosed results first validated the efficacy of the porcine codon-optimized synthetic hyperPB transposase, demonstrating the formation of stably transfected 293T cells and cell cultures that continued to express GFP after eight passages (Figure 35). Next, a transposon vector for hFIX expression was tested in a mouse model using HTLV-I (17). Delivery of 8 μg of hFIX transposon and 1 μg of hyperPB transposase resulted in 11,2...

Claims

1. 1. A composition comprising a nucleic acid for use in a method for introducing DNA into hepatocytes via hydrodynamic delivery, comprising: inserting a catheter into the common hepatic duct of the liver by endoscopic retrograde cholangiopancreatography (ERCP), endoscopic ultrasound (EUS) or cholecystostomy (PC); inflating a balloon to seal the common hepatic duct; injecting the composition in solution at a flow rate of at least about 2 mL / sec; wherein approximately 30% of the hepatocytes in the liver exhibit transgene expression from the transfected DNA. A composition for use in

2. The composition of claim 1 , wherein the nucleic acid is a vector, optionally the vector comprises a promoter, a 5′ UTR, a protein-coding gene, a 3′ UTR, and / or a polyadenylation sequence.

3. The composition of claim 2 , wherein the promoter is a liver-specific promoter.

4. The composition described in any one of claims 1 to 3, wherein the nucleic acid comprises a transposon, and optionally the transposon comprises a piggyBac transposon or a hyperactive piggyBac transposon.

5. (i) the protein coding for the gene is codon-optimized for the host organism to enhance protein expression; (ii) the 3′ UTR is selected to enhance mRNA transcript stability and protein expression; and / or (iii) The composition according to any one of claims 2 to 4, wherein the 5'UTR contains an intron for enhancing gene expression.

6. The composition according to any one of claims 1 to 5, wherein the transfected hepatocytes are observed in one or more hepatic lobules of the liver.

7. A composition described in any one of claims 1 to 5, wherein expression of the introduced gene is detectable by immunostaining of liver tissue.

8. The composition of any one of claims 1 to 7, wherein the solution comprises saline, 5% dextrose in water, lactated Ringer's solution, and / or phosphate buffer.

9. The composition of any one of claims 1 to 8, wherein one or more pharmacological agents are injected into the pancreatic duct before or after the endoscopic retrograde cholangiopancreatography (ERCP) procedure.

10. The composition of claim 9, wherein injection of the one or more pharmacological agents reduces the frequency and severity of post-procedural pancreatitis.

11. The composition described in claim 9 or 10, wherein the one or more pharmacological agents include one or more agents that inhibit pancreatic digestive enzymes or one or more agents that suppress the immune system.

12. the one or more pharmacological agents being (a) gabexate mesilate, nafamostat mesilate, urinastatin, camostat mesilate, aprotinin, pefabloc, trasylol, urinary trypsin inhibitors and / or enzyme inhibitors, and / or The composition of any one of claims 9 to 11, comprising (b) a corticosteroid, tacrolimus, or sirolimus.

13. A composition described in any one of claims 1 to 12, wherein the method further comprises selecting an amount of nucleic acid to be administered to the subject based on the liver weight of the subject.

14. The composition of any one of claims 1 to 13, wherein the nucleic acid is administered in an amount of at least 1 mg per kilogram of liver tissue weight of the subject.

15. The composition described in any one of claims 1 to 14, wherein the composition is administered in a total volume of 30 mL or more per kilogram of the subject's total liver tissue weight.

16. A composition for use in a method for introduction into a hepatocyte via hydrodynamic delivery, the method comprising: Determining the liver weight of an individual patient for nucleic acid, protein, and / or volumetric administration purposes, calculating the subject's body weight or calculating the liver weight from a computed tomography scan or magnetic resonance image; determining a flow rate of the injection; and performing a biliary hydrodynamic procedure based on the flow rate, wherein the flow rate is independent of liver weight of the subject. composition.

17. The composition of any one of claims 1 to 16, wherein one or more immunosuppressants or anti-inflammatory agents are administered to the subject before, during or after biliary hydrodynamic infusion.

18. The composition described in claim 17, wherein administration of the one or more immunosuppressants or anti-inflammatory agents reduces injection-induced inflammation or immune response to the introduced gene.

19. The composition of claim 17 or 18, wherein the one or more immunosuppressants or anti-inflammatory agents include cyclophosphamide, cyclosporine, tacrolimus, sirolamus, mycophenolate mofetil, dexamethasone, and / or prednisone.

20. A composition comprising nucleic acid and / or protein for delivering the nucleic acid and / or protein to hepatocytes by altering the flow rate of bile duct hydrodynamic injection.

21. 21. The composition of claim 20, wherein a higher flow rate of 4 mL / sec or greater preferentially targets hepatocytes near the lobule border (zone 1), the portal triad, and the great vessels.

22. 22. The composition of claim 20 or 21, wherein a lower flow rate of 1 mL / sec or less preferentially targets hepatocytes around the central vein of the lobule (zone 3) and throughout the lobule.

23. 23. The composition of any one of claims 20-22, wherein at least two different flow rates above and below 4 mL / sec are used during biliary hydrodynamic injection to maximize delivery to an increased proportion of hepatocytes within the hepatic lobule and throughout the liver.

24. A composition described in any one of claims 1 to 23, wherein the nucleic acid is transfected into bile duct cells by injecting the nucleic acid at high pressure through the biliary system, thereby allowing the nucleic acid and / or protein to enter directly into bile duct cells adjacent to the bile duct.

25. The composition of any one of claims 1 to 24, wherein the nucleic acid is transfected into endothelial cells, fibroblasts, neurons and / or smooth muscle cells of the liver.

26. 26. The composition of claim 25, wherein the nucleic acid is transfected into the cells by injecting the nucleic acid at high pressure through the biliary system to increase pressure in the portal triad.

27. (i) Bile duct cells are targeted for expression by the cytokeratin-19 promoter and the cytokeratin-18 promoter. (ii) endothelial cells are targeted for expression by the intercellular adhesion molecule-2 (ICAM-2) promoter, the fms-like tyrosine kinase-1 (Flt-1) promoter, the vascular endothelial cadherin promoter, or the von Willebrand factor (vWF) promoter; (iii) fibroblasts are targeted for expression by the COL1A1 promoter, the COL1A2 promoter, the FGF10 promoter, the Fsp1 promoter, the GFAP promoter, the NG2 promoter, or the PDGFR promoter; (iv) hepatic smooth muscle cells are targeted for expression by the muscle creatine kinase promoter; and / or (v) The composition described in claim 25 or 26, wherein hepatic neurons are targeted for expression by the synapsin I promoter, the calcium / calmodulin-dependent protein kinase II promoter, the tubulin αI promoter, the neuron-specific enolase promoter and the platelet-derived growth factor β chain promoter.

28. The composition described in any one of claims 24 to 27, wherein the nucleic acid comprises two or more promoters active in two or more of hepatocytes, cholangiocytes, endothelial cells, or fibroblasts.

29. The composition of claim 28, wherein the two or more promoters include a cytomegalovirus promoter, an EF1α promoter, or an SV40 promoter.

30. The composition of any one of claims 1 to 29, wherein the nucleic acid comprises one or more of DNA and / or RNA.

31. The composition of claim 30, wherein the RNA comprises mRNA, siRNA, miRNA, lncRNA, tRNA, circular RNA, or an antisense oligonucleotide.

32. 31. The composition of claim 30, wherein the DNA comprises circular DNA, linear DNA, single-stranded DNA, or double-stranded DNA.

33. The composition of any one of claims 1 to 32, wherein the nucleic acid comprises an expression cassette encoding a protein.

34. The composition of any one of claims 1 to 33, wherein the solution has a viscosity within ±10% of that of saline.

35. 35. The composition of claim 34, wherein the viscosity avoids stress on the wall of the common hepatic duct.

36. 36. The composition of claim 34 or 35, wherein the fluid solution is hypertonic with respect to serum or bile.

37. The composition of any one of claims 1 to 36, wherein the nucleic acid solution is substantially free of endotoxins.

38. The composition of any one of claims 1 to 37, wherein multiple hydrodynamic injections of the nucleic acid solution are performed during a single endoscopic examination or percutaneous procedure.

39. The composition of any one of claims 1 to 38, wherein one or more subsequent hydrodynamic injections are performed in the same subject.

40. The composition described in claim 39, wherein the one or more subsequent hydrodynamic injections do not result in tissue damage.

41. The composition described in claim 39 or 40, wherein a second endoscopic examination or percutaneous procedure is performed on the same patient through the bile duct on a different day.

42. The composition described in claim 41, wherein the second endoscopic or percutaneous procedure includes one or more subsequent hydrodynamic injections.

43. The composition of any one of claims 40 to 42, wherein the one or more subsequent hydrodynamic injections increase expression of the introduced gene.

Images